DNA barcode sequence and application thereof
By designing specific primers F and R to amplify the aceE gene within the Clavibacter genus and constructing a phylogenetic tree, the problem of insufficient resolution in the identification of tomato canker pathogens using existing DNA barcodes was solved, achieving highly specific identification and interspecific differentiation of Clavibacter michiganensis.
Patent Information
- Application Number
- CN202610620851.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-05-08
- Publication Date
- 2026-06-05
- Estimated Expiration
- 2046-05-08
AI Technical Summary
Existing DNA barcoding technology has insufficient resolution in identifying Clavibacter michiganensis, the pathogen causing tomato canker, and cannot effectively distinguish closely related species. Universal primers have low amplification efficiency and contain repetitive units or regions that are difficult to sequence, which cannot meet the needs of port quarantine and field monitoring.
Specific primers F and R were designed based on the conserved regions of the aceE gene in various species of the Clavibacter genus. The amplification length was 400-700 bp, and the melting temperature was less than 69℃. These primers were used for PCR amplification and sequencing, and a phylogenetic tree was constructed for identification.
It achieves highly specific identification of Clavibacter michiganensis, accurately distinguishes species at the species level, has a high support rate for monophyletic groups, and can effectively identify other species in the Clavibacter genus, demonstrating strong species-level resolution.
Smart Images

Figure CN122146909A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial identification technology, specifically to a DNA barcode sequence and its applications. Background Technology
[0002] Tomato bacterial canker is a global, devastating bacterial disease caused by Corynebacterium micranthum. Clavibacter michiganensis Plant pathogens are quarantine pests in my country and many other countries, posing a serious threat to the tomato industry. DNA barcoding refers to a standardized, easily amplified, and relatively short DNA fragment within an organism that represents the species, allowing for rapid and accurate species identification. (This is relevant to plant pathogenic bacteria.) Clavibacter michiganensis In classification and identification, the application of DNA barcoding technology faces certain challenges, especially in recent years. Clavibacter The taxonomic status of genera has changed, with many subspecies being elevated to species status. Existing barcode genes have some shortcomings. For example: insufficient resolution, making it difficult to effectively distinguish closely related species (poor species-level discrimination); universal primers have low amplification efficiency or fail in this group; and the sequence contains repetitive units or regions that are difficult to sequence.
[0003] Therefore, there is an urgent need in this field for a single DNA barcode and its detection system that is highly sensitive, specific, easy to operate, and rapid for the accurate identification of tomato canker pathogen, in order to meet the urgent needs of port quarantine, field monitoring, and seed health certification. Summary of the Invention
[0004] To address the aforementioned shortcomings of existing technologies, the present invention aims to provide a DNA barcode sequence and its application for the accurate identification of tomato canker pathogen.
[0005] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: a DNA barcode is provided, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0006] This invention provides a method for identifying tomato canker pathogens using the aforementioned DNA barcode. Clavibacter michiganensis Applications in [the context of the text].
[0007] This invention provides a method for identifying the pathogen causing tomato canker. Clavibacter michiganensis The method includes the following steps: (1) Design specific primers F and R based on the conserved regions of DNA barcodes; (2) Extract genomic DNA from the pathogen to be tested; (3) Using the genomic DNA of the pathogen extracted in step (2) as a template, PCR amplification was performed using the specific primers in step (1); (4) Sequencing the PCR amplification products obtained in step (3), and then constructing a phylogenetic tree based on the sequencing results to identify the species of the pathogen to be tested.
[0008] Furthermore, the design rules for the specific primers F and R in step (1) are as follows: based on Clavibacter Species within the genus aceE Based on the gene sequence alignment results, specific primers were designed within conserved regions. The melting temperature of the primers was less than 69℃, and the length of the amplification product was controlled between 400-700 bp.
[0009] Furthermore, the nucleotide sequences of the specific primers F and R in step (1) are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
[0010] Furthermore, the PCR amplification reaction system in step (2) is as follows: 6.25µL of 2×KeyPo PCR Master Mix, 0.5µL each of upstream and downstream primers, 0.5µL of DNA template and 4.75µL of double-distilled water.
[0011] Furthermore, the PCR amplification reaction program in step (2) is as follows: 98℃ for 3 min; 98℃ for 5 s, 57℃ for 5 s, 72℃ for 10 s, 35 cycles; 72℃ for 10 min.
