Application of SNP molecular marker related to heat tolerance in cattle
By analyzing whole-genome resequencing and population genetics data, the SNP molecular marker g.84324020 C>G on the EDIL3 gene was identified, which solved the problem of insufficient mining of heat stress-related genes in cattle, enabled efficient screening and breeding of heat-resistant cattle breeds, and improved the heat adaptability and production performance of cattle.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI
- Filing Date
- 2026-05-12
- Publication Date
- 2026-06-09
AI Technical Summary
Current technologies cannot effectively identify heat stress-related genes in cattle, especially the function of the EDIL3 gene in heat stress, which means that the negative impact of heat stress on bovine health and production performance cannot be effectively mitigated.
By using whole-genome resequencing technology, combined with multiple population genetic data analysis methods such as XPEHH, Fst, Pi, and TajimaD, the SNP molecular marker g.84324020 C>G on the EDIL3 gene was identified to assess the heat adaptability of cattle. Primer pairs were designed for genotyping to screen for cattle breeds adapted to high or low temperatures.
It enables efficient screening of heat-resistant cattle, significantly shortens the breeding cycle, improves the heat adaptability of cattle, reduces heat stress response, and lowers breeding costs.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetics, specifically to the application of bovine heat adaptation-related SNP molecular markers. Background Technology
[0002] In recent years, the intensification of global warming and the frequent occurrence of extreme heat events have led to significant and multi-dimensional negative impacts on the health and production performance of cattle. Specifically, in terms of health, heat stress causes elevated body temperature and accelerated metabolic rate, leading to dehydration, respiratory alkalosis, and even heatstroke. It also suppresses immune activity, reduces resistance, and causes reproductive disorders (decreased sperm quality in bulls, estrus disorders in cows, and increased risk of abortion). In terms of production, heat stress directly inhibits the synthetic function of bovine mammary gland cells, resulting in decreased milk production, reduced feed conversion rates, and increased breeding costs. Therefore, how to select heat-resistant cattle breeds to ensure the health and stable production performance of the herd has become a crucial task urgently needing breakthroughs for the sustainable development of animal husbandry.
[0003] Whole genome resequencing (WGRS) is a high-throughput genome sequencing technology that uses existing reference genome sequences to sequence the genome of an individual or population. Through comparative analysis, it identifies genomic differences, including single nucleotide polymorphisms (SNPs), insertions / deletions (InDels), structural variations (SVs), and copy number variations (CNVs). WGRS has become an important tool for studying genetic variation in livestock and poultry. In recent years, WGRS has revealed some genes related to heat tolerance in cattle, such as HSP1A1, HSPB8, HSPA4, HSPB2, HSF2, and TRPA1. However, heat tolerance is a complex biological process involving the coordinated action of multiple systems, including metabolic regulation and immune responses. Current research and functional analysis of heat tolerance-related genes in cattle are insufficient to meet the needs, and further high-throughput sequencing is required to uncover more heat tolerance-related gene loci.
[0004] The EDIL3 gene, also known as the DEL1 gene, encodes a protein containing EGF-like repetitive sequences and a discoidal structure. According to the annotations in the bovine reference genome ARS-UCD 2.0 version, the EDIL3 gene is located in the 83843439-84324060 bp region of chromosome 7 (NC_037334.1) of the bovine reference genome. As a secreted protein, EDIL3 can directly act on vascular endothelial cells by binding to extracellular matrix components, mediating cell adhesion, migration, and proliferation, maintaining vascular structural stability, and participating in dynamic remodeling of the vascular wall. Heat stress can directly damage the structure of vascular endothelial cells, interfering with normal endothelial cell proliferation and migration, and inhibiting angiogenesis. Currently, there is no in-depth research on the role of the EDIL3 gene in heat stress, and whether this gene plays a functional role in bovine heat stress requires further investigation and exploration. Summary of the Invention
[0005] The purpose of this invention is to provide the application of SNP molecular markers related to the heat adaptability of the EDIL3 gene, so as to evaluate the heat adaptability of cattle by detecting these molecular markers, screen desired individuals, and carry out genetic breeding.
