A methylation detection pretreatment kit and method for protecting DNA integrity

Abstract

The present application relates to the field of biotechnology and molecular diagnosis, and particularly relates to a methylation detection pretreatment kit and method for protecting DNA integrity, which can solve the problem that DNA degradation is serious in traditional bisulfite conversion technology, and conversion efficiency and DNA integrity are difficult to be obtained simultaneously, the kit comprises a conversion solution, a protection solution, a combination solution, a desulfonation solution, a washing solution and an elution solution, the conversion solution contains 2.5-4 mol / L bisulfite and linear polyethylene polyamine, the protection solution contains an organic denaturant and a polyphenol antioxidant, the DNA melting temperature is reduced by the organic denaturant, the linear polyethylene polyamine accelerates the conversion reaction, and the desulfonation system with low water activity is combined to complete the bisulfite conversion under mild conditions of 50-70 DEG C; the present application can realize the conversion efficiency of greater than 99.5% of unmethylated cytosine, greatly reduce DNA degradation, significantly improve the long fragment DNA recovery rate and the detection sensitivity of trace samples, and is suitable for the methylation detection of three generations of long read sequencing and clinical trace samples.

Description

Technical Field

[0001] This invention relates to the fields of biotechnology and molecular diagnostics, specifically a methylation detection pretreatment kit and method that protects DNA integrity. Background Technology

[0002] DNA methylation is an important epigenetic modification, achieved by adding methyl groups to cytosine bases in DNA. This modification typically occurs at CpG sites and can regulate various cellular physiological functions by modulating gene expression. During the development of diseases such as cancer, genome-wide DNA methylation levels can become disordered. Abnormal methylation in certain gene promoter regions can lead to the silencing of tumor suppressor genes. Therefore, accurate detection of DNA methylation sites is crucial for basic scientific research in epigenetics and clinical diagnostic applications such as tumor marker detection. Currently, bisulfite conversion is the recognized gold standard for DNA methylation detection. This method utilizes bisulfite ions to deaminate unmethylated cytosine in DNA into uracil, while methylated cytosine does not undergo this conversion. Thus, during subsequent PCR amplification and sequencing, uracil is recognized as thymine, and methylated cytosine is still recognized as cytosine, thereby achieving precise differentiation of methylation sites. Based on this principle, several mature detection technologies have been developed, such as methylation-specific PCR and bisulfite sequencing, which have been widely used in basic epigenetic research and clinical molecular diagnostics. Although some existing technologies have attempted to use enzymatic conversion methods, such as the TET enzyme method, to differentiate methylation sites, the bisulfite chemical conversion method still has irreplaceable advantages and a dominant position in terms of detection cost and method universality.

[0003] However, traditional bisulfite conversion technology faces serious DNA degradation problems and is known in the industry as destructive detection. Its core defect stems from the combined effects of multiple factors: to open the DNA double helix and expose the cytosine sites to be reacted, traditional methods require a high-temperature denaturation step above 95°C. This process easily leads to the shedding of purine groups from the DNA, i.e., depurination, which in turn causes the breakage of DNA phosphodiester bonds. At the same time, traditional methods rely on high concentrations of bisulfite (greater than 5 mol / L) to drive the deamination reaction, and the high ionic strength reaction environment further aggravates the physical damage to DNA. In addition, the sulfite free radicals generated during the conversion reaction attack the DNA backbone structure, leading to random breaks in the DNA strands. The combined effect of these factors results in low recovery rates and severely limited amplifiable fragment lengths in DNA treated by traditional methods. For a long time, the bisulfite chemical conversion method has faced the technical challenge of balancing conversion efficiency and DNA integrity. Existing improvement strategies have two major limitations. First, simply adding free radical scavengers such as hydroquinone and vitamin E can only partially alleviate oxidative damage and cannot solve the problems of depurination and subsequent phosphate backbone hydrolysis caused by high-temperature acidic environments. The average fragment length of the treated DNA is still less than 500 bp, which cannot meet the long read detection requirements of third-generation sequencing. Second, simply pursuing reaction rate by adding polyamines or quaternary ammonium salts is still limited to shortening the reaction time at high temperatures above 90°C. This approach fails to change the thermodynamic dependence of DNA double-strand denaturation on high temperatures and therefore cannot fundamentally solve the core problem of DNA thermal degradation. Developing a technology that can achieve breakthroughs from both thermodynamic (mild denaturation) and reaction kinetic (low-temperature acceleration) dimensions, and achieve efficient conversion while completely preserving long DNA fragments under mild conditions of low temperature and low salt, is a technical need that urgently needs to be addressed in this field. Summary of the Invention

[0004] The purpose of this invention is to provide a methylation detection pretreatment kit and method that protects DNA integrity, in order to solve the problems mentioned in the background art.

[0005] To achieve the above objectives, the present invention provides the following technical solution: A DNA integrity-preserving methylation detection pretreatment kit includes a transformation buffer, a binding buffer, a desulfonating buffer, a washing buffer, and an elution buffer. The kit further includes a protective buffer. The transformation buffer contains bisulfite and linear polyethylene polyamine. The protective buffer contains an organic denaturant and a polyphenolic antioxidant. The desulfonating buffer contains an alkali metal hydroxide and an alcohol solvent.

