Use of asd gene and its mutants in preparing lysine

By randomly mutating the asd gene and constructing a recombinant vector, the activity of aspartate semialdehyde dehydrogenase was enhanced, solving the problem of insufficient L-lysine production by microbial fermentation in existing technologies and achieving a significant increase in yield.

CN122146737APending Publication Date: 2026-06-05NINGXIA EPPEN BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
NINGXIA EPPEN BIOTECH CO LTD
Filing Date
2024-12-03
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively increase the yield of L-lysine produced by microbial fermentation, especially by improving the activity of key genes in microorganisms, such as the asd gene, to increase the accumulation of L-lysine.

Method used

By randomly mutating the asd gene, mutation sites that can enhance expression activity were screened out, a recombinant vector containing the mutated asd gene coding region was constructed, and the vector was introduced into Corynebacterium glutamicum to enhance the activity of aspartate semialdehyde dehydrogenase, thereby increasing the production of L-lysine.

Benefits of technology

This study significantly increased the L-lysine yield of Corynebacterium glutamicum, providing a new method for improving the production of L-lysine through microbial fermentation, and has great application potential.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005167427640000051
    Figure BDA0005167427640000051
  • Figure BDA0005167427640000061
    Figure BDA0005167427640000061
  • Figure BDA0005167427640000081
    Figure BDA0005167427640000081
Patent Text Reader

Abstract

The application discloses application of asd gene and mutants thereof in preparation of lysine, and belongs to the technical field of genetic engineering. The technical problem to be solved by the application is how to improve the fermentation yield of lysine, for example, the yield of lysine catalyzed by whole cells of microorganisms. In order to solve the technical problem, the application provides application of aspartate semialdehyde dehydrogenase in improving the lysine yield of microorganisms. The application also provides a recombinant microorganism containing aspartate semialdehyde dehydrogenase and provides a method for preparing lysine by using the recombinant microorganism. The application first discloses the use of aspartate semialdehyde dehydrogenase and the coding gene thereof in improving the L-lysine yield of microorganisms. The application obtains an optimized coding gene of aspartate semialdehyde dehydrogenase by codon optimization and produces unexpected technical effects, and has great application potential in the field of microbial fermentation of lysine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of genetic engineering technology, specifically relating to the application of the asd gene and its mutants in the preparation of lysine. Background Technology

[0002] L-Lysine is one of the essential amino acids for the human body. It promotes human development, enhances immune function, and improves the function of the central nervous system. It is one of the eight essential amino acids that humans and animals cannot synthesize and that are necessary for growth. Because the lysine content in cereal foods is very low and it is easily destroyed during processing, it is called the first limiting amino acid.

[0003] Currently, the main method for producing L-lysine is fermentation. Improvements to L-lysine production via fermentation can involve fermentation techniques such as stirring and oxygen supply; the composition of the nutrient medium, such as the sugar concentration during fermentation; processing the fermentation broth into a suitable product form, such as through drying and granulation of the fermentation broth or ion exchange chromatography; or the inherent properties of the relevant microorganisms themselves. Methods for improving the properties of these microorganisms include mutagenesis, selection of mutants, and screening.

[0004] L-Lysine is widely used in various fields, and its global demand is increasing annually. Therefore, various studies are underway to develop highly efficient microbial strains for L-lysine production. For example, overexpressing or mutating key genes involved in L-lysine synthesis in microbial strains to increase their activity; or deleting genes that are not needed for expression (byproducts or toxins affecting cell growth, etc.). However, with the increasing demand for L-lysine year by year, further research is needed to effectively increase L-lysine production capacity. The asd gene, encoding aspartate-semialdehyde dehydrogenase, is one of the key genes involved in L-lysine synthesis; therefore, increasing its activity is beneficial for L-lysine accumulation. Through years of continuous research and practice, we have randomly mutated the asd gene and finally screened out mutation sites that can improve gene expression activity, which can be applied to Corynebacterium glutamicum to increase L-lysine yield during fermentation. Summary of the Invention

[0005] The technical problem this application aims to solve is: how to increase the fermentation yield of lysine, such as the lysine yield catalyzed by whole-cell microbial microorganisms. To solve this technical problem, this application provides the following technical solution:

[0006] This application provides for the application of a protein, specifically its use in increasing lysine production in microorganisms, wherein the protein is any one of the following:

[0007] a1) A protein whose amino acid sequence contains SEQ ID NO.4;

[0008] a1'), a protein whose amino acid sequence contains SEQ ID NO.2;

[0009] a2) Proteins that are more than 80% identical to the amino acid sequence shown in a1) or a1') and are associated with aspartate semialdehyde dehydrogenase, obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) or a1').

[0010] a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1), a1'), or a2).

[0011] Furthermore, in the aforementioned applications, the protein described in a1) may also be a protein with the amino acid sequence SEQ ID NO.4.

[0012] Furthermore, in the aforementioned applications, the protein described in a1') may also be a protein with the amino acid sequence SEQ ID NO.2.

