Application of DRG9 gene in regulating high temperature tolerance of rice

Abstract

The application belongs to the technical field of plant genetic engineering, and discloses DRG9 Application of a gene in regulating high-temperature resistance of rice. DRG9 The application obtains a gene capable of improving high-temperature tolerance of rice through separation, cloning and function verification. DRG9 The protein sequence coded by the gene is shown as SEQ ID.2. The application clones a high-temperature response gene of rice DRG9 , and performs CRISPR mutant phenotype identification on the candidate gene. Through high-temperature stress phenotype identification in the seedling stage and the adult stage, it is shown that when the gene fragment is deleted, the high-temperature stress tolerance of rice is reduced, and when the gene is overexpressed, the high-temperature tolerance is improved, thereby confirming the function and application approach of the gene.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of the DRG9 gene in controlling heat tolerance in rice. The invention employs a candidate gene screening method to clone the DRG9 gene, which controls heat tolerance in rice. DRG9 mutants were constructed using CRISPR technology, and co-segregation analysis showed that the DRG9 mutants are closely associated with the heat-sensitive phenotype, confirming the function and application pathway of this gene. Background Technology

[0002] Plants are affected by numerous environmental factors during their growth. Drought, cold damage, and high temperatures can lead to large-scale crop yield reductions, posing a bottleneck to agricultural development in many regions. Developing stress-resistant crop varieties has always been a major goal of agricultural science and technology research. To resist or adapt to these adverse factors, plants sense changes in extracellular environmental conditions and transmit these changes into cells through various pathways. This induces the expression of response genes and the production of functional proteins and osmotic regulators that protect cells from stresses such as drought, high salinity, and low temperatures, thus adapting to unfavorable growth environments (Xiong et al., Cell signaling during cold, drought, and salt stress. Plant Cell. 14(suppl), S165–S183, 2002). The proper expression of these functional genes in response to environmental stress is finely regulated by regulatory factors. Transcription factors, as regulatory genes, can regulate the expression of a series of downstream genes when organisms experience abiotic stress, thereby enhancing the plant's tolerance to stress and achieving resistance to adverse environmental conditions. Most types of transcription factors are involved in abiotic stress responses in plants, including AP2 / EREBP, bZip, HD-ZIP, MYB, MYC, NAC, and Zinc finger transcription factors (Yamaguchi-Shinozaki K, Shinozaki K. Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses. Annu Rev Plant Biol, 2006, 57: 781-803). Through genetic engineering, some stress-response transcription factors have been successfully applied to rice stress resistance breeding. Transgenic rice plants bred using SNAC1 showed an approximately 30% increase in seed setting rate under drought conditions in the field, while yield remained unaffected and no other phenotypic changes occurred under normal conditions. Transgenic plants also showed significantly enhanced resistance to drought and high salt during the vegetative growth stage (Hu et al. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. Proc Natl Acad Sci USA, 2006, 103: 12987-12992). These antiretroviral transcription factors function by regulating the expression of a large number of downstream genes.These downstream genes often contain regulatory proteins involved in signal transduction and gene expression, which further form secondary regulatory networks. These downstream genes can also be used for genetic improvement of crop stress resistance. In Arabidopsis, the downstream gene HsfA3 of the heat-shock transcription factor DREB2A can also improve the heat resistance of transgenic overexpressing plants (Yoshida et al. Functional analysis of an Arabidopsis heat-shock transcription factor HsfA3 in the transcriptional cascade downstream of the DREB2A stress-regulatory system. Biochem Biophys Res Commun, 2008, 368: 515-21).

[0003] Double-stranded RNA (dsRNA) is a helical molecule formed by two complementary RNA strands through base pairing. In eukaryotes, it typically exists as an intermediate in viral replication or as a double-stranded region of non-coding RNA, forming its core structural feature. In plants, dsRNA plays a dual role: it is both a core molecule triggering RNA interference (RNAi) mechanisms and a signaling agent activating plant innate immunity. In plant stress resistance research, dsRNA-based technologies have expanded from early antiviral applications to antifungal and insect resistance, demonstrating enormous application potential.