[0006] As a further aspect of the present invention: the concentration of bisulfite in the conversion solution is 2.5-4 mol / L; The bisulfite is selected from one or more of ammonium bisulfite, sodium bisulfite, and potassium bisulfite.

[0007] As a further aspect of the present invention: the linear polyethylene polyamine has the general formula H2N-(CH2CH2-NH) n Linear compounds of -H, where n is an integer from 1 to 5; The linear polyethylene polyamine exists in the form of a free base or its acid addition salt; the concentration of the linear polyethylene polyamine in the conversion solution is 0.01-0.5 mol / L.

[0008] As a further aspect of the present invention: the organic denaturant is selected from sulfolane or propylene carbonate, and the final concentration of the organic denaturant in the conversion reaction system is 10%-35% (v / v). The polyphenolic antioxidant is 3,4,5-trihydroxybenzoic acid, and the final concentration of the polyphenolic antioxidant in the conversion reaction system is 0.1-10 mg / mL.

[0009] As a further aspect of the present invention: the concentration of alkali metal hydroxide in the desulfurization solution is 0.05-0.8 mol / L, and the alkali metal hydroxide is selected from one or more of sodium hydroxide, potassium hydroxide, and lithium hydroxide; The volume fraction of alcohol solvent in the desulfurization solution is 85%-95% (v / v), and the alcohol solvent is selected from one or more of methanol, ethanol, and isopropanol.

[0010] A method for pretreatment of DNA to protect DNA integrity in methylation detection includes the steps of converting the DNA sample to be transformed with bisulfite, binding purification, desulfonation, washing and elution recovery, using the kit described above, and specifically includes the following steps: S1: Preparation of the transformation reaction system: Mix the DNA sample to be transformed with the transformation solution and the protection solution to obtain a homogeneous transformation reaction system; S2: Mild conversion: The conversion reaction system is incubated at a constant temperature of 50-70℃ to complete the bisulfite conversion reaction; S3: Binding and purification: Add binding solution to the system after the transformation reaction is completed, mix well, and then make the mixture fully contact the solid-phase adsorption carrier so that the DNA is adsorbed on the solid-phase adsorption carrier and remove the waste liquid. S4: Desulfonation treatment: Add desulfonation solution to the solid-phase adsorption carrier containing DNA to complete the desulfonation reaction; S5: Washing and elution: The solid-phase adsorption carrier that has undergone desulfonation treatment is washed with washing liquid, and then the DNA adsorbed on the solid-phase adsorption carrier is eluted and recovered with elution liquid to obtain a DNA template for methylation detection.

[0011] As a further aspect of the present invention: the concentration of bisulfite in the conversion solution is 2.5-4 mol / L, and the bisulfite is selected from one or more of ammonium bisulfite, sodium bisulfite, and potassium bisulfite; The linear polyethylene polyamine has the general formula H2N-(CH2CH2-NH). n The linear compound of -H, wherein n is an integer from 1 to 5, the linear polyethylene polyamine exists in the form of a free base or its acid addition salt, and the concentration of the linear polyethylene polyamine in the conversion solution is 0.01-0.5 mol / L.

[0012] As a further aspect of the present invention: the final concentration of the organic denaturant in the conversion reaction system is 10%-35% (v / v), and the organic denaturant is selected from sulfolane or propylene carbonate; The final concentration of the polyphenolic antioxidant in the conversion reaction system is 0.1-10 mg / mL, and the polyphenolic antioxidant is 3,4,5-trihydroxybenzoic acid; The concentration of alkali metal hydroxide in the desulfurization solution is 0.05-0.8 mol / L, and the alkali metal hydroxide is selected from one or more of sodium hydroxide, potassium hydroxide, and lithium hydroxide. The volume fraction of alcohol solvent in the desulfurization solution is 85%-95% (v / v), and the alcohol solvent is selected from one or more of methanol, ethanol, and isopropanol.

[0013] As a further aspect of the present invention: in step S2, the constant temperature incubation time is 60-120 min; in step S4, the desulfurization reaction is carried out at room temperature for 10-20 min.

[0014] As a further aspect of the present invention, the solid-phase adsorption carrier is a nucleic acid adsorption column or a nucleic acid purification magnetic bead.