[0013] In this application, SEQ ID NO.4 or SEQ ID NO.2 consists of 344 amino acid residues.

[0014] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0015] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0016] Further, the connection described in a3) may be a peptide bond formed by dehydration condensation between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2). Alternatively, the connection described in a3) may be a peptide bond formed by dehydration condensation between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2).

[0017] In this application, the lysine may be L-lysine.

[0018] This application also provides applications of the biomaterials related to the said protein, wherein the applications are the applications of the biomaterials in any of the following A1)-A4).

[0019] A1) The application of the biomaterial in constructing engineered bacteria that produce lysine;

[0020] A2) The application of the biomaterial in the preparation of lysine;

[0021] A3) The application of the biomaterial in regulating the production of lysine in microorganisms;

[0022] A4) The application of the biomaterial in constructing engineered bacteria that produce high levels of lysine; the engineered bacteria that produce high levels of lysine are modified microorganisms obtained by modifying the target microorganism, and the lysine content of the engineered bacteria that produce high levels of lysine is higher than that of the target microorganism.

[0023] The biomaterial is at least one of the following B1)-B3):

[0024] B1) A nucleic acid molecule encoding the protein described in claim 1.

[0025] B2), an expression cassette containing the nucleic acid molecule described in B1),

[0026] B3), a recombinant vector containing the nucleic acid molecule described in B1), and / or a recombinant vector containing the expression cassette described in B2).

[0027] Furthermore, in the aforementioned application, the nucleic acid molecule described in B1) is G1)-G3).

[0028] G1), a nucleic acid molecule whose nucleotide sequence contains SEQ ID NO.3;

[0029] G2), a nucleic acid molecule whose nucleotide sequence contains SEQ ID NO.1;

[0030] G3) is a nucleic acid molecule that has more than 80% identity with the nucleic acid molecules described in G1 or G2.

[0031] Furthermore, in the aforementioned applications, the protein described in a1) may also be a protein with the amino acid sequence SEQ ID NO.4.

[0032] Furthermore, in the aforementioned applications, the protein described in a1') may also be a protein with the amino acid sequence SEQ ID NO.2.

[0033] Furthermore, in the aforementioned applications, the nucleotide sequence of the nucleic acid molecule described in G1) may also be SEQ ID NO.3.

[0034] Furthermore, in the aforementioned applications, the nucleotide sequence of the nucleic acid molecule described in G2 may also be SEQ ID NO.1.

[0035] The regulation can be increased, raised, or expanded.

[0036] The microorganism is any one of the following:

[0037] D1) Microorganisms capable of producing L-lysine;

[0038] D2), bacteria;

[0039] D3), ​​Gram-positive bacteria;

[0040] D4) Corynebacterium spp.;

[0041] D5), Corynebacterium glutamicum.

[0042] This application also provides the described protein and / or the described biological material.

[0043] Furthermore, in the protein described above, a1) the protein may also be a protein with the amino acid sequence SEQ ID NO.4.

[0044] Furthermore, the protein described above, a1'), may also be a protein with the amino acid sequence SEQ ID NO.2.

[0045] Furthermore, in the biological material described above, the nucleotide sequence of the nucleic acid molecule described in G1) may also be SEQ ID NO.3.

[0046] Furthermore, in the biological material described above, the nucleotide sequence of the nucleic acid molecule described in G2 may also be SEQ ID NO.1.

[0047] This application also provides recombinant microorganisms, wherein the recombinant microorganisms are any of the following:

[0048] C1) Recombinant microorganisms containing the nucleic acid molecules described in B1);

[0049] C2) Recombinant microorganisms containing the expression cassette described in B2);

[0050] C3) Recombinant microorganisms containing the recombinant vector described in B3);

[0051] C4) Recombinant microorganisms containing the protein.

[0052] This application also provides a method for preparing the recombinant microorganism, wherein the recombinant microorganism is prepared according to a method comprising the steps of: introducing a nucleic acid molecule encoding the protein or the expression cassette described in B2) or the recombinant vector described in B3) into a recipient microorganism, wherein the recipient microorganism is any one of the following:

[0053] D1) Microorganisms capable of producing L-lysine;

[0054] D2), bacteria;

[0055] D3), ​​Gram-positive bacteria;

[0056] D4) Corynebacterium spp.;

[0057] D5), Corynebacterium glutamicum.

[0058] Furthermore, compared to the recipient microorganism, the activity of aspartate semialdehyde dehydrogenase in the recombinant microorganism was enhanced.

[0059] Furthermore, compared with the recipient microorganism, the recombinant microorganism has an increased content of aspartate semialdehyde dehydrogenase.

[0060] This application also provides the application of recombinant microorganisms in the preparation of lysine, wherein the recombinant microorganisms are the recombinant microorganisms described above, or recombinant microorganisms prepared by the above method.

