Chimeric bovine viral diarrhea virus expressing porcine circovirus type 3 capsid protein and methods of making same

CN122146783APending Publication Date: 2026-06-05NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610349157.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-20
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing technologies struggle to stably express porcine circovirus type 3 (PCV3) capsid protein in bovine viral diarrhea virus (BVDV) through efficient and flexible reverse genetics operations, resulting in low vaccine development efficiency. Furthermore, traditional methods suffer from cumbersome procedures, long cycles, and poor stability.

Method used

A recombinant plasmid of BVDV chimeric virus was constructed using cyclic polymerase extension reaction (CPER). By inserting PCV3 antigen expression units at multiple sites (C7, C28, P7) in the BVDV genome, stable expression of heterologous antigens and virus rescue were achieved using the CMV promoter, SV40 poly(A) signal, and hepatitis D virus ribozyme sequence.

Benefits of technology

Multiple BVDV chimeric viruses capable of stable replication and co-expressing PCV3 antigen were obtained, providing an efficient and flexible viral vector platform, laying the foundation for the development of novel PCV3 vaccines, and improving the speed of virus rescue and the convenience of heterologous antigen replacement.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses a bovine viral diarrhea virus chimeric virus expressing porcine circovirus type 3 capsid protein and a preparation method thereof. In the experiment, a gene sequence for encoding a porcine circovirus type 3 capsid protein and a His tag fused with the C terminal of the protein is inserted into different sites of a bovine viral diarrhea virus genome through a circular polymerase extension reaction, and the chimeric virus is prepared through virus rescue of the obtained circular DNA. The His tag sequence in the gene sequence and the bovine viral diarrhea virus genome are connected through a 2A peptide sequence, so as to realize the target of effectively releasing the antigen through the co-expression of the heterologous protein. The chimeric virus prepared by the application retains the infectivity and replication capacity of the parent virus, can stably replicate in cells and efficiently express the target antigen, and provides an efficient and flexible virus carrier platform for the research and development of a porcine circovirus type 3 vaccine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetically engineered vaccines and relates to the preparation of bovine viral diarrhea virus chimeric virus (rBVDV) expressing porcine circovirus type 3 (PCV3) antigen protein or antigenic epitope. Specifically, it relates to a chimeric virus formed by using BVDV as the parent virus and arbitrarily inserting gene sequences for expressing the capsid protein (Cap) of PCV3 at the following sites in its genome: between the codons corresponding to the 7th and 8th amino acids, the 28th and 29th amino acids of the C protein coding region, and between the p7 and NS2 protein coding regions. Background Technology

[0002] Bovine viral diarrhea virus (BVDV) is a member of the Flaviviridae family and the Hexaviiridae genus, and is the main pathogen causing bovine viral diarrhea-mucosal disease. Infection with this virus in cattle can lead to various clinical manifestations, including subclinical, acute, persistent, and fatal mucosal diseases, causing significant economic losses to the livestock industry. Epidemiological studies have confirmed that BVDV has a broad host spectrum, infecting pigs, sheep, goats, and various even-toed ungulate wild animals across species. In pigs, BVDV infection via oral or respiratory routes activates humoral, cellular, and mucosal immunity, and typically does not cause clinical symptoms or only causes mild symptoms. This characteristic provides a basis for its potential application as a viral vector for swine disease vaccines. BVDV is a single-stranded positive-sense RNA virus with a genome length of approximately 12.5 kb. It contains 5' and 3' untranslated regions at both ends, and an open reading frame in the middle, encoding 12 mature proteins (NH2-Npro-C-Erns-E1-E2-p7-NS2-NS3-NS4A-NS4B-NS5A-NS5B-COOH) formed after protease cleavage. Based on whether the virus causes cytopathic effects in cell culture, BVDV can be divided into two biotypes: cytopathic and non-cytopathic.

[0003] To deeply understand the biological characteristics of BVDV and realize its potential as a vaccine vector, establishing an efficient and flexible reverse genetics system is a crucial prerequisite. Reverse genetics technology is key to analyzing viral gene function, constructing recombinant viruses, and developing vaccines. For BVDV, traditional reverse genetics relies on cloning plasmids containing the full-length viral cDNA in E. coli, followed by in vitro transcription under the control of the T7 promoter, and then transfecting the obtained viral RNA into sensitive cells (e.g., MDBK cells) to rescue the virus. However, this strategy has significant limitations: the viral genomic cDNA is unstable in the E. coli system, posing a risk of prokaryotic promoter activity and leakage expression of toxic proteins, leading to difficulties in cloning and low plasmid yield; the in vitro transcription step is cumbersome, and the obtained RNA has poor stability, resulting in low virus rescue efficiency and a long operation cycle.

[0004] In recent years, several rapid in vivo rescue technologies that do not rely on in vitro transcription and plasmid cloning have been developed, with circular polymerase extension cloning (CPER) being a prime example. This technology utilizes high-fidelity DNA polymerase to perform a circular polymerase extension reaction (CPER) in vitro, assembling multiple DNA fragments with overlapping terminal sequences into a circular DNA molecule in a single step. The resulting circular DNA can be directly transfected into cells expressing the corresponding RNA polymerase (e.g., HEK-293T cells), allowing for transcription and viral rescue within these cells. This avoids the cumbersome steps of enzyme digestion and ligation, bacterial transformation, and in vitro transcription, significantly improving the speed and success rate of virus rescue and providing a new technical pathway for rapid genetic manipulation of RNA viruses. However, currently, the highly efficient recombinant reverse genetic systems constructed using various technologies offer very few insertion sites for exogenous gene sequences into the parental viral genome, typically providing only a single insertion site (see CN108611329A, CN121046331A, etc.).

[0005] Porcine circovirus type 3 (PCV3) is an emerging and important porcine pathogen that can cause various clinical manifestations, including reproductive disorders, systemic diseases, and immunosuppression. The capsid protein (Cap) encoded by this virus is its main immunogenic protein and a key antigenic target for inducing specific immune responses (including neutralizing antibodies) in the host. Currently, there are no commercially available vaccines against PCV3, and existing PCV2 vaccines lack effective cross-protection. This makes the development of novel PCV3 vaccines (especially multivalent vaccines) an urgent need for disease control in swine farming. Although previous studies have confirmed the potential of BVDV as a viral vector, there are currently no reports of constructing structurally flexible and diverse BVDV chimeric viruses that can stably express the PCV3 Cap protein (or related antigenic epitopes) using reverse genetics technology. Summary of the Invention

[0006] The purpose of this invention is to provide a bovine viral diarrhea virus (BVDV) chimeric virus expressing porcine circovirus type 3 (PCV3) capsid protein (Cap) and its preparation method.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: In a first aspect, a BVDV chimeric virus recombinant plasmid is provided. This plasmid comprises a complete transcription unit, which mainly consists of a cytomegalovirus (CMV) promoter, chimeric viral DNA, and a simian virus 40 (SV40) poly(A) signal sequence arranged sequentially from the 5' end to the 3' end. The chimeric viral DNA is a parent virus (specifically, BVDV) genomic cDNA with an inserted heterologous antigen expression unit. The heterologous antigen expression unit includes a heterologous antigen gene sequence encoding a PCV3 Cap protein or a PCV3 Cap protein antigenic epitope co-expressed with the parent virus protein (i.e., PCV3 Cap and its antigenic epitope are collectively referred to as heterologous antigens). The insertion site of the heterologous antigen expression unit is selected from one or more parent virus genomic sites as shown in b1-b3 below. (b1) C7 site, specifically between the codons corresponding to the 7th and 8th amino acids in the BVDV C protein coding region; (b2) C28 site, specifically the codon between amino acids 28 and 29 in the coding region of the BVDV C protein; (b3) P7 site, specifically between the coding regions of BVDV p7 protein and NS2 protein.

[0008] Preferably, the heterologous antigen expression unit further includes a tag sequence fused with the heterologous antigen gene sequence, thereby facilitating the separation and / or identification of the target antigen (i.e., the aforementioned heterologous antigen, such as the PCV3 Cap protein) after expression using a tag (e.g., a 10×His tag fused to the C-terminus of the PCV3 Cap protein).

[0009] Preferably, the heterologous antigen expression unit further includes a 2A peptide sequence, which is linked to the parental viral genome cDNA sequence downstream of the insertion site (for example, the His tag sequence mentioned above is linked to the sequence downstream of the corresponding insertion site on the BVDV genome cDNA via the 2A peptide sequence).

[0010] Preferably, the transcription unit further includes a hepatitis D virus ribozyme (HDVRz) sequence arranged between the chimeric viral DNA and the SV40 poly(A) signal sequence.

[0011] Preferably, the chimeric viral recombinant plasmid is constructed using a circular polymerase extension reaction (CPER).

[0012] Preferably, the parent virus is the BVDV XZ-N1 strain.

[0013] Secondly, a method for constructing the aforementioned BVDV chimeric virus recombinant plasmid is provided, comprising the following steps: 1) Design primers that can both amplify and clone fragments of the parental virus (specifically BVDV, such as BVDV XZ-N1 strain) genomic cDNA via PCR and assemble and restore the sequence of the parental virus genomic cDNA via CPER. 2) Based on the selected insertion site of the heterologous antigen expression unit (i.e., one or more parental viral genomic sites selected from the C7, C28, and P7 sites) and the sequence matching relationship between the insertion site and the amplified fragment in step 1 (matching is completed based on the insertion site being located in the corresponding amplified fragment of a certain pair of primers obtained in step 1), taking any selected insertion site as an example (e.g., the C28 site), through gene operations including PCR amplification (e.g., homologous recombination ligation, etc.), clone one or more alternative fragments that have homologous sequences with the amplified fragment containing the insertion site, and one of the alternative fragments contains the heterologous antigen expression unit located at the insertion site; 3) Perform CPER on all replacement fragments, the corresponding fragments amplified using primer pairs for the remaining amplification fragments except for the replaced fragment (which does not require PCR amplification with the corresponding primers designed in step 1), and another cloned functional fragment containing the SV40 poly(A) signal sequence and CMV promoter (this fragment should ensure that the CMV promoter is located at the 5' end of the chimeric viral DNA and the SV40 poly(A) signal sequence is located at the 3' end of the chimeric viral DNA during CPER), and obtain a circular BVDV chimeric virus recombinant plasmid by extending and circularizing the overlapping sequences at the ends of each fragment.

[0014] Preferably, in step 3, after CPER, the hepatitis D virus ribozyme (HDVRz) sequence of one of the primer pairs designed in step 1 is added downstream of the chimeric viral DNA (specifically between the chimeric viral DNA and the SV40poly(A) signal sequence).

[0015] Thirdly, a BVDV chimeric virus expressing PCV3 antigen is provided, the genome of which includes the genome of a parent virus (specifically BVDV, such as BVDV XZ-N1 strain) and transcripts of the heterologous antigen expression units inserted at specific sites in the genome of the parent virus (determined with reference to one or more of the C7, C28, and P7 sites mentioned above).

