Molecular markers closely linked to rice herbicide resistance genes and their applications

By developing molecular markers 2-182333 and 2-182390, which are closely linked to herbicide-resistant genes in rice, the problems of limited application scope and high detection costs in existing technologies have been solved, enabling efficient identification and breeding of herbicide-resistant rice varieties and improving breeding efficiency.

CN122146920APending Publication Date: 2026-06-05JIANGSU LIXIAHE REGION AGRI RES INST
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGSU LIXIAHE REGION AGRI RES INST
Filing Date
2026-04-07
Publication Date
2026-06-05

AI Technical Summary

Technical Problem

Existing molecular markers for herbicide resistance in rice have problems such as limited application scope, high risk of recombination and segregation, and high detection costs, making it difficult to efficiently identify and breed herbicide-resistant rice varieties.

Method used

Molecular markers 2-182333 and 2-182390, which are closely linked to the herbicide resistance gene in rice, were developed and located 2.6 kb upstream and 0.6 kb downstream of the herbicide resistance gene, respectively. Accurate identification of herbicide-resistant rice varieties was achieved by PCR amplification and non-denaturing polyacrylamide gel electrophoresis.

Benefits of technology

It simplifies the breeding process, improves breeding efficiency, reduces testing costs, and can accurately distinguish between herbicide-resistant, herbicide-susceptible, and heterozygous genotypes, making it suitable for breeding herbicide-resistant japonica rice varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122146920A_ABST
    Figure CN122146920A_ABST
Patent Text Reader

Abstract

The application relates to a molecular marker closely linked to a rice herbicide-resistant gene and application thereof, the molecular marker is molecular marker 2-182333 or molecular marker 2-182390, and is located at 2.6 kb upstream or 0.6 kb downstream of the herbicide-resistant gene. Compared with the prior art, the two pairs of molecular markers provided by the application are closely linked to the herbicide-resistant gene, are located at the upstream and downstream of the herbicide-resistant gene, can accurately identify a herbicide-resistant japonica rice variety, the marker can simplify the breeding process and accelerate the breeding of the variety in the process of breeding the herbicide-resistant japonica rice variety; the molecular marker provided by the application is convenient to identify, the molecular marker 2-182333 and the molecular marker 2-182390 are codominant markers, can accurately distinguish three genotypes of the herbicide-resistant, herbicide-sensitive and hybrid types, the detected PCR amplification product is detected by using non-denaturing polyacrylamide gel electrophoresis, and cost can be saved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biological technology, specifically to a molecular marker closely linked to rice herbicide resistance genes and its application. Background Technology

[0002] In recent years, with the increase in labor costs and the migration of labor from rural to urban areas in my country, the area of ​​rice cultivated using direct seeding has been continuously expanding, and the problem of weeds in paddy fields has become increasingly serious. Currently, field weed control mainly relies on chemical control using herbicides; however, the continuous and repeated use of herbicides has led to the emergence of herbicide-resistant weeds. Switching to herbicides with different mechanisms of action is an effective solution to weed problems, with the use of low-toxicity, high-efficiency, broad-spectrum herbicides being more cost-effective. Combining herbicide-resistant rice with appropriate herbicides can effectively solve the problem of weeds in rice production, especially weedy rice.

[0003] As an important direction in genetic breeding, herbicide-resistant plants and their resistance mechanisms have been extensively studied by scholars both domestically and internationally. Through artificial mutagenesis and mutant screening, directed mutagenesis of herbicide resistance genes, or the introduction of exogenous resistance genes into rice, a series of herbicide-resistant rice materials have been created. Currently, the most widely used herbicide-resistant rice varieties are those resistant to imidazolinone herbicides (such as methoxypromethazine and imidazoline). The target of imidazolinone herbicides is acetyllactone synthase (ALS). Inhibition of ALS enzyme activity hinders the synthesis of branched-chain amino acids, thereby affecting protein synthesis and inhibiting plant growth. Mutations at different sites in ALS can lead to different levels of resistance in plants to different types of ALS-inhibiting herbicides. The S627N mutation type of ALS exhibits good herbicide resistance and is widely used in rice breeding, such as the Jinjing 818 bred by the Tianjin Rice Research Institute. The herbicide resistance level of Jietian Rice 001, bred based on the W548M mutation, was significantly improved without affecting yield.

