Methods for modulating rice plant height and / or yield

By regulating the expression of OsPGI2 protein in rice using the CRISPR/Cas9 system, the balance between rice plant height and yield was resolved, achieving regulation of both plant height and yield, and improving photosynthetic efficiency and lodging resistance.

CN122168657APending Publication Date: 2026-06-09INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Filing Date
2024-12-06
Publication Date
2026-06-09

Smart Images

  • Figure HDA0005174290780000011
    Figure HDA0005174290780000011
  • Figure HDA0005174290780000012
    Figure HDA0005174290780000012
  • Figure HDA0005174290780000021
    Figure HDA0005174290780000021
Patent Text Reader

Abstract

This application belongs to the field of genetic engineering breeding technology, specifically relating to methods for regulating rice plant height and / or yield. To regulate plant height and / or yield, this application also provides a method for regulating plant height and / or yield, including regulating the expression level of the gene encoding the OsPGI2 protein in the recipient plant and / or regulating the content of the OsPGI2 protein in the recipient plant to regulate the plant height and / or yield of the recipient plant. The OsPGI2 protein may be a protein with the amino acid sequence shown in SEQ ID NO:2. This application reveals for the first time the regulatory role of the OsPGI2 gene on rice plant height and / or yield. The rice gene OsPGI2 can be widely used in plant fields such as rice genetic breeding, germplasm resource screening, transgenic and genome editing breeding, and plays an important role in breeding rice yield, grain weight, effective tiller number and / or seed setting rate, as well as in the study of rice tillering mechanisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of genetic engineering breeding technology, specifically involving methods for regulating rice plant height and / or yield. Background Technology

[0002] The screening of rice plant height and its regulatory factors plays a crucial role in rice breeding. Firstly, sufficiently tall rice plants result in a greater number of leaves, expanding the photosynthetic area and improving photosynthetic efficiency. However, excessive height can lead to canopy closure, affecting the light exposure of the lower and middle leaves. Therefore, studying rice plant height helps identify the ideal plant height to balance photosynthetic efficiency and canopy structure. Secondly, plant height is closely related to rice's nutrient uptake capacity. Studies show that higher plant height corresponds to higher nitrogen uptake. However, excessive height can lead to uneven nutrient distribution, affecting rice growth and yield. Therefore, studying rice plant height helps optimize nutrient uptake and distribution, improving nutrient utilization efficiency. Thirdly, plant height is a significant factor influencing rice lodging resistance. Dwarf varieties generally have stronger lodging resistance, which is beneficial for high and stable yields. However, excessive dwarfing can restrict rice growth, affecting yield. Therefore, studying rice plant height helps find the ideal balance between plant height and lodging resistance.

[0003] Research on rice plant height helps advance breeding techniques. Modern biotechnologies such as gene editing and marker-assisted selection allow for precise control of rice plant height, enabling the cultivation of new rice varieties with superior traits.

[0004] Starch has applications in all aspects of our lives. Starch produced in cereal endosperm provides 50% of the energy required by humans daily and is also widely used in animal feed, food additives, clean energy, bioethanol production, and pharmaceutical preparations. During the day, transient starch is formed in plant chloroplasts, while starch synthesized at night provides energy for the plant. Human demand for food has always been very high. Statistics show that by 2050, the demand for agricultural output will increase by 70%, meaning that increasing food production will be a new challenge for humanity. As an essential food and energy source, starch will inevitably become an important research subject for improving food production. Glucose-6-phosphate isomerase (PGI) is distributed in eukaryotes, bacteria, and some archaea. It catalyzes the interconversion between fructose-6-phosphate (F6P) and glucose-1-phosphate (G1P) and also connects glycolysis and the pentose phosphate pathway. In plants, PGI has been identified as cytoplasmic and plastid forms, with different copy numbers in different species. When plastid PGI (PGIp) is missing in plant leaves, the starch content in the leaves decreases significantly, indicating that PGI significantly affects starch accumulation in plant leaves and thus affects plant biomass. Summary of the Invention

[0005] The technical problem this application aims to solve is: how to regulate plant height and / or yield. Specifically, the technical problem this application aims to solve is: how to regulate rice plant height and / or yield.

[0006] To address the aforementioned technical problems, this application also provides a method for regulating plant height and / or yield. The method includes regulating the expression level of the gene encoding the OsPGI2 protein in the recipient plant and / or regulating the content of the OsPGI2 protein in the recipient plant to regulate the plant height and / or yield of the recipient plant. The OsPGI2 protein can be any of the following proteins:

[0007] a1) The amino acid sequence is that of the protein shown in SEQ ID NO:2;

[0008] a2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in a1), which have more than 80% identity with the amino acid sequence shown in a1) and are related to plant height and / or yield.