[0016] Preferably, the chimeric virus is constructed by inserting a gene sequence encoding the PCV3 Cap protein into the BVDV genomic cDNA using CPER and then performing viral rescue on the resulting circular DNA. The PCV3 Cap protein is expressed by the chimeric virus in the form of a fusion protein with a 10×His tag fused to its C-terminus, and the 3' end of the gene sequence encoding the fusion protein is linked to the BVDV genomic cDNA sequence downstream of the insertion site via a 2A peptide sequence.

[0017] Fourthly, a method for preparing BVDV chimeric virus expressing PCV3 antigen is provided, comprising the following steps: Virus rescue was achieved by transfecting the above-mentioned BVDV chimeric virus recombinant plasmid into cells that have the function of expressing the required RNA polymerase (e.g., capable of transcription) (e.g., HEK-293T cells).

[0018] Preferably, the method includes the following steps: after constructing the chimeric virus recombinant plasmid using CPER, the obtained CPER product is directly transfected into HEK-293T cells that have reached 70%~80% fusion and the cells are cultured for another 3~5 days to rescue and obtain the first generation (F0) BVDV chimeric virus. Subsequently, the first generation (F0) BVDV chimeric virus is inoculated into parental virus host cells (e.g., MDBK cells) and the virus is continuously passaged. After passage (e.g., more than 3 passages) and observation of cytopathic effects, a stably proliferating BVDV chimeric virus strain is obtained.

[0019] The beneficial effects of this invention are reflected in: This invention obtains multiple chimeric BVDV viruses that can stably replicate and co-express this heterologous antigen by precisely inserting PCV3 antigen (e.g., PCV3 Cap protein) genes into multiple sites in the BVDV genome (i.e., the C7, C28, and P7 sites). This provides an efficient and flexible viral vector platform and technical foundation for the development of novel PCV3 vaccines. Furthermore, the chimeric viruses can be obtained by virus rescue from circular molecules with plasmid structures that are modularly designed and assembled (via CPER), facilitating the rapid replacement of different heterologous antigens and accelerating the PCV3 vaccine development process.

[0020] Furthermore, the chimeric virus can stably replicate in MDBK cells and simultaneously express BVDV's own proteins and heterologous antigens (including PCV3 Cap protein), providing an important experimental basis for the development of novel PCV3 vaccines (including multivalent vaccines) using BVDV as a vector. For example, the heterologous antigen expression unit used in the experiment (specifically PCV3 Cap-10×His-2A) can be used at all three insertion sites to efficiently and independently complete the expression of the target antigen as the chimeric virus proliferates. Attached Figure Description

[0021] Figure 1-1 This is a map of the pUC57-CPER-7 plasmid.

[0022] Figure 1-2 The image shows the pUC57-CPER-Cap-his plasmid.

[0023] Figure 1-3 The image shows the pBR322-rBVDV plasmid.

[0024] Figure 1-4The cloning of the segmented genomic cDNA and transcription elements of strain BVDV XZ-N1 was performed by PCR amplification (identified by electrophoresis); lane M: DNA Marker DL5000, lanes 1, 2, 3, 4, 5, 6: CPER-1, CPER-2, CPER-3, CPER-4, CPER-5, CPER-6, lane 7: CPER-7.

[0025] Figure 2 Construction of CPER-1-Cap-C7 and CPER-1-Cap-C28 fragments (electrophoretic identification); (a) PCR amplification, where lane M: DNA Marker DL5000, lane 1: CPER-1U-C7, lane 2: Cap-C7, lane 3: CPER-1D-C7, lane 4: CPER-1U-C28, lane 5: Cap-C28, lane 6: CPER-1D-C28; (b) homologous recombination, where lane M: DNA Marker DL5000, lane 1: CPER-1-Cap-C7, lane 2: CPER-1-Cap-C28.

[0026] Figure 3 PCR amplification (electrophoretic identification) of CPER-2-P7, CPER-Cap-P7, and CPER-3-P7 fragments were performed; lane M: DNA Marker DL5000, lane 1: CPER-2-P7, lane 2: CPER-Cap-P7, lane 3: CPER-3-P7.

[0027] Figure 4 Designed for the PCV3 Cap insertion site of the heterologous antigen protein.

[0028] Figure 5 Cytopathic effect (CPE) observation of chimeric viruses expressing PCV3 Cap protein (scale bar = 100 μm): (a) rBVDV-Cap-C7; (b) rBVDV-Cap-C28; (c) rBVDV-Cap-P7.

[0029] Figure 6For chimeric virus molecular identification: (a) Chimeric virus RT-PCR identification, where lane M: DNA Marker DL2000, lane 1: negative control (specifically water), lane 2: positive control (specifically BVDV XZ-N1 strain), lane 3: rBVDV-Cap-C7, lane 4: rBVDV-Cap-C28, lane 5: rBVDV-Cap-P7; (b) Cap gene RT-PCR identification, where lane M: DNA Marker DL2000, lane 1: rBVDV-Cap-C7, lane 2: rBVDV-Cap-C28, lane 3: rBVDV-Cap-P7.

[0030] Figure 7 Three chimeric viruses were identified by Western blot (referring to the expression of viral E2 protein and Cap protein fused with His tag in post-infected MDBK cells); lane 1: BVDV XZ-N1, lane 2: rBVDV-Cap-C7, lane 3: rBVDV-Cap-C28, and lane 4: rBVDV-Cap-P7.

[0031] Figure 8 The results are from indirect immunofluorescence (IFA) identification of MDBK cells infected with chimeric viruses.

[0032] Figure 9 To evaluate the growth trend of chimeric viruses: (a) RT-qPCR was used to detect the replication of chimeric viruses at different infection time points; (b) Western blot was used to detect the expression of E2 protein in MDBK cells infected with chimeric viruses for 48 h and 72 h.

[0033] Figure 10 RT-PCR was used to identify the genetic stability of chimeric viruses; specifically, "negative" refers to water and "positive" refers to the BVDV XZ-N1 strain. Detailed Implementation

[0034] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments. The embodiments described are for illustrative purposes only and are not intended to limit the scope of protection of the present invention.

[0035] Bovine viral diarrhea virus (BVDV) possesses the potential to serve as a vaccine vector for pigs due to its ability to infect pigs across species and its tendency to cause no obvious clinical symptoms. However, traditional reverse genetic manipulation relies on in vitro transcription and plasmid cloning, resulting in limitations such as cumbersome procedures, long cycles, and poor stability. Furthermore, the parent virus often selects only a single site for the insertion of exogenous fragments (e.g., genes expressing heterologous antigens or epitopes), severely restricting the development and application of viral vectors. Therefore, establishing an efficient, multi-insertion-site BVDV reverse genetic manipulation platform based on circular polymerase extension cloning technology is crucial for advancing its vectorization and vaccine development.

[0036] Previous experiments revealed that the N-terminal region of the C protein lacks a relatively conserved enzymatically active domain and mainly participates in the initiation of BVDV genome RNA wrapping and assembly. It exhibits a certain degree of sequence / length tolerance. Except for the C7 site reported in CN108611329A (specifically located between the codons corresponding to the 7th and 8th amino acids of the C protein coding region), when a foreign fragment is inserted at the C28 site (specifically located between the codons corresponding to the 28th and 29th amino acids of the C protein coding region), stable translational expression can be achieved without disrupting the function of core replication-related non-structural proteins. Furthermore, p7 and NS2 are located at the boundary between structural and non-structural protein conversion (i.e., the P7 site, specifically between the p7 and NS2 protein coding regions), adjacent to key nodes in the regulation of polyprotein cleavage and assembly. When combined with the 2A peptide, effective separation and expression of foreign and viral proteins can be achieved while maintaining the continuity of the downstream replicase region. Previous experiments have shown that BVDV, as a parental virus, has the flexibility of multiple insertion sites and takes into account the stable carrying of foreign genes, viral rescueability and passage stability, making it more suitable for constructing reporter viruses and chimeric viruses expressing heterologous antigens.

[0037] Based on previous experimental results, a strategy for stably expressing porcine circovirus type 3 (PCV3) capsid protein (Cap) or its different antigenic epitopes using BVDV chimeric viruses was designed and experimentally validated, thus laying a technical foundation for the development of PCV3 chimeric vaccines (including multivalent vaccines) based on BVDV vectors. In the experiment, a chimeric virus was first constructed by inserting an expression unit containing the PCV3 Cap gene into three different sites in the BVDV genome: between amino acids 7 and 8 of the C protein (i.e., the C7 site), between amino acids 28 and 29 of the C protein (i.e., the C28 site), and between the p7 and NS2 protein genes (i.e., the P7 site). The expression unit also included a corresponding gene sequence for introducing a 10×His tag at the C-terminus of the PCV3 Cap protein (i.e., the His tag sequence), and a 2A peptide sequence inserted between this gene sequence and the viral genome. The 2A peptide sequence ensures that the PCV3 Cap protein can be effectively cleaved and independently expressed during viral replication. In constructing the chimeric virus, specifically, a circular polymerase extension reaction (CPER) is used to assemble the CMV promoter for driving transcription, the hepatitis D virus ribozyme sequence for achieving precise self-cutting of RNA transcripts, and the SV40 poly(A) signal sequence for enhancing RNA stability and translation efficiency, along with expression units (e.g., PCV3 Cap-10×His-2A consisting of the PCV3 Cap gene, a 10×His tag sequence, and a 2A peptide sequence arranged sequentially) and various viral genome cDNA fragments into a circular DNA. This circular DNA is then directly transfected into cells (e.g., HEK-293T) to achieve rapid rescue of the chimeric virus without in vitro transcription. The CMV promoter, hepatitis D virus ribozyme sequence, and SV40 poly(A) signal sequence only function during the transcription stage and do not integrate into newly formed transcripts. Subsequent replication, translation, and protein synthesis of the chimeric virus depend entirely on the sequence information of the transcripts themselves.

[0038] The experimental preparation steps of BVDV chimeric viruses rBVDV-Cap-C7, rBVDV-Cap-C28, and rBVDV-Cap-P7 expressing PCV3 Cap protein, constructed according to the above three different insertion sites (i.e., C7, C28, and P7 sites), and the experimental evaluation of the good replication ability and genetic stability of the corresponding chimeric viruses in MDBK cells are described in detail below.

[0039] (a) Preparation of BVDV genome fragment and PCV3 Cap expression fragment 1. Design amplification primers for fragments CPER-1, CPER-2, CPER-3, CPER-4, CPER-5, CPER-6, and CPER-7. The upstream primer of CPER-1 is CPER-1-F: 5'-GCTCGTTTAGTGAACCGTAA-3', and the downstream primer is CPER-1-R: 5'-GCTGTTTCCGGTGCGAAGTC-3'; The upstream primer of CPER-2 is CPER-2-F: 5'-GACTTCGCACCGGAAACAGC-3', and the downstream primer is CPER-2-R: 5'-GGCCTTTACCACATCCCCA-3'; The upstream primer of CPER-3 is CPER-3-F: 5'-ATTGGGGATGTGGTAAAGGCC-3', and the downstream primer is CPER-3-R: 5'-CTTCCTATCTCCTCTATAAC-3'; The upstream primer of CPER-4 is CPER-4-F: 5'-GTTATAGAGGAGATAGGAAG-3', and the downstream primer is CPER-4-R: 5'-CAGGATTTCCATGGCTGCAC-3'; The upstream primer of CPER-5 is CPER-5-F: 5'-GTGCAGCCATGGAAATCCTG-3', and the downstream primer is CPER-5-R: 5'-GCTCTCTTATTACTGTATCC-3'. The upstream primer of CPER-6 is CPER-6-F: 5'-GGATACAGTAATAAGAGAGC-3', and the downstream primer is CPER-6-R: 5'-CAAACTCATCAATGTATCTTAGTCCCATTCGCCATTACC-3'; The upstream primer for CPER-7 is CPER-7-F: 5'-CTAAGATACATTGATGAGTTTG-3', and the downstream primer is CPER-7-R: 5'-TACGAGTGCCTTTTCTAATTACGGTTCACTAAACGAGC-3'.

