A method for efficiently synthesizing gastrodin by using recombinant corynebacterium glutamicum

Abstract

This invention discloses a method for the efficient synthesis of gastrodin using recombinant Corynebacterium glutamicum, belonging to the fields of genetic engineering, fermentation engineering, and synthetic biology. This invention uses Corynebacterium glutamicum as the host bacterium and knocks out… pobA The gene was expressed, and the engineered strain WN01 / pB6 was constructed using the expression plasmid pEC-XK99E to express cladoid-pyruvate lyase, carboxylic acid reductase, and glycosyltransferase, achieving heterologous synthesis of gastrodin. Further overexpression was then performed. aroG Genes, overexpression of protein-coding genes that activate carboxylic acid reductase sfp The engineered strain WN05 / pB6 was able to synthesize 7.37 g / L of gastrodin at the shake flask level, and the gastrodin yield reached 17.77 g / L at 72 h of batch fermentation in a 5-L fermenter, with a yield of 0.247 g / L / h. This provides a brand-new biomanufacturing platform for the industrial production of gastrodin.

Description

Technical Field

[0001] This invention relates to a method for the efficient synthesis of gastrodin using recombinant Corynebacterium glutamicum, belonging to the fields of genetic engineering, fermentation engineering, and synthetic biology. Background Technology

[0002] Gastrodin is the main active ingredient of the traditional Chinese medicine Gastrodia elata. Its chemical structure belongs to the benzyl alcohol glycoside class of compounds and has been proven to possess multiple biological activities, including antioxidant, anti-inflammatory, neuroprotective, vascular regulatory, hypoglycemic, and anti-tumor effects. It is widely used in the clinical treatment of diseases such as nervous system disorders, cardiovascular dysfunction, endocrine metabolic abnormalities, and liver damage. Currently, the market price of commercially available gastrodin raw materials is stable at 2000 yuan / kg, making it expensive. Its production mainly relies on four major technological systems: plant extraction, chemical synthesis, biotransformation, and microbial fermentation. Traditional plant extraction, which isolates and purifies the target component from the rhizome of Gastrodia elata, is limited by the natural deficiency of less than 0.7% gastrodin content in the raw material, resulting in high raw material consumption, complex extraction and purification processes, and low overall yield. While chemical synthesis can effectively improve production efficiency, it requires relatively strict reaction conditions and relies on the participation of toxic substances such as bromine, posing a significant environmental pollution risk. Biotransformation achieves green synthesis of the product through enzymatic catalysis; however, this technology requires the addition of expensive p-hydroxybenzyl alcohol as a substrate, increasing production costs. More importantly, the poor water solubility of p-hydroxybenzyl alcohol directly affects the synthesis of gastrodin, while microbial fermentation uses inexpensive raw materials such as glucose as substrates to directly synthesize gastrodin by introducing an exogenous gastrodin synthesis pathway. Compared with plant extraction, chemical synthesis, and biotransformation, microbial fermentation has become an increasingly important focus for researchers due to its advantages such as low production cost and minimal environmental pollution.

[0003] In 2016, Bai et al. reconstructed the gastrodin synthesis pathway in *Escherichia coli* by expressing *Rhodiola rosea* glycosyltransferase (UGT73B6), *Bacillus subtilis* phosphate pantothenicotinamide ethylamine transferase, and *Nocardia* carboxylreductase, achieving the first heterologous microbial synthesis of gastrodin. Subsequently, glucose-based gastrodin synthesis pathways were successfully constructed in *Saccharomyces cerevisiae* and *Yarrowia lipolytica*. *Yarrowia lipolytica* achieved a yield of 13.4 g / L, setting a new record for the highest yield of gastrodin synthesized by microbial fermentation. However, the fermentation cycle of *Yarrowia lipolytica* is relatively long (generally requiring 120 h), resulting in low production efficiency and high production costs, which is detrimental to large-scale production. Therefore, developing fermentation strains that can synthesize gastrodin more efficiently remains an urgent problem to be solved. Summary of the Invention

[0004] This invention provides a recombinant Corynebacterium glutamicum that produces gastrodin, reducing the p-hydroxybenzoic acid hydroxylase encoding gene.pobA The expression of the enzyme was enhanced by overexpression of the herbicides pyruvate lyase UbiC derived from Escherichia coli, the carboxylic acid reductase CAR derived from Mycobacterium abscessis, and the glycosyltransferase AtUGT derived from Arabidopsis thaliana.