[0004] In crop breeding, the application of molecular markers for selection offers advantages such as high specificity, cost-effectiveness, and short cycle time, and is unaffected by differences in gene expression and environmental conditions. Utilizing co-dominant herbicide resistance molecular markers for assisted selection can improve the efficiency of herbicide-resistant rice breeding. However, currently available molecular markers for rice resistance to imidazolinone herbicides are either located within the resistance gene, dependent on specific genotypes and thus limited in application; or rely on fluorescence detection equipment, resulting in high costs; or are located far from the resistance gene, posing a certain risk of recombination and segregation, thus lacking specificity. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention aims to develop a novel molecular marker that is closely linked to herbicide resistance genes, has an extremely low recombination rate, a wide range of applications, and low detection costs.

[0006] To achieve the above objectives, the present invention provides the following technical solution: A molecular marker closely linked to a rice herbicide resistance gene, wherein the molecular marker is molecular marker 2-182333 or molecular marker 2-182390, wherein the primer pair for amplifying the molecular marker 2-182333 includes the oligonucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2; The primer pair used to amplify the molecular marker 2-182390 includes the oligonucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4.

[0007] Furthermore, the molecular marker 2-182333 or the molecular marker 2-182390 is located 2.6 kb upstream or 0.6 kb downstream of the herbicide resistance gene, respectively.

[0008] A second objective of this invention is to provide the application of the molecular markers described above in the identification of herbicide-resistant rice.

[0009] Furthermore, PCR amplification of the genomic DNA of rice varieties was performed using primer pairs with molecular markers. Among them, the primer pair with molecular marker 2-182333 was able to amplify a DNA fragment of 281 bp, or the primer pair with molecular marker 2-182390 was able to amplify a DNA fragment of 125 bp, which indicates herbicide-resistant rice varieties.

[0010] Furthermore, the herbicide-resistant rice variety is a japonica rice variety or breeding material resistant to the herbicide methoxyfenozide.

[0011] Compared with the prior art, the beneficial effects of the present invention are: 1) The molecular markers 2-182333 and 2-182390 provided by this invention are closely linked to the herbicide resistance gene and are located upstream and downstream of the herbicide resistance gene, respectively, at a distance of 2.6 kb and 0.6 kb from the herbicide resistance gene. They can accurately identify herbicide-resistant japonica rice varieties. In the process of breeding herbicide-resistant japonica rice varieties, this marker can simplify the breeding process and accelerate the variety development.

[0012] 2) The molecular markers provided by this invention are convenient for identification. Molecular markers 2-182333 and 2-182390 are co-dominant markers, which can accurately distinguish between three genotypes: herbicide-resistant, herbicide-susceptible, and heterozygous. The PCR amplification products are detected by non-denaturing polyacrylamide gel electrophoresis, which can save costs. Attached Figure Description

[0013] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0014] Figure 1 This is a photograph of a japonica rice variety (line) used for herbicide resistance identification.

[0015] Figure 2 The results of detecting molecular marker 2-182333 in japonica rice varieties are shown in the figure (M is the marker; 1 is the herbicide-resistant line Yangxiangjing 2001; 2 is the herbicide-resistant line Suyuannuo 899; 3-48 are non-herbicide-resistant rice varieties).

[0016] Figure 3 The results of detecting molecular marker 2-182390 in japonica rice varieties are shown in the figure (M is the marker; 1 is the herbicide-resistant line Yangxiangjing 2001; 2 is the herbicide-resistant line Suyuannuo 899; 3-48 are non-herbicide-resistant rice varieties).

[0017] Figure 4 Photographs of herbicide resistance identification materials for japonica rice breeding.

[0018] Figure 5 The image shows the detection results of molecular marker 2-182333 in japonica rice breeding materials (M is the marker; R is the herbicide-resistant line; S is the herbicide-sensitive line; 1-46 are intermediate breeding material lines 1-46 in the selection nursery).