[0012] The present invention has the following beneficial effects: The present invention provides a method that can be used against tomato canker pathogens. Clavibacter michiganensis A novel DNA barcode sequence with high specificity for identification. Specific primers were designed based on the conserved regions of the DNA barcode of this invention. The amplified products were sequenced, and a phylogenetic analysis was constructed based on the sequencing sequences. The phylogenetic analysis results showed that in the phylogenetic tree constructed based on the DNA barcode sequence of this invention, all tested species formed independent monophyletic groups with high support. Further sequence alignment analysis showed that the amplified sequences of each species all possessed their unique single nucleotide polymorphism (SNP) sites. These results confirm that the DNA barcode provided by this invention can accurately distinguish *Tomato Canker* pathogens. Clavibacter michiganensis It can also effectively identify Clavibacter The other species within the genus demonstrate its strong species-level resolution. Attached Figure Description
[0013] Figure 1 DNA barcode of the present invention aceE Electrophoresis diagram of gene amplification; Figure 2 The strain samples in Table 1-2 are based on genes aceE The constructed phylogenetic tree; Figure 3For some strains in Table 1-2, based on genes gyrB The constructed phylogenetic tree; Figure 4 For some strains in Table 1-2, based on genes aceE The constructed phylogenetic tree. Detailed Implementation
[0014] The examples given below are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, conditions in the examples are performed under standard conditions or as recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.
[0015] Example 1: Bioinformatics Screening and Identification of DNA Barcode Sequences Download from NCBI database Clavibacter michiganensis Download the complete genome sequences (and annotation files) of all available strains. Clavibacter All other species ( C. capsici, C. tessellarius (etc.) and Escherichia coli The genomes of type strains from extant species were used as controls. Core and single-copy gene analyses were performed using bioinformatics tools. Multiple sequence alignment (MAFFT), SNP counting, calculation of intraspecific and interspecific SNP differences, and analysis of intraspecific and interspecific barcoding gaps were used to screen for a suitable gene. C. michiganensis Gene fragments that are highly conserved within the species but exhibit significant and stable differences from other closely related species (as shown in SEQ ID NO.1). Key data provided: C. michiganensis The number of intraspecific SNP sites is less than 2%, while the number of interspecific SNP sites between each closely related species is between 3% and 5%, indicating a significant barcoding gap.
[0016] Example 2: Design and synthesis of specific primers for DNA barcoding Specific primers F and R were designed based on conserved regions of the DNA barcode sequence (primer melting temperature less than 69℃, amplification product length controlled between 400-700 bp) to ensure primers... C.michiganensis The different strains were perfectly matched, and the primers were synthesized by a contract manufacturer. The nucleotide sequences of the specific primers F and R are shown below: F: 5'-CACGGACTACATCAACACCATC-3' (SEQ ID NO. 2); R: 5'-GCGGTTGGTGAGGTACTTGT-3' (SEQ ID NO. 3).
[0017] Example 3: The species-level resolution capability of the DNA barcode of the present invention A total of 36 bacterial strains were selected for PCR amplification and sequence analysis in this invention. Specific information is shown in Tables 1-2. Among them, sequence number 1 is... Clavibacter michiganensis The type strains were obtained from the NCBI database, and their sequence information was derived from the corresponding sequences within the primer regions of this invention. Sequences 2 to 25 were strains preserved in our laboratory, all of which underwent actual DNA extraction, PCR amplification, and sequencing to obtain the complete sequences of their respective regions. Sequences 26 to 36 were also derived from the NCBI database, covering the regions covered by this primer. All obtained sequences were subjected to multiple sequence alignment using MEGA software, and a phylogenetic tree was constructed based on the alignment results using the neighbor-joining method to evaluate the species-level resolution capability of the DNA barcode of this invention. PCR amplification and sequencing: The PCR reaction system is shown in Table 3; the reaction program was: 98℃ for 3 min; 98℃ for 5 s, 57℃ for 5 s, 72℃ for 10 s, 35 cycles; 72℃ for 10 min.
[0018] Table 1 Information on strains used (1)
[0019] Table 2 Information on the strains used (2)
[0020] Table 3 PCR reaction system
[0021] Results analysis: Depend on Figure 1 It can be seen that only in Clavibacter Clear and single target bands were amplified in each species of the genus, while no amplification products were observed in test strains of other non-target genera, indicating that the primers of this invention have good intrageneric universality and intergeneric specificity. Figure 1 In the middle, lanes 1-5 are C. nebraskensis Lanes 6-8 are C.insidiosus Lanes 9-12 are C.tessellarius Lanes 13-18 are C.michiganensis Lane 19 is Escherichia coli 20 lanes Xanthomonas oryzae pv. oryzae Lane 21 was used as a sterile water source (i.e., a negative control). Further sequence alignment analysis revealed that all... C. michiganensis The barcode sequence of the strain is highly consistent, showing significant intraspecific conservation. Meanwhile, Clavibacter Other species within the genus exhibit stable and specific single nucleotide polymorphism (SNP) sites in this region, and the SNP patterns among different strains of the same species are largely consistent, indicating that this DNA barcode has significant interspecific differentiation potential. A phylogenetic tree constructed based on the above sequencing sequences shows (see...) Figure 2(The species in the red box are the same species), and each species forms an independent monophyletic group with high support. C. michiganensis All strains clustered into one lineage, making them clearly distinguishable; other species within the genus also clustered separately, further confirming the accurate species-level resolution capability of the DNA barcode of this invention.