[0040] 2. PCR amplification was performed on six fragments containing homologous sequences from the fragmented cloned BVDV genome and a fragment containing the SV40 poly(A) signal-CMV promoter functional sequence. First, a DNA fragment containing the CMV promoter and the SV40 poly(A) signal sequence was designed and synthesized. This fragment was cloned into the pUC57 vector by Jiangsu Kangwei Century Biotechnology Co., Ltd., and the recombinant plasmid pUC57-CPER-7 was constructed (see [link to documentation]). Figure 1-1Based on the PCV3 virus genome sequence preserved in our laboratory and publicly available sequences in the GenBank database (MK033242.1, MK185662.1), a DNA fragment (i.e., PCV3 Cap-10×His-2A) consisting of the PCV3 Cap gene, a 10×His tag sequence, and a 2A peptide (specifically T2A) sequence arranged sequentially was designed and synthesized. This fragment was cloned into the pUC57 vector by Jiangsu Kangwei Century Biotechnology Co., Ltd., and the recombinant plasmid pUC57-CPER-Cap-his was constructed (see...). Figure 1-2 The pBR322 plasmid (Sangon Biotech (Shanghai) Co., Ltd., catalog number B620003) was linearized by double digestion with EcoRI (Jiangsu Bristol-Myers Squibb, catalog number EG15536S) and SalI (Jiangsu Bristol-Myers Squibb, catalog number EG15566S). Then, through homologous recombination, the full-length cDNA of BVDV XZ-N1 strain (isolated in our laboratory, reference: Construction of recombinant adenovirus of bovine viral diarrhea virus E2 and evaluation of its immunogenicity. Northwest A&F University, 2024) and the hepatitis D virus ribozyme sequence were sequentially inserted. (Reference: Le Mercier P, Jacob Y, Tanner K, Tordo N. A novel expression cassette of lyssavirus shows that the distantly related Mokola virus can rescue a defective rabies virus genome.) J Virol .2002;76(4):2024-2027.), and then constructed the infectious cloning plasmid pBR322-rBVDV of the BVDV XZ-N1 strain (see .2002;76(4):2024-2027.). Figure 1-3 ).

[0041] Using the infectious cloning plasmid pBR322-rBVDV of BVDV XZ-N1 strain as a template, high-fidelity polymerase (Nanjing Novizan Biotechnology Co., Ltd., catalog number P526) was used to amplify CPER-1 (fragment size 2103bp) with primers CPER-1-F and CPER-1-R; CPER-2 (fragment size 1719bp) with primers CPER-2-F and CPER-2-R; and CPER-3 (fragment size 2...) with primers CPER-3-F and CPER-3-R. 387bp); CPER-4 was amplified with primers CPER-4-F and CPER-4-R (fragment size 2190bp); CPER-5 was amplified with primers CPER-5-F and CPER-5-R (fragment size 2169bp); CPER-6 was amplified with primers CPER-6-F and CPER-6-R (fragment size 2223bp, which also includes the hepatitis D virus ribozyme sequence, namely the 5'-BVDV genomic cDNA fragment-hepatitis D virus ribozyme-3').

[0042] Using recombinant plasmid pUC57-CPER-7 as a template, high-fidelity polymerase was used to amplify CPER-7 (fragment size 754bp) with primers CPER-7-F and CPER-7-R. CPER-7 contains a functional sequence (composed of an SV40 poly(A) signal sequence, a CMV enhancer, and a CMV promoter arranged in sequence, denoted as 5'-SV40 poly(A) signal-CMV enhancer-CMV promoter-3'), which also serves as a linker fragment in CPER.

[0043] The amplification system is shown in Table 1, and the reaction procedure is shown in Table 2.

[0044] Table 1. PCR reaction system

[0045] Table 2. PCR reaction procedure

[0046] 3. Design amplification primers for use in cloning fragments CPER-1-Cap-C7 and CPER-1-Cap-C28. The upstream primer of fragment Cap-C7 (PCV3 Cap-10×His-2A containing the C7 insertion site) is CPER-C7-Cap-F: 5'-GACACGAAAGAAGAGGGAATGAGACACAGAGCTATATTCAG-3', and the downstream primer is CPER-C7-2A-R: 5'-CTTTTTTGTTGCTGGGCCAGGATTCTCCTCG-3'. The upstream primer of fragment Cap-C28 (PCV3 Cap-10×His-2A containing the insertion site C28) is CPER-C28-Cap-F: 5'-GAAAATGAAAATAGTGCCCATGAGACACAGAGCTATA-3', and the downstream primer is CPER-C28-2A-R: 5'-GTCTTTTTCAGATTCTTTTGGGCCAGGATTCTCCTC-3'. The upstream primer for the fragment CPER-1U-C7 (containing the upstream sequence of the C7 site homologous to CPER-1) is CPER-1-F: 5'-GCTCGTTTAGTGAACCGTAA-3', and the downstream primer is CPER-C7-R: 5'-TCCCTCTTCTTTCGTGTC-3'. The upstream primer for the fragment CPER-1D-C7 (containing a downstream sequence of the C7 site homologous to CPER-1) is CPER-C7-F: 5'-GGCCCAGCAACAAAAAAGAAAACA-3', and the downstream primer for CPER-1-R is CPER-1-R: 5'-GCTGTTTCCGGTGCGAAGTC-3'. The upstream primer for the fragment CPER-1U-C28 (containing the upstream sequence of the C28 site homologous to CPER-1) is CPER-1-F: 5'-GCTCGTTTAGTGAACCGTAA-3', and the downstream primer is CPER-C28-R: 5'-GGGCACTATTTTCATTTTC-3'. The upstream primer for fragment CPER-1D-C28 (containing a downstream sequence at the C28 site homologous to CPER-1) is CPER-C28-F: 5'-AAAGAATCTGAAAAAGACAGC-3', and the downstream primer for CPER-1-R is CPER-1-R: 5'-GCTGTTTCCGGTGCGAAGTC-3'.

[0047] 4. Cloning of CPER-1-Cap-C7 and CPER-1-Cap-C28 First, genomic cDNA fragments upstream and downstream of the insertion site and fragments containing the PCV3 Cap-10×His-2A sequence for insertion into the C7 or C28 sites were amplified by PCR (reaction system and procedure as shown in Tables 1 and 2). Specifically, using recombinant plasmid pUC57-CPER-Cap-his as a template, Cap-C7 (fragment length 765 bp) was amplified using primers CPER-C7-Cap-F and CPER-C7-2A-R, and Cap-C28 (fragment length 772 bp) was amplified using primers CPER-C28-Cap-F and CPER-C28-2A-R. Using plasmid pBR322-rBVDV as a template, CPER-1U-C7 (fragment length 919 bp) was amplified using primers CPER-1-F and CPER-C7-R, and CPER-1D-C7 (fragment length 1190 bp) was amplified using primers CPER-C7-F and CPER-1-R. The PCV3 Cap-10×His-2A fragment containing Cap-C7 was amplified using primers CPER-1-F and CPER-C7-R, and CPER-C7-F and CPER-1-R, respectively. The upstream and downstream sequences corresponding to the insertion site C7 in the CPER-1 fragment CPER-1, derived from the parental viral genomic cDNA, were located in fragments CPER-1U-C7 and CPER-1D-C7. Using plasmid pBR322-rBVDV as a template, CPER-1U-C28 (fragment length 982 bp) was amplified using primers CPER-1-F and CPER-C28-R, and CPER-1D-C28 (fragment length 1121 bp) was amplified using primers CPER-1-F and CPER-C28-R, respectively. This means that the PCV3 Cap-10×His-2A fragment containing Cap-C7 was amplified using primers CPER-1-F and CPER-C7-R, and CPER-1D-R, respectively. Cap-10×His-2A corresponds to the upstream and downstream sequences of the insertion site C28 in the CPER-1 fragment CPER-1, namely CPER-1U-C28 and CPER-1D-C28.

[0048] PCR products were electrophoresed on a 1% agarose gel, observed using a gel imaging system, and the target band was excised and purified from the gel. (Using LightNing...) TMDNA Assembly Mix Plus homologous recombinase (Jiangsu Bestway Biotechnology Co., Ltd., catalog number EG21202S) fused Cap-C7, CPER-1U-C7 and CPER-1D-C7, and fused Cap-C28, CPER-1U-C28 and CPER-1D-C28. Then, CPER-1-Cap-C7 (fragment length 2838 bp) and CPER-1-Cap-C28 (fragment length 2838 bp) were amplified by PCR (reaction system and program as in Tables 1 and 2). The DNA bands were purified by agarose gel electrophoresis.

[0049] Taking the fusion and PCR amplification of the full-length CPER-1-Cap-C7 fragment as an example, the specific operation steps are as follows: The purified Cap-C7, CPER-1U-C7, and CPER-1D-C7 are mixed in equimolar amounts (0.03 pmol each) to prepare a 10 μL reaction system (the specific reaction system is shown in Table 3); the reaction system is reacted in a 50℃ metal bath for 20 min, and immediately placed on ice after the reaction is completed; using the homologous recombination reactant as a template, the CPER-1-Cap-C7 fragment is amplified using primers CPER-1-F and CPER-1-R.

[0050] The same procedure can be used to clone the CPER-1-Cap-C28 fragment from purified Cap-C28, CPER-1U-C28, and CPER-1D-C28.

[0051] Table 3. Fragment homologous recombination system

[0052] 5. Design amplification primers for fragments CPER-2-P7, CPER-Cap-P7, and CPER-3-P7. The upstream primer of CPER-2-P7 is CPER-2-F: 5'-GACTTCGCACCGGAAACAGC-3', and the downstream primer is CPER-2-R: 5'-GGCCTTTACCACATCCCCA-3'; The upstream primer of CPER-Cap-P7 (containing the upstream sequence of the P7 site homologous to CPER-3 and the PCV3 Cap-10×His-2A inserted at the P7 site) is CPER-P7-Cap-F: 5'-GATTGGGGATGTGGTAAAGGCCATGAGACACAGAGCTATA-3', and the downstream primer is CPER-P7-2A-R: 5'-TGGCCCCCTGAATCTGGGCCAGGATTCTCCTC-3'. The upstream primer of CPER-3-P7 (containing a downstream sequence of the P7 site homologous to CPER-3) is CPER-3-P7-F: 5'-CCTGGCCCAGATTCAGGGGGCCAAGAG-3', and the downstream primer is CPER-3-R: 5'-CTTCCTATCTCCTCTATAAC-3'.

