A LAMP-PfAgo-based nucleic acid detection composition, kit and detection method for foodborne pathogens

Abstract

The present application belongs to the technical field of gene detection, and aims at the fact that most of the existing methods focus on the specific report and multiplex detection capacity of pAgos, but often ignore the key problem of amplicon contamination. The present application provides a nucleic acid detection composition, kit and method for foodborne pathogens based on LAMP-PfAgo, which utilizes primers to perform LAMP amplification on foodborne pathogens, and after the reaction is completed, a probe and PfAgo are added, the PfAgo performs the first cutting on the LAMP amplification product to obtain a cutting product, and then the PfAgo performs the second cutting on the probe under the action of the cutting product to produce specific fluorescence. The primer probe combination of the present application can efficiently, specifically and sensitively detect multiple foodborne pathogens at the same time, and can effectively eliminate the problem of LAMP amplicon contamination.

Description

Technical Field

[0001] This invention belongs to the field of gene detection technology, specifically relating to a LAMP-PfAgo-based nucleic acid detection composition, kit, and detection method for foodborne pathogens. Background Technology

[0002] Molecular diagnostics plays a vital role in human life and is widely used in various fields such as food safety testing, disease diagnosis, and environmental monitoring. Nucleic acid detection, as one of the key methods in molecular diagnostics, can rapidly and specifically detect nucleic acid targets. Nucleic acid amplification (NAA) technology has always been an essential means of detecting trace amounts of targets. Currently, various NAA methods, including polymerase chain reaction (PCR), are widely used.

[0003] Isothermal amplification techniques, such as loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RAA), and nicking enzyme amplification (NEAR), have been widely used in the field of target nucleic acid amplification. These techniques not only enable single-copy level detection, but their high sensitivity also makes them powerful tools for diagnostic testing. While isothermal amplification techniques offer the advantage of ultra-low limits of detection (LOD) due to their powerful amplification capabilities, they also suffer from significant amplification product contamination. When amplified DNA fragments (i.e., amplicones) contaminate subsequent reactions, it can lead to false positives and compromise the reliability of diagnostic testing. This makes it difficult to widely apply these highly sensitive techniques in field testing scenarios that require frequent annealing operations.

[0004] To address this issue, researchers have developed various strategies, focusing on both amplification protocol design and the development of new technologies. One classic approach combines uracil-DNA glycosylase (UDG) with NAA technology. UDG is an enzyme that removes uracil residues from DNA, and it can be introduced when deoxyuracil (dUTP) is used instead of dTTP (deoxythymidine triphosphate) for NAA. This enzyme activity is particularly suitable for preventing residual contamination because it selectively degrades uracil-containing DNA fragments from previous amplification reactions without affecting uracil-free target DNA. However, the addition of dUTP may affect DNA polymerase activity, thereby reducing amplification efficiency. Furthermore, UDG needs to be denatured before NAA, complicating the procedure. Most importantly, UDG-based strategies are pre-amplification steps, only removing amplification product contamination within the reaction tube. This means that aerosol contamination outside the reaction tube cannot be completely removed, posing a significant challenge to experiments when UDG is absent. With the emergence of novel programmable nuclease clusters of regularly spaced short palindromic repeats (CRISPR) and CRISPR-associated proteins (Cas), several cutting-edge strategies have been proposed recently. For example, Zhou et al. developed a pollution-free LAMP method based on CRISPR / Cas9.

[0005] Cut-LAMP, a technique that uses specific RNA targeting the amplicon to guide its execution, effectively eliminates amplicon contamination. While this method shows promise in eliminating amplicon contamination, it remains a pre-amplification step and cannot address aerosol contamination outside the reaction tube. Furthermore, the guide RNA is indispensable, increasing the cost of synthesis and storage. Recently, a method called CoRPLA (CRISPR-regulated one-pot recombinase polymerase loop-mediated amplification) has attracted significant attention in this field. This technique utilizes specially designed circular primers to enhance RPA, simultaneously triggering Cas12 for in-situ amplicon removal and signal amplification. To some extent, this technique has shown potential for amplicon elimination during Cas12a-based signal readout. However, due to the single-turn cis-cutting activity of Cas12a, amplicon cannot be completely cleaved. Moreover, this technique only generates double-strand breaks with sticky ends on the amplicon, potentially introducing new risks of non-specific amplification. Therefore, developing a new method that can completely eliminate amplicon contamination in a simpler and more economical manner is highly necessary.