[0015] Compared with the prior art, the beneficial effects of the present invention are: This invention fundamentally solves the problem of severe DNA degradation caused by high temperature, high salt, strong oxidation, and alkaline hydrolysis in traditional methods through the synergistic effects of multiple dimensions, including mild double-strand denaturation mediated by organic denaturants, accelerated reaction kinetics mediated by linear polyethylene polyamine, metal chelation and free radical scavenging by polyphenolic antioxidants, and inhibition of alkaline hydrolysis and strand breaking by a low water activity desulfonation system. Experimental data show that the average fragment length of DNA treated by this invention can reach over 1000 bp, significantly better than the effect of traditional kits treating fragments less than 500 bp. It is particularly suitable for third-generation sequencing applications with extremely high requirements for DNA integrity, such as Nanopore and PacBio sequencing, as well as for the detection of methylation of trace amounts of cfDNA. The synergistic protection system of this invention significantly reduces DNA loss and degradation throughout the transformation process, resulting in a significant improvement in the recovery rate of trace cfDNA samples as low as 1 ng. In clinical sample testing with extremely low input volumes, the kit of this invention can achieve higher effective template recovery, while the standard deviation of the Ct value of the test results is smaller. It also exhibits better detection uniformity and repeatability under trace sample conditions, providing a more reliable pretreatment basis for clinical testing of trace DNA methylation, such as liquid biopsy. By introducing an organic denaturant and linear polyethylene polyamine, this invention overcomes the technical bias that "bisulfite conversion efficiency depends on high-temperature and high-concentration reaction conditions." Under milder conditions—reducing the working concentration of bisulfite from the traditional greater than 5 mol / L to 2.5-4 mol / L and the reaction temperature from the traditional greater than 90℃ to 50-70℃—it still maintains a greater than 99.5% C→U conversion efficiency for unmethylated cytosine, truly achieving a balance between conversion completeness and DNA template integrity. Furthermore, the kit of this invention maintains good conversion consistency and detection accuracy within a relatively wide bisulfite concentration range of 2.5-4.0 mol / L, and is stably adaptable to the detection of various types of biological samples such as clinical urine and plasma, fully meeting the requirements for conversion stability in in vitro diagnostic scenarios. Attached Figure Description

[0016] Figure 1 This is a schematic diagram of agarose gel electrophoresis in an embodiment of the present invention. Detailed Implementation

[0017] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0018] The specific implementation of the present invention will be described in detail below with reference to specific embodiments.

[0019] Please see Figure 1 This invention provides a methylation detection pretreatment kit and method that protects DNA integrity. The kit is based on a synergistic protection system to achieve bisulfite conversion of DNA, which can achieve efficient conversion of unmethylated cytosine under mild conditions, while significantly reducing DNA degradation during the conversion process. It is particularly suitable for long-fragment methylation sequencing and methylation detection of trace samples where DNA integrity is extremely important.

[0020] I. Sample Pretreatment Kit for DNA Methylation Detection The kit includes conversion solution, protection solution, binding solution, desulfonation solution, washing solution, and elution solution, and can also be used with a solid-phase adsorption carrier.

[0021] 1. Conversion solution The conversion solution contains bisulfite and linear polyethylene polyamine.

[0022] The bisulfite refers to the salt that can provide bisulfite ions (HSO3) in the conversion reaction system. - The bisulfite is a salt compound, including its hydrates, mixed salts, or combinations thereof. In some embodiments, the bisulfite is selected from one or more of ammonium bisulfite, sodium bisulfite, and potassium bisulfite; in a preferred embodiment, the bisulfite is ammonium bisulfite. In the conversion reaction system, the concentration of the bisulfite is 2.5-4 mol / L; this concentration range, compared to conventional high-concentration systems greater than 5 mol / L, can reduce the physical damage to DNA caused by high ionic strength, while ensuring efficient deamination of unmethylated cytosine.

[0023] The linear polyethylene polyamine has a linear main chain structure and the general formula H2N-(CH2CH2-NH). n The compound is a -H compound, where n is an integer from 1 to 5; the linear polyethylene polyamine exists as a free base or its acid addition salt, including but not limited to hydrochloride, sulfate, phosphate, acetate, or methanesulfonate. In the conversion reaction system, the concentration of the linear polyethylene polyamine is 0.01-0.5 mol / L; the linear polyethylene polyamine can improve the conversion rate of unmethylated cytosine to uracil by providing a suitable reaction microenvironment, thereby maintaining high conversion efficiency at lower reaction temperatures and avoiding DNA degradation caused by high-temperature reactions.

[0024] The conversion solution was prepared using nuclease-free water and then sterilized by filtration through a 0.22 μm filter membrane.

[0025] 2. Protective fluid The protective liquid contains organic denaturants and polyphenolic antioxidants.

[0026] In some embodiments, the organic denaturant is selected from sulfolane or propylene carbonate; in the transformation reaction system, the final concentration of the organic denaturant is 10%-35% (v / v). The organic denaturant can disrupt the base stacking forces of DNA, significantly reducing the DNA melting temperature (Tm), allowing the DNA double helix structure to remain in a single-stranded open state at a mild temperature of 50-70°C, eliminating the need for the high-temperature denaturation step above 95°C in traditional methods. From a thermodynamic perspective, this avoids the problems of DNA thermal degradation, depurination, and phosphodiester bond breakage caused by high temperatures.

[0027] In some embodiments, the polyphenolic antioxidant is 3,4,5-trihydroxybenzoic acid; in the conversion reaction system, the final concentration of the polyphenolic antioxidant is 0.1-10 mg / mL. 3,4,5-trihydroxybenzoic acid can scavenge sulfite free radicals generated during the conversion reaction, while simultaneously chelating metal ions in the system, thus blocking random DNA strand breaks caused by oxidation at the source and further protecting DNA integrity.

[0028] After the protective solution is prepared, it is filtered through a 0.22μm filter membrane for sterilization and stored at 4℃ in the dark.

