A high-yield l-homoserine strain, a construction method and application thereof
By constructing recombinant Escherichia coli HOS15, the problem of low L-homoserine yield in microbial fermenters was solved, achieving efficient and low-cost fermentation production, optimizing fermentation process parameters, and increasing yield.
Patent Information
- Application Number
- CN202610596555.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-30
- Publication Date
- 2026-06-09
AI Technical Summary
Existing microbial methods for producing L-homoserine in fermenters have low yields, making it difficult to achieve efficient industrial production. Furthermore, chemical synthesis methods are costly and cause significant pollution.
Recombinant Escherichia coli HOS15 was constructed, and by knocking out or replacing key genes, heterologous NADH-dependent dehydrogenases were introduced to enhance the L-homoserine metabolic pathway and optimize fermentation process parameters.
This technology enables efficient production of L-homoserine in fermenters, reducing fermentation costs, increasing yield, and making the product competitive in the market.
Smart Images

Figure CN122168499A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a strain that produces high levels of L-homoserine, its construction method, and its applications. The invention belongs to the field of amino acid fermentation. Background Technology
[0002] L-homoserine belongs to the aspartic acid family of amino acids. As an intermediate amino acid, L-homoserine is a precursor to L-methionine and L-threonine, and also participates in the synthesis of some important compounds such as 1,4-butanediol, spermidine, tetrahydrofolate, and glufosinate. Compared with chemical synthesis methods, microbial fermentation is increasingly valued by researchers as a more economical and efficient method.
[0003] Currently, there are several main methods for producing L-homoserine: 1. Chemical method; 2. Chemical chiral resolution method; 3. Microbial method. Chemical synthesis methods have low yields, high reagent costs, and require large amounts of organic solvents, posing a significant environmental pollution threat. Microbial methods currently mainly involve constructing microbial cell factories using Escherichia coli or Corynebacterium glutamicum to generate L-homoserine from carbon sources such as glucose.
[0004] Microbial methods for preparing L-homoserine are currently a relatively advantageous approach. In the laboratory, shake-flask experiments are typically used to screen for high-yielding strains and optimize the basal culture medium. A strain that produces high yields in shake flasks demonstrates its high-yield potential. However, to achieve high yields in fermenters, the process parameters of the fermenter (dissolved oxygen, pH, feeding strategy, induction timing, etc.) must be re-optimized and finely controlled. If the scale-up process is not handled properly, it is common for the fermenter yield to be lower than that of the shake flask. Therefore, how to achieve efficient production of L-homoserine in industrial processes is an urgent problem to be solved. Summary of the Invention
[0005] The main objective of this invention is to address the aforementioned problems by providing a strain for the efficient fermentation production of L-homoserine, its construction method, and its applications. This strain utilizes a cofactor homogenization scheme to introduce a heterologous NADH-dependent dehydrogenase to replace the original NADPH-dependent dehydrogenase in *E. coli*, thereby removing cofactor limitations and constructing an efficient metabolic pathway for L-homoserine production. Furthermore, it knocks out the main byproduct pathway, enhances the supply of precursor substances, and strengthens the expression of efflux proteins.
[0006] The objective of this invention and the technical problem it solves are achieved by the following technical solutions.
[0007] The engineered strain HOS15 of this invention was developed by sequentially replacing the ptsG gene with the D-galactose transporter gene (galP) and the glucokinase gene (glk) from *E. coli*, knocking out the homoserine kinase gene (thrB), inserting the aspartate dehydrogenase gene (adhade) from *Achromobacter denitrificans* into the yedU and ymdE genes, and using the mutant aspartate semialdehyde dehydrogenase gene (ECasd). Q350N / H171A Insertion was performed into genes nmpC, fhiA, and tfaD. The homoserine dehydrogenase encoding gene (hompne) from *Polynucleobacter necessarius* subsp. *necessarius* was inserted into gene yghE. The pyruvate kinase encoding gene (pykA) was knocked out. Four copies of the mutant aspartate kinase encoding gene (thrA(S345F)) were inserted into the IS2 transposon element encoding gene (insC). The pyruvate dehydrogenase encoding gene (poxB) and the lactate dehydrogenase encoding gene (ldhA) were knocked out. The phosphoenolpyruvate encoding gene (ppc) was inserted into yqaC. The threonine transporter encoding gene (rhtA) was inserted into yjiV. The NADH ubiquinone reductase encoding gene (nuoF) was knocked out. The Escherichia coli mentioned is wild-type Escherichia coli W3110; The mutant E. coli genotype is E. coli W3110 ΔlacI, ΔptsG::glk, ΔptsG::galP, ΔthrB, ΔyedU::adhade, ΔymdE::adhade, ΔnmpC::ECasd Q350N / H171A ,ΔfhiA::ECasd Q350N / H171A ,ΔtfaD::ECasd Q350N / H171A ,ΔyghE::hompne,ΔinsC::thrA S345F ,ΔinsC::thrA S345F ,ΔinsC::thrA S345F ,ΔinsC::thrA S345F , ΔpoxB, ΔldhA, ΔyqaC::ppc, ΔyjiV::rhtA, ΔnuoF; The aspartate kinase / homoserine dehydrogenase 1 gene (thrA) S345F The homoserine dehydrogenase encoding gene (hompne) originates from *E. coli* W3110, and the aspartate semialdehyde dehydrogenase encoding gene (ECasd) originates from *Polynucleobacter necessarius* subsp. *necessarius*.Q350N / H171A The gene for aspartate dehydrogenase (adhade) originates from Escherichia coli W3110, and the gene encoding aspartate dehydrogenase (adhade) originates from Achromobacter denitrificans. The construction steps of the mutant Escherichia coli HOS15 are as follows: Using pQcascade as a template, primer pairs were used respectively: pQcascade-ptsG-F and pQcascade-ptsG-R, pQcascade-thrB-F and pQcascade-thrB-R, pQcascade-yedU-F and pQcascade-yedU-R, pQcascade-ymdE-F and pQcascade-ymdE-R, pQcascade-nmpC-F and pQcascade-nmpC-R, pQcascade-fhiA-F and pQcascade-fhiA-R, pQcascade-tfaD-F and pQcascade-tfaD-R, pQcascade-yghE-F and pQcascade-yghE-R, and pQcascade-insC-F. PCR amplification was performed on pQcascade-insC-R, pQcascade-poxB-F and pQcascade-poxB-R, pQcascade-yqaC-F and pQcascade-yqaC-R, pQcascade-ldhA-F and pQcascade-ldhA-R, pQcascade-yqaC-F and pQcascade-yqaC-R, pQcascade-yjiV-F and pQcascade-yjiV-R, pQcascade-nuoF-F and pQcascade-nuoF-R. The amplified fragments were digested with DpnI methyltransferase and transformed into E. coli DH5α competent cells. Positive clones were screened on LB plates containing streptomycin and then amplified using primers. After successful sequencing verification using pQcascade-cexu-F, the sequences were named pQcascade-ptsG, pQcascade-thrB, pQcascade-yedU, pQcascade-ymdE, pQcascade-nmpC, pQcascade-nmpC, pQcascade-fhiA, pQcascade-tfaD, pQcascade-lysA, pQcascade-yghE, pQcascade-insC, pQcascade-poxB, pQcascade-yqaC, pQcascade-ldhA, pQcascade-yqaC, pQcascade-yjiV, and pQcascade-nuoF, respectively. Using pDonor and E. coli genomes as templates, primer pairs galP-up and galP-down, glk-up and glk-down, asd-up and asd-down, thrA-up and thrA-down, ppc-up and ppc-down, rhtA-up and rhtA-down, and thrA were used respectively. S345F -up and thrA S345F PCR was performed using primers pDonor-up and pDonor-down. The amplified fragments were digested with DpnI methyltransferase and transformed into E. coli DH5α competent cells. Positive clones were screened on ampicillin-resistant LB plates and then sequenced using primers pDonor-cexu-up and pDonor-cexu-down. After successful sequencing verification, the clones were named pDonor-galP, pDonor-glk, pDonor-asd, pDonor-thrA, pDonor-ppc, and pDonor-rhtA. In addition, pDonor-hompne and pDonor-adhade were synthesized directly by the company.