[0004] In Arabidopsis thaliana, five DRB proteins (DRB1–DRB5) are primarily involved in small RNA biosynthesis: DRB1 (HYL1) forms a cleavage complex with DCL1 and SE in the nucleus, forming D-bodies through phase separation to ensure accurate processing of pri-miRNA; cytoplasmic HYL1 also monitors AGO1 and inhibits translation; DRB4 interacts with DCL4 and is essential for the correct production of ta-siRNA and antiviral defense; DRB3 participates in RdDM pathway-mediated viral genome methylation; DRB2 and DRB3 negatively regulate low-temperature-induced anthocyanin accumulation, suggesting their role in abiotic stress. In rice, OsDRB1 binds to specific regions of non-coding RNA and mRNA, participating in small RNA processing; OsDRB2 controls leaf curling by regulating the levels of miR160 and miR319. These studies reveal the multiple functions of plant double-stranded RNA-binding proteins in RNA interference, growth and development, and stress responses.

[0005] Rice is an important food crop and model plant. In today's world, where extreme weather conditions are frequent, breeding rice varieties with enhanced stress resistance is of great significance. Given that the DRG9 gene encodes a double-stranded RNA-binding protein, whether it can improve the heat tolerance of rice has not yet been reported. Therefore, isolating the DRG9 gene from rice and identifying its function in improving rice stress resistance will be of great importance for breeding new stress-resistant rice varieties. Summary of the Invention

[0006] The purpose of this invention is to provide the application of the DRG9 gene in rice in controlling the heat resistance of rice, wherein the protein encoded by the DRG9 gene is shown in SEQ ID NO.2.

[0007] Another object of the present invention is to provide the application of the DRG9 gene in rice in the creation of heat-resistant rice, wherein the protein encoded by the DRG9 gene is shown in SEQ ID NO.2.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] Using a candidate gene screening method, the applicant cloned the DRG9 gene, which controls the heat tolerance of rice. Loss of function of this gene leads to reduced heat tolerance in rice under high-temperature conditions, while overexpression of this gene can improve the heat tolerance of rice. The protein encoded by this gene is shown in SEQ ID NO.2, and one of the genes encoding this protein is shown in SEQ ID NO.1.

[0010] The scope of protection of this invention includes:

[0011] The application of increasing the expression level of the DRG9 gene in rice to improve the heat resistance of rice, wherein the protein encoded by the DRG9 gene is shown in SEQ ID NO.2.

[0012] The above-described application involves introducing substances that increase the expression level of the DRG9 gene into rice.

[0013] The applications described above refer to expression cassettes, recombinant vectors, or recombinant microorganisms that enhance the expression level of the DRG9 gene.

[0014] The application described above refers to the substance being a plant expression vector pU1301 containing a gene encoding the protein shown in SEQ ID NO.2;

[0015] Application of inhibiting DRG9 gene expression in rice in reducing rice heat tolerance;

[0016] The above-described applications involve introducing substances that inhibit or prevent the expression of the DRG9 gene in rice into the rice plant.

[0017] The substances mentioned in the above applications are expression cassettes, recombinant vectors, or recombinant microorganisms that reduce the expression level of the DRG9 gene.

[0018] The above-mentioned methods of inhibition include: DNA methylation, histone deacetylation or modification such as H3K27me3, blocking RNA polymerase activity, CRISPRi, RNA interference (RNAi), antisense oligonucleotides (ASO), translation inhibitors, upstream open reading frame editing, gene editing technology, ribozyme methods or triple-stranded DNA technology.

[0019] The above-described applications, when using gene editing technology, target the site as follows: AATAGTCTTTCCGGCGGCGGCGG.

[0020] Application of reagents for detecting the DRG9 gene in rice in the screening or breeding of rice heat resistance.

[0021] The method for determining the application described above is as follows: if the expression level of the DRG9 gene is significantly higher than that of wild-type rice, it is heat-resistant rice; if the gene is not detected or its expression level is significantly lower than normal, it is heat-sensitive rice.

[0022] Application of expression cassettes, recombinant vectors, or recombinant microorganisms that enhance DRG9 gene expression in the preparation of heat-resistant rice.

[0023] The DRG9 gene described above is shown in SEQ ID NO.1.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] The applicant disclosed for the first time that the DRG9 gene in rice is related to the heat resistance of rice. This gene can be transformed into a variety of plants, including rice, to cultivate new heat-resistant plant varieties. Attached Figure Description

[0026] Figure 1 The status of gene editing in the rice drg9 CRISPR mutant;

[0027] Figure 2 This describes the seedling high-temperature stress phenotype of the rice drg9 CRISPR mutant.

[0028] Where: A represents the growth status of the drg9-29 family before and after high temperature stress; B represents the growth status of the drg9-33 family before and after high temperature stress.

[0029] Figure 3 The expression level of DRG9 overexpression material in rice.