[0029] 3. Binding fluid The binding solution is a buffer solution containing a high concentration of ionizing salt, a nonionic surfactant, and an alcoholic organic solvent. The ionizing salt can disrupt the hydration layer of DNA, promoting the binding of DNA to the solid-phase adsorption carrier; the nonionic surfactant can reduce the surface tension of the system, reducing non-specific DNA adsorption; and the alcoholic organic solvent can maintain the binding state of DNA to the solid-phase adsorption carrier, ensuring efficient DNA recovery.

[0030] 4. Desulfurization solution The desulfurization solution contains alkali metal hydroxides and high-concentration alcohol solvents to create an alkaline environment with low water activity.

[0031] In some embodiments, the concentration of the alkali metal hydroxide in the desulfonation solution is from 0.05 mol / L to 0.8 mol / L, preferably from 0.1 mol / L to 0.3 mol / L; the alkali metal hydroxide is selected from one or more of sodium hydroxide, potassium hydroxide, and lithium hydroxide, and is used to provide the alkaline environment required to drive the sulfonic acid group elimination reaction.

[0032] In some embodiments, the volume fraction of the alcohol solvent in the desulfonation solution is 85%–95% (v / v), preferably 90%–95% (v / v); the alcohol solvent is selected from one or more of methanol, ethanol, and isopropanol, preferably ethanol and / or isopropanol. High concentrations of alcohol solvent can significantly reduce the water activity of the system, minimizing the hydrolysis and breakage of the DNA phosphate backbone during the alkaline desulfonation reaction, and avoiding secondary degradation of DNA during the desulfonation step.

[0033] 5. Washing solution and elution solution The washing solution is a buffer solution containing buffer and alcohol, used to rinse and remove residual salts, organic matter and other impurities adsorbed on the solid-phase adsorption carrier, so as to avoid impurities interfering with subsequent PCR amplification, sequencing and other reactions.

[0034] The elution buffer is a low-salt buffer solution used to elute and recover the transformed DNA adsorbed on the solid-phase adsorption support, obtaining a DNA template that can be directly used for downstream methylation detection.

[0035] 6. Solid-phase adsorption carrier In some embodiments, the kit is also equipped with a solid-phase adsorption carrier, which is a nucleic acid adsorption column or nucleic acid purification magnetic beads, for the purification and recovery of DNA after transformation.

[0036] II. Instructions for using the reagent kit The present invention also provides a method for using the above-mentioned sample pretreatment kit for DNA methylation detection, comprising the following steps: Step 1, Preparation of the transformation reaction system: Mix the DNA sample to be transformed with the transformation buffer and the protection buffer to obtain a homogeneous transformation reaction system. The operation is performed in a nuclease-free clean environment, and all consumables used are nuclease-free disposable supplies.

[0037] Step 2, Mild Conversion: The conversion reaction system prepared in Step 1 is placed under constant temperature conditions of 50-70℃ for thermal incubation to complete the bisulfite conversion reaction.

[0038] During this reaction, the organic denaturing agent in the protective solution reduces the stability of the DNA double helix, allowing the DNA to remain in a single-stranded open state at a mild temperature of 50-70°C, exposing the cytosine sites to be reacted; the linear polyethylene polyamine in the transformation solution accelerates the sulfonation and deamination reactions of unmethylated cytosine, enabling unmethylated cytosine to be efficiently converted into uracil, while methylated cytosine does not undergo transformation.

[0039] This step eliminates the need for high-temperature denaturation above 95°C required in traditional methods and reduces the concentration of bisulfite used, fundamentally reducing DNA degradation caused by high temperature, high salt, and oxidation reactions. While ensuring a cytosine conversion efficiency of over 99.5%, it maximizes the preservation of the integrity of long DNA fragments.

[0040] Step 3, purification: Add the binding solution to the system after the transformation reaction is completed, mix well, and then fully contact the mixture with the solid-phase adsorption carrier to allow the DNA to be adsorbed onto the solid-phase adsorption carrier. Remove excess transformation solution and protective solution by centrifugation or magnetic adsorption.

[0041] This step separates the transformed DNA from impurities such as unreacted bisulfite and organic reagents, achieving preliminary DNA purification.

[0042] Step 4, Desulfonation on the solid-phase adsorption carrier: Add desulfonation solution to the solid-phase adsorption carrier containing DNA, ensuring full contact between the carrier and the solution. Allow the mixture to stand at room temperature to complete the desulfonation reaction. Remove excess desulfonation solution by centrifugation or magnetic adsorption.

[0043] The alkali metal hydroxides in the desulfonation solution drive the elimination of sulfonic acid groups on DNA. At the same time, the low water activity environment created by the high concentration of alcohol solvents can inhibit the hydrolytic breakage of the DNA phosphate backbone under alkaline conditions, avoid secondary degradation of DNA during the desulfonation process, and further ensure the integrity of DNA.