[0061] This application also provides a method for preparing lysine, the method comprising the step of preparing lysine using recombinant microorganisms as fermentation strains, wherein the recombinant microorganisms are the recombinant microorganisms described above or the recombinant microorganisms prepared by the above method.

[0062] Furthermore, the method includes the steps of culturing the recombinant microorganism in a culture medium, collecting the culture, and obtaining lysine.

[0063] The term "culture" refers to a liquid or solid product (all substances within the culture container) that has grown a microbial community after artificial inoculation and cultivation. It is the product obtained by growing and / or amplifying microorganisms; it can be a biologically pure culture of microorganisms, or it can contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process. It can also be a mixture containing a certain amount of culture medium, microbial cell metabolites, and with the microbial cells removed.

[0064] This application also provides a method for increasing lysine production in recipient microorganisms, the method comprising introducing the nucleic acid molecule described in B1), the expression cassette described in B2), or the recombinant vector described in B3) into the recipient microorganisms to increase lysine production in the recipient microorganisms.

[0065] Furthermore, in the method, the recipient microorganism is any one of the following:

[0066] D1) Microorganisms capable of producing L-lysine;

[0067] D2), bacteria;

[0068] D3), ​​Gram-positive bacteria;

[0069] D4) Corynebacterium spp.;

[0070] D5), Corynebacterium glutamicum.

[0071] Furthermore, the recipient bacterium, Corynebacterium glutamicum, can be a Corynebacterium glutamicum that produces the lysine mentioned above.

[0072] "Microorganisms capable of producing L-lysine" refers to microorganisms that possess the following abilities: the ability to produce and accumulate L-lysine within themselves using external substances (such as culture media), and may further include the ability to secrete L-lysine into the culture system. Thus, L-lysine can be collected when microorganisms are cultured in a culture medium.

[0073] Furthermore, the Corynebacterium glutamicum contains the NCgl1741 gene (GenBank:CP115148.1,2023-1-4) and its promoter (GenBank:CP115148.1,2023-1-4).

[0074] Among the recombinant microorganisms, the recombinant microorganism obtained by using Corynebacterium glutamicum as the recipient bacterium is named recombinant Corynebacterium glutamicum. The recombinant Corynebacterium glutamicum can be a recombinant bacterium obtained by introducing the nucleic acid molecule described in B1) or the expression cassette described in B2) into the NCgl1741 gene and its promoter site of the recipient Corynebacterium glutamicum.

[0075] The recombinant Corynebacterium glutamicum further involves mutating guanine (G) at position 701 of the asd gene coding sequence (SEQ ID NO. 1) of the recipient Corynebacterium glutamicum to adenine (A), resulting in a recombinant Corynebacterium glutamicum containing asd. G701A Recombinant bacteria.

[0076] The recombinant Corynebacterium glutamicum is further described as containing a recombinant plasmid containing an ASD expression cassette or a plasmid containing ASD. G701A The recombinant plasmid containing the expression cassette was transformed into the recipient *Corynebacterium glutamicum* to obtain an expression cassette containing either the asd expression cassette or the asd expression cassette. G701A Recombinant bacteria for expression cassettes.

[0077] Furthermore, the recipient Corynebacterium glutamicum may be Corynebacterium glutamicum CGMCC23982 and / or Corynebacterium glutamicum ATCC13032.

[0078] The Corynebacterium glutamicum CGMCC23982 is a Corynebacterium glutamicum strain with accession number CGMCC No.23982.

[0079] The Corynebacterium glutamicum ATCC13032 is the Corynebacterium glutamicum with the ATCC number 13032.

[0080] The beneficial technical effects achieved by this application are as follows:

[0081] 1. This application discloses for the first time the use of aspartate semialdehyde dehydrogenase and its encoding gene in increasing L-lysine production in microorganisms. Experimental verification in this application shows that aspartate semialdehyde dehydrogenase can significantly increase L-lysine production in the recipient bacterium Corynebacterium glutamicum.

[0082] 2. This application obtained an optimized coding gene for aspartate semialdehyde dehydrogenase through codon optimization. Introducing the optimized coding gene or an expression cassette containing the optimized coding gene into recipient microorganisms can significantly increase the lysine production of the recipient microorganisms. The aspartate semialdehyde dehydrogenase gene optimized in this application has produced unexpected technical effects and has great application potential in the field of lysine microbial fermentation.

[0083] Preservation Instructions

[0084] Classification and nomenclature: Corynebacterium glutamicum;

[0085] Strain number: YP097158;

[0086] Name of the depository: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures;

[0087] Abbreviation of depositary institution: CGMCC;

[0088] Address of the depository: No. 3, No. 1 Courtyard, Beichen West Road, Chaoyang District, Beijing, Postcode: 100101;

[0089] Date of deposit: August 16, 2016;

[0090] Registered with the China National Collection Center (CGMCC) No. 12856. Detailed Implementation

[0091] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0092] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0093] The Corynebacterium glutamicum ATCC13032 in the following examples is the Corynebacterium glutamicum numbered 13032 in ATCC.