[0005] In one embodiment, the recombinant Corynebacterium glutamicum is based on Corynebacterium glutamicum ATCC13032 as the starting strain.

[0006] In one embodiment, the recombinant Corynebacterium glutamicum knocked out the gene encoding p-hydroxybenzoic acid hydroxylase. pobA To block the degradation pathway of p-hydroxybenzoic acid.

[0007] In one embodiment, the nucleotide sequence of the branching acid-pyruvate lyase UbiC derived from Escherichia coli is shown in SEQ ID NO.1.

[0008] In one embodiment, the nucleotide sequence of the carboxylic acid reductase CAR derived from Mycobacterium abscessus is shown in SEQ ID NO.2.

[0009] In one embodiment, the nucleotide sequence of the Arabidopsis-derived glycosyltransferase AtUGT is shown in SEQ ID NO.3.

[0010] In one embodiment, the cladose acid-pyruvate lyase gene is expressed using plasmid pEC-XK99E as a vector. ubiC Carboxylic acid reductase gene car and glycosyltransferase gene AndUGT .

[0011] In one embodiment, the recombinant Corynebacterium glutamicum further enhances the shikimic acid pathway and the reduction reaction of p-hydroxybenzoic acid.

[0012] In one embodiment, the enhanced shikimic acid pathway is achieved by inserting a strong promoter P. sod overexpression aroG Genes; the stated aroG The nucleotide sequence of the gene is shown in SEQ ID NO.5.

[0013] In one embodiment, the enhanced p-hydroxybenzoic acid reduction reaction is achieved by inserting a strong promoter P. sod overexpression sfp Gene.

[0014] In one embodiment, pDXW-3 is used as a carrier for the purpose of... aroG Genes and sfp Strong promoter P inserted upstream of the gene sod .

[0015] In one implementation, promoter P sod The nucleotide sequence is shown in SEQ ID NO.4.

[0016] The present invention also provides a method for preparing gastrodin by fermentation, wherein the recombinant Corynebacterium glutamicum is cultured in a culture medium and induced with IPTG.

[0017] In one embodiment, the method involves fermentation at 25–32°C.

[0018] In one implementation, glucose is also added during the fermentation process.

[0019] In one embodiment, the fermentation process uses 25% ammonia water to adjust the pH to 6-8, and the initial stirring speed is 400-800 r·min. -1 The ventilation rate is 2–4 L·min -1 Dissolved oxygen levels are maintained between 20% and 40%.

[0020] The present invention also provides the application of the recombinant Corynebacterium glutamicum or the method thereon in the preparation of gastrodin or products containing gastrodin.

[0021] Beneficial effects: (1) This invention involves knocking out Corynebacterium glutamicum ATCC13032 cells. pobA Gene blocking of p-hydroxybenzoic acid degradation based on expression plasmid pEC-XK99E expression. ubiC , car and AndUGT The gene enabled the heterologous synthesis of gastrodin in Corynebacterium glutamicum.

[0022] (2) The recombinant bacteria constructed in this invention also overexpressed aroG Gene-enhanced shikimic acid pathway yielded 3.67 g / L gastrodin production from strain WN02 / pB6 after 72 h of fermentation. Further enhancement was achieved by overexpressing the protein-coding gene for activated carboxylic acid reductase. sfp The reduction reaction of p-hydroxybenzoic acid was enhanced, further increasing the gastrodin yield to 7.67 g / L.