[0009] a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

[0010] Furthermore, in the method described, the regulation may be a reduction, suppression, or downregulation.

[0011] Furthermore, in the method described, the regulation may also be to increase, promote, or upregulate.

[0012] In this application, the protein may be derived from rice.

[0013] In this application, SEQ ID NO:2 consists of 217 amino acid residues.

[0014] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0015] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0016] Further, the connection described in a3) may be a peptide bond formed by dehydration condensation between the N-terminus of the tag and the C-terminus of the protein described in a1) or a2). Alternatively, the connection described in a3) may be a peptide bond formed by dehydration condensation between the C-terminus of the tag and the N-terminus of the protein described in a1) or a2).

[0017] Furthermore, the method may include reducing the expression level of the gene encoding the OsPGI2 protein in the recipient plant and / or reducing the content of the OsPGI2 protein in the recipient plant to reduce the plant height and / or yield of the recipient plant, wherein the recipient plant contains the gene encoding the OsPGI2 protein.

[0018] Furthermore, the method achieves the purpose of reducing the expression level of the gene encoding the OsPGI2 protein in the recipient plant and / or reducing the content of the OsPGI2 protein in the recipient plant through M1) or M2) as described below.

[0019] M1) The genome sequence in the recipient plant is mutated by any of the following methods: an adenine deoxyribonucleotide (A) is inserted between positions 216 and 217 of the genome sequence whose nucleotide sequence is SEQ ID NO:1, thereby knocking out the gene encoding the OsPGI2 protein.

[0020] M2) By knocking out the gene encoding the OsPGI2 protein in the recipient plant using the CRISPR / Cas9 system, the expression level of the gene encoding the OsPGI2 protein and / or the content of the OsPGI2 protein in the recipient plant are reduced.

[0021] Furthermore, in the method, the gene encoding the OsPGI2 protein may be any one of the following g1)-g3):

[0022] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO:3;

[0023] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO:1;

[0024] g3) DNA molecules that have more than 80% identity with the DNA molecules described in g1) or g2) and that regulate plant height and / or yield.

[0025] Furthermore, in the method described, the target sequence of CRISPR / Cas9 may be SEQ ID NO:4.

[0026] Furthermore, in the method, the gene encoding the OsPGI2 protein and / or the CRISPR / Cas9 system are introduced into the recipient plant in the form of a vector.

[0027] Furthermore, in the method described, the plant is selected from monocotyledonous plants.

[0028] Furthermore, in the method, the monocotyledonous plant is selected from grasses.

[0029] Furthermore, in the method, the grass plant is selected from the genus *Oryza*.

[0030] Furthermore, in the method, the rice plant is selected from rice (Oryza sativa L.).

[0031] This application also provides a method for obtaining rice with altered plant height and / or yield, the method comprising regulating the expression level of the gene encoding the OsPGI2 protein in the recipient rice and / or regulating the content of the OsPGI2 protein in the recipient rice to obtain rice with altered plant height and / or yield, wherein the recipient rice contains the gene encoding the OsPGI2 protein, and the OsPGI2 protein is a protein with the amino acid sequence shown in SEQ ID NO:2.

[0032] Furthermore, the method includes reducing the expression level of the gene encoding the OsPGI2 protein in the recipient rice and / or reducing the content of the OsPGI2 protein in the recipient rice to obtain rice with reduced plant height and / or yield.

[0033] Furthermore, in the method, the reduction of the expression level of the gene encoding the OsPGI2 protein in the recipient rice and / or the reduction of the content of the OsPGI2 protein in the recipient rice are achieved through the method described in N1) or N2).

[0034] N1) The genome sequence of the recipient rice was mutated by any of the following methods: an adenine deoxyribonucleotide (A) was inserted between positions 216 and 217 of the genome sequence whose nucleotide sequence is SEQ ID NO:1, thereby knocking out the gene encoding the OsPGI2 protein.

[0035] N2) By knocking out the gene encoding the OsPGI2 protein in the recipient plant using the CRISPR / Cas9 system, the expression level of the gene encoding the OsPGI2 protein and / or the content of the OsPGI2 protein in the recipient plant can be reduced.

[0036] This application verified the role of the OsPGI2 gene in rice through gene knockout experiments.

[0037] The gene knockout mutant lines prepared in this application can be used for mechanistic studies of plant yield, seed setting rate, effective tillering, thousand-grain weight, or plant height.