[0094] The Corynebacterium glutamicum YP097158 in the following examples has been deposited through patent procedures. The depository registration number is CGMCC No.12856, the classification name is Corynebacterium glutamicum, the strain number is YP097158, the depository institution is China General Microbiological Culture Collection Center, and the deposit date is August 16, 2016.

[0095] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0096] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test is used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0097] Example 1: Construction of a recombinant vector containing a point mutation in the coding region of the asd gene

[0098] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers were designed and synthesized to amplify the coding region of the asd gene. A point mutation was introduced into the coding region of the asd gene (SEQ ID No. 1) of Corynebacterium glutamicum YP097158 via allele substitution. The point mutation involved replacing guanine (G) at position 701 of the nucleotide sequence of the asd gene (SEQ ID No. 1) with adenine (A), resulting in the DNA molecule shown in SEQ ID No. 3 (the mutated asd gene, named asd). R234H ).

[0099] The DNA molecule shown in SEQ ID No. 1 encodes a protein with the amino acid sequence of SEQ ID No. 2 (the protein name is protein asd). The DNA molecule shown in SEQ ID No. 3 encodes a mutant protein with the amino acid sequence of SEQ ID No. 4 (the mutant protein name is asd). R234H ).

[0100] The recombinant vector was constructed using NEBuilder assembly technology, and the primers were designed as follows (synthesized by Invitrogen Shanghai):

[0101] P1:5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG GCTGACACTGTTCGTTTCTTTG-3' (The underlined nucleotide sequence is the sequence on pK18);

[0102] P2:5'-GACCGAGAATCTTGTGGGATTCGTTGC-3' (The bases in bold are the mutation positions);

[0103] P3:5'-GCAACGAATCCCACAAGATTCTCGGTC-3' (The bases in bold are the mutation positions);

[0104] P4:5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TCGTCCCATCATTTCTCC-3' (The underlined nucleotide sequence is the sequence on pK18).

[0105] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P1 / P2 and P3 / P4, respectively, to obtain two DNA fragments (asdUp and asdDown) containing mutant bases, with sizes of 670bp and 830bp, respectively, of the asd gene coding region.

[0106] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10mM) 1.5μL, primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0107] PCR amplification program: 95℃ pre-denaturation for 5 min, (98℃ denaturation for 20 s; 60℃ annealing for 15 s; 72℃ extension for 30 s; 30 cycles), 72℃ over-extension for 5 min.

[0108] The two DNA fragments (asdUp and asdDown) were separated and purified by agarose gel electrophoresis, and then ligated with the pK18mobsacB plasmid (sequence shown in SEQ ID No. 10, Biovector, abbreviated as PK18) purified after enzyme digestion (Xbal I / BamHI) using NEBuilder enzyme (NEB product) at 50℃ for 30 min. The single clones grown after transformation were identified by PCR using primers P1 / P4. Those that amplified a 1473 bp fragment (SEQ ID No. 5) were considered positive for the recombinant vector pK18-asd. R234H The vector was sent to a sequencing company for sequencing and identification, and the recombinant vector pK18-asd containing the correct point mutation (G701A) was then analyzed. R234H Save for future use.

[0109] Recombinant vector pK18-asd R234HThe presence of the mutation site (G701A) will cause the guanine (G) at position 701 of the coding region of the asd gene in Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032 to be mutated to adenine (A), which will ultimately cause the arginine (R) at position 234 of the encoded protein to be changed to histidine (H).

[0110] Recombinant vector pK18-asd R234H The recombinant vector pK18-asd is obtained by replacing the fragment shown in positions 392 to 474 of SEQ ID No. 10 of the pK18mobsacB vector with the DNA fragment shown in SEQ ID No. 5, while keeping the other sequences of the pK18mobsacB vector unchanged. R234H Contains the mutated gene asd shown in SEQ ID No. 3 R234H The mutation site (G701A).

[0111] Example 2: Constructing a gene-asd R234H engineered strains

[0112] The allelic substitution plasmid (pK18-asd) constructed in Example 1 was used. R234H The bacteria were transformed into *Corynebacterium glutamicum* YP097158 (which, according to sequencing, retains the wild-type asd gene coding region on its chromosome) and wild-type *Corynebacterium glutamicum* ATCC13032 via electroporation. The cultures were then incubated at 30°C for 40 hours on solid medium plates containing kanamycin (50 mg / L) (medium composition shown in Table 1). Single colonies were identified using primers P1 / P4 from Example 1; strains amplifying a 1473 bp band were considered positive. Positive strains were streaked and cultured for 40 h on solid medium containing 15% sucrose (this medium was obtained by increasing the sucrose concentration in the medium in Table 1 to 150 g / L). Single colonies were screened on solid medium plates containing and without kanamycin (as shown in Table 1). Strains that grew on the kanamycin-free medium but not on the kanamycin-containing medium were further amplified by PCR using primers P1 / P4. Multiple DNA fragments (1473 bp) were sequenced. Through sequence alignment, strains with a base sequence mutation (G701A) were identified as positive strains with successful allelic substitution. Positive strains obtained from Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032 were named L-asd-1 and Y-asd-1, respectively.