[0023] (3) The production performance of strain WN05 / pB6 was evaluated in a 5 L fermenter. After 72 h of fermentation, the strain could produce 17.77 g / L gastrodin, with a yield of 0.247 g / L / h. Attached Figure Description

[0024] Figure 1 Strategy for constructing a heterologous gastrodin synthesis pathway in Corynebacterium glutamicum.

[0025] Figure 2 pB6 plasmid map.

[0026] Figure 3 Shake-flask fermentation of different recombinant strains. A. Growth curve; B. Glucose consumption curve; C. Gastrodin synthesis curve. Figure 4 Feed-in fermentation of engineered strain WN05 / pB6. Detailed Implementation

[0027] After recombinant Corynebacterium glutamicum cells were activated on plates for 12 hours, two loops of pea-sized bacterial slurry were scraped using an inoculation loop and transferred to 20 mL of LBG medium for 12 hours of incubation. Then, 4 mL of LBG bacterial culture was inoculated into 16 mL of seed culture medium and incubated for another 12 hours. Finally, 4 mL of seed culture was transferred to 16 mL of fermentation medium for fermentation. The activation temperature and fermentation speed were 30℃ and 200 rpm, respectively, with samples taken every 12 hours.

[0028] LBG medium: tryptone 10 g / L, NaCl 10 g / L, yeast extract 5 g / L, glucose 20 g / L.

[0029] Seed culture medium: corn steep liquor 10 g / L, yeast powder 10 g / L, (NH4)2SO4 15 g / L, MgSO4 2.5 g / L, KH2PO4 1 g / L, K2HPO4 0.5 g / L, Na2HPO4 0.5 g / L, glucose 30 g / L, CaCO3 10 g / L; Gastrodin fermentation medium: KH2PO4 1 g / L, yeast powder 3 g / L, MgSO4 1 g / L, (NH4)2SO4 10 g / L, MnSO4 20 mg / L, Fe2SO4 20 mg / L, thiamine 100 μg / L, biotin 1 mg / L, CaCO3 30 g / L.

[0030] Feeding medium: KH2PO4: 6 g / L, glucose: 750 g / L.

[0031] Gastrodin content determination: The fermentation broth was centrifuged at 12,000 rpm for 20 min. 100 μL of the supernatant was diluted 5-fold with deionized water to a final volume of 500 μL. The supernatant was filtered through a 0.22 μm filter and loaded onto a high-performance liquid chromatograph (Waters) for detection. The detection conditions were: column: C-18, detection wavelength: 220 nm, column temperature: 30℃, mobile phase: acetonitrile-water (5-95).

[0032] Example 1: Corynebacterium glutamicum pobA Construction of the knockout strain WN01 by Corynebacterium glutamicum Using the ATCC13032 genome as a template, primers were designed and amplified. pobA Upstream and downstream homologous arms of gene (Gene ID: 1019062). The pDXW-3 plasmid was processed with restriction endonucleases. Sac I and BamH I. Perform double enzyme digestion to obtain the linear vector. pobA The upstream and downstream homologous arms of the gene were cloned into a linear vector in one step and heat-shocked to transform into DH5α. The transformed cells were plated on LB agar plates containing 50 μg / mL kanamycin and cultured overnight. Single colonies were picked and verified by PCR using primers pDXW-3-F and pDXW-3-R. Gel electrophoresis showed a band of approximately 4000 bp, confirming the plasmid pDXW-3-Δ. pobA Successfully constructed. The amplification primers are: Δ pobA -up-F:gagtgcggccgcaagcttgtcgacggCCAGGTGCGATCTCGAAGT; Δ pobA -up-R:TGACACGAGCGTCATGGGGAACTCCTTTCATTG; Δ pobA -dn-F:GGAGTTCCCCATGACGCTCGGTCAACGACCAC; Δ pobA -dn-R:tgactggtggacagcaaatgggtcgcgCGGTGAGCAGCACGATGCCAT; The verification primers are: pDXW-3-F: cgggctttgttagcagccggat; pDXW-3-R:aacagctcagctagcatgactggt; plasmid pDXW-3-Δ pobA Electric shock converted to Corynebacterium glutamicum ATCC 13032 competent cells were plated on LB agar plates containing 12.5 μg / mL kanamycin. Single colonies were picked and cultured in liquid LB medium for 6 h, then plated on LB agar plates containing 100 g / L sucrose. The grown single colonies were verified using validation primers; no band was amplified, indicating that... pobA The knockout strain WN01 was successfully constructed. The validation primers were: ΔpobA-check-F:AAGATCACTTTGCCACCCAG; ΔpobA-down-R:tgactggtggacagcaaatgggtcgcgCGGTGAGCAGCACGATGCCAT.