[0030] Figure 4 The panicle phenotype of rice DRG9 overexpression families after high temperature stress at the adult stage;

[0031] Among them: OE19 and OE48 are two DRG9 overexpression families, and Kongyu 131 (KY131) is used as a control; A is the ear filling status of the OE19 family after high temperature treatment; B is the ear filling status of the OE48 family after high temperature treatment.

[0032] Figure 5 Statistics on seed setting rate of rice DRG9 overexpression families after high temperature stress;

[0033] Among them: DRG9-OE19 and DRG9-OE48 are two DRG9 overexpression families, and Kongyu 131 (KY131) is used as a control; A shows the seed setting rate statistics of the DRG9-OE19 family after high temperature stress; B shows the seed setting rate statistics of the DRG9-OE48 family after high temperature stress. Detailed Implementation

[0034] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or materials described are all from commercial sources unless otherwise specified.

[0035] Example 1:

[0036] Isolation and cloning of the DRG9 gene

[0037] Primers DRG9-FL-F (5'-ATGGACTTCGCCGACGC-3', as shown in SEQ ID NO. 6) and DRG9-FL-R (5'-TTCCGTCGCATTGAGCT-3', as shown in SEQ ID NO. 7) were designed based on the Rice Data gene database (https: / / www.ricedata.cn / gene / ). Using cDNA from leaves of the rice variety Nipponbare as a template, the CDS sequence encoded by the DRG9 gene was amplified using primers DRG9-FL-F and DRG9-FL-R.

[0038] The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, for 33 cycles. The amplified PCR product was ligated into the pGEM-T Easy vector (purchased from Promega) using the TA cloning method. Positive clones were screened and confirmed by sequencing to obtain the CDS sequence of DRG9, as shown in SEQ ID NO.1. The protein it encodes is shown in SEQ ID NO.2.

[0039] The applicant named the clone pGEM DRG9 plasmid, from which a DNA fragment of the complete coding region of the DRG9 gene can be obtained.

[0040] Example 2:

[0041] Construction of DRG9 gene overexpression vector

[0042] The positive clone pGEM-DRG9 obtained in Example 1 was amplified using primers DRG9-OE-F (5'-tacgaacgatagccggtacc ATGGACTTCGCCGACGC-3', as shown in SEQ ID NO. 8) and DRG9-OE-R (5'-ttgcggactctagaggatcc TTCCGTCGCATTGAGCT-3', as shown in SEQ ID NO. 9) to produce a DNA fragment containing the complete coding region of the DRG9 gene. The PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 55℃ for 30 sec, 72℃ for 2 min, for 30 cycles. The obtained PCR product was ligated into the pU1301 vector digested with restriction endonucleases KpnI and BamHI using the Gibson Assembly method. The vector was sequenced for confirmation, and finally, a DRG9 gene overexpression vector suitable for genetic transformation was obtained.

[0043] Example 3:

[0044] Constructing drg9 CRISPR mutants

[0045] The DRG9 gene sequence was obtained from the Rice Data (https: / / www.ricedata.cn / gene / ) rice gene database. A target site was selected from CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ) to construct the CRISPR vector DRG9-CRISPR. The construction of the CRISPR mutant line vector can be found in relevant literature (He Yubing et al. Programmed self-elimination of the CRISPR / Cas9 construct greatly accelerates the isolation of edited and transgene-free rice plants. Mol. Plant. 2018, 05.005.), which will not be described in detail here due to space limitations. The target site selected from the CRISPR-P v2.0 website is as follows:

[0046] Target site: AATAGTCTTTCCGGCGGCGGCGG, as shown in SEQ ID NO.5.

[0047] The constructed CRISPR vector DRG9-CRISPR was transferred into the rice variety “Zhonghua 11” using an Agrobacterium-mediated rice genetic transformation method (specific steps described below). After pre-culture, infection, co-culture, screening for hygromycin-resistant calluses, differentiation, rooting, hardening-off, and transplanting, transgenic plants were obtained. The above Agrobacterium-mediated rice (Zhonghua 11) genetic transformation method (system) was improved based on the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA, Plant J, 6:271-282, 1994) (see transformation steps below).

[0048] The specific genetic transformation steps in this embodiment are as follows:

[0049] (1) Electroporation: The final CRISPR target vector DRG9-CRISPR was electroporated into Agrobacterium EHA105 strain at 1800V. The mixture was then plated onto LA medium with corresponding resistance selection, and positive clones were screened for use in the following callus transformation.