[0006] In recent years, the rediscovery of programmable nucleases (especially prokaryotic Argonautes, or pAgos) has attracted widespread attention in the field of molecular diagnostics. These pAgos can specifically cleave target sequences guided by short guide DNA (gDNA) without relying on adjacent motifs (PA-Ms) of the protospacer sequence, thus providing a more convenient alternative to CRISPR / Cas systems. Among the many pAgos, Argonautes derived from *P. f. Ago* and *T. t. Ago* have been widely used in nucleic acid detection. However, existing methods mostly focus on utilizing the specific reporting and multiplexing capabilities of pAgos, often neglecting the critical issue of amplicon contamination. Summary of the Invention

[0007] The purpose of this invention is to overcome the shortcomings of the prior art and provide a nucleic acid detection composition, kit and detection method for foodborne pathogens based on LAMP-PfAgo.

[0008] The first aspect of this invention provides a LAMP-PfAgo-based nucleic acid detection composition for foodborne pathogens, comprising:

[0009] Primers are designed based on the genes of foodborne pathogens;

[0010] The probe, designed based on the gene amplification region of the foodborne pathogen, has the nucleotide sequence shown in SEQ ID NO. 1.

[0011] Furthermore, the nucleotide sequences of the primers are shown in SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO. 7.

[0012] Furthermore, the probe has a fluorescent reporter group and a fluorescent quencher group.

[0013] Furthermore, the fluorescent reporter group and the fluorescent quencher group are FAM and BHQ1, respectively.

[0014] Furthermore, the foodborne pathogens are bacteria.

[0015] Furthermore, the bacteria was identified as Salmonella typhimurium.

[0016] A second aspect of the present invention provides a nucleic acid detection kit for foodborne pathogens based on LAMP-PfAgo, characterized in that it includes the above-mentioned nucleic acid detection composition for foodborne pathogens based on LAMP-PfAgo.

[0017] A third aspect of this invention provides a method for detecting foodborne pathogen nucleic acid based on LAMP-PfAgo, characterized in that, using the aforementioned LAMP-PfAgo-based foodborne pathogen nucleic acid detection kit, the method includes the following steps:

[0018] LAMP amplification was performed using the RNA of the sample to be tested as a template through a LAMP amplification system.

[0019] The LAMP amplification system contains primers from the LAMP-PfAgo-based foodborne pathogen detection kit.

[0020] The LAMP amplification products were PfAgo-specifically cleaved using the PfAgo system.

[0021] The PfAgo system includes probes from a LAMP-PfAgo-based foodborne pathogen detection kit.

[0022] The cleavage product was purified, ligated, and subjected to PCR amplification. The fluorescence signal data monitored in real time during the PCR amplification process was recorded to obtain the fluorescence amplification curve.

[0023] Foodborne pathogens are identified based on fluorescence amplification curves; a clear amplification curve indicates a positive result, while the absence of a clear amplification curve indicates a negative result.

[0024] Furthermore, the LAMP amplification system includes:

[0025] 0.2 μL of Bst DNA polymerase, 2 μL of 5 mol / L betaine, 0.8 μL of 10 mM dNTPs, 1 μL of 10×LAMP buffer, 0.4 μL of 20×SGI, 0.32 μL each of primers shown in SEQ ID NO. 2 and SEQ ID NO. 3, 0.08 μL each of primers shown in SEQ ID NO. 4 and SEQ ID NO. 5, 0.16 μL each of primers shown in SEQ ID NO. 6 and SEQ ID NO. 7, 1 μL of template, and 3.48 μL of sterile water.

[0026] Furthermore, the PfAgo system includes:

[0027] 2 μL of PfAgo buffer, 1.75 μL of 20 mM MnCl2, 5 μL of PfAgo, and 1 μL of the probe shown in SEQ ID NO. 1 (20 μM).

[0028] Compared with the prior art, the advantages of this invention are as follows:

[0029] This invention employs a method for detecting nucleic acids of foodborne pathogens that combines PfAgo cutting with PCR and LAMP amplification technologies, achieving synchronization of sequence-specific reporting and amplicon removal. It exhibits high sensitivity and specificity for foodborne pathogens, capable of detecting target nucleic acids down to 10 copies, and effectively eliminating LAMP amplicon contamination. Validation on food samples shows that this method is 100% consistent with commercial PCR detection. It demonstrates great potential in the detection of foodborne pathogens. Attached Figure Description

[0030] Figure 1 The image shows the experimental results of Argonaute cutting double-stranded DNA; in which, Figure 1 The diagram shows the experimental procedure for Argonaute cutting of double-stranded DNA and the agarose gel electrophoresis image of the cutting products (left image shows PfAgo cutting products, right image shows TtAgo cutting products). Figure 1 B in the diagram represents the experimental procedure of adding a homologous probe (probe 1) or a mismatched probe (probe 2) after Argonaute cleavage of the DNA double strand, as well as the PAGE gel electrophoresis image of the cleavage product (left image is the PfAgo cleavage product, right image is the TtAgo cleavage product). Figure 1 In the diagram, C represents the sequencing results of short double-stranded DNA after PfAgo cutting, ligation, and amplification.