[0033] Example 2: Construction of expression plasmid pB6 Use primers ubiC -F and ubiC -R amplification of the E. coli cladopyruvate lyase gene (nucleotide sequence as shown in SEQ ID NO.1), using primers. car -F and car -R amplification of the carboxylic acid reductase gene of Mycobacterium abscessus (nucleotide sequence as shown in SEQ ID NO.2), using AndUGT -F and AndUGT -R amplification of the Arabidopsis-derived glycosyltransferase gene (nucleotide sequence as shown in SEQ ID NO.3); subsequently, the amplified... ubiC , car and AndUGT One-step cloning of gene fragments to... EcoR I and Sac I. The purified plasmid pEC-XK99E was digested with enzymes. The reaction product was heat-shocked and transformed into DH5α, plated on LB agar plates containing 50 μg / mL kanamycin, and cultured overnight. Single colonies were picked and PCR was performed using verification primers pE-F and pE-R. Gel electrophoresis showed a band of approximately 5500 bp, confirming the successful construction of plasmid pB6. The amplification and verification primers were: ubiC -F:cacaggaaacagaccatgAAAGGAGGACAACCATGTCACACCCCGCGTTAACGCAAC; ubiC-R:TTAGTACAACGGTGACGCCGGTAAAAACAG; car -F:ACCGGCGTCACCGTTGTACTAA AAAGGAGGACAACCATGACTGAGACCAT; car -R:TTAAACCAGGCCCAGCAGCTGGATAT; AndUGT -F:ATATCCAGCTGCTGGGCCTGGTTTAA AAAGGAGGACAACCATGGAAG; AndUGT -R:gaggatccccgggtaccgTTAGTGGGTTGCCGTTCTGT; pE-F:tcacacaggaaacagaccat; pE-R:caaaacagccaagcttgcat.

[0034] Example 3: Corynebacterium glutamicum aroG Construction of overexpression strain WN02 Using the genome of strain WN01 constructed in Example 1 as a template, primers were designed to amplify P. sod (The nucleotide sequence is shown in SEQ ID NO.4) aroG (The nucleotide sequence is shown in SEQ ID NO.5) Upstream and downstream homologous arms of the gene. The pDXW-3 plasmid was processed with restriction endonucleases... Sac I and BamH I. Double enzyme digestion was performed to obtain a linear vector. The three fragments were cloned into the linear vector in one step and transformed into DH5α by heat shock. The vector was plated on LB agar plates containing 50 μg / mL kanamycin and cultured overnight. Single colonies were picked and verified by PCR using primers pDXW-3-F and pDXW-3-R. Gel electrophoresis showed a band of approximately 2200 bp, confirming the plasmid pDXW-3-P. sod - aroG Successfully constructed. The amplification primers are: aroG -up-F:ggccgcaagcttgtcgacggagctGATGCAGCGTATGCACCTG; aroG -up-R:TAATTGGCAGCTAGGGATGGGGTGAATTTAGGAAAC; P sod -F- aroG :TTCACCCCATCCCTAGCTGCCAATTATTCCGGGCTT; P sod -R- aroG : AGGGCTATGCATTGGGTAAAAAATCCTTTCGTAGG; aroG -dn-F:GGATTTTTTACCCAATGCATAGCCCTGAAAGGCAAG; aroG -dn-R:actggtggacagcaaatgggtcgcgACCAACGAGGAAGGACTCAATC; plasmid pDXW-3-P sod - aroGThe cells were electroporated into competent cells of strain WN01 constructed in Example 1, plated on LB agar plates containing 12.5 μg / mL kanamycin, and single colonies were picked and cultured in liquid LB medium for 6 h. These colonies were then plated on LB agar plates containing 100 g / L sucrose, and the resulting single colonies were analyzed using primer P. sod -F- aroG and aroG Verification using -dn-R yielded a band of approximately 1200bp, proving its effectiveness. aroG The overexpression strain WN02 was successfully constructed.