[0008] The pQcascade-ptsG plasmid and pDonor-glk were mixed with electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then recovered in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with the pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IMPTG was added. After overnight incubation, the colonies were plated on solid LB medium containing the three antibiotics and 0.1 mM IMPTG. After single colonies grew, primers glk-yzup and glk-yzdown were used to transform the colonies. After sequencing verification and preparation of competent cells, pCutamp was added. After transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted on LB solid medium containing ampicillin resistance, kanamycin resistance, streptomycin resistance, and 10 g / L sucrose to screen for engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated. The bacteria on the sucrose plate were then transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate the pCutamp plasmid and obtain engineered strain HOS1. Electrocompetent cells were prepared from the E. coli mutant HOS1, mixed with pQcascade-ptsG plasmid and pDonor-galP plasmid, and the above steps were repeated. The E. coli mutant ΔptsG::glk was obtained by sequencing with primer pairs galP-yzup and galP-yzdown and named HOS1. Electrocompetent cells were prepared from the E. coli mutant HOS1 and mixed with pQcascade-ptsG and pDonor-galP plasmids. The above steps were repeated and sequenced using primer pairs galP-yzup and galP-yzdown to obtain the E. coli mutant ΔptsG::glkΔptsG::galP containing pCas plasmid, named HOS2. All subsequent gene editing steps were the same as above. Preferably, the method further includes the step of preparing electrocompetent cells: the engineered bacteria in the plate are inoculated into LB liquid shake tubes and cultured for 8 hours. Then, the culture is transferred to a 250 ml shake flask containing 50 ml of LB liquid medium and cultured for 3 hours. The culture is then placed on ice for 30 minutes, centrifuged at 4000 rpm for 10 minutes, resuspended in sterile water, and centrifuged at 4000 rpm for 10 minutes. The above steps are repeated once. The cells are then resuspended again in sterile water containing 20% glycerol, centrifuged at 3000 rpm for 10 minutes, and resuspended again in sterile water containing 20% glycerol. After resuspension, the cells are dispensed to obtain electrocompetent cells. The PCR amplification system consisted of: 10 μL of 5X SF Buffer, 1 μL of dNTP Mix (10 mM each), 20 ng of template pTargetF, 2 μL each of primers (10 μM), 1 μL of Phanta Super-Fidelity DNA Polymerase, and 34 μL of distilled water, for a total volume of 50 μL. The PCR amplification conditions were as follows: 95℃ pre-denaturation for 2 minutes (1 cycle); 95℃ denaturation for 10 seconds, 55℃ annealing for 20 seconds, and 72℃ extension for 1.5 minutes (30 cycles); 72℃ extension for 10 minutes (1 cycle).
[0009] The PCR amplification system consisted of: 10 μL of 5X SF Buffer, 1 μL of dNTP Mix (10 mM each), 5-20 ng of template, 2 μL each of primers (10 μM), 1 μL of Phanta Super-Fidelity DNA Polymerase, and 34 μL of distilled water, for a total volume of 50 μL. The PCR amplification conditions were as follows: 95℃ pre-denaturation for 2 minutes (1 cycle); 95℃ denaturation for 10 seconds, 55℃ annealing for 20 seconds, 72℃ extension for 0.5-2 minutes (30 seconds / kb) (30 cycles); 72℃ extension for 10 minutes (1 cycle).
[0010] This invention provides a recombinant *E. coli* strain, wherein the recombinant *E. coli* strain has the following genes knocked out: lacI, thrB, poxB, ldhA, and nuoF genes; overexpresses the glk and galP genes at the ptsG gene locus; and overexpresses ad at the ydeU and ymdE gene loci, respectively. hade The gene overexpressed ECasd at the nmpC, fhiA, and tfaD sites on the genome. Q350N / H171A The gene overexpresses hom at the yghE gene locus in the genome. pne The gene overexpresses thrA at the insC gene locus on the genome. S345F The gene overexpressed the ppc gene at the yqaC gene locus on the genome and the rhtA gene at the yjiV gene locus on the genome.
[0011] In one embodiment of the present invention, the glk gene, galP gene, and ad... hade Genes, ECasd Q350N / H171A Genes, hom pne Gene, thrA S345F The gene, ppc gene, and rhtA gene are expressed using the Ptrc promoter.
[0012] In one embodiment of the present invention, the ad hade Genes originate from Achromobacter denitrifying The hom pne Genes originate from Polynucleobacter essential subsp. Necessary .
[0013] In one embodiment of the present invention, the lacI gene is numbered AP_000997.1 on NCBI, the thrB gene is numbered AP_000667.1 on NCBI, the poxB gene is numbered AP_001502.1 on NCBI, the ldhA gene is numbered AP_002007.1 on NCBI, the nuoF gene is numbered AP_002882.1 on NCBI, the ptsG gene is numbered AP_001727.1 on NCBI, the glk gene is numbered AP_002988.1 on NCBI, the galP gene is numbered AP_003500.1 on NCBI, and the ydeU gene is numbered AC_000091.1, specifically genes 1,594379-1,595779 (genes). The ymdE gene has the NCBI ID 1095966-1096268 in AC_000091.1 (gene ID 12931055), the nmpC gene has the NCBI ID 574981-576108 in AC_000091.1 (gene ID 12930889), the fhiA gene has the NCBI ID 248358-250070 in AC_000091.1 (gene ID 12932596), the tfaD gene has the NCBI ID 580757-581320 in AC_000091.1 (gene ID 12933941), and the yghE gene has the NCBI ID 3109784-3110644 in AC_000091.1 (gene ID 12931228). The insC gene has the NCBI ID 12933357, the yqaC gene has the NCBI ID 2,786,298-2,786,894 (gene ID 12933264), the ppc gene has the NCBI ID AP_003854.1, the yjiV gene has the NCBI ID AC_000091.1 4578815-4581535 (gene ID 12933769), and the rhtA gene has the NCBI ID AP_001444.1.