[0044] Step 5, Cleaning and Recovery: Add washing solution to the solid-phase adsorption carrier after the desulfonation reaction to rinse and remove residual salts and organic impurities; after rinsing, add elution solution to the solid-phase adsorption carrier to elute and recover the adsorbed transformed DNA, and obtain a DNA sample with high integrity and high transformation efficiency, which can be directly used for downstream methylation detection experiments such as PCR amplification and sequencing. III. Specific Implementation Examples Example 1: Preparation of the conversion kit This embodiment describes the preparation of a sample pretreatment kit for DNA methylation detection. The specific formulations of each component are as follows: Conversion solution: 3 mol / L ammonium bisulfite, 0.1 mol / L tetraethylenepentamine pentahydrochloride, pH 5.0-5.5, solvent is nuclease-free water; Protective solution: sulfolane, with 0.1% (w / v) 3,4,5-trihydroxybenzoic acid added; Binding solution: 3 mol / L guanidine hydrochloride, 4% Triton X-100, 51% anhydrous ethanol, with nuclease-free water as the solvent; Desulfurization solution: 0.2 mol / L potassium hydroxide, 90% ethanol, solvent is nuclease-free water; Washing solution: 100mM sodium chloride, 10mM tris(hydroxymethyl)aminomethane, 80% anhydrous ethanol, pH 7.5, solvent is nuclease-free water; Elution buffer: 10 mM tris(hydroxymethyl)aminomethane, 0.5 mM EDTA, pH 9.0, solvent is nuclease-free water; Supporting consumables: Nucleic acid adsorption column (equipped with a 2mL collection tube), wherein the nucleic acid adsorption column is a silica membrane adsorption column with an adsorption capacity of not less than 20μg DNA.

[0046] After all the above reagents were prepared, they were filtered through a 0.22μm filter membrane for sterilization and stored in the dark under the corresponding conditions; all consumables were single-use consumables without nucleases or pyrogens.

[0047] Example 2: How to use the reagent kit This embodiment uses the kit prepared in Example 1 to perform bisulfite conversion and purification of the DNA sample to be transformed. The specific operation steps are as follows: 1. Prepare the transformation reaction system: Add 20µL of DNA sample to be transformed, 90µL of transformation buffer, and 30µL of protection buffer to a nuclease-free PCR tube. Vortex thoroughly to mix and then centrifuge briefly to allow all the liquid on the tube wall to settle to the bottom of the tube. 2. Mild transformation: Place the PCR tube in a thermal cycler and set the thermal cycle program as follows: reaction volume 140 μL, hot cap temperature 105℃, incubation at 70℃ for 90 min; after the reaction, briefly centrifuge the PCR tube to allow the condensate on the tube wall to settle to the bottom of the tube. 3. Binding and Purification: Transfer all reaction solution from the PCR tube to a clean 1.5 mL nuclease-free centrifuge tube, add 560 µL of binding buffer, vortex to mix, and then centrifuge briefly. Transfer all the mixed liquid to a nucleic acid adsorption column, centrifuge at 6000 × g for 1 min, discard the filtrate in the collection tube, and return the nucleic acid adsorption column to the collection tube. Add 500 µL of washing buffer, centrifuge at 6000 × g for 1 min, discard the filtrate, and return the nucleic acid adsorption column to the collection tube. 4. On-column desulfonation: Add 500µL of desulfonation solution to the nucleic acid adsorption column and let it stand at room temperature (15-25℃) for 15 min; after standing, centrifuge at 6000×g for 1 min, discard the filtrate, and put the nucleic acid adsorption column back into the collection tube; 5. Washing and Recovery: Add 500 μL of washing buffer to the nucleic acid adsorption column, centrifuge at 6000×g for 1 min, discard the filtrate, and return the nucleic acid adsorption column to the collection tube; repeat this washing step once; after washing, centrifuge the empty nucleic acid adsorption column tube at 20,000×g for 1 min to completely remove the residual washing buffer from the nucleic acid adsorption column; transfer the nucleic acid adsorption column to a clean 1.5 mL nuclease-free centrifuge tube, add 30 µL of preheated elution buffer (65-70℃) to the center of the silica membrane of the nucleic acid adsorption column, let it stand at room temperature for 2-5 min, centrifuge at 20,000×g for 1 min, and the liquid collected in the centrifuge tube is the transformed and purified DNA sample, which can be directly used for downstream methylation detection experiments.

[0048] All centrifugation operations in this embodiment were performed at room temperature, and the thermal cycler and centrifuge were calibrated in accordance with conventional practices in the field before use.

[0049] Example 3: Transformation and performance testing of human genomic DNA samples In this embodiment, the kit prepared in Example 1 was used to transform human genomic DNA samples, and the integrity and transformation efficiency of the transformed DNA were detected. The results were also compared with a commercially available traditional bisulfite transformation kit.

[0050] 1. Experimental Materials and Methods Samples to be tested: human genomic DNA, with the main peak of fragment length distribution around 30-50kb; after quantification using the Qubit dsDNA HS kit, 500ng DNA was added to each reaction system, and 4 independent replicate experiments were set up.

[0051] Reference settings: Experimental group: DNA transformation and purification were performed using the kit prepared in Example 1, following the operating steps in Example 2; Control group: The commercially available competitor K (bisulfite conversion kit based on traditional high-temperature conversion and magnetic bead purification) was used, and the operation was performed according to the kit instructions.

[0052] Both sets of experiments used the same batch of DNA samples, the same operator, and were processed in parallel within the same time window, with the final elution volume kept consistent to eliminate systematic errors.