[0035] Example 4: Corynebacterium glutamicum sfp Construction of overexpression strain WN05 Using the genome of strain WN02 constructed in Example 3 as a template, primers were designed to amplify P. sod (The nucleotide sequence is shown in SEQ ID NO.4) sfp Upstream and downstream homologous arms of the gene (nucleotide sequence as shown in SEQ ID NO. 6). The pDXW-3 plasmid was processed with restriction endonucleases... Sac I and BamH I. Double enzyme digestion was performed to obtain a linear vector. The three fragments were cloned into the linear vector in one step and transformed into DH5α by heat shock. The vector was plated on LB agar plates containing 50 μg / mL kanamycin and cultured overnight. Single colonies were picked and verified by PCR using primers pDXW-3-F and pDXW-3-R. Gel electrophoresis showed a band of approximately 2200 bp, confirming the plasmid pDXW-3-P. sod - sfp Successfully constructed. The amplification primers are: sfp -up-F:ggccgcaagcttgtcgacggagctTCTGATCCGACTATTTGCGGTGATTTG ； sfp -up-R: TAATTGGCAGCTATGTCCACCTCCATCACTGGAT; P sod -F- sfp :GATGGAGGTGGACATAGCTGCCAATTATTCCGGGCTT; P sod -R- sfp :GACTCATCCAGCATTGGGTAAAAAAATCCTTTCGTAGG; sfp-dn-F:GGATTTTTTACCCAATGCTGGATGAGTCTTTGTTTCC; sfp -dn-R:actggtggacagcaaatgggtcgcgAGGTCGAATTTCGCTAGATAGG; plasmid pDXW-3-P sod - aroG The cells were electroporated into competent cells of strain WN02 constructed in Example 3, plated on LB agar plates containing 12.5 μg / mL kanamycin, and single colonies were picked and cultured in liquid LB medium for 6 h. These colonies were then plated on LB agar plates containing 100 g / L sucrose, and the resulting single colonies were analyzed using primer P. sod -F- sfp and sfp Verification using -dn-R yielded a band of approximately 1200bp, proving its effectiveness. aroG The overexpression strain WN05 was successfully constructed.

[0036] Example 5: Construction of Gastrodin-producing recombinant Corynebacterium glutamicum The plasmid pB6 constructed in Example 2 was electroporated into competent cells of strain WN01 constructed in Example 1, strain WN02 constructed in Example 3, and strain WN05 constructed in Example 4, respectively. The cells were plated on LB plates containing 12.5 μg / mL kanamycin. Single colonies were picked and verified using primers pE-F and pE-R. The amplification of a band of approximately 5500 bp proved that the gastrodin-producing bacteria WN01 / pB6, WN02 / pB6, and WN05 / pB6 were successfully constructed.

[0037] Example 6: Shake-flask fermentation of gastrodin-producing bacteria The strains WN01 / pB6, WN02 / pB6 and WN05 / pB6 constructed in Example 5 were streaked onto LB plates and cultured overnight. Then, the strains on the plates were transferred to 250 mL Erlenmeyer flasks containing 20 mL of LBG medium and cultured at 30 °C, 200 rpm for 12 h to obtain primary seed culture.

[0038] The primary seed culture was inoculated into a 250 mL Erlenmeyer flask containing 16 mL of seed culture medium at a 20% inoculation volume (v / v), and cultured at 30℃ and 200 rpm for 12 h to obtain the secondary seed culture.