[0014] The ad hade The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the ECasd... Q350N / H171A The nucleotide sequence of the gene is shown in SEQ ID NO.2, wherein the hom pne The nucleotide sequence of the gene is shown in SEQ ID NO.3, wherein the thrAS345F The nucleotide sequence of the gene is shown in SEQ ID NO.4.
[0015] In one embodiment of the present invention, thrA S345F The gene was inserted into the insC gene, which encodes the IS2 transposable protein element, and four copies were obtained.
[0016] In one embodiment of the present invention, the recombinant Escherichia coli uses Escherichia coli BL21(DE3) or Escherichia coli W3110 as the host cell.
[0017] The present invention also provides a method for preparing L-homoserine by fermentation, wherein the recombinant Escherichia coli is added to a system containing threonine and fermented to obtain L-homoserine.
[0018] In one embodiment of the present invention, in the shake flask fermentation system: the amount of recombinant Escherichia coli added is 1-10%; the fermentation conditions are: 30-37℃, 200-220 rpm, and pH value controlled at 6-7.
[0019] In one embodiment of the present invention, the substrate is threonine, and the amount of threonine added is 0.5-1 g / L.
[0020] In one embodiment of the present invention, the amount of recombinant Escherichia coli added in the upper tank system is 5%; the fermentation conditions are: temperature of 30-37℃, initial air flow rate of 1-2 vvm, stirring speed of 200-400 rpm, and dissolved oxygen concentration set at 100%. During cell growth, the air flow rate is adjusted to 1-2 vvm, and the air flow rate is appropriately increased according to dissolved oxygen and stirring speed. At the same time, the stirring speed is correlated with the DO value to control the dissolved oxygen concentration to be maintained at around 20-30%. When the initial glucose is consumed, the feeding medium is turned on. During the fermentation process, ammonia water is used to control the pH at 6.5-7.0.
[0021] In one embodiment of the present invention, the substrate is threonine, and the amount of threonine added is 0.5-1 g / L. Preferably, the application involves inoculating an activated, high-efficiency L-homoserine fermentation strain into a fermentation medium and preparing L-homoserine using a bio-fermentation method. The method includes: a temperature of 37°C, an initial air flux of 2 vvm, a stirring speed of 400 rpm, and a dissolved oxygen concentration of 100%. During cell growth, the air flux is adjusted to 1 vvm, and the aeration rate is appropriately increased according to the dissolved oxygen and stirring speed. Simultaneously, the stirring speed is correlated with the dissolved oxygen value to maintain the dissolved oxygen concentration at around 30%. When the initial glucose is consumed, the feeding medium is started. During fermentation, ammonia is used to control the pH at 7.0. When the cell density reaches an absorbance (OD600) of 70-80 at 600 nm, L-arabinose at a final concentration of 1 g / L is added to induce protein expression. At this point, the temperature is lowered to 30°C, and after eight hours of induction, the dissolved oxygen is reduced to 15-20%.
[0022] Preferably, the fermentation medium consists of: 2 g / L citric acid, 5 g / L potassium dihydrogen phosphate, 20 g / L glucose, 1 g / L MgSO4·7H2O, 5 mg / L vitamin B1, 1 g / L threonine, and pH 7.0±0.5. The present invention also provides the application of the above-mentioned recombinant Escherichia coli in the preparation of L-homoserine or products containing L-homoserine.
[0023] Beneficial effects This invention constructs a strain of *Escherichia coli* (strain number HOS15) capable of efficiently producing L-homoserine. By introducing a heterologous NADH-dependent dehydrogenase, a highly efficient L-homoserine metabolic pathway is constructed, eliminating the cofactor limitation of the original NADPH-dependent dehydrogenase and enabling efficient production of L-homoserine. Furthermore, fermentation is carried out using an inorganic salt medium, reducing fermentation costs and giving it strong market competitiveness. Attached Figure Description
[0024] Figure 1 L-homoserine metabolic pathway and the modifications made in this invention. Detailed Implementation
[0025] The construction method of the HOS0 (E. coli W3110, ΔlacI) strain involved in the following examples is described in the paper "Metabolic engineering of Escherichia coli W3110 for L-homoserine production".
[0026] The fermentation medium used in the following examples is as follows: Citric acid 2 g / L, potassium dihydrogen phosphate 5 g / L, glucose 20 g / L, MgSO4·7H2O 1 g / L, VB1 5 mg / L, threonine 1 g / L, pH 7.0±0.5.
[0027] The detection methods involved in the following embodiments are as follows: Residual glucose concentration during fermentation was detected using a biosensor analyzer (SBA-40C, Shandong, China). Cell density was measured by absorbance at 600 nm using a UV spectrophotometer. L-homoserine concentration was determined by high-performance liquid chromatography (HPLC) (Agilent 1260 series, CA, USA) using pre-column derivatization with o-phthalaldehyde (OPA). The chromatographic column was an Agilent ZORBAX Eclipes AAA, 3.5 μm, 3 × 150 mm. Mobile phase A: 10 mM sodium acetate; Mobile phase B: methanol: acetonitrile: water = 45:45:10.
[0028] The universal primers used in the following examples: pQcascade-cexu-F: cgccgcttcgttctaccatc; pQcascade-yz: gttctgttaattgccaacccaagtagc; pDonor-up: gctcacatgttctttcctgcgt; pDonor-down: gacgttgtaaaacgacggccagtg; The genotypes involved in the following examples are shown in Table 1 below: Table 1: Genotypes of the strains
[0029] The genes involved in the following examples are: lacI gene (NCBI ID: AP_000997.1), thrB gene (NCBI ID: AP_000667.1), poxB gene (NCBI ID: AP_001502.1), ldhA gene (NCBI ID: AP_002007.1), nuoF gene (NCBI ID: AP_002882.1), and ptsG gene (NCBI ID: AP_002882.1). The NCBI accession numbers for the glk gene, galP gene, and nmpC gene are: AP_001727.1, AP_002988.1, AP_003500.1, AC_000091.1 (1,594379-1,595779), AC_000091.1 (1095966-1096268), and AP_001727.1, AP_00298 ... The CBI numbers are: AC_000091.1, 574981-576108; the NCBI numbers for the fhiA gene are: AC_000091.1, 248358-250070; the NCBI numbers for the tfaD gene are: AC_000091.1, 580757-581320; the NCBI numbers for the yghE gene are: AC_000091.1, 3109784-3110644; and the insC gene is... The NCBI accession numbers for the following genes are: AP_004767.1, yqaC (AC_000091.1, 2,786,298-2,786,894), ppc (AP_003854.1), yjiV (AC_000091.1, 4578815-4581535), and rhtA (AP_001444.1).
[0030] In the examples described below, the concentrations of ampicillin added to the culture medium were: 100 mg / L, streptomycin: 50 mg / L, and kanamycin and apramycin: 50 mg / L.