[0053] Detection method: (1) Integrity test: Take two groups of DNA products of equal volume after transformation and purification, and perform 1.5% agarose gel electrophoresis. The electrophoresis buffer is 1×TAE, and the electrophoresis conditions are 100V constant voltage electrophoresis for 30-40 min. The tailing of the electrophoretic bands and the fragment distribution are observed with 2kb DNA Marker as reference. (2) Transformation efficiency detection: PCR primers targeting the BRCA1 gene promoter region were designed to amplify the bisulfite-transformed sequence, with an amplified fragment length of approximately 500 bp. The primer design avoided CpG sites. After TA cloning of the PCR product, 20 single clones were randomly selected for Sanger sequencing. The C→T transformation efficiency was calculated using non-CpG site cytosine in the amplified fragment as the statistical object. The calculation formula is as follows: Conversion rate = (Number of times non-CpG site C was read as T) / (Total number of times non-CpG site C was read) × 100%.

[0054] The PCR primer sequences for the BRCA1 gene are as follows: SEQ ID NO:1 Forward primer (F): AGATTGGGTGGTTAATTTAGAGTTT; SEQ ID NO:2 Reverse primer(R): ATAATATCCCCCTCAAAACATATTC; 2. Experimental Results and Effects Agarose gel electrophoresis results showed that the DNA transformed in the experimental group retained more long fragments, with an average fragment length of about 1000 bp, while the DNA in the control group showed obvious fragmentation, with an average fragment length of only about 500 bp. This indicates that the kit of the present invention can significantly reduce the risk of random DNA breakage during bisulfite transformation and greatly improve the integrity of the transformed DNA. It is suitable for methylation detection applications that require longer amplification fragments or are more sensitive to template integrity.

[0055] The transformation efficiency test results showed that the C→T transformation efficiency of the non-CpG sites in the experimental group was 99.7%±0.1% (n=4), and the transformation efficiency of the control group was 99.2%±0.2% (n=4). This indicates that the kit of the present invention can still maintain a high transformation efficiency of over 99.5% under mild reaction conditions, and the completeness of transformation is not reduced due to the mildening of reaction conditions, thus achieving a balance between transformation efficiency and DNA integrity.

[0056] Example 4: Transformation and performance testing of trace plasma cfDNA samples In this embodiment, the kit prepared in Example 1 was used to transform a trace amount of plasma cfDNA sample to verify the performance of the kit in the detection of trace samples, and it was compared with a commercially available traditional bisulfite conversion kit.

[0057] 1. Experimental Materials and Methods Test samples: Collect plasma from healthy donors, obtain cfDNA using conventional circulating cell-free DNA extraction methods in the field, and mix well; after quantification using the Qubit dsDNA HS kit, dilute to prepare a low concentration sample of 0.2 ng / µL, add 20 µL (total DNA 4 ng) to each reaction system to simulate a micro-volume clinical sample scenario, and set up 6 independent replicate experiments for each group.

[0058] Reference settings: Experimental group: The kit prepared in Example 1 was used for transformation and purification according to the operating steps in Example 2; Control group 1: Commercially available competitor Q (bisulfite conversion kit based on silica column purification), operated according to the kit instructions; Control group 2: Commercially available competitor K (bisulfite conversion kit based on magnetic bead purification), operated according to the kit instructions.

[0059] All groups were kept at the same final elution volume to ensure comparability of results.

[0060] Detection method: Quantitative real-time PCR (qPCR) was used. Specific primers and probes were designed for the transformed sequences of housekeeping genes ACTB and GAPDH. The amplified fragment length was approximately 140 bp, matching the main peak length of cfDNA. Three technical replicates were set for each sample, and the results were calculated by taking the mean of the technical replicates and then performing intergroup statistical analysis.

[0061] The primer and probe sequences for the housekeeping gene ACTB are as follows: SEQ ID NO:3 Forward primer (F): GGTGATGGAGGAGGTTTAG; SEQ ID NO:4 Reverse primer (R): TTTAGGGAGGAGTAGGTT; SEQ ID NO: 5 probe: 6FAM-GTGTTTGTTATTGTGTGTTGGGTGGTGG-BHQ1; The primer and probe sequences for the housekeeping gene GAPDH are as follows: SEQ ID NO:6 Forward primer (F): ATAGGTTTTTAGGAGTGTTTTTGTG; SEQ ID NO:7 Reverse primer (R): CCTATAACCTAAACCTAATAATTAAAACAA; SEQ ID NO:8 Probe: VIC-TTAGTTCGGAGAGAGTCGTTGGTG-BHQ1; Data conversion explanation: The lower the Ct value, the more effective template molecules can be amplified under the same reaction system; when the amplification efficiency is close to 100%, for every 1.0 decrease in ΔCt, the corresponding effective template amount increases by about 2 times (2^ΔCt).

[0062] 2. Experimental Results and Effects The qPCR test results are shown in the table below: The results showed that, under extremely low input conditions of 4 ng cfDNA, the kit of the present invention exhibited lower Ct values ​​for both ACTB and GAPDH targets, and the effective template recovery was increased by 2.6-3.2 times compared to the commercially available competitor Q. At the same time, the standard deviation of the Ct value in the experimental group was significantly lower than that in the two control groups, indicating that the kit of the present invention has better detection uniformity and repeatability under micro-sample conditions.