[0031] Figure 2 The image shows the detection results of the CREDIT method; where, Figure 2 In the diagram, A represents the principle of the CREDIT method; Figure 2 B in the diagram represents the PCR-based CREDIT method; Figure 2 C is the electrophoresis image of the cleavage products; from left to right, they are the marker, the HBV amplification band, and the result of HBV PCR amplification products after PfAgo cleavage. Figure 2 In the figure, D represents the real-time fluorescence curve of HBV during PfAgo cutting and the result of the reaction tube under blue light after the reaction is completed. Figure 2 E in the figure represents the specific fluorescence curve for HBV detection using the PCR-based CREDIT method and the result of the reaction tube under blue light after the reaction is completed. Figure 2 F in the figure represents the schematic diagram of the experiment for verifying credit-mediated amplicon elimination and the real-time amplification curves of digested and undigested PCR product templates (left figure is the schematic diagram of the experiment, right figure is the real-time amplification curve).

[0032] Figure 3 The image shows the agarose gel electrophoresis results of the cleavage products (from left to right: the marker, the LAMP amplification band using St as a template, and the result of PfAgo cleavage of the St LAMP amplification product using St as a template).

[0033] Figure 4 Real-time fluorescence curves of St LAMP amplification products after PfAgo cleavage following the addition of homologous probes;

[0034] Figure 5 for Figure 2 The denaturation PAGE image of probe cutting in B;

[0035] Figure 6 The optimized real-time fluorescence curve for credit (target concentration of 1×10 copies, NC is the negative control without template).

[0036] Figure 7 The results show the LAMP-based credit fluorescence values ​​and the reaction tubes under blue light.

[0037] Figure 8 The real-time fluorescence curves for LAMP-based credit in the detection of serially diluted ST templates;

[0038] Figure 9 The fluorescence values ​​of a series of diluted ST templates detected at 25 minutes for LAMP-based credit;

[0039] Figure 10 The specificity results of LAMP-based credit for ST detection;

[0040] Figure 11 for Figure 10 The visualization results of the corresponding sample under blue light.

[0041] Figure 12 To introduce LAMP-based CREDIT-specific detection results for ST under mismatch conditions;

[0042] Figure 13 The diagram shows the experimental procedure and the amplicon elimination results (the left diagram shows the credit-mediated amplicon elimination results, and the right diagram shows the real-time LAMP amplification curves using digested and undigested LAMP products as templates).

[0043] Figure 14 The diagram shows a schematic of a LAMP-based credit test strip and the results of the test (the left image is the schematic diagram, and the right image is the results).

[0044] Figure 15 The results are from real-time fluorescence detection of hepatitis B virus PCR products.

[0045] Figure 16 Real-time fluorescence detection results for non-target template PCR products;

[0046] Figure 17Agarose gel electrophoresis image of LAMP amplification products of Salmonella typhimurium; Figure 17 In the diagram, A represents the product after PfAgo cleavage (lanes from left to right: standard molecular weight marker, LAMP-amplified DNA, LAMP-amplified DNA after 15 minutes of reaction with PfAgo, LAMP-amplified DNA after 20 minutes of reaction with PfAgo, LAMP-amplified DNA after 25 minutes of reaction with PfAgo, LAMP-amplified DNA after 30 minutes of reaction with PfAgo, LAMP amplification reagent result, and LAMP amplification reagent after 15 minutes of reaction with PfAgo). Figure 17 B in the table represents the product after TtAgo cleavage (lanes from left to right: standard molecular weight marker, LAMP-amplified DNA, LAMP-amplified DNA after 15 minutes of reaction with TtAgo, LAMP-amplified DNA after 3 hours of reaction with TtAgo, LAMP-amplified DNA after 16 hours of reaction with TtAgo, LAMP amplification reagent result, and LAMP amplification reagent after 16 hours of reaction with TtAgo).