[0031] Construction of recombinant plasmids involved in the following embodiments: pQcascade-ptsG plasmid, pQcascade-thrB plasmid, pQcascade-ydeU plasmid, pQcascade-ymdE plasmid, pQcascade-nmpC plasmid, pQcascade-fhiA plasmid, pQcascade-tfaD plasmid, pQcascade-yghE plasmid, pQcascade-insE plasmid, pQcascade-poxB plasmid, pQcascade-ldhA plasmid, pQcascade-yqaC plasmid, pQcascade-yjiV plasmid, pQcascade-nuoF plasmid, pDonor-glk plasmid, pDonor-galP plasmid, pDonor-adhade plasmid, pDonor-ECasd Q350N / H171A plasmid, pDonor-hom pne plasmid, pDonor-thrA S345F plasmid: Using pQcascade as a template, primer pairs were selected: pQcascade-ptsG-F and pQcascade-ptsG-R, pQcascade-thrB-F and pQcascade-thrB-R, pQcascade-yedU-F and pQcascade-yedU-R, pQcascade-ymdE-F and pQcascade-ymdE-R, pQcascade-nmpC-F and pQcascade-nmpC-R, pQcascade-fhiA-F and pQcascade-fhiA-R, pQcascade-tfaD-F and pQcascade-tfaD-R, pQcascade-yghE-F and pQcascade-yghE-R, and pQcascade-insC-F. PCR amplification was performed on pQcascade-insC-R, pQcascade-poxB-F and pQcascade-poxB-R, pQcascade-yqaC-F and pQcascade-yqaC-R, pQcascade-ldhA-F and pQcascade-ldhA-R, pQcascade-yqaC-F and pQcascade-yqaC-R, pQcascade-yjiV-F and pQcascade-yjiV-R, pQcascade-nuoF-F and pQcascade-nuoF-R. The amplified fragments were digested with DpnI methyltransferase and transformed into E. coli DHOS5α competent cells. Positive clones were screened on LB agar plates containing streptomycin and then... The pQcascade-cexu-F sequence was verified by sequencing. After correct sequencing, the pQcascade-ptsG, pQcascade-thrB, pQcascade-yedU, pQcascade-ymdE, pQcascade-nmpC, pQcascade-nmpC, pQcascade-fhiA, pQcascade-tfaD, pQcascade-lysA, pQcascade-yghE, pQcascade-insC, pQcascade-poxB, pQcascade-yqaC, pQcascade-ldhA, pQcascade-yqaC, pQcascade-yjiV, and pQcascade-nuoF were named respectively. Using pDonor and E. coli genomes as templates, primer pairs galP-up and galP-down, glk-up and glk-down, asd-up and asd-down, thrA-up and thrA-down, ppc-up and ppc-down, rhtA-up and rhtA-down, and thrA were used respectively. S345F -up and thrA S345F PCR was performed using primers pDonor-up and pDonor-down. The amplified fragments were digested with DpnI methyltransferase and transformed into E. coli DH5α competent cells. Positive clones were screened on ampicillin-resistant LB plates and then sequenced using primers pDonor-cexu-up and pDonor-cexu-down. After successful sequencing verification, the clones were named pDonor-galP, pDonor-glk, pDonor-asd, pDonor-thrA, pDonor-ppc, and pDonor-rhtA. In addition, pDonor-hompne and pDonor-adhade were synthesized directly by the company.
[0032] Example 1: Construction of genetically engineered bacteria The specific steps are as follows: 1. Construction of HOS1 and HOS2 strains HOS1 (HOS0,ΔptsG::Ptrc-glk) construction: The pQcascade-ptsG1 plasmid and pDonor-glk were mixed with HOS0 electrotransformed competent cells, placed in an electrotransformation cuvette, electrolyzed, and then LB liquid medium was added. After recovery at 30°C, the mixture was plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, they were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in the above-mentioned LB liquid medium containing the three resistances, and 0.1 mM IPTG was added. After overnight incubation, they were plated on solid LB medium containing the above three resistances and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers glk-yzup and glk-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, they were plated on solid LB medium containing apramycin. Single colonies were picked and spotted on ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10-cell-resistant agar plates respectively. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were transferred to LB solid medium containing apramycin and no antibiotics, and the pCutamp plasmid was eliminated to obtain engineered strain HOS1 (HOS0,ΔptsG::Ptrc-glk). HOS2 (HOS1,ΔptsG:: Ptrc-galP) construction: The pQcascade-ptsG2 plasmid and pDonor-galP were mixed with HOS1 electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then revived in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, they were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three resistances mentioned above, and 0.1 mM IPTG was added. After overnight incubation, they were plated on solid LB medium containing the three resistances and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers galP-yzup and galP-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, they were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates respectively. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp and obtain engineered strain HOS2 (HOS1,ΔptsG:: Ptrc-galP). Primers used for constructing pQcascade-ptsG1 and pQcascade-ptsG2 plasmids: pQcascade-ptsG1-F:gtggttgcgccactggtagtgaactgccgagtaggtagctgataacggatccg; pQcascade-ptsG1-R:taccagtggcgcaaccacgttatcagctacctactcggcagttcacccatgg; pQcascade-ptsG2-F: ggtatcaccgagccgatcgagttctccttcatgtgaactgccgagtaggtagctgataacggat; pQcascade-ptsG2-Rgatcggctcggtgataccgttatcagctacctactcggcagttcacccat; Primers used for constructing pDonor-galP and pDonor-glk plasmids: galP-up:tcacacaggaaacagaccatgcctgacgctaaaaaacagggg; galP-down:catattgaacgtaatctgatgaaaggtcgtaaactgcgcgaaataggcgctcacg; glk-up:tgtgggcggcaccaacgcacgtcttgctctgtgtgatattgcc glk-down:tttgttagcagccggatcttacagaatgtgacctaaggtctggcg Verify the primers used: galP-yzup: cactgaattattttactctgtgtaataaataaagggcgc; galP-yzdown: tcagcaggtaaatgcagtaccagtg; glk-yzup: cactgaattattttatctctgtgtaataaataaagggcgc; glk-yzdown: tcagcaggtaaatgcagtaccagtg; The gene sequences and primer sequences involved are shown in Table 2 below: Table 2: Gene Sequences
[0033] 2. Construction of strain HOS3 (HOS2, ΔthrB) HOS3 construction: pQcascade-thrB plasmid and pDonor were mixed with HOS2 electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then revived in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IPTG was added. After overnight incubation, the cells were plated on solid LB medium containing the three antibiotics and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers thrB-yzup and thrB-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were then transferred to LB solid medium containing apramycin and no antibiotics to eliminate plasmid pCutamp and obtain engineered strain HOS3 (HOS2, ΔthrB). Primers used for constructing the pQcascade-thrB plasmid: pQcascade-thrB-F:ggcagcattcattacgacaacgtggcaccgtggtgaactgccgagtaggtagctgataacggatccg; pQcascade-thrB-R: cacggtgccacgttgtcgtaatgaatgctgccgttatcagctacctactcggcagttcacccatgg; Primers used for verification: thrB-yzup: cagagacattcagtctcaacaacctcgg; thrB-yzdown: cacggtgccacgttgtcgtaatg; The gene sequences and primer sequences involved are shown in Table 3 below: Table 3: Gene Sequences