[0038] To address the aforementioned technical problems, this application provides the use of OsPGI2 protein, a substance regulating the expression of the OsPGI2 protein-encoding gene, or a substance regulating the OsPGI2 content in any of the following:

[0039] A1) Application in regulating plant yield;

[0040] A2) Application in the preparation of products that regulate plant yield;

[0041] A3) Application in regulating plant grain weight;

[0042] A4) Application in the preparation of products that regulate the weight of plant seeds;

[0043] A5) Application in regulating the number of plant tillers;

[0044] A6) Application in the preparation of products that regulate the number of plant tillers;

[0045] A7) Application in regulating plant fruit setting rate;

[0046] A8) Application in the preparation of products that regulate plant fruit setting rate;

[0047] A9) Application in regulating plant height;

[0048] A10), its application in the preparation of products that regulate plant height;

[0049] A11) Applications in plant breeding or plant-assisted breeding;

[0050] A12) Application in the preparation of plant breeding or plant-assisted breeding products;

[0051] The OsPGI2 protein may be a protein with the amino acid sequence shown in SEQ ID NO:3.

[0052] In this application, the indicators for plant breeding may include any one of yield, grain weight, effective tiller number, seed setting rate, and plant height.

[0053] In this application, the purpose of plant breeding may include cultivating plants with altered yield and plant height.

[0054] More specifically, the purpose of plant breeding may include cultivating plants with alterations in any one or more traits such as yield, seed setting rate, effective tillering, thousand-grain weight, or plant height.

[0055] Furthermore, in the aforementioned application, the substance regulating the expression of the OsPGI2 protein-encoding gene or the substance regulating the OsPGI2 protein content is a biological material, which may be any of the following:

[0056] B1) Nucleic acid molecules that inhibit or reduce the expression of the OsPGI2 protein-encoding gene;

[0057] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0058] B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);

[0059] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0060] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0061] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0062] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);

[0063] B8), nucleic acid molecules encoding the OsPGI2 protein;

[0064] B9) Expression cassettes containing the gene encoding the nucleic acid molecule described in B8), recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs.

[0065] Furthermore, in the aforementioned applications, the nucleic acid molecule in B1) may be RNA encoding a gene that targets the OsPGI2 protein or DNA encoding the RNA.

[0066] Furthermore, in the method described in B1), the target sequence of the nucleic acid molecule may be SEQ ID NO:4.

[0067] Furthermore, in the aforementioned application, the nucleic acid molecule described in B8) can be any one of the following DNA molecules described in g1)-g3):

[0068] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO:3;

[0069] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO:1;

[0070] g3) DNA molecules that have more than 80% identity with the DNA molecules described in g1) or g2) and that regulate plant height and / or yield.

[0071] In some embodiments of this application, the expression cassette described in B2) may be an expression cassette of RNA encoding the gene that targets the OsPGI2 protein described above.

[0072] The recombinant vector described in B3) may be WMC025-OsPGI2. The WMC025-OsPGI2 vector may encode an sgRNA targeting the DNA molecule shown in SEQ ID NO:1 and an effector protein of the CRISPR / Cas9 system: the Cas9 protein.

[0073] In some embodiments of this application, the full sequence of the gene editing vector WMC025-OsPGI2 is SEQ ID NO:5, wherein positions 274-518 of SEQ ID NO:5 are the U6 promoter, positions 520-615 are sgRNA (where positions 520-539 are the target sequence (spacer) of the sgRNA, and positions 540-615 are the scaffold sequence of the sgRNA), positions 639-2624 are the Ubi promoter, and positions 2747-6847 are the coding sequence for Cas9. The gene editing vector WMC025-OsPGI2 contains hygromycin selection genes and kanamycin selection genes.

[0074] Furthermore, in the aforementioned application, the expression cassette described in B9) refers to DNA capable of expressing the OsPGI2 protein in a host cell. This DNA may include not only a promoter that initiates transcription of the OsPGI2 protein-encoding gene, but also a terminator and / or enhancer sequence that terminates transcription of the OsPGI2 protein-encoding gene.

[0075] Furthermore, in the aforementioned applications, the recombinant microorganisms may specifically be yeast, bacteria, algae, and fungi.

[0076] Furthermore, in the aforementioned applications, the plant tissue may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0077] Furthermore, in the aforementioned applications, the transgenic plant organs may be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0078] Furthermore, in the aforementioned applications, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0079] Furthermore, in the aforementioned application, the plant is selected from monocotyledonous plants.

[0080] Furthermore, in the aforementioned application, the monocotyledonous plant is selected from grasses.

[0081] Furthermore, in the aforementioned application, the grass plant is selected from plants of the genus *Oryza*.

[0082] Furthermore, in the aforementioned application, the rice plant is selected from rice (Oryza sativa L.).