[0113] Both recombinant bacteria L-asd-1 and Y-asd-1 contain the mutant gene asd shown in SEQ ID No. 3. R234HBoth strains expressed the protein shown in SEQ ID No. 4. The only difference between the recombinant strain L-asd-1 and Corynebacterium glutamicum YP097158 is that L-asd-1 is formed by replacing the asd gene of Corynebacterium glutamicum YP097158 with asd. R234H The strain was obtained by reproducing the gene while keeping other sequences unchanged; the only difference between the recombinant strain Y-asd-1 and the wild-type Corynebacterium glutamicum ATCC13032 is that Y-asd-1 is obtained by replacing the asd gene of wild-type Corynebacterium glutamicum ATCC13032 with asd. R234H The strain was obtained by extracting the gene while keeping other sequences unchanged.

[0114] Table 1. Composition of Corynebacterium glutamicum culture medium (solvent is water)

[0115] Element formula sucrose 10g / L Polypeptone 10g / L Beef extract 10g / L yeast powder 5g / L urea 2g / L Sodium chloride 2.5g / L Agar powder 18g / L pH 7.0

[0116] Example 3: Constructing a genome overexpressing the asd gene or asd R234H engineered strains of genes

[0117] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, four pairs of amplified upstream and downstream homologous arm fragments and asd or asd were designed and synthesized. R234H Primers for the gene promoter and coding regions were used to insert asd or asd into *Corynebacterium glutamicum* YP097158 and wild-type *Corynebacterium glutamicum* strain ATCC13032 via homologous recombination. R234H Gene copy.

[0118] The primers were designed as follows (synthesized by Invitrogen Shanghai):

[0119] (The underlined nucleotide sequence is the sequence on pK18);

[0120]

[0121] (The underlined nucleotide sequence is the sequence on pK18).

[0122] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed using primers P5 and P6 to obtain a 763bp upstream homologous arm fragment (corresponding to a partial coding region of NCgl1740 in Corynebacterium glutamicum ATCC13032 and the NCgl1741 gene (GenBank: CP115148.1, 2023-1-4) and its promoter region (GenBank: CP115148.1, 2023-1-4), the sequence of which is shown as 37-799 in SEQ ID No. 6). PCR amplification was performed using primers P7 and P8 to obtain a 362bp asd gene promoter fragment (the sequence of which is shown as 800-1161 in SEQ ID No. 6). PCR amplification was performed using primers P9 and P10 to obtain a 1124bp asd gene fragment (the sequence of which is shown as SEQ ID No. 6). As shown in SEQ ID No. 6 (1162-2285), PCR amplification using primers P11 and P12 yielded a 596 bp downstream homologous arm fragment of the NCgl1741 gene (corresponding to a partial coding region of the *Corynebacterium glutamicum* ATCC13032 NCgl1742 gene, sequence shown in SEQ ID No. 6 (2286-2881)). After the PCR reaction, the four amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The four recovered fragments were ligated with the pK18mobsacB plasmid (Addgene) purified after digestion with Xbal I and BamHI using NEBuilder enzyme (NEB) at 50°C for 30 min. The single clones grown after transformation of the ligation product were identified by PCR using primers P5 / P12. The fragment with a size of 2919 bp (sequence shown in SEQ ID No. 6, where the deoxyribonucleotide at position 1862 of SEQ ID No. 6 is guanine deoxyribonucleotide (G)) was identified as a positive integration plasmid (recombinant vector). The resulting recombinant vector was pK18-asdOE. This positive integration plasmid contained a kanamycin resistance marker, and recombinants integrated into the genome could be obtained through kanamycin screening.

[0123] pK18-asd R234H The preparation method for OE is the same as that for pK18-asdOE, the only difference being that the template for the PCR reaction is glutamate rod-shaped L-asd-1 genomic DNA. pK18-asd R234H The only difference between the nucleotide sequence of OE and pK18-asdOE is at position 1862 of SEQ ID No. 6: pK18-asd R234HIn OE, the deoxyribonucleotide at position 1862 of SEQ ID No. 6 is adenine deoxyribonucleotide (A), while in pK18-asdOE, the deoxyribonucleotide at position 1862 of SEQ ID No. 6 is guanine deoxyribonucleotide (G).