[0053] 6. Amplification of CPER-2-P7, CPER-Cap-P7, and CPER-3-P7 Using recombinant plasmid pUC57-CPER-Cap-his as a template, CPER-Cap-P7 (fragment length 771 bp) was amplified using primers CPER-P7-Cap-F and CPER-P7-2A-R. This fragment contains the sequence upstream of insertion site P7 in fragment CPER-3, which is amplified from parental viral genomic cDNA, and PCV3 Cap-10×His-2A. Using recombinant plasmid pBR322-rBVDV as a template, CPER-2-P7 (fragment length 1719 bp, identical to CPER-2 sequence) was amplified using primers CPER-2-F and CPER-2-R. CPER-3-P7 (fragment length 2375 bp) was amplified using primers CPER-3-P7-F and CPER-3-R. CPER-3-P7 contains the sequence downstream of insertion site P7 in fragment CPER-3, which is amplified from parental viral genomic cDNA.

[0054] The reaction system and procedure are the same as those in Tables 1 and 2.

[0055] (ii) CPER reaction assembly of circular DNA Three 50 μL reaction systems were prepared, corresponding to the Cap-C7-CPER assembly system, the Cap-C28-CPER assembly system, and the Cap-P7-CPER assembly system, respectively. The Cap-C7-CPER assembly system contained CPER-1-Cap-C7 (this fragment replaces CPER-1 to achieve the insertion of PCV3 Cap-10×His-2A at the C7 site), CPER-2, CPER-3, CPER-4, CPER-5, CPER-6, and CPER-7, each mixed in equimolar amounts (0.1 pmol each). The Cap-C28-CPER assembly system contained CPER-1-Cap-C28 (this fragment replaces CPER-1 to achieve the insertion of PCV3 Cap-10×His-2A at the C28 site), CPER-2, CPER-3, CPER-4, CPER-5, CPER-6, and CPER-7, each mixed in equimolar amounts (0.1 pmol each). The Cap-P7-CPER assembly system comprises CPER-1, CPER-2-P7, CPER-Cap-P7, CPER-3-P7, CPER-4, CPER-5, CPER-6, and CPER-7 (where CPER-Cap-P7 and CPER-3-P7 replace CPER-3 to achieve the insertion of PCV3 Cap-10×His-2A at the P7 site), and each fragment is mixed in equimolar amounts (0.1 pmol each). Taking the Cap-C28-CPER assembly system as an example, the reaction system is prepared according to Table 4, and then the CPER reaction is carried out according to the reaction procedure shown in Table 5. The CPER product is stored at 4°C for later use.

[0056] Table 4. CPER Reaction System

[0057] Table 5. CPER Reaction Procedure

[0058] (III) CPER products rescue chimeric viruses The specific methods for virus removal are as follows: (1) Before transfection, HEK-293T cells (the number of cells used at the time of seeding is 2~3×10) 5 Cells (per well) are seeded into 12-well plates and transfected when the cell confluence reaches approximately 80%. (2) Take a sterile enzyme-free EP tube and quickly add 100 μL of Opti-MEM and 10 μL of CPER product (obtained by the reaction of Cap-C7-CPER assembly system, Cap-C28-CPER assembly system or Cap-P7-CPER assembly system, respectively), and gently mix to dilute the CPER product. (3) Take 2 μL of TransIntro® EL Transfection Reagent (Beijing TransGen Biotech Co., Ltd., catalog number FT201) and quickly add it to the diluted reaction solution, then mix gently. (4) Let stand at room temperature for 15 min; (5) Add all the solution to the well containing HEK-293T cells, mix well and incubate in a 37°C, 5% CO2 incubator; CPER products from three different assembly systems were grouped to complete this step. (6) After transfection, observe the cytopathic effects of each group of cells every day. Change the medium and collect the culture supernatant on the third and fifth days after transfection. Record it as F0 generation chimeric virus. Name the recombinant virus as rBVDV-Cap-C7, rBVDV-Cap-C28 and rBVDV-Cap-P7 respectively. (7) MDBK cells were infected with three chimeric viruses named rBVDV-Cap-C7, rBVDV-Cap-C28 and rBVDV-Cap-P7 respectively, and passaged continuously (passed after 80% of the cells showed obvious lesions).

[0059] (iv) Identification of chimeric virus molecules 1. Design primers for identifying the BVDV-5'UTR fragment. The upstream primer of BVDV-5UTR is BVDV-5UTR-F: 5'-TCGACGCCTTGGAATAAA-3', and the downstream primer is BVDV-5UTR-R: 5'-TCCATGTGCCATGTACA-3'.

[0060] 2. Identification of 5'UTR fragments After rescue, the three chimeric viruses were passaged, and the viral supernatant was collected. RNA was extracted and reverse transcribed to obtain the genomic cDNA of the chimeric viruses. Using the cDNA as a template, the 5'UTR region (fragment length 188 bp) of the virus was identified by PCR using primers BVDV-5UTR-F and BVDV-5UTR-R. At the same time, control groups such as the parental virus (BVDV XZ-N1 strain) were set up.

[0061] The RNA extraction method is as follows: (1) Take a 1.5 mL EP tube, add 400 μL of virus solution and 600 μL of Trizol into it, mix well, and incubate on ice for 30 s; (2) Add 200 μL of chloroform, mix well, let stand on ice for 5 min, and then centrifuge at 12000 rpm for 10 min; (3) Transfer the supernatant to a new 1.5 mL EP tube, add an equal volume of isopropanol, mix by inversion, and place in a -80℃ refrigerator overnight for precipitation; (4) Place the EP tube on ice to thaw, and after thawing, centrifuge at 4°C for 15 min (speed 12000 rpm). (5) After centrifugation, discard the supernatant, add 1 mL of 75% ethanol, gently invert to mix, and centrifuge at 12000 rpm and 4℃ for 5 min. After centrifugation, discard the supernatant. (6) Repeat step 5 above once, then open the EP tube cover and place it in the clean bench to dry; (7) Add 20 μL of DEPC water and mix well to dissolve the precipitate.

[0062] RNA reverse transcription involves using M-MLV reverse transcriptase (Nanjing Novizan Biotechnology Co., Ltd., catalog number R111) to synthesize cDNA strands from extracted RNA in a two-step process.

[0063] The specific methods of reverse transcription are as follows: (1) Take 2 μL (1 μg) of RNA and 1 μL of Random hexamers into a PCR tube and make up the volume to 8 μL. Mix well, centrifuge to collect the reaction solution to the bottom of the tube, and place it in a PCR instrument at 65℃ for 5 min. (2) After the reaction is complete, place the mixture on ice for 2 minutes, add the reaction buffer and reverse transcriptase, mix gently to obtain the reaction system (the specific reaction system is shown in Table 6), and carry out the reaction according to the reaction procedure shown in Table 7.

[0064] Table 6. Reaction System

[0065] Table 7. Reaction Procedure

[0066] 3. PCV3 Cap gene identification Culture supernatants from parental and chimeric viruses infected MDBK cells were collected, RNA was extracted, and cDNA obtained by reverse transcription was used as a template for PCR amplification and electrophoresis using primers CPER-P7-Cap-F and CPER-P7-2A-R. The PCV3 Cap gene (fragment length 771 bp) of the three chimeric viruses was identified.

[0067] (v) Determination of viral titer of chimeric viruses Three chimeric virus cell culture supernatants, after three passages, were collected for TCID testing. 50 The assay involves serially diluting the virus solution and adding it to pre-coated 96-well plates (each dilution of the virus solution forms one column of inoculated cells, with one column serving as a blank control). The plates are then placed in an incubator, and the cytopathic effect is observed. The specific procedure is as follows: (1) Digest MDBK cells and resuspend the cells in 10 mL of complete culture medium. Add the cell suspension to a 96-well plate at a rate of 100 μL / well and incubate at 37°C and 5% CO2. (2) Dilute the virus solution 10-fold sequentially with serum-free culture medium, starting from 10... -1 Dilute to 10 -10 Once the cell density reaches 80%, discard the culture medium, wash the cells twice with PBS, and inoculate the diluted virus solution into the cells according to the dilution factor from low to high. Inoculate one row of 8 wells for each dilution, and inoculate 100 μL into each well. (3) Place the 96-well plate in an incubator at 37°C and 5% CO2 for incubation; (4) After adsorption for 2 h, the virus solution was discarded, the virus was washed twice with PBS, and 1640 maintenance medium containing 2% serum was added and then placed in an incubator at 37℃ and 5% CO2 for 5 consecutive days. (5) Calculate the viral titer using the Reed-Muench method.

[0068] (vi) Western blot identification of chimeric viruses (1) Collect the cell culture supernatant of the three chimeric virus strains after three passages respectively, and inoculate the three chimeric viruses into MDBK cells at MOI=0.1 for 3-5 days. When cell lesions are observed, discard the culture medium, wash twice with PBS, add cell lysis buffer, and incubate on ice for 15 min. Take 10 μL of lysed cells and add protein loading buffer, incubate at 100℃ for 10 min. At the same time, set up a control group of parental virus (BVDV XZ-N1 strain). (2) After centrifugation, SDS-PAGE electrophoresis, membrane transfer and blocking were performed. The specific procedures are as follows: Take 10 μL of protein sample for electrophoresis (110 V for 90 min); after electrophoresis, prepare wet transfer buffer and transfer the target protein onto a PVDF membrane under the conditions of 220 mA for 65 min; prepare blocking buffer containing 5% skim milk powder using PBST. After the transfer operation, place the PVDF membrane containing the desired protein in the blocking buffer and gently shake at room temperature for 2 h to block the non-specific binding sites on the surface of the PVDF membrane.

[0069] (3) Mouse E2 monoclonal antibody (VMRD, catalog number 157, diluted 1:2000), His monoclonal antibody (Beyotime Biotechnology Co., Ltd., catalog number AF2876, diluted 1:8000), and rabbit β-actin monoclonal antibody (Huaan Biotechnology Co., Ltd., catalog number PSH03-63, diluted 1:20000) were used as primary antibodies and incubated overnight at 4°C. The next day, the samples were washed with PBST to remove unbound primary antibodies. Each wash lasted 10 min and was repeated 3 times. HRP-labeled goat anti-mouse IgG (Beyotime Biotechnology Co., Ltd., catalog number A0216, diluted 1:5000) and HRP-labeled goat anti-rabbit IgG (Beyotime Biotechnology Co., Ltd., catalog number A0208, diluted 1:1000) were used as secondary antibodies to detect protein samples. After the secondary antibody incubation, the samples were also washed 3 times with PBST. After washing, the luminescent solution was prepared and the samples were exposed.