[0083] This application also provides the OsPGI2 protein and the biological material described herein.

[0084] In this application, identity refers to the identity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences (or nucleotide sequences) can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences, the identity value (%) can be obtained.

[0085] The aforementioned 80% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.

[0086] The 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 85% or more identity can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0087] The beneficial technical effects achieved by this application are as follows:

[0088] This application reveals for the first time the regulatory role of the OsPGI2 gene in rice plant height and / or yield. The rice gene OsPGI2 can be widely applied in plant fields such as rice genetics and breeding, germplasm resource screening, transgenic and genome editing breeding, and plays an important role in breeding for rice yield, grain weight, effective tiller number and / or seed setting rate, as well as in the study of rice tillering mechanisms. Attached Figure Description

[0089] Figure 1 Evolutionary analysis of OsPGI was conducted. The amino acid sequences of PGI from different species were retrieved using EnsemblPlants (http: / / plants.ensembl.org / index.html) for sequence alignment and evolutionary analysis. Sequence search revealed that PGI exists in most plants, with two OsPGI sequences located in chloroplasts found in rice.

[0090] Figure 2 Identification of the rice ospgi2 mutant. A: Schematic diagram of the insertion site of the rice ospgi2 mutant. The location indicated by the scissors is the CRISPR / Cas9 target site. The dashed line marks the nucleotide sequence of the CRISPR / Cas9-edited plant. The red text shows the location where the mutant prematurely terminates. B: Detection of OsPGI2 expression levels in wild-type (Nipponbare) and ospgi2 mutants. In the ospgi2 mutant, the expression level of OsPGI2 was significantly decreased compared with that of the wild type. *P<0.05,

[0091] **P<0.01, ***P<0.001. NIP: wild type; ospgi2: homozygous mutant.

[0092] Figure 3 Phenotypic identification of the rice ospgi2 mutant. Field agronomic trait statistics of the mutant rice materials showed that the plant height of the mutant was significantly lower than that of the wild type at the same time point. NIP: wild type; ospgi2: homozygous mutant. The scale bar in the figure is 10 cm.

[0093] Figure 4Statistics on agronomic traits of the rice ospgi2 mutant. A: After knocking out PGI2, the average yield per plant of the ospgi2 mutant was 15.15g, while the average yield per plant of the wild type was 42.42g, a decrease of 64.29% compared to the wild type. B: The average seed setting rate of the ospgi2 mutant was 56.51%, while the average seed setting rate of the wild type was 91.54%, a decrease of 38.27% compared to the wild type. C: The average number of effective tillers in the ospgi2 mutant was 14, while the average number of effective tillers in the wild type was 20.33, a decrease of 31.14% compared to the wild type. D: The thousand-grain weight of the ospgi2 mutant was 23.275g, while the thousand-grain weight of the wild type was 23.2g, showing no decrease compared to the wild type. E: The mutant ospgi2 has a plant height of 92.6 cm, while the wild type has a plant height of 100.9 cm, representing a decrease of 8.23% compared to the wild type. NIP: Wild type;

[0094] ospgi2: homozygous mutant. The yield per plant, seed setting rate, effective tillers, thousand-grain weight, and plant height were determined from multiple experimental replicates (n≥30). *P<0.05, **P<0.01, ***P<0.001. Detailed Implementation

[0095] We attempted to create rice ospgi2 deletion mutants using CRISPR / Cas9 technology and analyzed their phenotypes. The results showed that the deletion of OsPGI2 significantly reduced the plant height, seed setting rate, and yield per plant in rice, indicating that this gene has the potential to be used to improve crop phenotype and increase crop yield.

[0096] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0097] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0098] The following examples include the names and formulations of some reagents, culture media, and methods used in rice genetic transformation:

[0099] Infection solution: N6 basic salt mixture 4 g / L (product number: C1416, brand: Sigma-Aldrich), B5 organic 10 mL / L, sucrose 10 g / L, glucose 10 g / L, iron salt 18.35 mg / L, 2,4-D 2 mg / L, inositol 2 g / L, hydrolyzed casein 0.6 g / L, solvent is water, pH adjusted to 5.2; when using, add 100 mM acetylsyl syringone solution at a concentration of 100 μL / L.

[0100] Solid co-culture medium: N6 basic salt mixture 4 g / L (product number: C1416, brand: Sigma-Aldrich), B5 organic 10 mL / L, hydrolyzed casein 0.5 g / L, proline 0.5 g / L, sucrose 30 g / L, 2 mg / L 2,4-D, plant gel 4 g / L, with 100 mM acetylsylgenone solution added at a concentration of 100 μL / L, water as solvent, pH 5.2.