[0063] The above results demonstrate that the kit of the present invention significantly reduces DNA loss during the transformation process without sacrificing transformation efficiency, achieving efficient recovery and stable detection of trace short DNA fragments, and providing a more reliable pretreatment basis for clinical detection of trace DNA methylation, such as liquid biopsy.

[0064] Example 5: Bisulfite (2.5-4 mol / L) and linear polyethylene polyamine (H2N-(CH2CH2-NH)) n Clinical urine sample conversion detection under -H, n is 1-5) This embodiment verifies the presence of bisulfite (2.5-4 mol / L) and linear polyethylene polyamine (H2N-(CH2CH2-NH)). n The conversion efficiency of the conversion solution (H, n = 1-5) on DNA from clinical urine samples was evaluated to verify the conversion stability and detection accuracy of the kit over a wide range of salt concentrations.

[0065] 1. Experimental Materials and Methods Samples to be tested: Three clinical urine samples were collected from patients who were clinically and pathologically diagnosed with bladder cancer (positive and negative). Genomic DNA was obtained from the urine samples using standard DNA extraction methods in the field. Nucleic acid quantification was performed using micro-volume ultraviolet spectrophotometry. Specific sample information is shown in the table below: Preparation of conversion solutions: 11 solutions containing ammonium bisulfite (2.5-4 mol / L) and linear polyethylene polyamine (H2N-(CH2CH2-NH) were prepared. n The conversion solution (-H, n is 1-5) is as follows: Conversion solution 1: 2.5 mol / L ammonium bisulfite, 0.1 mol / L ethylenediamine dihydrochloride, pH 5.0-5.5; Conversion solution 2: 2.5 mol / L ammonium bisulfite, 0.1 mol / L diethylenetriamine hydrochloride, pH 5.0-5.5; Conversion solution 3: 2.5 mol / L ammonium bisulfite, 0.1 mol / L triethylenetetramine, pH 5.0-5.5; Conversion solution 4: 2.5 mol / L ammonium bisulfite, 0.1 mol / L tetraethylenepentaminepentahydrochloride, pH 5.0-5.5; Conversion solution 5: 2.5 mol / L ammonium bisulfite, 0.1 mol / L pentaethylenehexamine, pH 5.0-5.5; Conversion solution 6: 3.25 mol / L ammonium bisulfite, 0.1 mol / L ethylenediamine dihydrochloride, pH 5.0-5.5; Conversion solution 7: 3.25 mol / L ammonium bisulfite, 0.1 mol / L tetraethylenepentaminepentahydrochloride, pH 5.0-5.5; Conversion solution 8: 3.25 mol / L ammonium bisulfite, 0.1 mol / L pentaethylenehexamine, pH 5.0-5.5; Conversion solution 9: 4.0 mol / L ammonium bisulfite, 0.1 mol / L ethylenediamine dihydrochloride, pH 5.0-5.5; Conversion solution 10: 4.0 mol / L ammonium bisulfite, 0.1 mol / L tetraethylenepentaminepentahydrochloride, pH 5.0-5.5; Conversion solution 11: 4.0 mol / L ammonium bisulfite, 0.1 mol / L pentaethylenehexamine, pH 5.0-5.5; The remaining components of the kit (protective solution, binding solution, desulfonating solution, washing solution, elution solution, and nucleic acid adsorption column) are consistent with those in Example 1.

[0066] Transformation and detection process: Following the operating steps of Example 2, the DNA of samples S1-S6 were transformed using the above 11 transformation solutions. The initial amount of DNA input for each sample was uniformly 200 ng. After transformation and purification, 25 μL of elution buffer was used for elution.

[0067] The detection was performed using qPCR: specific primers and qPCR reaction system targeting the methylation marker POU4F2-3 in bladder cancer and an internal reference gene (designed for the transformed sequence) were used to amplify and detect the transformed DNA products; each sample was tested in parallel 3 times, and the average Ct value was taken as the final result.

[0068] 2. Experimental Results and Effects The qPCR test results are shown in the table below: Note: ND indicates that no amplification signal was detected under the detection conditions.

[0069] The results showed that, under the same DNA input conditions, after treatment with transformation solutions containing different concentrations of bisulfite and different linear polyethylene polyamines (n=1-5), the internal reference genes of all S1-S6 samples were stably amplified. Specific amplification signals were detected for the target POU4F2-3 in the three bladder cancer positive samples, while no target amplification signals were detected in the three negative samples, thus accurately distinguishing clinically positive and negative samples. For the same sample, there were no significant differences in the target Ct value and the internal reference Ct value after treatment with different transformation solutions, with minimal fluctuations.

[0070] The above results indicate that the substance contains ammonium bisulfite (2.5-4.0 mol / L) and linear polyethylene polyamine (H2N-(CH2CH2-NH)). n Transformation solutions of -H (n = 1-5) can achieve stable bisulfite transformation of genomic DNA in clinical urine samples. The transformed DNA can be stably detected by target and internal reference genes, and has good transformation consistency and detection accuracy, which can meet the requirements for transformation stability in in vitro diagnostic clinical scenarios.