[0070] (vii) IFA identification of chimeric viruses (1) Collect the culture supernatant of the three chimeric virus cell lines after three passages; one day in advance, seed the MDBK cells in a 24-well plate, and when the cell density reaches 70%~90%, infect the MDBK cells with the three chimeric viruses according to MOI=0.1, and set up an uninfected cell group (i.e. MOCK); after a certain period of infection, each group is treated in the same way as steps 2 to 8 below; (2) Fixation: Take the cell culture medium, wash twice with PBS, and add 200 μL of 4% paraformaldehyde at room temperature to fix the cells for 15 min; (3) Permeabilization: Wash the cells three times with 100 μL of pre-cooled PBS, and permeabilize the cells for 15 min at room temperature using 0.2% Triton X-100 (prepared with PBS); (4) Blocking: Wash cells with PBS 3 times (5 min each time), blot dry with absorbent paper, add 5% FBS (prepared with PBS), and block at room temperature for 1 h; (5) Primary antibody incubation: Discard the blocking solution, add 100 μL of mouse E2 monoclonal antibody (VMRD, catalog number 157 and diluted 1:400) to each well, and incubate overnight at 4°C in a humidified chamber; (6) Secondary antibody incubation: Wash 3 times with PBS (5 min each time), add fluorescently conjugated goat anti-mouse IgG polyclonal antibody (Huaan Biotechnology Co., Ltd., catalog number HA1126 and diluted at 1:800), incubate at 37°C for 1 h in a humidified chamber, wash 3 times with PBST (5 min each time), and keep out of light throughout the process; (7) Add 500 μL of DAPI to each well and stain at 37℃ for 10 min; (8) Discard the DAPI and observe the 24-well plate under a fluorescence microscope.

[0071] (viii) Establishment of chimeric virus growth curves The supernatant from the parental virus and the three chimeric virus strains after three passages were collected separately. MDBK cells were passaged into 35 mm cell culture dishes one day prior to infection and incubated overnight at 37°C with 5% CO2 until approximately 80% confluence. The following day, the three chimeric virus strains were inoculated at an MOI of 0.1 and incubated at 37°C with 5% CO2 for 1 hour for adsorption, followed by replacement with fresh maintenance medium. Cell culture dishes were collected at 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, and 84 h post-infection and frozen at -80°C. Viral RNA copy number was measured after all samples were collected.

[0072] The method for detecting viral RNA copy number is as follows: RNA was extracted from the collected viral supernatant and reverse transcribed to obtain the genomic cDNA of the chimeric virus. Using the fluorescent quantitative primers RTFQ-E0-F (5'-CATAACACAGTGGAACCTAC-3') and RTFQ-E0-R (5'-CTCACTTGCATCCATCATAC-3'), and with the cDNA obtained by reverse transcription as a template, identification was performed using hot-start DNA polymerase (Nanjing Novizan Biotechnology Co., Ltd., catalog number Q312). The qPCR reaction system used is shown in Table 8, and the reaction procedure is shown in Table 9.

[0073] Table 8. qPCR reaction system

[0074] Table 9. qPCR reaction procedure

[0075] Absolute quantification of qPCR results was performed using standard curves. After SPSS one-way ANOVA and post-hoc tests, growth curves of parental BVDV and rescued BVDV chimeric virus on MDBK cells were plotted using GraphPad Prism.

[0076] (ix) Experimental Results 1. PCR amplification of six fragments containing homologous sequences from the fragmented cloned BVDV genome and a fragment containing the SV40 poly(A) signal-CMV promoter functional sequence. See Figure 1-4 Using the full-length infectious cloning plasmid of BVDV cDNA (i.e., pBR322-rBVDV) as a template, high-fidelity polymerase was used for PCR to amplify the BVDV genomic cDNA into six fragments, obtaining CPER-1, CPER-2, CPER-3, CPER-4, CPER-5, and CPER-6; using plasmid pUC57-CPER-7 as a template, CPER-7 was obtained by PCR amplification. Analysis by 1% agarose gel electrophoresis showed that the band sizes of the amplified products were correct. Each fragment was excised from the gel and recovered, then stored at -20℃ for later use.

[0077] 2. Cloning of CPER-1-Cap-C7 and CPER-1-Cap-C28 See Figure 2 Using the full-length infectious cloning plasmid of BVDV cDNA (i.e., pBR322-rBVDV) as a template, high-fidelity polymerase was used for PCR to amplify four DNA fragments upstream and downstream of the two insertion sites C7 and C28 (i.e., CPER-1U-C7 and CPER-1D-C7, CPER-1U-C28 and CPER-1D-C28). Correspondingly, using pUC57-CPER-Cap-his as a template, high-fidelity polymerase was used for PCR to amplify two fragments carrying PCV3 Cap-10×His-2A sequences with different homologous arms (i.e., Cap-C7 and Cap-C28). The three fragments CPER-1U-C7, CPER-1D-C7, and Cap-C7, and the three fragments CPER-1U-C28, CPER-1D-C28, and Cap-C28 were cloned into two large fragments (CPER-1-Cap-C7 and CPER-1-Cap-C28) using homologous recombination ligation and PCR reaction, respectively. The amplified products were analyzed by 1% agarose gel electrophoresis, and the band size of the amplified products was correct. The two large fragments were excised and recovered from the gel and stored at -20℃ for later use.

[0078] 3. Amplification of CPER-2-P7, CPER-Cap-P7, and CPER-3-P7 See Figure 3Having already amplified CPER-2 (which has the same sequence as CPER-2-P7), the target fragment was amplified using two other pairs of primers. This resulted in three fragments with homologous complementary sequences at their ends: CPER-2-P7, CPER-Cap-P7, and CPER-3-P7. Analysis by 1% agarose gel electrophoresis confirmed that the amplified product bands were the correct size. The fragments were then excised and recovered, and stored at -20°C for later use.