[0101] Selection medium: 4.4 g / L MS basal medium (catalog number M5519, brand Sigma-Aldrich), 40 g / L sucrose, 2 mg / L 2,4-D, 0.5 g / L hydrolyzed casein, 0.5 g / L proline, 0.5 g / L glutamine, solvent: water, pH adjusted to 5.8, add 3.5 g / L plant gel, autoclave. Before pouring into solid culture plates, the selection medium should be mixed with 500 mg / L cephalosporin and 50 mg / L hygromycin B (sterilized by filtration).

[0102] Differentiation medium: 4.3 g / L MS basal salt medium (catalog number M5524, brand: Sigma-Aldrich), 10 mL B5 organic medium, 0.1 g / L inositol, 30 g / L sorbitol, 0.5 g / L hydrolyzed casein, 0.5 g / L proline, 0.5 g / L glutamine, 18.35 mg / L iron salt (ethylenediaminetetraacetic acid sodium iron salt), solvent: water, pH adjusted to 5.8, 3.5 g / L plant gel added, autoclaved. Before pouring into solid culture plates, add sterile 0.2 mg / L KT (kinetin), 0.1 mg / L NAA (α-naphthaleneacetic acid), 2 mg / L 6-BA (cytokinin), and 50 mg / L hygromycin B.

[0103] On the rooting medium: 2.2 g / L MS basal medium (catalog number M5519, brand Sigma-Aldrich), 30 g / L sucrose, 0.5 g / L hydrolyzed casein, solvent: water, adjusted to pH 5.8, add 3.2 g / L plant gel, and autoclave. Before pouring into solid culture plates, add sterile 30 mg / L hygromycin B.

[0104] The formula for 1L of B5 organic (100 times the mother liquor) is as follows: 0.2g glycine, 10mg thiamine hydrochloride, 50mg pyridoxine hydrochloride, 50mg niacin vitamin E, 10g inositol, and water as the solvent.

[0105] Unless otherwise specified, the quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0106] The following examples use GraphPad Prism statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test is used, and P < 0.05 (*) indicates a significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0107] Example 1: Phenotypic Changes in OsPGI2 Knockout Rice Mutants

[0108] 1.1 Gene Cloning and Analysis

[0109] To further investigate the function of rice glucose-6-phosphate isomerase 2 (OsPGI2), the protein sequence of rice OsPGI2 was used as a template to search for PGI sequences of different species in EnsemblPlants (http: / / plants.ensembl.org / index.html) and perform sequence alignment and evolutionary analysis. Based on the amino acid sequence analysis of rice PGI, two OsPGI sequences located in chloroplasts were found in rice: OsPGI1 and OsPGI2 (…). Figure 1 OsPGI1 (Os09g0465600, top) and OsPGI2 (Os08g0478800, bottom) are marked with red dots. Among them, the genomic sequence of the glucose-6-phosphate isomerase gene OsPGI2 is SEQ ID NO:1, its coding sequence (CDS) is SEQ ID NO:3, and the amino acid sequence of the glucose-6-phosphate isomerase it encodes is SEQ ID NO:2, named OsPGI2.

[0110] 1.2 Preparation and Screening of OsPGI2 Gene Editing Mutants

[0111] To investigate the function of OsPGI2 in detail, we commissioned Baige Biotechnology Co., Ltd. to create an ospgi2 mutant using CRISPR / Cas9 technology with wild-type rice material Nipponbare as the receptor. The specific steps are as follows:

[0112] 1.2.1 Construction of gene editing plasmids

[0113] Use the online website (http: / / skl.scau.edu.cn / targetdesign / ) to select a suitable singleguide RNA (sgRNA) and design corresponding target primers.

[0114] The target sequence (5' to 3') is as follows:

[0115] Target: TCGCTCAGCTCCAAGCAGTC (SEQ ID NO: 4);

[0116] Annealing primers were synthesized based on the target sequence as follows (5' to 3'):

[0117] F:TGTGCTCGCTCAGCTCCAAGCAGTC;

[0118] R: AAACGACTGCTTGGAGCTGAGCGA.

[0119] Annealing primers were used to synthesize a gRNA fragment with homologous arms at both ends and the target sequence in the middle. This gRNA fragment was then constructed into the gene editing vector WMC025 (a product of Baige Biotechnology Co., Ltd.) to obtain the gene editing vector WMC025-ospgi2. The full sequence of the gene editing vector WMC025-ospgi2 is SEQ ID NO:5, where positions 274-518 of SEQ ID NO:5 are the U6 promoter, positions 520-615 are the sgRNA (where positions 520-539 are the target sequence (spacer) of the sgRNA, and positions 540-615 are the scaffold sequence of the sgRNA), positions 639-2624 are the Ubi promoter, and positions 2747-6847 are the coding sequence of Cas9. The gene editing vector WMC025-ospgi2 contains hygromycin and kanamycin selection genes.