[0006] The technical solution of this invention is as follows: In a first aspect, this invention provides the application of bovine heat adaptation-related SNP molecular markers. The heat adaptation of cattle is assessed by detecting the genotype of these SNP molecular markers. The SNP molecular marker is located at position 125 of the sequence shown in SEQ ID NO:1, and is g.84324020 C>G, located on the EDIL3 gene. The EDIL3 gene sequence is based on the region 83843439-84324060bp in NCBI:NC_037334.1 (showing the reverse complementary sequence of the EDIL3 gene). Cattle with the SNP molecular marker genotype GG have significantly better high-temperature adaptation performance than cattle with the SNP molecular marker genotypes CC or CG. Cattle with SNP molecular marker genotypes CC or CG showed significantly better low-temperature adaptation than cattle with SNP molecular marker genotype GG.
[0007] In this invention, the low temperature range is 4.0~9.0℃ and the high temperature range is 18.0~25.0℃.
[0008] The sequence of SEQ ID NO:1 is as follows: AGGCTGGTGGAGGGAGTAAG AAGGAAGGGGCGGGGGGTAGGGGCGCTCTGGGCGGGCGGGCACTTGTGAGGCTCAGGCTCGCACGCACGCCGCCTCTGTTTGTACACAGTGCGCTCCCGACCGC C GGCTTGCTCGCTCCCCGCCAGCTCACGCTTCATTGTTCTCCAAGTCGGCAGCCCAGCCGCTGGCCGCAGCGACTGGAGCCGAGCGCACCGTCTGCGGGTCCGCGGGCGCGGGGGACCCAGTGCCCCGCCCCACC CGCCGTGCCTCGGCCGGGACCCACCCGCCGCAGAGGCTGAGCCCGCCGGCCACTCCTCGGAGCTCGCCCACCTCCCGGCGCCACCGGAGCGCAGGCAATAGGGGAAGCAACGTTCTTCTCTTGGGTCACCCCTC TTTCTCGTCCTCTCCGACAA(The 125th position in the sequence is an SNP site, with polymorphism of C or G).
[0009] Optionally or preferably, the heat adaptability of cattle can be assessed by detecting the genotype of SNP molecular markers related to heat adaptability, which can then be used to screen for cattle breeds adapted to high temperatures or low temperatures, or for genetic improvement breeding.
[0010] Secondly, this invention provides the application of a reagent for detecting SNP molecular markers in the preparation of products for assessing bovine heat adaptability. The SNP molecular marker is located at position 125 of the sequence shown in SEQ ID NO:1, which is g.84324020 C>G, located on the EDIL3 gene. The EDIL3 gene sequence is based on the region from 83843439 to 84324060 bp in NCBI:NC_037334.1. Cattle with the SNP molecular marker genotype GG have significantly better high-temperature adaptation performance than cattle with the SNP molecular marker genotypes CC or CG. Cattle with SNP molecular marker genotypes CC or CG showed significantly better low-temperature adaptation than cattle with SNP molecular marker genotype GG.
[0011] Optionally or preferably, the reagent includes primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:2~3.
[0012] Upstream primer SEQ ID NO.2: AGGCTGGTGGAGGGAGTAAG; Downstream primer SEQ ID NO.3: TTGTCGGAGAGGACGAGAAA.
[0013] Compared with the prior art, the present invention has the following beneficial effects: This invention focuses on the genetic characteristics of heat adaptation in cattle breeds. From the perspective of genomic evolution and adaptation, typical local cattle breeds from both northern and southern China were selected and divided into high-temperature / low-temperature adapted populations based on the local average annual temperature. Genotyping was performed on DNA samples from local cattle breeds in both northern and southern regions using whole-genome resequencing technology. Multiple population genetic data analysis methods, including XPEHH, Fst, Pi, and TajimaD, were integrated to compare and analyze genomic genetic variations between different cattle breeds in high- and low-temperature regions and within the same cattle breed population. A genetic variation locus, g.84324020 C>G, associated with bovine heat adaptation (heat tolerance), was identified. Analysis revealed that individuals with the GG genotype of this SNP showed better adaptation to high temperatures, while individuals with the CC or CG genotypes showed better adaptation to low-temperature environments.