[0047] Figure 18 Real-time fluorescence detection results of LAMP products from 11 pathogens. Detailed Implementation

[0048] The following will be described in conjunction with embodiments of the present invention. Figures 1 to 18 The technical solutions in the embodiments of the present invention are clearly and completely described herein. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0049] Unless otherwise specified in the examples, the conditions shall be performed according to the standard conditions or the conditions recommended by the manufacturer.

[0050] Unless otherwise specified, in the following embodiments, reagents or instruments whose manufacturers are not indicated are all conventional products that can be purchased commercially.

[0051] Unless otherwise specified in the following examples, all molecular biology experimental methods were performed in accordance with the kit and product instructions.

[0052] 1. Materials and Methods

[0053] 1.1 Materials and Equipment

[0054] All oligonucleotides used in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd. dNTPs were purchased from Sangon Biotech (Shanghai) Co., Ltd., PfAgo and PfAgo buffer were purchased from Shanghai Jiaohong Biotechnology Co., Ltd., and TtAgo and T4 DNA ligase were purchased from New England Biolabs. 2× universal SYBR GreenFastqPCR mixture (RK21203) was provided by AB Cloning Technology Co., Ltd., the real-time fluorescence PCR instrument was purchased from Chengdu Fuji Gene Biotechnology Co., Ltd., and the UV-Vis spectrophotometer was purchased from Biotec.

[0055] 1.2 Chopping reaction of PfAgo and TtAgo and probe cleavage reaction method of their products

[0056] 10 μL of DNA double-stranded solution was mixed with 0.3 μL of PfAgo, 1 μL of PfAgo buffer and 1 μL of 40 mM MnCl2, and reacted at 95 °C for 50 minutes to carry out the PfAgo Chopping reaction to obtain the PfAgo reaction mixture.

[0057] Mix 10 μL of DNA double-stranded solution with 3 μL of TtAgo and 1 μL of TtAgo buffer, and react at 85 °C for 50 minutes to complete the TtAgo chopping reaction, obtaining the TtAgo reaction mixture.

[0058] Add 1 μl of 20 μM probe 1 or probe 2 to the PfAgo reaction mixture and the TtAgo reaction mixture, respectively, to carry out the probe cleavage reaction, and then analyze the cleavage products by agarose gel electrophoresis.

[0059] In this embodiment of the invention, the DNA double-stranded solution is obtained by the following method:

[0060] Using genomic DNA of Salmonella Typhimurium as a template, PCR amplification was performed with F: CGGCCCGATTTTCTCTGG and R: CGGCAATAGCGTCACCTT as upstream and downstream primers, respectively, to obtain a DNA double-stranded solution. The total volume of the PCR amplification reaction system was 10 µL, and the specific components included: 0.25 µL Easy Taq polymerase, 0.2 µL dNTPs (10 mM), 1 µL 10× Easy Taq Buffer, 1 µL each of upstream primer F and downstream primer R (10 μM), and 1 µL template, which was finally made up with sterile water.

[0061] The PCR amplification reaction program was as follows: initial denaturation at 94°C for 30 seconds, followed by 30 cycles of 94°C for 10 seconds and 60°C for 15 seconds.

[0062] In this embodiment of the invention, the nucleotide sequences of probe 1 and probe 2 are shown in SEQ ID NO. 8 and SEQ ID NO. 9, respectively.

[0063] 1.3 Experiment to verify whether PfAgo can produce gDNA

[0064] 2 μL of short double-stranded DNA, 1 μL of PfAgo buffer, 0.5 μL of 40 mM MnCl2, 0.5 μL of PfAgo, and 6 μL of sterile water were mixed and incubated at 95 °C for 30 minutes to perform PfAgo cleavage. The cleavage products were then analyzed by PAGE, recovered, and purified. Subsequently, the purified product was ligated with a long single-stranded DNA (130 nt) in the presence of T4 DNA ligase. The ligation product was amplified by PCR using the commercially available 2xEasyTaqPCR premix kit (AS111), and the amplified products were sequenced.

[0065] In this embodiment of the invention, the short double-stranded DNA is obtained by hybridization of two complementary single-stranded DNAs. The nucleotide sequences of the two complementary single-stranded DNAs of the short double-stranded DNA are shown in SEQ ID NO. 10 and SEQ ID NO. 11, respectively.

[0066] In the embodiment of the present invention, the nucleotide sequence of the long single-stranded DNA is: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT.