[0039] The secondary seed culture was transferred at a 20% inoculum (v / v) to three 250 mL Erlenmeyer flasks containing 16 mL of fermentation medium. Kanamycin and 1 mM IPTG were added at the time of inoculation, and fermentation was carried out at 30 °C and 200 rpm for 72 h.

[0040] The results showed that after 72 h of fermentation, the gastrodin yields of the three engineered strains were 0.65 g / L, 3.67 g / L and 7.37 g / L, respectively, achieving heterologous synthesis of gastrodin in Corynebacterium glutamicum.

[0041] Example 7: Production of Gastrodin by Horizontal Fermentation in a Fermenter Seed culture was prepared according to the method in Example 6. The secondary seed culture of strain WN05 / pB6 constructed in Example 5 was inoculated into a 5-L fermenter at a 10% inoculum (v / v), with a total volume of 3 L. The temperature was controlled at 30°C, and the pH was adjusted to 7.0 using 25% ammonia. The stirring speed was correlated with dissolved oxygen, and the initial dissolved oxygen was maintained at 60%. The aeration rate was 2.5 L·min. -1 After 12 hours, dissolved oxygen was maintained at 30%. When the glucose concentration was below 5 g / L, feed medium was added to maintain the glucose concentration in the fermentation system at ≤30 g / L.

[0042] The results showed that the gastrodin content in the supernatant of the fermentation broth from strain WN05 / pB6 after 72 h of fermentation was 17.77 g / L, with a yield of 0.247 g / L / h, which is the highest yield reported to date. Compared with shake-flask fermentation, the gastrodin yield increased by 1.4 times, indicating that large-scale culture can further improve the synthesis of gastrodin, and it has great potential for industrial application.

[0043] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A recombinant Corynebacterium glutamicum that produces gastrodin, characterized in that, Decreased expression of p-hydroxybenzoic acid hydroxylase encoding gene pobA and overexpression of chorismate-pyruvate lyase UbiC from E. coli, carboxylate reductase CAR from M. abscessus and glycosyltransferase AtUGT from A. thaliana.

2. The recombinant Corynebacterium glutamicum according to claim 1, characterized in that, Knockout of p-hydroxybenzoic acid hydroxylase encoding gene pobA .

3. The recombinant Corynebacterium glutamicum according to claim 1 or 2, characterized in that, The starting strain was Corynebacterium glutamicum ATCC13032.

4. The recombinant Corynebacterium glutamicum according to any one of claims 1 to 3, characterized in that, The nucleotide sequence of the cladoid acid-pyruvate lyase UbiC is shown in SEQ ID NO.1, the nucleotide sequence of the carboxylic acid reductase CAR is shown in SEQ ID NO.2, and the nucleotide sequence of the glycosyltransferase AtUGT is shown in SEQ ID NO.

3.

5. The recombinant Corynebacterium glutamicum according to any one of claims 1 to 4, characterized in that, The cladose acid-pyruvate lyase gene was expressed using plasmid pEC-XK99E as a vector. ubiC Carboxylic acid reductase gene car and glycosyltransferase gene AtUGT .

6. The recombinant Corynebacterium glutamicum according to any one of claims 1 to 5, characterized in that, Using a strong promoter P sod overexpression aroG Genes, and / or with strong promoters P sod overexpression sfp Gene.

7. A method for preparing gastrodin by fermentation, characterized in that, The recombinant Corynebacterium glutamicum according to any one of claims 1 to 6 was cultured in a culture medium and induced with IPTG.

8. The method according to claim 7, characterized in that, Ferment at 25–32°C for at least 72 hours.

9. The method according to claim 7 or 8, characterized in that, Glucose is also added during the fermentation process.

10. The use of the recombinant Corynebacterium glutamicum according to any one of claims 1 to 6 or the method according to any one of claims 7 to 9 in the preparation of gastrodin or products containing gastrodin.

Images