[0034] 3. Construction of HOS4~HOS5 strains HOS4(HOS3,ΔydeU:: Ptrc-ad) hade ) Build: The pQcascade-ydeU plasmid and pDonor-ad hadeMixed with HOS3 electrotransformed competent cells, the cells were electroporated in an electroporation cuvette, thawed in LB liquid medium at 30°C, and then plated onto LB plates containing ampicillin and streptomycin. The plates were incubated at 30°C, and positive clones were screened. PCR amplification was performed using universal primers pDonor-up and pDonor-down, pQcascade-cexu-F, and pQcascade-yz. Sequencing of the amplified fragments confirmed the selection of positive clones. Competent cells were prepared from the obtained positive clones and mixed with pTnsABC plasmid. After transformation, the cells were plated onto LB plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, with the addition of 0.1 mM IPTG. After overnight incubation, the colonies were plated onto solid LB medium containing the three antibiotics and 0.1 mM IPTG. After single colonies grew, primers adhade1-yzup and adhade1-yzdown were used. After sequencing verification and preparation of competent cells, pCutamp was added. After transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted on LB solid medium containing ampicillin resistance, kanamycin resistance, streptomycin resistance, and 10 g / L sucrose to screen for engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated. The bacteria on the sucrose plate were then transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate the pCutamp plasmid and obtain engineered strain HOS4. HOS5(HOS4,ΔymdE::Ptrc-ad) hade ) Build: The pQcascade-ymdE plasmid and pDonor-ad hadeMixed with HOS4 electrotransformed competent cells, the mixture was electroporated in an electroporator, thawed in LB liquid medium at 30°C, and then plated onto LB plates containing ampicillin and streptomycin. The plates were incubated at 30°C, and positive clones were screened. PCR amplification was performed using universal primers pDonor-up and pDonor-down, pQcascade-cexu-F, and pQcascade-yz. Sequencing of the amplified fragments confirmed the selection of positive clones. Competent cells were prepared from the obtained positive clones and mixed with pTnsABC plasmid. After transformation, the cells were plated onto LB plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, with the addition of 0.1 mM IPTG. After overnight incubation, the colonies were plated onto solid LB medium containing the three antibiotics and 0.1 mM IPTG. After single colonies grew, primers adhade2-yzup and adhade2-yzdown were used. After sequencing verification and preparation of competent cells, pCutamp was added. After transformation and resuscitation, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto LB solid medium containing ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10 g / L sucrose to screen for engineered strains with the pTnsABC, pQcascade, and pDonor plasmids eliminated. The bacteria from the sucrose-containing plates were then transferred to LB solid medium containing apramycin and antibiotic-free medium, and the pCutamp plasmid was eliminated to obtain the engineered strain HOS5 (HOS4,ΔymdE::Ptrc-ad). hade ); pQcascade-ydeU, pQcascade-ymdE plasmid, pDonor-ad hade Primers used in construction: pQcascade-ydeU-F: ggaaacaatggcctgatgacgttcaacgcgacgtgaactgccgagtaggtagctgataacggatccg; pQcascade-ydeU-R:gtcgcgttgaacgtcatcaggccattgtttccgttatcagctacctactcggcagttcacccatgg; pQcascade-ymdE-F:agagcatcaggttctgatgaacgtaacagcaagtgaactgccgagtaggtagctgataacggatccg; pQcascade-ymdE-R:ttgctgttacgttcatcagaacctgatgctctgttatcagctacctactcggcagttcacccatgg; Primers used for verification: adhade1-yzup-yzup: caaacggtcaacggtattgaactcat; adhade1-yzup-yzdown: gccatcacgccaagatgccagc; adhade2-yzup-yzup: gcgattatcttgccggactgga; adhade2-yzup-yzdown: cctttgcatcactaaatgctttacgacaatg; The gene sequences and primer sequences involved are shown in Table 4 below: Table 4: Gene Sequences
[0035] 4. Construction of HOS6~HOS8 strains HOS6(HOS5,ΔnmpC::Ptrc-ECasd Q350N / H171A Construction: The pQcascade-nmpC plasmid and pDonor-ECasd plasmid were constructed. Q350N / H171A Mixed with HOS5 electrotransformed competent cells, placed in an electroporation cuvette for electroporation, and then thawed in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and PCR amplification was performed using universal primers pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin, and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three resistances mentioned above, and 0.1 mM IPTG was added. After overnight incubation, the cells were plated on solid LB medium containing the three resistances and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers ECasd1-yzup and ECasd1-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp and obtain engineered strain HOS6. HOS7(HOS6,ΔfhiA::Ptrc-ECasd Q350N / H171A Construction: The pQcascade-fhiA plasmid and pDonor-ECasd plasmid were constructed. Q350N / H171A Mixed with electroporated HOS6 competent cells, placed in an electroporation cuvette for electroporation, and then thawed in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and PCR amplification was performed using universal primers pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with the pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin, and incubated at 30°C. After single colonies grew, a small amount of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IPTG was added. After overnight incubation, the cells were plated on agar plates containing the three antibiotics and 0.1 mM IPTG. After single colonies grew in IPTG solid LB medium, they were sequenced and verified using primers ECasd2-yzup and ECasd2-yzdown. Competent cells were prepared and pCutamp was added. After transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted on LB solid medium containing ampicillin resistance, kanamycin resistance, streptomycin resistance, and 10 g / L sucrose to screen for engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated. The bacteria on the sucrose plate were then transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate the pCutamp plasmid, resulting in the engineered strain HOS7. HOS8(HOS7,ΔtfaD::Ptrc-ECasd Q350N / H171A Construction: The pQcascade-tfaD plasmid and pDonor-ECasd plasmid were constructed. Q350N / H171A Mixed with electrotransformed competent cells, placed in an electrotransformation cuvette for electroporation, and after recovery in LB liquid medium at 30°C, the mixture was spread on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and PCR amplification was performed using universal primers pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, they were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three resistances mentioned above, and 0.1 mM IPTG was added. After overnight incubation, they were plated on solid LB medium containing the three resistances and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers ECasd3-yzup and ECasd3-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, they were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates respectively. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria from the sucrose-containing plates were then transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp, resulting in engineered strain HOS8 (HOS7, ΔtfaD:: Ptrc-ECasd). Q350N / H171A ); Primers used for constructing the pQcascade-ptsG plasmid: pQcascade-nmpC-F:gtaactacggtgtagcatacgacatcggtgcggtgaactgccgagtaggtagctgataacggatccg; pQcascade-nmpC-R: cgcaccgatgtcgtatgctacaccgtagttacgttatcagctacctactcggcagttcacccatgg; pQcascade-fhiA-F:gcgtcagcgacaacggcgatatcgcccatgacgtgaactgccgagtaggtagctgataacggatccg; pQcascade-fhiA-R:gtcatgggcgatatcgccgttgtcgctgacgcgttatcagctacctactcggcagttcacccatgg; pQcascade-tfaD-F: ggaaggggagtttcagaagtggaacggtacaggtgaactgccgagtaggtagctgataacggatccg; pQcascade-tfaD-F:ctgtaccgttccacttctgaaactccccttccgttatcagctacctactcggcagttcacccatgg; pDonor-ECasd Q350N / H171A Primers used for plasmid construction: ECasd-up:tccggctcgtataatgtgttcacacaggaaacagaccatgaaaaatgttggttttatcggctggc; ECasd-down:tttgttagcagccggatcttacgccagttgacgaagcatccga; Primers used for verification: ECasd1-yzup: gatctgtacgggaaagttaatgctaagcac; ECasd1-yzdown: accagaccaaagaagtcgttgttacgata; ECasd2-yzup: cactgaattattttactctgtgtaataaataaagggcgc; ECasd2-yzdown: tcagcaggtaaatgcagtaccagtg; ECasd3-yzup: gatgagtcatcgtggcatctcgttgaa; ECasd3-yzdown: ctgaagtggcgcaatatgctcact; The gene sequences and primer sequences involved are shown in Table 5 below: Table 5: Gene Sequences
[0036] 5. HOS9 strain (HOS8,ΔyghE::Ptrc-hom pne Construction of ) HOS9 construction: pQcascade-yghE plasmid, pDonor-hom pne Mixed with HOS8 electrotransformed competent cells, placed in an electrotransformation cuvette for electroporation, and then thawed in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and PCR amplification was performed using universal primers pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin, and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three resistances mentioned above, and 0.1 mM IPTG was added. After overnight incubation, the cells were plated on solid LB medium containing the three resistances and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers hom-yzup and hom-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria from the sucrose-containing plates were then transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp, resulting in engineered strain HOS9 (HOS8, ΔyghE:: Ptrc-hom). pne ); pQcascade-yghE plasmid, pDonor-hom pne Primers used in construction: pQcascade-yghE-F:tgaccgttacagctctgcccgccattaccactgtgaactgccgagtaggtagctgataacggatccg; pQcascade-yghE-R:agtggtaatggcgggcagagctgtaacggtcagttatcagctacctactcggcagttcacccatgg; Primers used for verification: hom-yzup: ttatctgccgcatcgatgaatgcc; hom-yzdown: ccgcttctgctccgggaacaac; The gene sequences and primer sequences involved are shown in Table 6 below: Table 6: Gene Sequences
[0037] 6. HOS10 strain (HOS9,ΔinsC::Ptrc-thrA S345F Construction of ) HOS10:HOS9,ΔinsC::thrAS345F (four copies) (insC has six copies in the E. coli W3110 genome, with co-expressed genes inserted in four of these copies). HOS10 construction: The pQcascade-insC plasmid and pDonor-thrA were used. S345F Mixed with HOS9 electrotransformed competent cells, placed in an electroporation cuvette for electroporation, and then thawed in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and PCR amplification was performed using universal primers pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with the pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin, and incubated at 30°C. After single colonies grew, a small amount of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IPTG was added. After overnight incubation, the cells were plated on agar plates containing the three antibiotics and 0.1 mM IPTG. After single colonies grew in IPTG solid LB medium, they were sequenced and verified using primers thrA1-yzup and thrA1-yzdown, thrA2-yzup and thrA2-yzdown, thrA3-yzup and thrA3-yzdown, and thrA4-yzup and thrA4-yzdown. Competent cells were prepared, pCutamp was added, and after transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto LB solid medium containing ampicillin resistance, kanamycin resistance, streptomycin resistance, and 10 g / L sucrose to screen for engineered bacteria with the pTnsABC, pQcascade, and pDonor plasmids eliminated. The bacteria from the sucrose-containing plates were then transferred to LB solid medium containing apramycin and antibiotic-free medium, and the pCutamp plasmid was eliminated to obtain the engineered strain HOS9,ΔinsC::Ptrc-thrA S345F ; Following the above method, insC has 6 copies in the E. coli W3110 genome, and a co-expressed gene was inserted into four of these copies, resulting in HOS9,ΔinsC::Ptrc-thrA. S345F ΔinsC:: Ptrc-thrA S345F ΔinsC:: Ptrc-thrA S345F ΔinsC:: Ptrc-thrA S345F Named as: HOS9,ΔinsC:: Ptrc-thrA S345F -4 (HOS10).
[0038] pQcascade-insC plasmid, pDonor-thrA S345FPrimers used in construction: pQcascade-insC-F:ggggatgacggtctccctcgttgcccggcaacgtgaactgccgagtaggtagctgataacggatccg; pQcascade-insC-R:gttgccgggcaacgagggagaccgtcatccccgttatcagctacctactcggcagttcacccatgg; thrA S345F -up:tcacacaggaaacagaccatgcgagtgttgaagttcggcg; thrA S345F -down:tttgttagcagccggatctcagactcctaacttccatgagagggtacg; S345F-up: cgcccgtattttcgtggtgctgatta S345F-down:gcaccacgaaaatacgggcgcg Verify the primers used: thrA1-yzup: cgctgcccgatataacaacctaa; thrA1-yzdown: cctggccgctaatggttttttcaatc; thrA2-yzup:ttcactgttgaagccgccggtag;thrA2-yzudown:cctggccgctaatggttttttcaatc;thrA3-y zup: cgataatttgcaggacatccccggagtagag; thrA3-yzdown: cctggccgctaatggttttttcaatc; thrA4-yzup: atttgcccctatatttccagacatctgttatcacttaa; thrA4-yzdown: cctggccgctaatggttttttcaatc; The gene sequences and primer sequences involved are shown in Table 7 below: Table 7: Gene Sequences
[0039] 7. Construction of strains HOS11-HOS15 HOS11 (HOS10, ΔpoxB) build: The pQcascade-poxB plasmid and pDonor were mixed with HOS10 electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then revived in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with the pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IPTG was added. After overnight incubation, the colonies were plated on solid LB medium containing the three antibiotics and 0.1 mM IPTG. After single colonies grew, primers poxB-yzup and poxB-yzdown were used. After sequencing verification and preparation of competent cells, pCutamp was added. After transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted on LB solid medium containing ampicillin resistance, kanamycin resistance, streptomycin resistance, and 10 g / L sucrose to screen for engineered bacteria that eliminated pTnsABC, pQcascade, and pDonor plasmids. The bacteria on the sucrose plate were then transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate the pCutamp plasmid, resulting in the engineered strain HOS11. HOS12 (HOS11,ΔldhA) construction: The pQcascade-ldhA plasmid and pDonor were mixed with HOS11 electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then recovered in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, they were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three resistances mentioned above, and 0.1 mM IPTG was added. After overnight incubation, they were plated on solid LB medium containing the three resistances and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers ldhA-yzup and ldhA-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, they were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates respectively. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp and obtain engineered strain HOS12. HOS13 (HOS12,ΔyqaC::Ptrc-ppc) build: The pQcascade-yqaC plasmid and pDonor-ppc were mixed with HOS12 electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then revived in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, they were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IPTG was added. After overnight incubation, they were plated on solid LB medium containing the three antibiotics and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers ppc-yzup and ppc-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, they were plated on solid LB medium containing apramycin. Single colonies were picked and spotted on ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp and obtain engineered strain HOS13. HOS14 (HOS13,ΔyjiV:: Ptrc-rhtA) build: The pQcascade-yjiV plasmid and pDonor-rhtA were mixed with HOS13 electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then recovered in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, the cells were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IPTG was added. After overnight incubation, the cells were plated on solid LB medium containing the three antibiotics and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers rhtAm-yzup and rhtA-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, the cells were plated on solid LB medium containing apramycin. Single colonies were picked and spotted onto ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10% LB agar plates. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp and obtain engineered strain HOS14. HOS15 (HOS14, ΔnuoF) build: The pQcascade-nuoF plasmid and pDonor were mixed with HOS14 electrotransformed competent cells, placed in an electroporation cuvette, electroporated, and then revived in LB liquid medium at 30°C. The mixture was then plated on LB plates containing ampicillin and streptomycin and cultured at 30°C. Positive clones were screened, and pDonor-up and pDonor-down, pQcascade-cexu-F and pQcascade-yz were amplified by PCR using universal primers. The amplified fragments were sequenced to verify the screening of positive clones. The obtained positive clones were prepared into competent cells and mixed with pTnsABC plasmid. After transformation, they were plated on LB agar plates containing ampicillin, streptomycin, and kanamycin and incubated at 30°C. After single colonies grew, a small number of single colonies were scraped off and resuspended in LB liquid medium containing the three antibiotics, and 0.1 mM IPTG was added. After overnight incubation, they were plated on solid LB medium containing the three antibiotics and 0.1 mM IPTG. After single colonies grew, they were sequenced using primers nuoF-yzup and nuoF-yzdown. After preparing competent cells, pCutamp was added, and after transformation and revival, they were plated on solid LB medium containing apramycin. Single colonies were picked and spotted on ampicillin-resistant, kanamycin-resistant, streptomycin-resistant, and 10 μmol / L agar plates. Engineered bacteria with pTnsABC, pQcascade, and pDonor plasmids eliminated were screened on LB solid medium containing g / L sucrose. The bacteria on the sucrose plate were transferred to LB solid medium containing apramycin and antibiotic-free medium to eliminate plasmid pCutamp and obtain engineered strain HOS15. Primers used for constructing plasmids pQcascade-poxB, pQcascade-ldhA, pQcascade-yqaC, pQcascade-yjiV, and pQcascade-nuoF: pQcascade-insC-F: cacaagtactggcgattgccatgcgcaaagcggtgaactgccgagtaggtagctgataacggatccg; pQcascade-insC-R: cgctttgcgcatggcaatcgccagtacttgtggttatcagctacctactcggcagttcacccatgg; pQcascade-insC-F:gcccggtgctggaagagctgaaaaagcacggcgtgaactgccgagtaggtagctgataacggatccg; pQcascade-insC-R: gccgtgctttttcagctcttccagcaccgggcgttatcagctacctactcggcagttcacccatgg; pQcascade-insC-F: attgatttttcattgctcatgaaaacgataaagtgaactgccgagtaggtagctgataacggatccg; pQcascade-insC-R: tttatcgttttcatgagcaatgaaaaatcaatgttatcagctacctactcggcagttcacccatgg; pQcascade-insC-F: acaatctcaagtatcccatcagaaagacggatgtgaactgccgagtaggtagctgataacggatccg; pQcascade-insC-R: atccgtctttctgatgggatacttgagattgtgttatcagctacctactcggcagttcacccatgg; pQcascade-insC-F: tttacagacagtcgacaagggacagcccgaatgtgaactgccgagtaggtagctgataacggatccg; pQcascade-insC-R: attcgggctgtcccttgtcgactgtctgtaaagttatcagctacctactcggcagttcacccatgg; Primers used for the construction of pDonor-ppc and pDonor-rhtA plasmids: ppc-up: tcacacaggaaacagaccatgaacgaacaatattccgcattgcg; ppc-down: tttgttagcagccggatcttagccggtattacgcatacctgccg; rhtA-up: atccggctcgtataatgcctctagaaataatagaggtatacatatgcctggttcattacgtaaaatgcc; rhtA-down: tttgttagcagccggatcttaattaatgtctaattcttttattttgctctctttgcgtac; Verify the primers used: poxB-yzup: gctgaagcacaacttagcggagaact; poxB-yzdown: ccagtacttgtgggatctgctccg; ldhA-yzup: gaaaaag cacggcgttaaatatatcgcc;ldhA-yzudown:ctccacaccgagttccagcgc;ppc-yzup:cgttatgaattacatggaatatctggtaacttg tc;ppc-yzdown:aaatagaaagtcattgaaaagattaccattgttag;rhtA-yzup:gacgcgccgtattggcgttattaaca;rhtA-yzdown :ctttgatgccagctgagaatttcgac;nuoF-yzup:agcctgatgccgaaagacgaa;nuoF-yzdown:acgtccttccagggagttgattaacg; The gene sequences involved are shown in Table 8 below: Table 8: Gene Sequences
[0040] Example 2: Preparation of L-homoserine by shake-flask fermentation (1) HOS1~HOS15 were inoculated into LB medium and cultured at 37℃ and 200 rpm for 8 h to prepare seed liquid. The prepared seed liquid was transferred to fermentation medium at an inoculation rate of 5% (v / v) and cultured at 37℃, 200 rpm and pH 7 for 48 h to prepare fermentation broth. (2) The yield of L-homoserine in the fermentation broth was detected, and the results are shown in Table 9. The results show that: Table 9: L-homoserine yield of different strains
[0041] Example 3: Effects of different construction methods on the fermentation preparation of L-homoserine by genetically engineered bacteria (1) The specific construction method is the same as HOS15, the difference being that the adjustment comes from Achromobacter denitrificans The aspartate dehydrogenases (adhade) (HOS15 strain) were: aspartate dehydrogenase from Pseudomonas aeruginosa (NCBI number: NC_002516.2), and aspartate from... Rhodopseudomonas palustrisAspartate dehydrogenase (NCBI ID: NZ_CP066699.1), derived from... Bradyrhizobium japonicum Aspartate dehydrogenase (NCBI ID: NZ_CP058354.1) was used to prepare HOS15-1, HOS15-2, and HOS15-3, respectively.
[0042] (2) The specific construction method is the same as that of HOS15, except that the homoserine dehydrogenase encoding gene (hompne) from Polynucleobacter necessarius subsp. Necessarius (HOS15 strain) is adjusted as follows: the homoserine dehydrogenase encoding gene from Bacillus subtilis (NCBI number: NC_000964.3), the homoserine dehydrogenase encoding gene from Corynebacterium glutamicum (NCBI number: NC_003450.3), and the homoserine dehydrogenase from Pseudomonas aeruginosa (NCBI number: NC_002516.2); and HOS15-4, HOS15-5, and HOS15-6 are prepared respectively.