[0019] Figure 6 The results of detecting molecular marker 2-182390 in japonica rice breeding materials are shown (M is the marker; R is the herbicide-resistant line; S is the herbicide-sensitive line; 1-46 are the intermediate breeding material lines 1-46 in the selection nursery). Detailed Implementation

[0020] The technical solution of the present invention will now be clearly and completely described with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Furthermore, the technical features involved in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0022] Example 1: Identification of herbicide resistance in rice varieties and development of molecular markers (1) Identification of herbicide resistance in rice varieties Resistance to the herbicide methoxyfenozide was identified in 48 collected rice germplasm resources. Seeds were soaked and germinated before being sown in plastic pots (8 cm in diameter). When seedlings reached the 3-leaf stage, they were sprayed with a 100-fold diluted 4% methoxyfenozide aqueous solution. Plant survival was assessed 15 days later; surviving plants were classified as resistant, and those with dead leaves were classified as susceptible. Results showed that Yangxiangjing 2001 and Suyuannuo 899 exhibited herbicide resistance, while the control varieties Yangfujing 0318 and Yanghangnuo 1 showed no herbicide resistance and plant death. Figure 1 ).

[0023] (2) Molecular marker development Using the RiceVarMap v2.0 database (http: / / ricevarmap.ncpgr.cn / ), which contains genomic data from 4726 rice varieties, we queried upstream and downstream variation information of the ALS gene. We found that the variant sites vg0218233380 and vg0218239060 are highly specific in temperate japonica rice and have significant application potential. Based on the primer information provided by this database, we developed two pairs of molecular marker primers using PerlPrimer v1.1.21 software: Molecular marker 2-182333 primers: Pre-primer sequence: GCTTGTGGGAGAAAAGGGTCT (as shown in SEQ ID NO.1) Back primer sequence: TGCACGCATGTTTATCAGCA (as shown in SEQ ID NO.2).

[0024] Molecular marker 2-182390 primers: Pre-primer sequence: CCCGACCTTGGAGTATTGGT (as shown in SEQ ID NO.3) Back primer sequence: AGGTTGTGCTTTCCCTGGAT (as shown in SEQ ID NO.4).

[0025] To verify the specificity of the molecular markers, this study used herbicide-resistant Yangxiangjing 2001 and Suyuannuo 899 as control varieties and detected the band size of two molecular markers in 46 herbicide-intolerant rice varieties. These varieties were: Yangfujing 0318, Yanghangnuo 1, Fengxiangjing 2301, Huajing 2369, Huazhejing 2048, Huazhejing 2050, Huai 61345, Huaidao 26, Huaidao 5, Huainuo 51, Jinlingxiangnuo 1, Jinxiangyu 1, Jingdao 66, Jinghua 800, Lianjing 15, Lianjing 20, and Liannuo 191. 05, Nanjing 46, Nanjing 9036, Nanjing 9108, Qianxiangnuo No. 1, Rongjing 118, Sidao No. 20, Sidao 22-370, Sidao 301, Suxiu 839, Suxiu 867, Suyanjing 230, Tianlongjing 81, Wujing 38, Wujing 68, Wuxiangjing 113, Wuyujing 919, Wuyun 2026, Xu 92038, Xudao 119, Xudao No. 11, Xudao No. 12, Xudao No. 3, Yannuo 17279, Yangfujing No. 11, Yangfujing No. 12, Yangfujing 7008, Yangfujing No. 9, Yangnongxiang 28, Zaoxiangjing No. 1.

[0026] A small number of fresh leaves were collected from rice materials, and genomic DNA was extracted using a simplified CTAB method. Molecular markers were then amplified by PCR. The PCR reaction system consisted of 1.5 μL of DNA template and 2 μmol·L⁻¹ mol / L phosphate dehydrogenase. -1 Forward primer 1 μL, 2 μmol·L -1 1 μL reverse primer, 5 μL 2×Master Mix, and 1.5 μL ddH2O were used. The reaction program was set according to the Master Mix instructions, and the annealing temperature was adjusted as needed. The amplified products were detected by 8% polyacrylamide gel electrophoresis. The electrophoresis results showed that the sizes of the two molecular markers of the herbicide-resistant varieties Yangxiangjing 2001 and Suyuannuo 899 were 281 bp and 125 bp, respectively, while the sizes of the two molecular markers of the non-herbicide-resistant varieties were 300 bp and 154 bp, respectively. Figure 2 , Figure 3 These results indicate that molecular markers 2-182333 and 2-182390 have good specificity and can accurately distinguish and identify the resistance of rice varieties to the herbicide methoxyfenozide.