[0079] 4. Rescue of CPER products and BVDV chimeric viruses See Figure 4 The DNA fragments from the three assembly systems, Cap-C7-CPER, Cap-C28-CPER, and Cap-P7-CPER, were prepared into reaction systems at a dosage of 0.1 pmol per fragment and assembled into circular DNA via CPER reaction. The sequence of the circular DNA (referred to as the chimeric virus rBVDV-Cap-C28 recombinant plasmid) composed of the fragments from the Cap-C28-CPER assembly system is as follows (SEQ.ID.NO.1): 5'-GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGT AATTAGAAAAGGCACTCGTATACGTATTGGGCAATTAAAAATAATAATTAGGCCTAGGGAACAAATCCCTCTCA GCGAAGGCCGAAAAGAGGCTAGCCATGCCCTTAGTAGGACTAGCATAATGAGGGGGGTAGCAACAGTGGTGAGTTC GTTGGATGGCTTAAGCCCTGAGTACAGGGTAGTCGTCAGTGGTTCGACGCCTTGGAATAAAGGTCTCGAGATGCCA CGTGGACGAGGGCATGCCCAAAGCACATCTTAACCTGAGCGGGGGTCGCCCAGGTAAAAGCAGTTTTAACCGACTG TTACGAATACAGCCTGATAGGGTGCTGCAGAGGCCCACTGTATTGCTACTAAAAATCTCTGCTGTACATGGCACAT GGAGTTGATCACAAATGAACTTTTATACAAAACATACAAACAAAAACCCGTCGGGGTGGAGGAACCTGTTTATGAT CAGGCAGGTGATCCCTTATTTGGTGAAAGGGGAGCAGTCCACCCTCAATCGACGCTAAAGCTCCCACACAAGAGAG GGGAACGCGATGTTCCAACCAACTTGGCATCCTTACCAAAAAGAGGTGACTGCAGGTCGGGTAATAGCAGAGGACC TGTGAGCGGGATCTACCTGAAGCCAGGGCCACTATTTTACCAGGACTATAAAGGTCCCGTCTATCACAGGGCCCCG CTGGAGCTCTTTGAGGAGGGATCCATGTGTGAAACGACTAAACGGATAGGGAGAGTAACTGGAAGTGACGGAAAGC TGTACCACATTTATGTGTGTATAGATGGATGTATAATAATAAAAAGTGCCACGAGAAGTTACCAAAGGGTGTTCAG GTGGGTCCATAATAGGCTTGACTGCCCTCTATGGGTCACAAGTTGCTCAGACACGAAAGAAGAGGGA (C7 site) G CAACAAAAAAAGAAACACAGAAACCCGACAGACTAGAAGGGGAAATGAAAATAGTGCCC ATGAGACACAGAGC TATATTCAGAAGAGACCCGCCCAAGGAGACGTCGACCCCACAAGGCGCTATGTCAGAAAAAACTATTCATT AGGAGGCCCACAGCTGGCACATACCACAAAAATACTCCACCATGAACGTCATTTCCGTTGGAACCCCTCAGG ATAATAAGCCCTGGCACGCCAACCACTTCATTACCCGCCTAAACGAATGGGAAACTGCAATTAGCTTTGAATTA TAAGATACTAAAGATGAAAGTTACACTCAGCCCTGTAATTTCCGGCGCGGCCAAAAAAACTATGTTCGGGCAC ACAGCCATAGATCTAGACGGCGCCTGGACCAAACACTTGGCTCCAAGACGACCCTATATGCGGAAAGTTCCACTC GGAAAGTAATGACTTCTAAAAAAAAACAGCCGTTACTTCACCCCCAAACCAATTCTGGCGGGAACTACCAGCGC TCACCCAGGACAAAGCCTCTTCTTTTTCTCCAAACCCACCCCATGGCTCAACACATACGACCCCACCGTTCAATGG GGAGCACTGCTTTGGAGCATTTATGTCCCGGAAAAACTGGAATGACACTTCTACGGCACCAAAGAGTTTGGA TTCGTTACAAGTCCGTTCTCCATCATCATCATCACCATCACCACCACCACGGCAGTGGAGAGGGCAGAGGAAGCCT GCTGACATGCGGTGACGTCGAGGAGAATCCTGGCCCA AAAGAATCTGAAAAAAGACAGCAAAACTAAACCTCCGGAT GCTACAATAGTGGTGGAAGGAGTCAAATACCAGGTGAGGAGAAGGGAAAAACCAAGAGTAAAAACACTCAGGACG GCTTGTACCATAACAAAAACAAACCTCAGGAATCACGCAAACTGGAAAAAAGCATTGTTGGCGTGGGCATTA AGCTATAGTTTTGTTTCAGTTACAGGGAGAAAACATAACAGTGGAACCTAAGATAATGGGACGGAAGGG ATACAACGGGCAATGTTCCAAAGGGGTGTGAATAGAAGTTTACATGGAATCTGGCCAGAGAAAATCTGTACTGGTG TCCCTTCCCATCTAGCCACCGATATAGAACTAAAAACAATTCATGGTATGATGGATGCAAGTGAGAAGACCAACTA CACGTGTTGCAGACTTCAACGCCATGAGTGGAACAAGCATGGTTGGTGCAACTGGTACAATATTGAACCCTGGATT CTAGTCATGAATAGAACCCAAGCCAATCTCACTGAGGGACAACCACCAAGGGAGTGCGCAGTCACTTGTAGGTATG ATAGGGCTAGTGACTTAAACGTGGTAACACAAGCTAGAGATAGCCCCACACCCTTAACAGGTTGCAAGAAAGGAAA GAACTTCTCCTTTGCAGGCATATTGACGCGGGGCCCCTGCAACTTTGAAATAGCTGCAAGTGATGTATTATTCAAA GAACATGAATGCACTAGTATGTTCCAGGATACTACTCATTACCTTGTTGACGGGTTGACCAACTCCTTAGAAGGTG CCAGACAAGGAACCGCTAAACTGACAACCTGGTTAGGCAAGCAGCTCGGGATACTAGGAAAAAAGTTGGAAAACAA GAGTAAGACGTGGTTTGGAGCATACGCTGCTTCCCCTTACTGTGATGTCGATCGCAAAATTGGCTACATATGGTAT ACAAAAAATTGCACCCCTGCCTGTTTACCCAAGAACACAAAAATTGTCGGCCCTGGGAAATTTGACACCAATGCAG AGGACGGCAAGATATTACATGAGATGGGGGGTCACTTGTCGGAGGTACTACTACTTTCTTTAGTGGTGCTGTCCGA CTTCGCACCGGAAACAGCTAGTGTAATGTACCTAATCCTACATTTTTCCATCCCACAAAGTCACGTTGATATAATG GATTGTGATAAGACCCAGTTGAACCTCACAGTGGAGCTGACAACAGCTGAAGTAATACCAGGGTCGGTCTGGAATC TAGGCAAATATGTATGCATAAGACCAAATTGGTGGCCTTATGAGACAACTGTAGTGTTGGCATTTGAAGAGGTGAG CCAGGTGGTGAAGTTAGTGTTGAGGGCACTCAGAGATTTAACACGCATTTGGAACGCTGCAACAACTACTGCTTTT TTAGTATGCCTTGTTAAGATAGTCAGGGGCCAGATGGTACAGGGCATTCTGTGGCTACTATTGATAACAGGGGTAC AAGGGCACTTGGATTGCAAACCTGAATTCTCGTATGCCATAGCAAAGGACGAAAGAATTGGTCAACTGGGGGCTGA AGGCCTTACCACCACTTGGAAGGAATACTCACCTGGAATGAAGCTGGAAGACACAATGGTCATTGCTTGGTGCGAA GATGGGAAGTTAATGTACCTCCAAAGATGCACGAGAGAAACCAGATATCTCGCAATCTTGCATACAAGAGCCTTGC CGACCAGTGTGGTATTCAAAAAACTCTTTGATGGGCGAAAGCAAGAGGACGTAGTCGAAATGAACGACAACTTTGA ATTTGGACTCTGCCCATGTGATGCCAAACCCATAGTAAGAGGGAAGTTCAATACAACGCTGCTGAACGGACCGGCC TTCCAGATGGTATGCCCCATAGGATGGACAGGGACTGTAAGCTGTACGTCATTCAATATGGACACCTTAGCCACAA CTGTGGTACGGACATATAGAAGGTCTAAACCATTCCCTCATAGGCAAGGCTGTATCACCCAAAAGAATCTGGGGGA GGATCTCCATAACTGCATCCTTGGAGGAAATTGGACTTGTGTGCCTGGAGACCAACTACTATACAAAGGGGGCTCT ATTGAATCTTGCAAGTGGTGTGGCTATCAATTTAAAGAGAGTGAGGGACTACCACACTACCCCATTGGCAAGTGTA AATTGGAGAACGAGACTGGTTACAGGCTAGTAGACAGTACCTCTTGCAATAGAGAAGGTGTGGCCATAGTACCACA AGGGACATTAAAGTGCAAGATAGGAAAAACAACTGTACAGGTCATAGCTATGGATACCAAACTCGGGCCTATGCCT TGCAGACCATATGAAATCATATCAAGTGAGGGGCCTGTAGAAAAGACAGCGTGTACTTTCAACTACACTAAGACAT TAAAAAATAAGTATTTTGAGCCCAGAGACAGCTACTTTCAGCAATACATGCTAAAAGGAGAGTATCAATACTGGTT TGACCTGGAGGTGACTGACCATCACCGGGATTACTTCGCTGAGTCCATATTAGTGGTGGTAGTAGCCCTCTTAGGT GGCAGATATGTACTTTGGTTACTGGTTACATACATGGTCTTATCAGAACAGAAGGCCTTAGGGATTCAGTATGGAT CAGGGGAAGTGGTGATGATGGGCAACTTGCTAACCCATAACAATATTGAAGTGGTGACATACTTCTTGCTGCTGTA CCTACTGCTTAGGGAGGAGAGCGTAAAGAAGTGGGTCTTACTCTTATACCACATCTTAGTGGTACACCCAATCAAA TCTGTAATTGTGATCCTACTGATGATTGGGGATGTGGTAAAGGCC (P7 site) GATTCAGGGGGCCAAGAGTACTT GGGGCAAATAGACCTCTGTTTTACAACAGTAGTACTAATCGTCATAGGTTTAATCATAGCCAGGCGTGACCCAACT ATAGTGCCACTGGTAACAATAATGGCAGCACTGAGGGTCACTGAATTGACCCACCAGCCTGGAGTTGACATCGCTG TGGCGGTCATGACTATAACCCTACTGATGGTTAGCTATGTGACAGATTATTTTAGATATAAAAAATGGTTACAGTG CATTCTCAGCCTGGTATCTGGGGTGTTCTTGATAAGAAGCCTAATATACCTAGGTAGAATCGAGATGCCAGAGGTA ACTATCCCAAACTGGAGACCACTAACTCTAATACTATTATATTTGATCTCAACAACAATTGTAACGAGGTGGAAGG TTGACGTGGCTGGCCTATTGTTGCAATGTGTGCCTATCTTATTGCTGGTCACAACCTTGTGGGCCGACTTCTTAAC CCTAATACTGATCCTGCCTACCTATGAATTGGTTAAATTATACTATCTGAAAACTGTTAGGACTGATATAGAAAGA AGTTGGCTAGGGGGGATAGACTATACAAGAGTTGACTCCATCTACGACGTTGATGAGAGTGGAGAGGGCGTATATC TTTTTCCATCAAGGCAGAAAGCACAGGGGAATTTTTCTATACTCTTGCCCCTTATCAAAGCAACACTGATAAGTTG CGTCAGCAGTAAATGGCAGCTAATATACATGAGTTACTTAACTTTGGACTTTATGTACTACATGCACAGGAAAGTT ATAGAAGAGATCTCAGGAGGTACCAACATAATATCCAGGTTAGTGGCAGCACTCATAGAGCTGAACTGGTCCATGG AAGAAGAGGAGAGCAAAGGCTTAAAGAAGTTTTATCTATTGTCTGGAAGGTTGAGAAACCTAATAATAAAACATAA GGTAAGGAATGAGACCGTGGCTTCTTGGTACGGGGAGGAGGAAGTCTACGGTATGCCAAAGATCATGACTATAATC AAGGCCAGTACACTGAGTAAGAGCAGGCACTGCATAATATGCACTGTATGTGAGGGCCGAGAGTGGAAAGGTGGCA CCTGCCCAAAATGTGGACGCCATGGGAAGCCGATAACGTGTGGGATGTCGCTAGCAGATTTTGAAGAAAGACACTA TAAAAGAATCTTTATAAGGGAAGGCAACTTTGAGGGTATGTGCAGCCGATGCCAGGGAAAGCATAGGAGGTTTGAA ATGGACCGGGAACCTAAGAGTGCCAGATACTGTGCTGAGTGTAATAGGCTGCATCCTGCTGAGGAAGGTGACTTTT GGGCAGAGTCGAGCATGTTGGGCCTCAAAATCACCTACTTTGCGCTGATGGATGGAAAGGTGTATGATGTCACAGA GTGGGCTGGATGCCAGCGTGTGGGAATCTCCCCAGATACCCACAGAGTCCCTTGTCACATCTCATTTGGTTCACGG ATGCCTTTCAGGCAGGAATACAATGGCTTTGTACAATATACCGCTAGGGGGCAACTATTTCTGAGAAACTTGCCCG TACTGGCAACTAAAGTAAAAATGCTCATGGTAGGCAACCTTGGAGAAGAAATTGGTAATCTGGAACATCTTGGGTG GATCCTAAGGGGGCCTGCCGTGTGTAAGAAGATCACAGAGCACGAAAAATGCCACATTAATATACTGGATAAACTA ACCGCATTTTTTGGGATCATGCCAAGGGGGACTACACCCAGAGCCCCGGTGAGGTTCCCTACGAGCTTACTAAAAG TGAGGAGGGGTCTGGAGACTGGCTGGGCTTACACACACCAAGGCGGGATAAGTTCAGTCGACCATGTAACCGCCGG AAAAGATCTACTGGTCTGTGACAGCATGGGACGAACTAGAGTGGTTTGCCAAAGCAACAACAGGTTGACCGATGAG ACAGAGTATGGCGTCAAGACTGACTCAGGGTGCCCAGACGGTGCCAGATGTTATGTGTTAAATCCAGAGGCCGTTA ACATATCAGGATCCAAAGGGGCAGTCGTTCACCTCCAAAAGACAGGTGGAGAATTCACGTGTGTCACCGCATCAGG CACACCGGCTTTCTTCGACCTAAAAAACTTGAAAGGATGGTCAGGCTTGCCTATATTTGAAGCCTCCAGCGGGAGG GTGGTTGGCAGAGTCAAAGTAGGGAAGAATGAAGAGTCTAAACCTACAAAAATAATGAGTGGAATCCAGACCGTCT