[0050] (2) Callus induction: Remove the shell from mature rice seeds of Zhonghua 11, then treat them with 70% ethanol for 1 minute, and then disinfect the seed surface with 0.15% mercuric chloride (HgCl2) for 15 minutes; wash the seeds with sterile water 4-5 times; place the disinfected seeds on the induction medium; and incubate the inoculated callus induction medium in the dark for 4 weeks at a temperature of 25±1℃.

[0051] (3) Callus subculture: Select bright yellow, firm and relatively dry embryogenic callus, place it on subculture medium and culture it in the dark for 2 weeks at a temperature of 25±1℃.

[0052] (4) Pre-culture: Select firm and relatively dry embryogenic callus, place it on pre-culture medium and culture it in the dark for 2 weeks at a temperature of 25±1℃.

[0053] (5) Agrobacterium culture: Agrobacterium EHA105 (derived from CAMBIA, a commercial strain carrying the CRISPR vector DRG9-CRISPR of the present invention) was pre-cultured on LA medium with corresponding resistance selection for two days at a culture temperature of 28°C; the Agrobacterium was then transferred to suspension medium and cultured on a shaker at 28°C for 2-3 hours.

[0054] (6) Agrobacterium infection: Transfer the pre-cultured callus to a sterilized bottle; adjust the Agrobacterium suspension to OD. 600 0.8-1.0; Soak the callus in Agrobacterium suspension for 30 minutes; Transfer the callus to sterilized filter paper and blot dry; Then place it on co-culture medium and incubate for 3 days at a temperature of 19-20℃.

[0055] (7) Callus washing and selection culture: Wash the callus with sterile water until Agrobacterium is no longer visible; soak in sterile water containing 400 ppm carbenicillin (CN) for 30 minutes; transfer the callus to sterile filter paper and blot dry; transfer the callus to selection medium and select 2-3 times, each time for 2 weeks (the concentration of carbenicillin for the first screening is 400 ppm, and the concentration of hygromycin is 250 ppm for the second and subsequent screenings).

[0056] (8) Differentiation: Transfer the resistant callus to the pre-differentiation medium and culture it in the dark for 5-7 weeks; transfer the pre-differentiated callus to the differentiation medium and culture it under light at a temperature of 26℃.

[0057] (9) Rooting: Cut off the roots produced during differentiation; then transfer them to a rooting medium and culture them under light for 2-3 weeks at a temperature of 26℃.

[0058] (10) Transplanting: Wash off the residual culture medium on the roots and transfer the seedlings with good root systems to the greenhouse, while keeping them moist for the first few days.

[0059] Based on the aforementioned gene editing target sites, primers were designed to detect the editing status of the DRG9 gene in the mutants. Specific PCR amplification of the DRG9 gene was performed using primers OsDRG9-CR-F: 5'-ATGGACTTCGCCGACGC-3' (as shown in SEQ ID NO.10) and DRG9-CR-R: 5'-GCTGCGACTTTGGACTGG-3' (as shown in SEQ ID NO.11). The amplified PCR products were sequenced, and the presence of Cas9 was detected. Sequencing results showed that two drg9 CRISPR mutant families were screened ( Figure 1In the drg9-29 CRISPR homozygous Cas9 mutant family, one base was inserted into the DRG9 gene, and the resulting gene sequence is shown in SEQ ID NO.3. In the drg9-33 CRISPR homozygous Cas9 mutant family, one base was inserted into the DRG9 gene, and the resulting gene sequence is shown in SEQ ID NO.4.

[0060] Example 4:

[0061] Identification of the high-temperature stress phenotype in seedlings of drg9 CRISPR mutants

[0062] The homozygous mutants drg9-29 and drg9-33, whose genotypes had been identified in Example 3, and the control wild-type rice variety Zhonghua 11 (ZH11) were directly sown into small cylindrical containers after germination. One half of the containers was planted with the mutant material, and the other half with the control wild-type rice variety Zhonghua 11, with 12 plants in each half. The soil used in the experiment was a mixture of paddy soil from southern China and coarse sand at a volume ratio of 2:3. An equal volume of water was added to each container, allowing the water to seep out to ensure consistent soil compaction. The experiment was repeated three times. Healthy rice plants at the 4-leaf stage were subjected to 40℃ high-temperature stress for 10 days, followed by a 7-day recovery period at room temperature (20-22℃), and photographs were taken.

[0063] The results showed that, compared with the ZH11 control, the drg9 CRISPR homozygous mutant plants exhibited a heat-sensitive phenotype. Figure 2 ).