[0120] 1.2.2 Agrobacterium-mediated transformation

[0121] The plasmid with correct sequencing results was transformed into Agrobacterium EHA105, and the positive transformants were selected and named EHA105 / WMC025-ospgi2.

[0122] 1) Add 20 μL of Agrobacterium EHA105 competent cells and 1 μL of plasmid WMC025-ospgi2. Incubate on ice for 5 min, then flash freeze in liquid nitrogen for 5 min, incubate in water at 37°C for 5 min, and then on ice for 5 min. Add 100 μL of antibiotic-free LB medium, shake at 200 rpm for 2 h at 28°C, and then directly plate onto LB solid medium containing kanamycin and rifampin. Incubate at 28°C for two days.

[0123] 2) Picking a single clone and shaking: Two days later, pick a single clone and put it into a 5mL sterile EP tube. Add 2mL of LB liquid medium containing kanamycin and rifampin in advance, and shake overnight.

[0124] 3) Select single clones for sequencing. If the sequencing is correct, conduct rice callus transformation experiments.

[0125] 1.2.3 Genetic Transformation Process

[0126] 1) Callus induction and succession

[0127] Select mature, plump, newly harvested Nipponbare rice seeds, remove the husks, pour into 50mL centrifuge tubes, add 75% ethanol for 1 minute to sterilize, discard the ethanol, rinse once with sterile water, discard the ethanol, then add 30% sodium hypochlorite for 20 minutes to sterilize, discard the sodium hypochlorite, and rinse 5 to 6 times with sterile water. Use a pipette to remove excess water (or use sterile filter paper to blot dry), and transfer the seeds to induction medium, 20 to 25 seeds per dish. After callus formation, the proembryos can be directly used for transformation. Small particles growing next to the proembryos can be transferred to a new induction medium for subculture; when they reach a suitable size, they can also be transformed.

[0128] 2) Agrobacterium culture

[0129] Agrobacterium EHA105 / WMC025-ospgi2 was streaked on LB solid medium containing kanamycin and rifampin and incubated in the dark at 28°C for 2 days until single colonies appeared.

[0130] 3) Agrobacterium infection

[0131] Prepare the infection solution by using a pipette to wash the Agrobacterium off the plate; this is the Agrobacterium suspension used for co-culturing and transforming rice. Select a sufficient number of callus tissues (good callus condition, bright yellow color, round and firm texture, with a particle diameter of about 3 mm) and place them in a 100 mL sterile Erlenmeyer flask. Add an appropriate amount of Agrobacterium suspension (ensuring sufficient contact between the bacterial suspension and the material), and incubate at room temperature for 20 minutes, shaking occasionally. Discard the bacterial suspension, place the callus tissues on sterile filter paper to absorb excess bacterial suspension, and then transfer them to a solid co-culture medium lined with sterile filter paper. Incubate at 26°C in the dark for 3 days.

[0132] 4) Screening and Cultivation

[0133] After 3 days of co-culture, the callus tissue needs to be cleaned. Using a 1mL blue pipette tip, transfer the callus from the co-culture medium to a sterile Erlenmeyer flask, rinse twice with sterile water, and then rinse a third time with sterile water containing 500μL / L carbenicillin. After pipetting away excess water, transfer the callus to sterile filter paper and use the airflow of a laminar flow hood to dry the water on the callus for about 30 minutes. Once the callus is dry, transfer it to selection medium for selection culture at 28-30℃ in the dark. The selection process takes 3-4 weeks.

[0134] 5) Differentiation and regeneration

[0135] One month after screening, bright yellow positive calluses will appear. At this time, the positive calluses can be picked and transferred to differentiation medium for differentiation and regeneration. Place 16 positive calluses on each differentiation dish and culture them under light in a greenhouse at 28-30℃. Generally, green spots will appear on the callus tissue after about 10 days, and seedlings will differentiate after another 10 days.

[0136] 6) Seedling rooting

[0137] Once the differentiated seedlings have grown to about 2-3 cm and have obvious roots, they can be transferred to a rooting medium to allow them to grow. The rooting medium should be poured into a relatively tall bottle or tube so that the rooted seedlings have enough space to grow tall. The rooting culture conditions are 28-30℃ and sterile light culture.