CAAAAAACACAGCAGACCTGACCGAGATGGTCAAGAAGATAACCAGCATGAACAGGGGAGACTTCAAGCAGATTAC TTTGGCAACAGGGGCAGGCAAAACCACAGAACTCCCAAAAGCAGTTATAGAGGAGATAGGAAGACACAAGAGAGTA TTAGTTCTTATACCATTAAGGGCAGCGGCAGAGTCAGTCTACCAGTATATGAGATTGAAACACCCAAGCATCTCTT TTAACCTAAGGATAGGGGACATGAAAGAGGGGGACATGGCAACCGGGATAACCTATGCATCATACGGGTACTTCTG CCAAATGCCTCAACCAAAGCTCAGAGCTGCTATGGTAGAATACTCATACATATTCTTAGATGAATACCATTGTGCC ACTCCTGAACAACTGGCAATTATCGGGAAGATCCACAGATTTTCAGAGAGTATAAGGGTTGTCGCCATGACTGCCA CGCCAGCAGGGTCGGTGACCACAACAGGTCAAAAGCACCCAATAGAGGAATTCATAGCCCCCGAGGTAATGAAAGG GGAGGATCTTGGTAGTCAGTTCCTTGATATAGCAGGGTTAAAAATACCAGTGGATGAGATGAAAGGCAATATGTTG GTTTTTGTACCAACGAGAAACATGGCAGTAGAGGTAGCAAAGAAGCTAAAAGCTAAGGGCTATAACTCTGGATACT ATTACAGTGGAGAGGATCCAGCCAATCTGAGAGTTGTGACATCACAATCCCCCTATGTAATCGTGGCTACAAATGC TATTGAATCAGGAGTGACACTACCAGATTTGGACACGGTTATAGACACGGGGTTGAAATGTGAAAAGAGGGTGAGG GTATCATCAAAGATACCCTTCATCGTAACAGGCCTTAAGAGGATGGCCGTGACTGTGGGCGAGCAGGCGCAGCGTA GGGGCAGAGTAGGTAGAGTGAAACCCGGGAGGTATTATAGGAGCCAGGAAACAGCAACAGGGTCAAAGGACTACCA CTATGACCTCTTGCAGGCACAAAGATACGGGATTGAGGATGGAATCAACGTGACGAAATCCTTTAGGGAGATGAAT TACGATTGGAGCCTATACGAGGAGGACAGCCTACTAATAACCCAGCTGGAAATACTAAATAATCTACTCATCTCAG AAGACTTGCCAGCCGCTGTTAAGAACATAATGGCCAGGACTGATCACCCAGAGCCAATCCAACTTGCATACAACAG CTATGAAGTCCAGGTCCCGGTCCTGTTCCCAAAAATAAGGAATGGAGAAGTCACAGACACCTACGAAAATTACTCG TTTCTAAATGCCAGAAAGTTAGGGGAGGATGTGCCCGTGTATATCTACGCTACTGAAGATGAGGATCTGGCAGTTG ACCTCTTAGGGCTAGACTGGCCTGATCCTGGGAACCAGCAGGTAGTGGAGACTGGTAAAGCACTGAAGCAAGTGAC CGGGTTGTCCTCGGCTGAAAATGCCCTACTAGTGGCTTTATTTGGGTATGTGGGTTACCAGGCTCTCTCAAAGAGG CATGTCCCAATGATAACAGACATATATACCATCGAGGACCAGAGACTAGAAGACACCACCCACCTCCAGTATGCAC CCAACGCCATAAAAACCGATGGGACAGAGACTGAACTGAAAGAACTGGCGTCGGGTGACGTGGAAAAAATCATGGG AGCCATTTCAGATTATGCAGCTGGGGGACTGGAGTTTGTTAAATCCCAAGCAGAAAAGATAAAAACAGCTCCTTTG TTTAAAGAAAACGTAGAAGCTGCAAAAGGGTATGTCCAAAAATTCATTGACTCATTAATTGAAAATAAAGAAGAAA TAATCAGATATGGTTTGTGGGGAACACACACAGCACTATACAAAAGCATAGCTGCAAGACTGGGGCATGAAACAGC GTTTGCCACACTAGTGTTAAAGTGGCTAGCTTTTGGAGGGGAATCAGTGTCAGACCACGTCAAGCAGGCGGCAGTT GATTTAGTGGTCTATTATGTGATGAATAAGCCTTCCTTCCCAGGTGACTCCGAGACACAGCAAGAAGGGAGGCGAT TCGTCGCAAGCCTGTTCATCTCCGCACTGGCAACCTACACATACAAAACTTGGAATTACCACAATCTCTCTAAAGT GGTGGAACCAGCCCTGGCTTACCTCCCCTATGCTACCAGCGCATTAAAAATGTTCACCCCAACGCGGCTGGAGAGT GTGGTGATACTGAGCACCACGATATATAAGACATACCTCTCTATAAGGAAGGGGAAGAGTGATGGATTGCTGGGTA CGGGGATAAGTGCAGCCATGGAAATCCTGTCACAAAACCCAGTATCGGTAGGTATATCTGTGATGTTGGGGGTAGG GGCAATCGCTGCGCACAACGCTATTGAGTCCAGTGAACAGAAAAGGACCCTACTTATGAAGGTGTTTGTAAAGAAC TTCTTGGATCAGGCTGCAACAGATGAGCTGGTAAAAGAAAACCCAGAAAAAATTATAATGGCCTTATTTGAAGCAG TCCAGACAATTGGTAACCCCCTGAGACTAATATACCACCTGTATGGGGTTTACTACAAAGGTTGGGAGGTCAAGGA ACTATCTGAGAGGACAGCAGGCAGAAACTTATTCACATTGATAATGTTTGAAGCCTTCGAGTTATTAGGGATGGAC TCACAAGGGAAAATAAGGAACCTGTCCGGAAATTACATTTTGGATTTGATATACGGCCTACACAAGCAAATCAACA GAGGGCTGAAGAAAATGGTACTGGGGTGGGCCCCTGCACCCTTTAGTTGTGACTGGACCCCTAGTGACGAGAGGAT CAGATTGCCAACAGACAACTATTTGAGGGTAGAAACCAGGTGCCCATGTGGCTATGAGATGAAAGCTTTCAAAAAT GTAGGTGGCAAAATTACCAAAGTGGAGGAGAGCGGGCCTTTCCTATGTAGAAACAGACCTGGTAGGGGACCAGTCA ACTACAGAGTCACCAAGTATTACGATGACAACCTCAGAGAGATAAAACCAGTAGCAAAGTTGGAAGGACAGGTAGA GCACTACTACAAAGGAGTCACAGCAAAAATTGACTACAGTAAAGGAAAAATGCTCTTGGCCACTGACAAGTGGGAG GTGGAACATGGTGTCATAACCAGGTTAGCTAAGAGATATACTGGGGTCGGGTTCAATGGTGCATACTTAGGTGACG AGCCCAATCACCGTGCTCTAGTGGAGAGGGACTGTGCAACTATAACCAAAAACACAGTACAGTTTCTAAAAATGAA GAAGGGGTGTGCGTTCACCTATGACCTGACCATCTCCAATCTGACCAGGCTCATCGAACTAGTACACAGGAACAAT CTTGAAGAAAAGGAAATACCCACCGCTACGGTCACCACATGGCTAGCTTACACCTTCGTGAATGAAGACGTAGGGA CTATAAAACCAGTACTAGGAGAGAGAGTAATCCCCGACCCTGTAGTTGATATCAATTTACAACCAGAGGTGCAAGT GGACACGTCAGAGGTTGGGATCACAATAATTGGAAGGGAAACCCTGATGACAACGGGAGTGACACCTGTCTTGGAA AAAGTAGAGCCTGACGCCAGCGACAACCAAAACTCGGTGAAGATCGGGTTGGATGAGGGTGATTACCCAGGGCCTG GAATACAGACACATACACTAACAGAAGAAATACACAACAGGGATGCGAGGCCCTTCATCATGATCCTGGGCTCAAG GAATTCCATATCAAATAGGGCAAAGACTGCTAGAAATATAAATCTGTACACAGGAAATGACCCCAGGGAAATACGA GACTTGATGGCTGCAGGGCGCATGTTAGTAGTAGCACTGAGGGATGTCGACCCTGAGCTGTCTGAAATGGTCGATT TCAAGGGGACTTTTTTAGATAGGGAGGCCCTGGAGGCTCTAAGTCTCGGGCAACCTAAACCGAAGCAGGTTACCAA GGAAGCTGTTAGGAATTTGATAGAACAGAAAAAAGATGTGGAGATCCCTAACTGGTTTGCATCAGATGACCCAGTA TTTCTGGAAGTGGCCTTAAAAAATGATAAGTACTACTTAGTAGGAGATGTTGGAGAGGTAAAAGATCAAGCTAAAG CACTTGGGGCCACGGATCAGACAAGAATTATAAAGGAGGTAGGCTCAAGGACGTATGCCATGAAGCTATCTAGCTG GTTCCTCCAGGCATCAAACAAACAGATGAGTTTAACTCCACTGTTTGAGGAATTGTTGCTACGGTGCCCACCTGCA ACTAAGAGCAACAAGGGGCACATGGCATCAGCTTACCAATTGGCACAGGGTAACTGGGAGCCCCTCGGTTGCGGGG TGCACCTAGGTACAATACCAGCCAGAAGGGTGAAGATACACCCATATGAAGCTTACCTGAAGTTGAAAGATTTCAT AGAAGAAGAAGAGAAGAAACCTAGGGTTAAGGATACAGTAATAAGAGAGCACAACAAATGGATACTTAAAAAAATA AGGTTTCAAGGAAGCCTCAACACCAAGAAAATGCTCAACCCTGGGAAACTATCTGAACAGTTGGACAGGGAGGGGC GCAAGAGGAACATCTACAACCACCAGATTGGTACTATAATGTCAAGTGCAGGCATAAGGCTGGAGAAATTGCCAAT AGTGAGGGCCCAAACCGACACCAAAACCTTTCATGAGGCAATAAGAGATAAGATAGACAAGAGTGAAAACCGGCAA AATCCAGAATTGCACAACAAATTGTTGGAGATTTTCCACACGATAGCCCAACCCGCCCTGAAACACACCTACGGTG AGGTGACGTGGGAGCAACTTGAGGCGGGGATAAATAGAAAGGGGGCAGCAGGCTTCCTGGAGAAGAAGAACATCGG AGAAGTATTGGATTCAGAAAAGCACCTGGTAGAACAATTGGTCAGGGATCTGAAGGCTGGGAGAAAGATAAAATAT TATGAAACTGCAATACCAAAAAATGAGAAGAGAGATGTCAGTGATGACTGGCAGGCAGGGGACCTGGTGGTTGAGA AGAGGCCAAGAGTTATCCAATACCCTGAAGCCAAGACAAGGCTAGCCATCACTAAGGTCATGTATAACTGGGTGAA ACAGCAGCCCGTTGTGATTCCAGGATATGAAGGAAAGACCCCCTTGTTCAACATCTTTGATAAAGTGAGAAAGGAA TGGGACTTGTTCAATGAGCCAGTGGCCGTAAGTTTTGACACCAAAGCCTGGGACACTCAAGTGACTAGTAAGGATC TGCAACTTATTGGAGAAATCCAGAAATATTACTATAAGAAGGAGTGGCACAAGTTCATTGACACCATCACCGACCA CATGACAGAAGTACCAGTTATAACAGCAGATGGTGAAGTATATATAAGAAATGGGCAGAGAGGGAGCGGCCAGCCA GACACAAGTGCTGGCAACAGCATGTTAAATGTCCTGACAATGATGTACGCCTTCTGCGAAAGCACAGGGGTACCGT ACAAGAGTTTCAACAGGGTGGCAAGGATCCACGTCTGTGGGGATGATGGCTTCTTAATAACTGAAAAAGGGTTAGG GCTGAAATTTGCTAACAAAGGGATGCAGATTCTTCATGAAGCAGGCAAACCTCAGAAGATAACGGAAGGGGAAAAG ATGAAAGTTGCCTATAGATTTGAGGATATAGAGTTCTGTTCTCATACCCCAGTCCCTGTTAGGTGGTCCGACAACA CCAGTAGTCACATGGCCGGGAGAGACACCGCTGTGATACTATCAAAGATGGCAACAAGATTGGATTCAAGTGGAGA GAGGGGTACCACAGCATATGAAAAAGCGGTAGCCTTCAGTTTCTTGCTGATGTATTCCTGGAACCCGCTTGTTAGG AGGATTTGCCTGTTGGTCCTTTCGCAACAGCCAGAGACAGACCCATCAAAACATGCCACTTATTATTACAAAGGTG ATCCAATAGGGGCCTATAAAGATGTAATAGGTCGGAATCTAAGTGAACTGAAGAGAACAGGCTTTGAGAAATTGGC AAATCTAAACCTAAGCCTGTCCACGTTGGGGATCTGGACTAAGCACACAAGCAAAAGAATAATTCAGGACTGTGTT GCCATTGGGAAAGAAGAGGGCAACTGGCTAGTTAACGCCGACAGGCTGATATCCAGCAAAACTGGCCACTTATACA TACCTGATAAAGGCTTTACATTACAAGGAAAGCATTATGAGCAACTGCAGCTAAGAACAGAGACAAACCCGGTCAT GGGGGTTGGGACTGAGAGATACAAGTTAGGTCCCATAGTCAATCTGCTGCTGAGAAGGTTGAAAATTCTGCTCATG ACGGCCGTCGGCGTCAGCAGCTGAGACAAAATGTATATATTGTAAATAAATTAATCCATGTACATAGTGTATATAA ATATAGTTGGGACCGTCCACCTCAAGAAGACGACACGCCCAACACGCACAGCTAAACAGTAGTTAAGATTATCTAC CTCAAGATAACACTACATTTAATGCACACAGCACTTTAGCTGTATGAGGATACGCCCGACGTCTATAGTTGGACTA GGGAAGACCTCTAACAGCCCGGCCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGGCTGGGCAACATTCCGAGGGGACCGTCCCCTCGGTAATGGCGAATGGGACTAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGGTGATGCTATTGCTTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTGGCCTAACTTAA-3' The above sequence contains, in sequence, the CMV promoter, chimeric viral DNA, hepatitis D virus ribozyme sequence, and SV40 poly(A) signal sequence; the underlined part is the chimeric viral DNA, the italic part is the heterologous antigen expression unit inserted into the parental viral genome cDNA (specifically PCV3 Cap-10×His-2A), and the bolded part is the 3 bases upstream and downstream of the insertion site.