[0022] Current research indicates that... gy=]]gyrB Genes are relatively effective DNA barcodes for distinguishing species of the genus Corynebacterium. To verify the superiority of the DNA barcode provided by this invention, the DNA barcode sequence of this invention was compared with... gyrB Gene expression. Phylogenetic analysis shows (see...) Figures 3 - 4 ), gyrB The resolution at the seed level is lower than that of the DNA barcode of this invention; for example, it cannot... C. insidiosus All strains clustered into a single, independent monophyletic group. Genetic distance analysis further supports this conclusion. As shown in Table 4, the strains selected in this invention… aceE The mean interspecific genetic distance of gene barcodes was 0.05567, significantly greater than that of other species. gyrB The gene's value is 0.0388. This indicates... aceE Genes exhibit stronger distinguishing ability among species of the genus Corynebacterium. Furthermore, based on... aceE Gene sequences allow each closely related species to obtain its own unique and specific sequence, thus enabling accurate differentiation of most closely related species.
[0023] Table 4 C. michiganensis Genetic distance information statistics
[0024] The nucleotide sequence of the DNA barcode of this invention is as follows: CACGGACTACATCAACACCATCGCGCCGGAGAACGAGCCCGACTTCCCCGGTGACGAGGACCTCGAGCGCCGCTACCGCGCGTGGATCCGCTGGAATGCGGCCGTCACCGTGCACCGGGCCCAGCGCCCCGGCATCGCGGTGGGCGGCACATCGCCACCTACGCGTCCTCGGCCGCGCTCTACGAGGTCGGCTACAACCACTTCTTCCGCGGCCAGGACCACCCCGGCGGCG GCGACCAGGTCTTCGTGCAGGGCCACCGCATCGCCCGGCACCTACGCCCGCGCCTTCCTCGAGGGTCGCCTGAGCGAGCACCAGCTCGACGGCTTCCGCCAGGAGAAGAGCCACGCGGGCGGCGGGCT CTCCTCCTACCCGCACCCGCGTCTCATGCCGGAGTTCTGGCAGTTCCCCACGGTCTCGATGGGCCTCGGCCCCATCAACGCGATCTACCAGGCGCAGGCGAACAAGTACCTCACCAACCGC (SEQID NO.1).
[0025] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.
Claims
1. A DNA barcode, characterized in that, The nucleotide sequence of the DNA barcode is shown in SEQ ID NO.
1.
2. The DNA barcode described in claim 1 for identifying tomato canker pathogens. Clavibacter michiganensis Applications in [the context of the text].
3. A method for identifying the pathogen causing tomato canker. Clavibacter michiganensis The method is characterized by, Includes the following steps: (1) Design specific primers F and R based on the conserved regions of DNA barcodes; (2) Extract genomic DNA from the pathogen to be tested; (3) Using the genomic DNA of the pathogen extracted in step (2) as a template, PCR amplification was performed using the specific primers in step (1); (4) Sequencing the PCR amplification products obtained in step (3), and then constructing a phylogenetic tree based on the sequencing results to identify the species of the pathogen to be tested.
4. The method according to claim 3, characterized in that, The design rules for the specific primers F and R in step (1) are as follows: Based on Clavibacter Species within the genus aceE Based on the gene sequence alignment results, specific primers were designed within conserved regions. The melting temperature of the primers was less than 69℃, and the length of the amplification product was controlled between 400-700bp.
5. The method according to claim 4, characterized in that, The nucleotide sequences of the specific primers F and R described in step (1) are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively.
6. The method according to claim 3, characterized in that, The PCR amplification reaction system described in step (2) is as follows: 6.25µL of 2×KeyPo PCR Master Mix, 0.5µL each of upstream and downstream primers, 0.5µL of DNA template and 4.75µL of double-distilled water.
7. The method according to claim 3, characterized in that, The PCR amplification reaction procedure described in step (2) is as follows: 98℃ for 3 min; 98℃ for 5 s, 57℃ for 5 s, 72℃ for 10 s, 35 cycles; 72℃ for 10 min.
Citation Information
Patent Citations
Nest-type NEST-PCR amplification primer for detecting Clavibacter michiganensis subsp, michiganensis, detection kit and using method of kit thereof
CN101560570A
Method for rapidly detecting bacterial canker of tomatoes and special primer for method
CN104651490A
Barcode identification method for identifying different subspecies of clavibacter michiganensis and primer specially adopted in method
CN105200130A
Trichoderma fungus species identification primer based on mitochondria NAD5 gene sequence and application thereof
CN106048071A
Method for identifying tomato canker
CN110592247A