[0138] 7) Screening for gene-edited mutants

[0139] Genomic DNA was extracted from the leaves of the rice seedlings obtained in step 6, and sequencing primers were designed:

[0140] (1) The hyg gene and target site were detected in T0 plants. The amplified target fragment was 519 bp in size. The primer sequences (5' to 3') are as follows:

[0141] HYG-F1:CAAAGATCGTTATGTTTATCGGCACT;

[0142] HYG-R1:TTGGCGACCTCGTATTGGGAA.

[0143] (2) The primer sequences (5' to 3') for detecting the target site are as follows:

[0144] ospgi2-F:CTTCTCGAGCTCCCGCATC;

[0145] ospgi2-R: GTCGTAAACTCCCAGTCCCC;

[0146] Mutations at the genomic level, including those targeting specific mutations, were detected, resulting in 27 mutant strains. These 27 mutant strains were self-crossed twice, and following standard screening procedures, 20 homozygous mutant lines were selected. After sequencing, one homozygous deletion mutant line (named ospgi2 or ospgi2 mutant) was chosen for further experiments. Sequencing results showed that, compared to wild-type Nipponbare rice, the ospgi2 variant had an adenine deoxyribonucleotide (A) inserted between positions 216 and 217 of the gene with SEQ ID NO:1 on both chromosomes, thus achieving ospgi2 gene knockout. Figure 2 (A)

[0147] To ensure the accuracy of the materials, molecular identification at the transcriptional level was performed on the mutant lines. Quantitative PCR analysis revealed that the expression level of ospgi2 in the mutant ospgi2 plants was significantly reduced by 31.1% compared to the wild type. Figure 2 (B)

[0148] Example 2: Changes in the properties of mutant materials

[0149] To further investigate the function of OsPGI2, important agronomic traits of rice ospgi2 deletion mutants were analyzed in a field setting. Following a randomized block design, three replicates were set up with 15 rows of rice plants, 8 plants per row, with a row spacing of 20 cm and a plant spacing of 15 cm.

[0150] 1) Changes in growth and development: Field phenotypes of the ospgi2 mutant and wild-type rice were analyzed during the grain-filling stage. Thirty plants were randomly selected from each line to measure plant height, and the average value was taken. The results showed a significant decrease in plant height between the ospgi2 mutant and the wild-type. Figure 3 and Figure 4 (E).

[0151] 2) Changes in agronomic traits: To further assess the impact of OsPGI2 on yield, changes in agronomic traits of the aboveground vegetative parts of the transgenic materials were also examined. Thirty rice plants were randomly selected from each line to measure plant height and count the number of effective tillers; the results were averaged. Field phenotypic observations showed that, compared to the wild type, the homozygous ospgi2 mutant had significantly higher effective tiller counts (…). Figure 4 (C) Plant height ( Figure 4 Both showed a significant decrease in the number of grains (E) in wild-type and mutant materials. The number of grains and the total number of grains were counted for both wild-type and mutant materials, and the seed setting rate (E) was calculated. Figure 4 The results showed that the seed setting rate of the mutant was also significantly reduced, which led to a decrease in the yield of the mutant rice plant and further reduced rice production.

[0152] Glucose-6-phosphate isomerase (PGI) is the first enzyme in the starch synthesis pathway, converting the Calvin cycle product F6P to G6P, and plays a crucial role in crop growth and development. In rice, there are two PGI genes located in chloroplasts: OsPGI1 and OsPGI2. To study OsPGI in more detail, we used CRISPR / Cas9 technology to knock out OsPGI2. The results showed that the growth, development, and yield of the mutant rice were significantly inhibited, specifically, plant height, effective tillering, and thousand-grain weight were all significantly reduced compared to the wild type. Further analysis of the number of filled grains and total grains in the wild type and mutant revealed a significant decrease in the seed setting rate compared to the wild type. This directly led to a decrease in yield per plant and a substantial reduction in overall rice production, indicating that OsPGI2 has a very significant impact on rice growth, development, and final yield. Therefore, we hypothesize that this gene has great potential in improving crop traits and increasing crop yield, and may be an important component for agricultural productivity enhancement.

[0153] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for regulating plant height and / or yield, characterized in that: The method includes regulating the expression level of the gene encoding the OsPGI2 protein in the recipient plant and / or regulating the content of the OsPGI2 protein in the recipient plant to regulate the plant height and / or yield of the recipient plant, wherein the OsPGI2 protein is any one of the following proteins: a1) The amino acid sequence is that of the protein shown in SEQ ID NO:2; a2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in a1), which have more than 80% identity with the amino acid sequence shown in a1) and are related to plant height and / or yield. a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

2. The method according to claim 1, characterized in that: The method includes reducing the expression level of the gene encoding the OsPGI2 protein in the recipient plant and / or reducing the content of the OsPGI2 protein in the recipient plant to reduce the plant height and / or yield of the recipient plant, wherein the recipient plant contains the gene encoding the OsPGI2 protein.