[0124] Using *Corynebacterium glutamicum* L-asd-1 as a template, PCR amplification was performed using primers P5 and P6, P7 and P8, P9 and P10, and P11 and P12, respectively. This yielded a 763 bp upstream homologous arm fragment (corresponding to a portion of the coding region of *Corynebacterium glutamicum* ATCC13032 NCgl1740 and the NCgl1741 gene and its promoter region, sequence shown as SEQ ID No. 6, 37-799), and a 362 bp asd gene promoter fragment (sequence shown as SEQ ID No. 6, 800-1161). R234H The gene fragment 1124 bp (sequence shown as SEQ ID No. 6, 1162-2285, where guanine (G) at position 1862 is mutated to adenine (A)) and the downstream homologous arm fragment 596 bp (corresponding to a partial coding region of the Corynebacterium glutamicum ATCC13032 NCgl1742 gene, sequence shown as SEQ ID No. 6, 2286-2881) were extracted. After PCR, the four amplified fragments were recovered by electrophoresis using a column DNA gel extraction kit. The four recovered fragments were ligated with pK18mobsacB plasmid (Addgene) purified by Xbal I and BamHI digestion using NEBuilder enzyme (NEB) at 50℃ for 30 min. The single clones grown after transformation were identified by PCR using primers P5 / P12. The fragment with a size of 2919 bp (sequence shown as SEQ ID No. 6) was identified as a positive integrative plasmid (recombinant vector), and the resulting recombinant vector was pK18-asd. R234H OE, the positive integration plasmid contains a kanamycin resistance marker, and recombinants integrated into the genome can be obtained through kanamycin screening.

[0125] The correctly sequenced integration plasmids (pK18-asdOE, pK18-asd) R234HOE was electroporated into *Corynebacterium glutamicum* YP097158 and wild-type *Corynebacterium glutamicum* ATCC13032, respectively, and then cultured on solid culture plates for 40 h. Single colonies were identified by PCR using primers P13 / P14. Strains amplified with a 1360 bp fragment (sequence shown in SEQ ID No. 7) were considered positive strains; those without amplification were considered the original strains. Positive strains were streaked onto solid culture plates containing 15% sucrose for 40 h. Single colonies were further identified by PCR using primers P15 / P16. Strains amplified with a 1537 bp fragment (sequence shown in SEQ ID No. 8) were identified as *asd* or *asd*. R234H Positive strains of the gene and its promoter integrated into the spacer region of the homologous arm NCgl1741 and the lower homologous arm NCgl1742 of the Corynebacterium glutamicum genome. Among these positive strains, the deoxyribonucleotide at position 427 of sequence 8 is guanine deoxyribonucleotide (G). R234H In positive strains where the gene and its promoter are integrated into the spacer region of the homologous arm NCgl1741 and the lower homologous arm NCgl1742 of the Corynebacterium glutamicum genome, the deoxyribonucleotide at position 427 of sequence 8 is adenine deoxyribonucleotide (A).

[0126] The strains obtained from Corynebacterium glutamicum YP097158 were named L-asd-2 (without mutation point) and L-asd-3 (with mutation point), respectively; the strains obtained from Corynebacterium glutamicum ATCC13032 were named Y-asd-2 (without mutation point) and Y-asd-3 (with mutation point), respectively.

[0127] The recombinant bacteria L-asd-2 and Y-asd-2 contain two copies of the asd gene shown in SEQ ID No. 1. Specifically, the recombinant bacteria L-asd-2 is obtained by replacing the spacer region of the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with the asd gene and its promoter (i.e., the DNA fragment shown in SEQ ID No. 6, 800-2285, where the deoxyribonucleotide at position 1862 of SEQ ID No. 6 is guanine deoxyribonucleotide (G)), while keeping the other nucleotides of the Corynebacterium glutamicum YP097158 genome unchanged. The recombinant strain Y-asd-2 is obtained by replacing the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the genome of Corynebacterium glutamicum ATCC13032 with the asd gene and its promoter (i.e., the DNA fragment shown in SEQ ID No. 6 800-2285, where the deoxyribonucleotide at position 1862 of SEQ ID No. 6 is guanine deoxyribonucleotide (G)), while keeping the other nucleotides of the Corynebacterium glutamicum ATCC13032 genome unchanged.

[0128] The recombinant bacteria L-asd-3 and Y-asd-3 contain the mutated asd shown in SEQ ID No. 3. R234H Gene; specifically, the recombinant strain L-asd-3 is formed by replacing the spacer region between the upper homologous arm NCgl1741 and the lower homologous arm NCgl1742 in the genome of Corynebacterium glutamicum YP097158 with asd. R234H The recombinant strain Y-asd-3 was obtained by replacing the gene and its promoter (i.e., shown in SEQ ID No. 6, where the deoxyribonucleotide at position 1862 is adenine deoxyribonucleotide (A)) with other nucleotides of the *Corynebacterium glutamicum* YP097158 genome unchanged. The recombinant strain Y-asd-3 is obtained by replacing the spacer region between the upstream homologous arm NCgl1741 and the downstream homologous arm NCgl1742 in the *Corynebacterium glutamicum* ATCC13032 genome with asd. R234H The recombinant bacteria were obtained by keeping the gene and its promoter (i.e., shown in SEQ ID No. 6, 800-2285, where the deoxyribonucleotide at position 1862 is adenine deoxyribonucleotide (A)) unchanged, while keeping other nucleotides of the Corynebacterium glutamicum ATCC13032 genome unchanged.