[0027] Example 2: Molecular marker-assisted selection of herbicide-resistant japonica rice breeding materials (1) Detection of molecular markers in breeding materials Rice breeding lines 1–46 were used. Small amounts of fresh leaves were collected from each line, and genomic DNA was extracted using a simplified CTAB method. Molecular markers were then amplified by PCR. The PCR reaction system consisted of 1.5 μL DNA template and 2 μmol·L⁻¹ HCl. -1 Forward primer 1 μL, 2 μmol·L -11 μL reverse primer, 5 μL 2×Master Mix, and 1.5 μL ddH2O were used. The reaction program was set according to the MasterMix instruction manual, and the annealing temperature was adjusted as needed. The amplification products were detected by 8% polyacrylamide gel electrophoresis.

[0028] The results showed that three genotypes were observed for both molecular markers in lines 1-46, and lines 2-182333 exhibited homozygous 281 bp, homozygous 300 bp, and heterozygous genotypes. Figure 5 ), 2-182390 has homozygous 125 bp, homozygous 154 bp and heterozygous types ( Figure 6 The two molecular markers have the same genotype in the breeding materials and are easily distinguishable. Herbicide-resistant genotype characteristics: 2-182333 is 281 bp and 2-182390 is 125 bp; herbicide-susceptible genotype characteristics: 2-182333 is 300 bp and 2-182390 is 154 bp.

[0029] (2) Identification of herbicide resistance in breeding materials To verify the consistency between the test results of 2-182333 and 2-182390 and the phenotype, herbicide resistance was identified in lines 2, 4, and 7 (resistant genotype) and lines 5, 6, and 12 (susceptible genotype) from the tested breeding materials. Figure 4 The experimental materials were soaked and germinated before being sown in plastic pots (8 cm in diameter). When the seedlings reached the 3-leaf, 1-heart stage, they were sprayed with a 100-fold diluted 4% methoxyfenozide solution at a rate of 300 L / hm². Plant survival was assessed 15 days later. Yangxiangjing 2001 and Yangfujing 0318 were used as controls. The results showed that lines 2, 4, and 7 were resistant to the herbicide methoxyfenozide, while lines 5, 6, and 12 did not, consistent with the results of molecular markers 2-182333 and 2-182390.

[0030] The above results indicate that amplifying the genomic DNA of japonica rice varieties or breeding materials using molecular marker primers 2-182333 (SEQ ID NO.1 / SEQ ID NO.2) or 2-182390 (SEQ ID NO.3 / SEQ ID NO.4) results in a 281 bp DNA fragment being amplified using molecular marker primer 2-182333 or a 125 bp DNA fragment being amplified using molecular marker primer 2-182390, indicating that the japonica rice varieties or breeding materials are resistant to the herbicide methoxyfenozide.

[0031] The molecular markers 2-182333 and 2-182390 provided by this invention can be used for the breeding of japonica rice varieties resistant to the herbicide methoxyfenozide. Molecular marker-assisted selection can greatly improve breeding efficiency.

[0032] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A molecular marker closely linked to a rice herbicide resistance gene, said molecular marker being molecular marker 2-182333 or molecular marker 2-182390. in, The primer pair used to amplify the molecular marker 2-182333 includes the oligonucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2; The primer pair used to amplify the molecular marker 2-182390 includes the oligonucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.

4.

2. The molecular marker according to claim 1, characterized in that, The molecular markers 2-182333 and 2-182390 are located 2.6 kb upstream and 0.6 kb downstream of the herbicide resistance gene, respectively.

3. The application of the molecular markers according to claim 1 or 2 in the identification of herbicide-resistant rice.

4. The application of the molecular marker according to claim 3 in the identification of herbicide-resistant rice, characterized in that, PCR amplification of genomic DNA of rice varieties using primer pairs with molecular markers: the primer pair with molecular marker 2-182333 can amplify a DNA fragment of 281 bp, or the primer pair with molecular marker 2-182390 can amplify a DNA fragment of 125 bp, which indicates herbicide-resistant rice varieties.

5. The application of the molecular marker according to claim 4 in the identification of herbicide-resistant rice, characterized in that, The herbicide-resistant rice variety is a japonica rice variety or breeding material resistant to the herbicide methoxyfenozide.