3. The method according to claim 1 or 2, characterized in that: The method achieves the purpose of reducing the expression level of the gene encoding the OsPGI2 protein in the recipient plant and / or reducing the content of the OsPGI2 protein in the recipient plant through M1) or M2) as described below. M1) The genome sequence in the recipient plant is mutated by any of the following methods: an adenine deoxyribonucleotide is inserted between positions 216 and 217 of the genome sequence whose nucleotide sequence is SEQ ID NO:

1. M2) By knocking out the gene encoding the OsPGI2 protein in the recipient plant using the CRISPR / Cas9 system, the expression level of the gene encoding the OsPGI2 protein and / or the content of the OsPGI2 protein in the recipient plant are reduced.

4. The method according to any one of claims 1-3, characterized in that: The gene encoding the OsPGI2 protein is any one of the following g1)-g3): g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID NO:3; g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID NO:1; g3) DNA molecules that have more than 80% identity with the DNA molecules described in g1) or g2) and that regulate plant height and / or yield.

5. The method according to any one of claims 1-4, characterized in that: The plants were selected from monocotyledonous plants.

6. A method for obtaining target rice with altered plant height and / or yield, the method comprising regulating the expression level of the gene encoding the OsPGI2 protein in recipient rice and / or regulating the content of the OsPGI2 protein in recipient rice to obtain target rice with altered plant height and / or yield, wherein the recipient rice contains the gene encoding the OsPGI2 protein, and the OsPGI2 protein is a protein with the amino acid sequence shown in SEQ ID NO:2; Furthermore, the method includes reducing the expression level of the gene encoding the OsPGI2 protein in the recipient rice and / or reducing the content of the OsPGI2 protein in the recipient rice to obtain rice with reduced plant height and / or yield.

7. The method according to claim 6, characterized in that: The reduction of the expression level of the gene encoding the OsPGI2 protein in the recipient rice and / or the reduction of the content of the OsPGI2 protein in the recipient rice are achieved by the method described in N1) or N2). N1) The genome sequence of the recipient rice is mutated by any of the following: an adenine deoxyribonucleotide is inserted between positions 216 and 217 of the genome sequence whose nucleotide sequence is SEQ ID NO:1; N2) By knocking out the gene encoding the OsPGI2 protein in the recipient plant using the CRISPR / Cas9 system, the expression level of the gene encoding the OsPGI2 protein and / or the content of the OsPGI2 protein in the recipient plant can be reduced.

8. The use of the OsPGI2 protein, or a substance regulating the expression of the gene encoding the OsPGI2 protein, or a substance regulating the OsPGI2 content, in any of the following: A1) Application in regulating plant yield; A2) Application in the preparation of products that regulate plant yield; A3) Application in regulating plant grain weight; A4) Application in the preparation of products that regulate the weight of plant seeds; A5) Application in regulating the number of plant tillers; A6) Application in the preparation of products that regulate the number of plant tillers; A7) Application in regulating plant fruit setting rate; A8) Application in the preparation of products that regulate plant fruit setting rate; A9) Application in regulating plant height; A10), its application in the preparation of products that regulate plant height; A11) Applications in plant breeding or plant-assisted breeding; A12) Application in the preparation of plant breeding or plant-assisted breeding products; The OsPGI2 protein is any of the following proteins: a1) The amino acid sequence is that of the protein shown in SEQ ID NO:2; a2) Proteins obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in a1), which have more than 80% identity with the amino acid sequence shown in a1) and are related to plant height and / or yield. a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

9. The application according to claim 8, characterized in that: The substance that regulates the expression of the OsPGI2 protein-encoding gene or the substance that regulates the content of the OsPGI2 protein is a biological material, and the biological material is any one of the following: B1) Nucleic acid molecules that inhibit or reduce the expression of the OsPGI2 protein-encoding gene; B2), an expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3); B8), nucleic acid molecules encoding the OsPGI2 protein; B9) Expression cassettes containing the gene encoding the nucleic acid molecule described in B8), recombinant vectors, recombinant microorganisms, transgenic plant cell lines, transgenic plant tissues and / or transgenic plant organs; Furthermore, the nucleic acid molecule described in B1) is either RNA encoding a gene that targets the OsPGI2 protein described above, or DNA encoding the RNA. Furthermore, the target sequence of the nucleic acid molecule described in B1) is SEQ ID NO:

4.

10. The OsPGI2 protein as described in claim 8 or 9 and / or the biomaterial as described in claim 9.