[0067] 1.4 Establishing the CREDIT method using the cutting effect of PfAgo

[0068] The PCR amplification system contains 0.25 μL EasyTaq polymerase, 0.2 μL dNTP (10 mM), 1 μL EasyTaq buffer (10×), 0.5 μL SGI (20×), 1 μL forward primer (10 μM) and 1 μL reverse primer (10 μM), as well as 1 μL template and 5 μL sterile water.

[0069] In this embodiment of the invention, the nucleotide sequences of the forward primer and the reverse primer are as follows:

[0070] Forward primer: GTGTCTGCGGCGTTTTATCAT;

[0071] Reverse primer: ACAAACGGGCAACATACCTTG.

[0072] The PfAgo system consists of 1 μL PfAgo buffer, 0.5 μL 40 mM MnCl2, 0.3 μL PfAgo and 1 μL specific probe 1 (20 μM).

[0073] In this embodiment of the invention, the nucleotide sequence of specific probe 1 is: ROX-CATCCTGCTGCTATGCCTCATCTTCTT-BHQ2;

[0074] Place the PCR amplification system at the bottom of the reaction tube, cover the surface with 10 μL of mineral oil, and place the PfAgo system on the tube cap. Perform PCR amplification first. After amplification, centrifuge the PfAgo system to the bottom of the reaction tube and react at 95 °C for 30 min. When developing, place the completed reaction tube under blue light to observe whether the probe is specifically cleaved and emits a fluorescent signal. PCR amplification reaction program: initial denaturation at 94 °C for 30 seconds, followed by 30 cycles of 94 °C for 10 seconds and 60 °C for 15 seconds.

[0075] 1.5 Establishment of the CREDIT method based on isothermal amplification

[0076] The LAMP system comprises a total of 10 μL, including 0.2 μL Bst DNA polymerase, 2 μL betaine (5 mol / L), 0.8 μL dNTP (10 mM), 1 μL LAMP buffer (10×), 0.4 μL SGI (20×), 0.32 μL each of 50 μM FIP (SEQ ID NO. 2) and BIP (SEQ ID NO. 3), 0.08 μL each of 50 μM F3 (SEQ ID NO. 4) and B3 (SEQ ID NO. 5), 0.16 μL each of 50 μM LF (SEQ ID NO. 6) and LB (SEQ ID NO. 7), 1 μL template, and 3.48 μL sterile water.

[0077] The PfAgo system consists of 2 μL PfAgo buffer, 1.75 μL 20 mM MnCl2, 3 μL PfAgo, 1 μL 20 μM probe (i.e., specific probe 2, SEQ ID NO. 1) and 2.75 μL sterile water.

[0078] Place the LAMP amplification system at the bottom of the reaction tube, cover the surface with 10 μL of mineral oil, and place the PfAgo system on the tube cap. First, perform LAMP amplification at 60 °C for 1 hour. After amplification, centrifuge the PfAgo system to the bottom of the reaction tube and react at 95 °C for 30 minutes. For visualization, place the completed reaction tube under blue light and observe whether the probe is specifically cleaved to emit a fluorescent signal.

[0079] 1.6 Optimization of the CREDIT method based on isothermal amplification

[0080] The amplification system used in this section is the LAMP system described in section 1.5 above. The amount of PfAgo and the concentration of manganese ions in the PfAgo system were then optimized.

[0081] When optimizing the PfAgo dosage, the total volume of the PfAgo system is 10.5 μL, containing 2 μL of PfAgo buffer, 1.75 μL of 20 mM MnCl2, 1 μL of 20 μM probe (i.e., specific probe 2), and 0-4 μL (i.e., 0, 2, 2.5, 3, 3.5, 4 μL) of PfAgo. The remaining volume is adjusted with sterile water.

[0082] When optimizing the manganese ion concentration, the total volume of the PfAgo system was 10.5 μL, containing 2 μL of PfAgo buffer, 3 μL of PfAgo, 1 μL of 20 μM probe (i.e., specific probe 2), and 0–3 μL (i.e., 0, 0.75, 1.75, 2.75, 3 μL) of 20 mM MnCl2. The remaining volume was adjusted with sterile water. LAMP amplification and the PfAgo Chopping reaction were then performed according to the method described in section 1.5.

[0083] Credit-based test strips: After LAMP amplification and PfAgo Chopping reaction are completed, open the reaction tube. Since the liquid volume in the tube is small, add 20 μL of sterile water and mix thoroughly. Then insert the test strip into the reaction tube and observe the results.