[0043] (3) The specific construction method is the same as that of HOS15. The difference is that the number of copies of the mutant aspartate kinase encoding gene (thrA(S345F)) inserted into the IS2 transposable protein element encoding gene (insC) is adjusted to 1, 2, 3 and 5 respectively. The strains prepared are named as HOS15-7, HOS15-8, HOS15-9 and HOS15-10 respectively.
[0044] (3) The above-mentioned strains were prepared according to the method in Example 2, and the results are shown in Table 10: Table 10: L-homoserine yield of different strains
[0045] Example 4: Preparation of L-homoserine by fermentation of HOS15 genetically engineered bacteria under upper tank conditions The specific steps are as follows: Fermentation medium: citric acid 2 g / L, potassium dihydrogen phosphate 5 g / L, glucose 20 g / L, MgSO4·7H2O 1 g / L, VB1 5 mg / L, threonine 1 g / L.
[0046] The prepared HOS15 strain was streaked in LB solid medium and incubated at 37°C for 12 h to activate the strain. A single colony was picked and inoculated into a shake flask containing 50 mL of LB liquid medium and incubated at 37°C and 200 rpm for 10 h. Then, a 1% (v / v) inoculation was added to another shake flask containing 50 mL of LB liquid medium and incubated at 37°C and 200 rpm for 5 h. Finally, a 3% (v / v) inoculation was added to a 5 L fermenter containing 1.5 L of fermentation medium. The temperature was set at 37°C, and the aeration rate was 1.5 vvm. The pH was controlled at 7 by adding 25% ammonia. The fermentation speed was correlated with dissolved oxygen to maintain dissolved oxygen between 20-30%. Residual sugar was maintained at a low concentration by adding 60% (w / v) glucose solution. During fermentation, the L-threonine content was monitored in real time, and the L-threonine flow rate was adjusted accordingly. The growth phase (i.e., the first 30 days after fermentation) was monitored. h) Maintain dissolved oxygen at 30%, and after the stationary phase (i.e., 22-60 h after fermentation begins), maintain dissolved oxygen at 20%, with an initial aeration rate of 1.5 vvm. The feeding method during fermentation is to add L-threonine to the culture medium (to maintain the threonine concentration in the system at 1 g / L).
[0047] The fermentation time was 60 h. After fermentation, the yield of L-homoserine was 155 g / L and the highest OD600 value was 65.
[0048] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.
Claims
1. A recombinant Escherichia coli, characterized in that, The recombinant *E. coli* strain is characterized by the knockout of the lacI, thrB, poxB, ldhA, and nuoF genes in its genome, overexpression of the glk and galP genes at the ptsG gene locus in its genome, and overexpression of ad at the ydeU and ymdE gene loci in its genome. hade The gene overexpressed ECasd at the nmpC, fhiA, and tfaD sites on the genome. Q350N / H171A The gene overexpresses hom at the yghE gene locus in the genome. pne The gene overexpresses thrA at the insC gene locus on the genome. S345F The gene overexpressed the ppc gene at the yqaC gene locus on the genome and the rhtA gene at the yjiV gene locus on the genome.
2. The recombinant Escherichia coli according to claim 1, characterized in that, The ad hade Genes originate from Achromobacter denitrificans The hom pne Genes originate from Polynucleobacter necessarius subsp. Necessarius .
3. The recombinant Escherichia coli according to claim 1 or 2, characterized in that, The lacI gene is indexed in NCBI as AP_000997.1, the thrB gene as AP_000667.1, the poxB gene as AP_001502.1, the ldhA gene as AP_002007.1, the nuoF gene as AP_002882.1, and the ptsG gene as AP_00 1727.1, the glk gene's NCBI ID is: AP_002988.1, the galP gene's NCBI ID is: AP_003500.1, the ydeU gene's NCBI ID is: AC_000091.1 (1,594379-1,595779), the ymdE gene's NCBI ID is: AC_000091.1 (1095966-1096268), the nmpC gene's NCBI ID is... The NCBI accession numbers for the following genes are: AC_000091.1 (574981-576108), fhiA (248358-250070), tfaD (580757-581320), and yghE (3109784-3110644). The insC gene is located in AC_000091.
1. The NCBI accession numbers for gene I are: AP_004767.1, yqaC gene AC_000091.1 (2,786,298-2,786,894), ppc gene AP_003854.1, yjiV gene AC_000091.1 (4578815-4581535), and rhtA gene AP_001444.
1. The ad hade The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the ECasd... Q350N / H171A The nucleotide sequence of the gene is shown in SEQ ID NO.2, wherein the hom pne The nucleotide sequence of the gene is shown in SEQ ID NO.3, wherein the thrA S345F The nucleotide sequence of the gene is shown in SEQ ID NO.
4.
4. The recombinant Escherichia coli according to claim 3, characterized in that, thrA S345F The gene was inserted into the insC gene, which encodes the IS2 transposable protein element, and four copies were obtained.
5. The recombinant Escherichia coli according to claim 4, characterized in that, The recombinant Escherichia coli uses Escherichia coli BL21(DE3) or Escherichia coli W3110 as the host cell.
6. A method for improving the preparation of L-homoserine from Escherichia coli, characterized in that, The method involves knocking out the lacI, thrB, poxB, ldhA, and nuoF genes on the *E. coli* genome, overexpressing the glk and galP genes at the ptsG gene locus, and overexpressing ad at the ydeU and ymdE gene loci, respectively. hade The gene overexpressed ECasd at the nmpC, fhiA, and tfaD sites on the genome. Q350N / H171A The gene overexpresses hom at the yghE gene locus in the genome. pne The gene overexpresses thrA at the insC gene locus on the genome. S345F The gene overexpressed the ppc gene at the yqaC gene locus on the genome and the rhtA gene at the yjiV gene locus on the genome.
7. A method for preparing L-homoserine by fermentation, characterized in that, The method involves adding the recombinant Escherichia coli according to any one of claims 1 to 5 to a system containing threonine, and fermenting to prepare L-homoserine.
8. The method according to claim 7, characterized in that, In the shake-flask fermentation system: the amount of recombinant Escherichia coli added is 1-10%; the fermentation conditions are 30-37℃, 200-220 rpm, and pH value controlled at 6-7. Preferably, the substrate is threonine, and the amount of threonine added is 0.5-1 g / L.
9. The method according to claim 7, characterized in that, In the upper tank system, the amount of recombinant Escherichia coli added is 5%; Fermentation conditions were as follows: temperature 30-37℃, initial air flux 1-2 vvm, stirring speed 200-400 rpm, dissolved oxygen concentration set to 100%; during cell growth, the air flux was adjusted to 1-2 vvm, and the aeration rate was increased appropriately according to dissolved oxygen and stirring speed; the stirring speed was correlated with the dissolved oxygen value to maintain the dissolved oxygen concentration at 20-30% initially; when the initial glucose was consumed, the feeding medium was turned on; and ammonia was used to control the pH at 6.5-7.0 during the fermentation process.
10. The use of the recombinant Escherichia coli according to any one of claims 1 to 5 in the preparation of L-homoserine or products containing L-homoserine.