[0071] It should be noted that, in this invention, although the specification describes the embodiments, not every embodiment contains only one independent technical solution. This way of describing the specification is only for clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A methylation detection pretreatment kit for protecting DNA integrity, comprising a transformation buffer, a binding buffer, a desulfonation buffer, a washing buffer, and an elution buffer, characterized in that, The kit also includes a protective solution; the conversion solution contains bisulfite and linear polyethylene polyamine; the protective solution contains an organic denaturant and a polyphenolic antioxidant; and the desulfurization solution contains an alkali metal hydroxide and an alcohol solvent.

2. The methylation detection pretreatment kit for protecting DNA integrity according to claim 1, characterized in that, The concentration of bisulfite in the conversion solution is 2.5-4 mol / L; The bisulfite is selected from one or more of ammonium bisulfite, sodium bisulfite, and potassium bisulfite.

3. The methylation detection pretreatment kit for protecting DNA integrity according to claim 1 or 2, characterized in that, The linear polyethylene polyamine has the general formula H2N-(CH2CH2-NH). n Linear compounds of -H, where n is an integer from 1 to 5; The linear polyethylene polyamine exists in the form of a free base or its acid addition salt; the concentration of the linear polyethylene polyamine in the conversion solution is 0.01-0.5 mol / L.

4. The methylation detection pretreatment kit for protecting DNA integrity according to claim 1, characterized in that, The organic modifier is selected from sulfolane or propylene carbonate, and the final concentration of the organic modifier in the conversion reaction system is 10%-35% (v / v). The polyphenolic antioxidant is 3,4,5-trihydroxybenzoic acid, and the final concentration of the polyphenolic antioxidant in the conversion reaction system is 0.1-10 mg / mL.

5. The methylation detection pretreatment kit for protecting DNA integrity according to claim 1, characterized in that, The concentration of alkali metal hydroxide in the desulfurization solution is 0.05-0.8 mol / L, and the alkali metal hydroxide is selected from one or more of sodium hydroxide, potassium hydroxide, and lithium hydroxide. The volume fraction of alcohol solvent in the desulfurization solution is 85%-95% (v / v), and the alcohol solvent is selected from one or more of methanol, ethanol, and isopropanol.

6. A method for pretreatment of DNA to protect DNA integrity in methylation detection, comprising the steps of bisulfite conversion, binding purification, desulfonation, washing, and elution recovery of the DNA sample to be transformed, characterized in that, The treatment using the kit described in claim 1 specifically includes the following steps: S1: Preparation of the transformation reaction system: Mix the DNA sample to be transformed with the transformation solution and the protection solution to obtain a homogeneous transformation reaction system; S2: Mild conversion: The conversion reaction system is incubated at a constant temperature of 50-70℃ to complete the bisulfite conversion reaction; S3: Binding and purification: Add binding solution to the system after the transformation reaction is completed, mix well, and then make the mixture fully contact the solid-phase adsorption carrier so that the DNA is adsorbed on the solid-phase adsorption carrier and remove the waste liquid. S4: Desulfonation treatment: Add desulfonation solution to the solid-phase adsorption carrier containing DNA to complete the desulfonation reaction; S5: Washing and elution: The solid-phase adsorption carrier that has undergone desulfonation treatment is washed with washing liquid, and then the DNA adsorbed on the solid-phase adsorption carrier is eluted and recovered with elution liquid to obtain a DNA template for methylation detection.

7. The method for pretreatment of DNA for methylation detection to protect DNA integrity according to claim 6, characterized in that, The concentration of bisulfite in the conversion solution is 2.5-4 mol / L, and the bisulfite is selected from one or more of ammonium bisulfite, sodium bisulfite, and potassium bisulfite. The linear polyethylene polyamine has the general formula H2N-(CH2CH2-NH). n The linear compound of -H, wherein n is an integer from 1 to 5, the linear polyethylene polyamine exists in the form of a free base or its acid addition salt, and the concentration of the linear polyethylene polyamine in the conversion solution is 0.01-0.5 mol / L.

8. The method for pretreatment of DNA for methylation detection to protect DNA integrity according to claim 6, characterized in that, The final concentration of the organic denaturant in the conversion reaction system is 10%-35% (v / v), and the organic denaturant is selected from sulfolane or propylene carbonate. The final concentration of the polyphenolic antioxidant in the conversion reaction system is 0.1-10 mg / mL, and the polyphenolic antioxidant is 3,4,5-trihydroxybenzoic acid; The concentration of alkali metal hydroxide in the desulfurization solution is 0.05-0.8 mol / L, and the alkali metal hydroxide is selected from one or more of sodium hydroxide, potassium hydroxide, and lithium hydroxide. The volume fraction of alcohol solvent in the desulfurization solution is 85%-95% (v / v), and the alcohol solvent is selected from one or more of methanol, ethanol, and isopropanol.

9. The method for pretreatment of DNA for methylation detection while protecting DNA integrity according to claim 6, characterized in that, In step S2, the constant temperature incubation time is 60-120 min; in step S4, the desulfurization reaction is carried out at room temperature for 10-20 min.

10. The method for pretreatment of DNA for methylation detection while protecting DNA integrity according to claim 6, characterized in that, The solid-phase adsorption carrier is a nucleic acid adsorption column or nucleic acid purification magnetic beads.

Images