[0084] 2. Results and Discussion

[0085] 2.1 PfAgo's cleavage effect can efficiently digest double-stranded DNA (dsDNA).

[0086] Similar to the role of guide RNA in the CRISPR host defense system, pAgos require gDNA to achieve site-specific cleavage of invading DNA. During the generation of initial gDNA, some pAgos have been reported to cleave double-stranded DNA (dsDNA) nonspecifically, a phenomenon known as the "cleavage effect." This effect was initially discovered in *TtAgo*, and subsequently observed in *Methanococcus japonicus* Argonaute (MjAgo) and *Thermococcus thioreductive* Argonaute (TtrAgo). These findings suggest that these pAgos can fragment dsDNA into smaller fragments, hinting that the cleavage effect may serve as an effective tool for eliminating amplicon contamination.

[0087] To evaluate the effect of cleavage on dsDNA, this invention compared the activities of two commonly used pAgos—PfAgo and TtAgo, such as Figure 1 As shown in A, through Figure 1 Figure A shows that both PfAgo and TtAgo can degrade dsDNA. Notably, agarose gel analysis shows that PfAgo exhibits higher cleavage efficiency and can completely digest dsDNA. Since gDNA is essentially generated by the cleavage effect, this invention infers that small DNA fragments contained in the cleavage products can act as gDNA to activate the gDNA-dependent cleavage activity of pAgo.

[0088] To verify this hypothesis, this invention designs a probe (probe 1) with a fluorescent label and a quencher, which contains homologous sequences of double-stranded DNA (dsDNA). Figure 1 As shown in Figure B, when the cleavage product was added to a reaction system containing PfAgo and a homologous probe (probe 1), a cleavage band was observed, indicating that the cleavage product contained gDNA. Conversely, when the cleavage product was added to a reaction system containing PfAgo and a mismatch probe (probe 2), no cleavage band was observed, indicating that the gDNA-dependent cleavage activity of PfAgo is highly specific. Notably, regardless of sequence matching, the cleavage product using TtAgo failed to induce probe cleavage, which may be attributed to the insufficient gDNA content in the TtAgo-based cleavage product. Therefore, PfAgo was used in subsequent experiments.

[0089] 2.2 PfAgo produces gDNA

[0090] To further validate the generation of gDNA using PfAgo-based cleavage technology, this invention designed a short double-stranded DNA (dsDNA), where one strand is labeled at the 3' end, and the other strand is fully modified with phosphorylation-thiophosphate. After double-stranded DNA cleavage, the labeled product was purified and ligated with a long adapter. The ligation product was then amplified and sequenced. Figure 1 As shown in C, the sequencing results showed that a 15-nucleotide gDNA fragment was present in the cleavage product, which confirms that the PfAgo-mediated cleavage process did indeed produce gDNA.

[0091] 2.3 Verification of the CREDIT method established using the PfAgo cleavage effect

[0092] After confirming the cleavage effect of PfAgo, this invention utilizes its function to develop a CREDIT method that can simultaneously degrade amplification products and achieve sequence-specific reporting. Its working principle is as follows: Figure 2 As shown in Figure A, the target nucleic acid is first amplified by DNA polymerase and then digested by PfAgo. Simultaneously, the gDNA generated from the cleaved amplification product can be loaded onto the PfAgo cleavage site, activating the cleavage of the reporter probe, thus achieving sequence-specific detection without the need for the addition of initial gDNA. This invention names this method the detection method based on the non-specific cleavage activity of Ago nuclease (CREDIT).

[0093] To verify the feasibility of this method, this invention combines it with PCR technology to construct a one-pot detection strategy, such as... Figure 2 As shown in B in the diagram. Specifically, the PfAgo restriction site and specific probe 1 were added to the reaction cap. After PCR amplification, the reaction tube was centrifuged to mix the PfAgo restriction site with the PCR product, followed by restriction digestion and reporting. This study used hepatitis B virus (HBV) as the detection target and performed real-time fluorescence detection of HBV PCR products. The detection results are shown in Figure B. Figure 15 As shown, through Figure 15 It can be seen that the HBV template can be normally amplified by PCR. The results of PfAgo enzyme digestion activity assay of the HBV PCR product are as follows: Figure 2 As shown in C, through Figure 2 The C value in the figure shows that the PCR product bands completely disappeared after the addition of PfAgo, indicating that PfAgo has high cleavage efficiency.