[0080] The reaction product containing the circular DNA obtained by CPER circularization (i.e., the CPER product) was then transfected into HEK-293T cells. The cell culture supernatant collected on day 5 post-transfection was the F0 generation chimeric virus, which showed no significant pathological changes in HEK-293T cells. Since BVDV cannot infect HEK-293T cells under natural conditions, the F0 generation chimeric virus was further inoculated into MDBK cells and passaged. See also... Figure 5 The results showed that MDBK cells inoculated with F0 generation chimeric viruses exhibited CPE after 60 h of culture (Note: normally cultured blank control MDBK cells showed good growth and no pathological changes). These results indicate that the CPER product can successfully rescue three BVDV chimeric viruses carrying the PCV3 Cap gene at different sites (the three chimeric viruses were named rBVDV-Cap-C7, rBVDV-Cap-C28, and rBVDV-Cap-P7, respectively), and these three chimeric viruses can induce CPE in MDBK cells.

[0081] 5. Identification of BVDV chimeric viruses See Figure 6Third-generation chimeric virus samples were collected, and RNA was extracted for identification by RT-PCR. Electrophoresis results showed that in the genomic cDNA samples of the parent virus and the three chimeric viruses, a specific band of 188 bp could be amplified using primers BVDV-5UTR-F and BVDV-5UTR-R; however, when amplified using primers CPER-P7-Cap-F and CPER-P7-2A-R, only the genomic cDNA samples of the three chimeric viruses yielded a 771 bp PCV3 Cap gene fragment.

[0082] See Figure 7 Parental viruses and third-generation chimeric viruses were inoculated into MDBK cells at an MOI of 0.1, and cell samples were detected using E2 protein antibody and His protein tag antibody, respectively. The results showed that the three chimeric viruses could proliferate in MDBK cells and successfully express BVDV E2 protein and PCV3 Cap protein, indicating that the three chimeric viruses could efficiently express antigens (referring to PCV3 Cap protein) using BVDV as a vector after infection.

[0083] See Figure 8 To further verify viral protein expression, immunofluorescence was performed on three chimeric viruses. Specifically, third-generation chimeric viruses were used to infect MDBK cells at an MOI of 0.1, and the expression of E2 protein in the cells was detected 60 h after infection. The results showed that all three chimeric viruses expressed BVDV E2 protein, which appeared as green fluorescence surrounding a blue cell nucleus under a fluorescence microscope, indicating that the three chimeric viruses retained the infectivity and replication ability of their parent viruses.

[0084] 6. Preliminary evaluation of the growth characteristics of BVDV chimeric virus See Figure 9 Three chimeric viruses (generation 3) were inoculated into MDBK cells at an MOI of 0.1. Cell culture supernatant samples were collected at seven time points: 12 h, 24 h, 36 h, 48 h, 60 h, 72 h, and 84 h. RT-qPCR results showed that the three chimeric viruses had similar viral replication levels. Western blot analysis of cell samples at 48 h and 72 h showed that the BVDV E2 protein expression levels of the three chimeric viruses were comparable at both 48 h and 72 h. Therefore, it can be concluded that chimeric viruses constructed by inserting the PCV3 Cap gene into the C7, C28, and P7 sites of the BVDV genome possess the same growth characteristics.

[0085] See also: Figure 10Viral RNA was extracted from frozen samples of three chimeric viruses at passages 6, 7, 8, 9, and 10. RT-PCR was performed using primers BVDV-5UTR-F and BVDV-5UTR-R, and all three amplified a 188 bp BVDV XZ-N1 strain-specific gene fragment, indicating that the three chimeric viruses can be stably passaged in MDBK cells and exhibit efficient replication ability.

[0086] The above results also indicate that the chimeric virus constructed using the three heterologous antigen gene insertion sites of C7, C28, and P7 and the BVDV parent virus as the original seed strain for a live vector vaccine to prevent PCV3 infection can be used to evaluate its production performance for large-scale amplification on inoculated cells.

Claims

1. A BVDV chimeric virus recombinant plasmid, characterized in that: The chimeric viral recombinant plasmid includes a transcription unit comprising chimeric viral DNA, which is BVDV genomic cDNA with an inserted heterologous antigen expression unit; wherein the heterologous antigen expression unit includes a heterologous antigen gene sequence encoding a PCV3 Cap protein or a PCV3 Cap protein antigenic epitope co-expressed with BVDV protein, and the insertion site of the heterologous antigen expression unit is selected from one or more BVDV genomic sites as shown in b1-b3 below: (b1) The C7 site is the codon between the 7th and 8th amino acids in the coding region of the BVDV C protein; (b2) The C28 site is the codon between the 28th and 29th amino acids in the coding region of the BVDV C protein; (b3) P7 site, located between the coding regions of BVDV p7 protein and NS2 protein.

2. The BVDV chimeric virus recombinant plasmid according to claim 1, characterized in that: The heteroantigen expression unit also includes a tag sequence fused with the heteroantigen gene sequence.

3. The BVDV chimeric virus recombinant plasmid according to claim 1, characterized in that: The heteroantigen expression unit also includes a 2A peptide sequence, which is linked to a BVDV genomic cDNA sequence downstream of the insertion site.

4. The BVDV chimeric virus recombinant plasmid according to claim 1, characterized in that: The transcription unit also includes a promoter, a hepatitis D virus ribozyme sequence, and a poly(A) signal sequence, wherein the hepatitis D virus ribozyme sequence is arranged between the chimeric viral DNA and the poly(A) signal sequence.

5. The BVDV chimeric virus recombinant plasmid according to claim 1, characterized in that: The chimeric virus recombinant plasmid was constructed using a cyclic polymerase extension reaction.

6. The BVDV chimeric virus recombinant plasmid according to claim 1, characterized in that: The BVDV mentioned is strain BVDVXZ-N1.

7. A method for constructing a BVDV chimeric virus recombinant plasmid, characterized in that: Includes the following steps: 1) Design primers that can both clone fragments of BVDV genomic cDNA by PCR amplification and assemble and restore the sequence of the BVDV genomic cDNA by circular polymerase extension reaction. 2) Based on the selected insertion site of the heterologous antigen expression unit and the sequence matching relationship between the insertion site and the amplified fragment in step 1, clone one or more replacement fragments with homologous sequences to the amplified fragment containing the insertion site for each insertion site, and one of the replacement fragments contains a heterologous antigen expression unit located at the insertion site, wherein the heterologous antigen expression unit includes a heterologous antigen gene sequence encoding a PCV3 Cap protein or a PCV3 Cap protein antigenic epitope co-expressed with BVDV protein; wherein the insertion site is selected from one or more BVDV genomic sites as shown in b1-b3 below: (b1) The C7 site is the codon between the 7th and 8th amino acids in the coding region of the BVDV C protein; (b2) The C28 site is the codon between the 28th and 29th amino acids in the coding region of the BVDV C protein; (b3) P7 site, located between the coding regions of BVDV p7 protein and NS2 protein; 3) Perform a circular polymerase extension reaction on all the replacement fragments, the corresponding fragments amplified by the primers corresponding to the other amplified fragments in step 1 (excluding the replaced fragments), and the functional fragments containing the poly(A) signal sequence and promoter to obtain the BVDV chimeric virus recombinant plasmid.

8. A BVDV chimeric virus expressing PCV3 antigen, characterized in that: The genome of this chimeric virus includes the genome of BVDV and transcripts of heterologous antigen expression units inserted into the genome of BVDV; wherein the heterologous antigen expression unit includes a heterologous antigen gene sequence encoding a PCV3 Cap protein or a PCV3 Cap protein antigenic epitope co-expressed with BVDV protein, and the insertion site of the heterologous antigen expression unit is selected from one or more BVDV genomic sites as shown in b1 to b3 below: (b1) The C7 site is the codon between the 7th and 8th amino acids in the coding region of the BVDV C protein; (b2) The C28 site is the codon between the 28th and 29th amino acids in the coding region of the BVDV C protein; (b3) P7 site, located between the coding regions of BVDV p7 protein and NS2 protein.

9. A method for preparing a BVDV chimeric virus expressing PCV3 antigen, characterized in that: Includes the following steps: Virus rescue was performed by transfecting cells with the BVDV chimeric virus recombinant plasmid as described in any one of claims 1 to 6.

10. The method for preparing a BVDV chimeric virus expressing PCV3 antigen according to claim 9, characterized in that: The chimeric virus recombinant plasmid was constructed using a circular polymerase extension reaction. The resulting circular polymerase extension reaction product was transfected into HEK-293T cells and cultured for a period of time to rescue the primary generation of BVDV chimeric virus. The primary generation of BVDV chimeric virus was then inoculated into BVDV host cells and passaged to obtain a stably proliferating BVDV chimeric virus strain.

Citation Information

Patent Citations

  • Porcine BVDV (Bovine Viral Diarrhea Virus) recombinant virus for expressing porcine epidemic diarrhea virus (PEDV) S genes and application

    CN108611329A

  • Method for rapidly rescuing bovine coronavirus epidemic strain and application thereof

    CN121046331A