[0064] Example 5:

[0065] Identification of DRG9 overexpression in adult plants under high temperature stress phenotype

[0066] Using the method described in Example 3, the constructed DRG9 gene overexpression vector was transformed into the rice variety "Kongyu 131" via Agrobacterium-mediated transformation. DRG9 expression levels in the overexpression families were detected. The primers were DRG9-qRT-F: 5'-TTGCAGTTGTCCTGCGAGAT-3' (as shown in SEQ ID NO. 12) and DRG9-qRT-R: 5'-TGAGCTTTGCCTGAAGCACT-3' (as shown in SEQ ID NO. 13), and the internal control primers were Ubq-qRT-F: 5'-AACCAGCTGAGGCCCAAGA-3' (as shown in SEQ ID NO. 14) and Ubq-qRT-R: 5'-ACGATTGATTTAACCAGTCCATGA-3' (as shown in SEQ ID NO. 15). Two DRG9 gene overexpression families, OE19 and OE48, were finally identified. Figure 3In this embodiment of the invention, OE19 and OE48 are also referred to as DRG9-OE19 and DRG9-OE48, respectively.

[0067] The identified overexpression families OE19 and OE48, along with the control wild-type (i.e., non-GMO, the same below) rice variety Kongyu 131 (KY131), were germinated and sown into seedling trays, and transplanted into large blue buckets one month later.

[0068] At 16:00 daily, potted rice samples nearing heading were selected based on the panicle differentiation process and transferred to an artificial climate chamber for continuous high-temperature treatment at 40℃ (9 hours daily) for 9 days to cover the sensitive period of spikelet development. At the start of the high-temperature treatment, at least three main panicles on each pot were marked using a tagging method to ensure the stressed panicles were in the critical flowering stage. During the treatment, a 3-4cm water layer was maintained in the potted soil to simulate field irrigation conditions. After the high-temperature stress ended, once all the spikelets on the marked panicles had opened, the plants were removed from the artificial climate chamber and returned to normal management. This method allows for precise control of the high-temperature period and avoids interference with non-target developmental stages. After grain set, the seed setting rate of the tagged panicles was assessed during seed harvesting.

[0069] The results showed that, compared with the KY131 control, the overexpressing plants exhibited a heat-resistant phenotype. Figure 4 After high-temperature stress, the average seed setting rates of DRG9-OE19 and the control KY131 were 42.26% and 21.02%, respectively, while the average seed setting rates of DRG9-OE48 and the control KY131 were 43.01% and 21.02%, respectively. Statistical results indicate that the seed setting rate of DRG9 overexpression families was significantly higher than that of the wild-type control KY131 after high-temperature stress. Figure 5 ).

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. Improve rice DRG9 The application of gene expression levels in improving the heat resistance of rice, as described above. DRG9 The protein encoded by the gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, Its application process involves improving the rice's... DRG9 The substance that controls gene expression is introduced into rice.

3. The application according to claim 2, characterized in that, The substance described is for improving DRG9 Gene expression cassettes, recombinant vectors, or recombinant microorganisms.

4. Inhibits the growth of certain substances in rice. DRG9 The application of gene expression in reducing heat tolerance in rice, as described above. DRG9 The protein encoded by the gene is shown in SEQ ID NO.

2.

5. The application according to claim 4, characterized in that, Its application process involves inhibiting the growth of certain substances in rice. DRG9 The gene is expressed or the substance that prevents it from being expressed is introduced into rice.

6. The application according to claim 5, characterized in that, The substance mentioned is a reducing agent. DRG9 Gene expression cassettes, recombinant vectors, or recombinant microorganisms.

7. Detection of rice DRG9 The application of gene-based reagents in the screening or breeding of rice heat resistance, as described above. DRG9 The protein encoded by the gene is shown in SEQ ID NO.

2.

8. The application according to claim 7, characterized in that, The determination method used in its application is: if it detects DRG9 Rice varieties with significantly higher gene expression levels than wild-type rice are heat-resistant; rice varieties with no detected gene or significantly lower gene expression levels compared to normal are heat-sensitive.

9. Improve DRG9 The application of gene expression cassettes, recombinant vectors, or recombinant microorganisms in the preparation of heat-resistant rice, wherein... DRG9 The protein encoded by the gene is shown in SEQ ID NO.

2.

10. The application according to claim 1, 4, 7 or 9, characterized in that, The aforementioned DRG9 The gene is shown in SEQ ID NO.1.

Images