[0094] Furthermore, real-time fluorescence detection confirmed that adding a specific probe to the cleavage reaction could produce an enhanced fluorescence signal (results as shown in Figure 1). Figure 2 As shown in D in the figure, this demonstrates the feasibility of detecting PCR products based on the cleavage effect. Furthermore, by adding a non-target template (i.e., Salmonella typhimurium template), real-time fluorescence detection of the non-target template PCR product was performed, and the detection results are shown in Figure D. Figure 16 As shown, through Figure 16 It can be seen that both non-target and target templates can be normally amplified by PCR. Figure 2The E-value in the image shows that it cannot induce a positive fluorescence curve, indicating that this method has the advantage of sequence-specific detection. Notably, this method does not introduce gDNA, meaning it differs from current pAgo methods that require initial gDNA, which is advantageous when developing multiplex detection strategies.

[0095] like Figure 2 As shown in F, the HBV PCR product, after being digested with PfAgo, was used as the input for the next round of PCR amplification. Through... Figure 2 As shown in F, the cleaved PCR product did not amplify during PCR amplification. The amplification product treated with PfAgo exhibited a typical amplification curve, while the untreated PCR product showed a normal amplification curve. This indicates that the cleavage effect of PfAgo effectively eliminates PCR products. The results demonstrate that by integrating PfAgo with PCR technology, a novel detection method for simultaneous detection has been successfully developed. This novel detection method differs from existing pAgo technology and has several advantages: it eliminates the need for genomic DNA (gDNA) and prevents amplicon contamination, while also exhibiting significant potential for practical applications.

[0096] 2.4 Validation of the CREDIT method based on isothermal amplification

[0097] This study chose LAMP as the amplification method due to its high amplification efficiency, low cost, and good tolerance to amplification interference. To verify the effect of cleavage activity on LAMP products, *Salmonella typhimurium* was used as a model target. After obtaining LAMP products through conventional LAMP amplification of the model target, the LAMP products were cleaved using PfAgo or TtAgo. The cleaved products were then analyzed by agarose gel electrophoresis. Figure 3 The results showed that the LAMP products without PfAgo treatment exhibited typical ladder-like bands on agarose gel, while the products completely disappeared after PfAgo treatment, indicating that PfAgo can degrade LAMP products.

[0098] This invention also investigated the cutting time of PfAgo, and the results are as follows: Figure 17 As shown, through Figure 17 It was found that PfAgo treatment for 20 minutes completely degraded the LAMP product, while TtAgo degradation efficiency was much lower. Subsequently, the present invention used a probe containing a homologous sequence of the LAMP product (i.e., specific probe 2) to perform a cleavage reaction, and the results are as follows: Figure 4 As shown. (Through) Figure 4 The results showed that adding the probe to the cleavage reaction successfully induced an enhancement of the fluorescence curve. Furthermore, through... Figure 5 The feasibility of the cleavage effect in detecting LAMP products has been demonstrated. These results indicate that a credit-based LAMP detection method has been successfully developed.

[0099] 2.5 Optimization and Validation of the CREDIT Method Based on Isothermal Amplification

[0100] Under optimized conditions of 0.5 μM PfAgo and 1.75 mM Mn, this invention develops a LAMP-PfAgo-based CREDIT method for Salmonella Typhimurium. The real-time fluorescence curve report and blue light endpoint visualization results of this method are as follows: Figure 6 and Figure 7 As shown. (Through) Figure 6 and Figure 7 The results show that a LAMP-PfAgo-based CREDIT method for Salmonella Typhimurium has been successfully established.

[0101] This invention systematically evaluated the detection performance of the LAMP-PfAgo-based Salmonella Typhimurium CREDIT method, and the results are as follows: Figure 8 and Figure 9 As shown, through Figure 8 and Figure 9 This method demonstrates its ability to detect target sequences as low as 10 copies, sufficient for routine screening of Salmonella Typhimurium. The specificity of the method was validated by differentiating LAMP products from 11 pathogens using a probe (specific probe 2) and PfAgo, as shown in the figure. Figure 10 and Figure 11 as well as Figure 18 As shown. (Through) Figure 10 and Figure 11 as well as Figure 18 The results showed that only the LAMP product of Salmonella Typhimurium could induce a positive signal, while other LAMP products did not trigger fluorescence enhancement, confirming the high specificity of this method.

[0102] Meanwhile, this invention designed multiple single nucleotide differential probes to further determine specificity, and the results are as follows: Figure 12 As shown, through Figure 12 The fluorescence intensity decreased with increasing number of mutated bases, and three mismatches were sufficient to completely suppress probe reporting, indicating that this method has the potential to detect single nucleotide mutations. It is well known that LAMP reactions, due to their high amplification efficiency and the presence of multiple inverted repeat sequences in the product, are particularly prone to false positives due to contamination.