[0129] The PCR identification primers are shown below (synthesized by Invitrogen Shanghai):

[0130] P13:5'-TCCAAGGAAGATACACGCC-3' (corresponding to the outer side of the upstream homologous arm NCgl1740),

[0131] P14:5'-CAAAGAAACGAACAGTGTCAGC-3' (corresponding to the inside of the asd gene),

[0132] P15:5'-CTGTTGTGGATAACTCTTCTGC-3' (corresponding to the inside of the asd gene),

[0133] P16:5'-TGGTCGTTGGAATCTTGC-3' (corresponding to the outer side of the downstream homologous arm NCgl1742).

[0134] Example 4: Constructing plasmids to overexpress the asd gene or asd R234H engineered strains of genes

[0135] Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, amplified asd or asd was designed and synthesized. R234H Primers for the gene coding region and promoter region were used to overexpress asd or asd in Corynebacterium glutamicum YP097158 and wild-type Corynebacterium glutamicum ATCC13032 using the expression vector pXMJ19 (sequence shown in SEQ ID NO.11). R234H Gene.

[0136] The recombinant vector was constructed using NEBuilder assembly technology, and the primers were designed as follows (synthesized by Invitrogen Shanghai):

[0137] P17:5'-CAGAATAATTAAGCTTGCATGCCTGCAGGTCGACCTTAGGGAGCCATCTTTTG-3' (The underlined nucleotide sequence is a homologous sequence of pXMJ19);

[0138] P18:5'-CCAAAACAGCCAAGCTGAATTCGAGCTCGGTACCCACTTCACAAGCTCGACC-3' (The underlined nucleotide sequence is a homologous sequence of pXMJ19).

[0139] Using plasmid pK18-asdOE or pK18-asd R234H Using OE as a template, PCR amplification was performed using primers P17 / P18 to obtain asd or asd. R234HThe gene promoter and coding region fragments were purified and ligated with the expression vector pXMJ19 (purchased from Biovector, containing chloramphenicol resistance) recovered by Xbal I and BamHI enzyme digestion using NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The ligation product was transformed into DH5α competent cells and plated on 2-YT agar plates containing chloramphenicol (34 mg / L) and cultured at 37°C for 12 h. The resulting single clones were identified by PCR using primers P17 / P18. Those that could amplify a 1554 bp fragment (sequence shown in SEQ ID No. 9) were those containing asd or asd. R234H Positive transformants pXMJ19-asd and pXMJ19-asd of gene promoter and coding region sequences R234H The deoxyribonucleotide at position 1097 of sequence 9 in the positive transformant pXMJ19-asd is guanine deoxyribonucleotide (G). R234H The deoxyribonucleotide at position 1097 of sequence 9 is adenine deoxyribonucleotide (A).

[0140] The correctly sequenced pXMJ19-asd and pXMJ19-asd R234H The plasmids were electroporated into *Corynebacterium glutamicum* YP097158 and wild-type *Corynebacterium glutamicum* ATCC13032, respectively. After 40 h of culture on solid agar plates, single colonies were identified by PCR using primers P17 / P18. Strains amplified by PCR containing a 1554 bp fragment (sequence shown in SEQ ID No. 9) were considered positive. Strains obtained using *Corynebacterium glutamicum* YP097158 as the starting strain were named L-asd-4 (containing plasmid pXMJ19-asd) and L-asd-5 (containing plasmid pXMJ19-asd), respectively. R234H The strains obtained using Corynebacterium glutamicum ATCC13032 as the starting strain were named Y-asd-4 (containing plasmid pXMJ19-asd) and Y-asd-5 (containing plasmid pXMJ19-asd), respectively. R234H ).

[0141] Example 5: L-Lysine fermentation experiment

[0142] The strains constructed in Examples 2-4, wild-type Corynebacterium glutamicum ATCC13032, and Corynebacterium glutamicum YP097158 were fermented in 500 mL baffle shake flasks under the culture medium shown in Table 2 and the control conditions shown in Table 3. After fermentation, the L-lysine yield was detected using an SBA-Biosensor Analyzer (Shandong Academy of Sciences Institute of Biology). Each strain was repeated three times, and the results are shown in Table 4.

[0143] Table 2. Shake-flask fermentation medium formulation (solvent is water)

[0144] Element Final concentration glucose 90g / L Molasses 15mL / L ammonium sulfate 45g / L Magnesium sulfate 1.2g / L Potassium dihydrogen phosphate 1.1g / L Corn syrup 15mL / L manganese sulfate 150mg / L Ferrous sulfate 200mg / L Zinc sulfate 1mg / L Copper sulfate 0.9 mg / L Vitamin B1 9mg / L Calcium pantothenate 9mg / L Niacinamide 60mg / L Biotin 1.8 mg / L Calcium carbonate 30g / L Defoamer 0.07 mL / L

[0145] Table 3. Fermentation Control Conditions

[0146]

[0147] Table 4. L-Lysine production and significance analysis

[0148]

[0149] Note: P<0.05 in the table indicates a significant difference, and P<0.01 in the table indicates a highly significant difference.