[0103] To assess the potential of the CREDIT method in eliminating LAMP contamination, this invention conducted two rounds of LAMP detection, such as... Figure 13 As shown, the first-round LAMP output is processed using PfAgo-based segmentation and then used as the input sample for the second-round LAMP. Through... Figure 13The results showed that, unlike the untreated LAMP product, the cleaved LAMP product did not produce a positive signal in the second round of reaction. This phenomenon indicates that the CREDIT method can effectively remove LAMP amplicon contamination. Given its high efficiency in amplicon removal, the CREDIT method can be seamlessly integrated into capless detection schemes and is suitable for field applications.

[0104] As a proof of concept, such as Figure 14 As shown, this invention successfully combines the LAMP-PfAgo-based Salmonella Typhimurium CREDIT method with lateral flow strips (LFS) for the detection of Salmonella Typhimurium. Figure 14 The LFS method clearly distinguishes between positive and negative test results. In summary, the LAMP-PfAgo-based CREDIT method for Salmonella Typhimurium developed in this invention solves two major challenges related to LAMP: sequence-specific detection and amplicon contamination. This method exhibits high sensitivity and specificity, demonstrating significant application potential.

[0105] Although embodiments of the invention have been shown and described, those skilled in the art will understand that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Claims

1. A LAMP-PfAgo-based nucleic acid detection composition for foodborne pathogens, characterized in that, include: Primers are designed based on the genes of foodborne pathogens; The probe, designed based on the gene amplification region of the foodborne pathogen, has the nucleotide sequence shown in SEQ ID NO.

1.

2. The LAMP-PfAgo-based nucleic acid detection composition for foodborne pathogens according to claim 1, characterized in that, The nucleotide sequences of the primers are shown in SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6 and SEQ ID NO.

7.

3. The LAMP-PfAgo-based nucleic acid detection composition for foodborne pathogens according to claim 1, characterized in that, The probe has a fluorescent reporter group and a fluorescent quencher group.

4. The LAMP-PfAgo-based nucleic acid detection composition for foodborne pathogens according to claim 1, characterized in that, The foodborne pathogen is bacteria.

5. The LAMP-PfAgo-based nucleic acid detection composition for foodborne pathogens according to claim 4, characterized in that, The bacteria is Salmonella typhimurium.

6. A nucleic acid detection kit for foodborne pathogens based on LAMP-PfAgo, characterized in that, Includes the foodborne pathogen detection composition based on LAMP-PfAgo as described in any one of claims 1-5.

7. A method for detecting nucleic acid of foodborne pathogens based on LAMP-PfAgo, characterized in that, The foodborne pathogen detection kit based on LAMP-PfAgo as described in claim 6 includes the following steps: LAMP amplification was performed using the RNA of the sample to be tested as a template through a LAMP amplification system. The LAMP amplification system contains primers from the LAMP-PfAgo-based foodborne pathogen detection kit. The LAMP amplification products were PfAgo-specifically cleaved using the PfAgo system. The PfAgo system includes probes from a LAMP-PfAgo-based foodborne pathogen detection kit. The cleavage product was purified, ligated, and subjected to PCR amplification. The fluorescence signal data monitored in real time during the PCR amplification process was recorded to obtain the fluorescence amplification curve. Foodborne pathogens are identified based on fluorescence amplification curves; a clear amplification curve indicates a positive result, while the absence of a clear amplification curve indicates a negative result.

8. The method according to claim 7, characterized in that, The LAMP amplification system includes: 0.2 μL of Bst DNA polymerase, 2 μL of 5 mol / L betaine, 0.8 μL of 10 mM dNTPs, 1 μL of 10×LAMP buffer, 0.4 μL of 20×SGI, 0.32 μL each of primers shown in SEQ ID NO. 2 and SEQ ID NO. 3, 0.08 μL each of primers shown in SEQ ID NO. 4 and SEQ ID NO. 5, 0.16 μL each of primers shown in SEQ ID NO. 6 and SEQ ID NO. 7, 1 μL of template, and 3.48 μL of sterile water.

9. The method according to claim 7, characterized in that, The PfAgo system includes: 2 μL of PfAgo buffer, 1.75 μL of 20 mM MnCl2, 5 μL of PfAgo, and 1 μL of the probe shown in SEQ ID NO. 1 (20 μM).

Images