[0150] Table 5, including asd and asd R234H L-lysine production and significance analysis of the gene

[0151]

[0152] Note: P<0.05 in the table indicates a significant difference, and P<0.01 in the table indicates a highly significant difference.

[0153] Fermentation results are shown in Tables 4 and 5. The results show that point mutations in the coding region of the asd gene in wild-type Corynebacterium glutamicum ATCC13032 and Corynebacterium glutamicum YP097158 can effectively promote the fermentation of asd genes. R234H and overexpression asd or asd R234H Genes that contribute to increased L-lysine production, and overexpression of asd R234H The effect of the gene is better than that of the asd gene.

[0154] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. The application of proteins, characterized in that, The application refers to the use of the protein in increasing the lysine production of microorganisms, wherein the protein is any one of the following: a1) A protein whose amino acid sequence contains SEQ ID NO.4; a1'), a protein whose amino acid sequence contains SEQ ID NO.2; a2) Proteins that are more than 80% identical to the amino acid sequence shown in a1) or a1') and are associated with aspartate semialdehyde dehydrogenase, obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) or a1'). a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1), a1'), or a2).

2. The application of biomaterials related to the protein described in claim 1, characterized in that, The application refers to the use of the biomaterial in any one of A1)-A4) below. A1) The application of the biomaterial in constructing engineered bacteria that produce lysine; A2) The application of the biomaterial in the preparation of lysine; A3) The application of the biomaterial in regulating the production of lysine in microorganisms; A4) The application of the biomaterial in constructing engineered bacteria that produce high levels of lysine; the engineered bacteria that produce high levels of lysine are modified microorganisms obtained by modifying the target microorganism, and the lysine content of the engineered bacteria that produce high levels of lysine is higher than that of the target microorganism. The biomaterial is at least one of the following B1)-B3): B1) A nucleic acid molecule encoding the protein described in claim 1. B2), an expression cassette containing the nucleic acid molecule described in B1), B3), a recombinant vector containing the nucleic acid molecule described in B1), and / or a recombinant vector containing the expression cassette described in B2).

3. The application according to claim 2, characterized in that, B1) The nucleic acid molecule mentioned is any one of G1)-G3). G1), a nucleic acid molecule whose nucleotide sequence contains SEQ ID NO.3; G2), a nucleic acid molecule whose nucleotide sequence contains SEQ ID NO.1; G3) is a nucleic acid molecule that has more than 80% identity with the nucleic acid molecules described in G1 or G2.

4. The protein as described in claim 1 and / or the biomaterial as described in claim 2 or 3.

5. Recombinant microorganisms, characterized in that, The recombinant microorganism is any one of the following: C1) Recombinant microorganisms containing the nucleic acid molecules described in claim 2 or 3 (B1); C2) Recombinant microorganisms containing the expression cassette described in claim 2 or 3 (B2); C3) Recombinant microorganisms containing the recombinant vector described in claim 2 or 3 (B3); C4) Recombinant microorganisms containing the protein described in claim 1.

6. A method for preparing the recombinant microorganisms of claim 5, characterized in that, The recombinant microorganism is prepared by a method comprising the steps of: introducing a nucleic acid molecule encoding the protein of claim 1, or the expression cassette of claim 2 or 3 (B2), or the recombinant vector of claim 2 or 3 (B3) into the recipient microorganism, wherein the recipient microorganism is any one of the following: D1) Microorganisms capable of producing L-lysine; D2), bacteria; D3), ​​Gram-positive bacteria; D4) Corynebacterium spp.; D5), Corynebacterium glutamicum.

7. The application of recombinant microorganisms in the preparation of lysine, characterized in that, The recombinant microorganism is the recombinant microorganism according to claim 5, or the recombinant microorganism prepared by the method according to claim 6.

8. A method for preparing lysine, characterized in that, The method includes the step of preparing lysine using recombinant microorganisms as fermentation strains, wherein the recombinant microorganisms are the recombinant microorganisms of claim 5 or the recombinant microorganisms prepared by the method of claim 6.

9. A method for increasing lysine production in recipient microorganisms, characterized in that, The method includes introducing the nucleic acid molecule of claim 2 or 3 (B1), the expression cassette of claim 2 or 3 (B2), or the recombinant vector of claim 2 or 3 (B3) into the recipient microorganism to increase the lysine production of the recipient microorganism.

10. The method according to claim 9, characterized in that, The recipient microorganism is any one of the following: D1) Microorganisms capable of producing L-lysine; D2), bacteria; D3), ​​Gram-positive bacteria; D4) Corynebacterium spp.; D5), Corynebacterium glutamicum.