[0014] The SNP molecular markers of this invention can be used to efficiently screen cattle individuals with heat adaptability, which has important guiding significance for the selection, breeding and genetic improvement of heat-resistant cattle breeds, provides a high-quality technical solution for the cultivation of special germplasm resources, and significantly shortens the breeding cycle. Detailed Implementation
[0015] To enable those skilled in the art to better understand the present application, the present application will be clearly and completely described below with reference to embodiments. Obviously, the described embodiments are only a part of the embodiments of the present application, and not all of the embodiments. Based on the embodiments of the present application, all other embodiments obtained by those of ordinary skill in the art without creative effort should fall within the scope of protection of the present application. Unless otherwise specified, the instruments and reagents used in the embodiments are all from commercial channels.
[0016] Example 1: Screening and identification of heat-resistant SNP sites in the EDIL3 gene 1. Local cattle sample collection Eight local cattle breeds, totaling 187 head, were selected, and genomic DNA was extracted from their blood. The cattle samples were then divided into a high-temperature acclimatization group (annual average temperature > 18℃) and a low-temperature acclimatization group (annual average temperature < 10℃) based on the average annual temperature. Specific breed information is as follows: Table 1. Information on Local Cattle Breeds 2. Genotyping of DNA samples using whole-genome resequencing Genotyping of bovine blood DNA samples was performed using whole-genome resequencing technology. The raw data was quality-checked using FastQC and filtered and cleaned using Trimmomatic software to obtain high-quality filtered data. This high-quality data was then mapped to a reference genome (using the bovine ARS-UCD2.0 reference genome). The filtered high-quality data was compared with the reference genome using the BWA-MEM algorithm. SNPs / InDels were identified using GATK HaplotypeCaller, and the final data were used for subsequent SNP / InDel analysis.
[0017] 3. Screening of molecular markers for heat adaptation in cattle breeds in high and low temperature regions Population genetics data analysis was performed on the obtained resequencing data. Four analysis methods, XPEHH, Fst, Pi and Tajima's D, were integrated. XPEHH+Fst was used to locate and select loci, and Pi+Tajima's D was used to exclude non-selective factors to improve the reliability of the final data. Bovine SNPs in high and low temperature regions were further screened to capture significantly different signals.
[0018] The top 1% of highly selected SNPs were obtained through the above method, anchoring 152 candidate genes. Emphasis was placed on the EDIL3 gene (NCBI: NC_037334.1) and the most significantly differentiating single nucleotide polymorphism (SNP) site located on the EDIL3 gene (NCBI: NC_037334.1), namely g.84324020 C>G, with a p-value of 1.26e-23, which was defined as the dominant SNP site.
[0019] 4. Validation of the dominant molecular markers for thermo-adaptation of the EDIL3 gene A total of 187 cattle samples from 8 local cattle breeds were collected, including 90 cattle in the high-temperature group and 97 cattle in the low-temperature group. Genotyping was performed on the dominant SNP sites on the screened EDIL3 gene, and the results are shown in Table 2.
[0020] Table 2. Genotyping of dominant SNP sites in the EDIL3 gene The results showed that at position g.84324020, there were 61 individuals with the homozygous CC genotype, 54 individuals with the heterozygous CG genotype, and 72 individuals with the homozygous GG genotype. Among them, 42 individuals with the homozygous CC genotype belonged to the low-temperature group, and 59 individuals with the homozygous GG genotype belonged to the high-temperature group. The above genotyping results indicate that the GG homozygous genotype at the g.84324020 locus is the dominant genotype for heat adaptation (heat tolerance).
[0021] Example 2: Detection of heat-adapted SNP sites of gene EDIL3 in the validation population (1) Select 30 local cattle breeds from high-temperature and low-temperature areas as validation groups, collect blood and extract blood DNA.
[0022] (2) Design a pair of PCR primers to amplify DNA fragments containing the target SNP (g.84324020) site.
[0023] Upstream primer SEQ ID NO.2: AGGCTGGTGGAGGGAGTAAG; Downstream primer SEQ ID NO.3: TTGTCGGAGAGGACGAGAAA.
[0024] (3) The PCR amplification system consisted of 25 μl, including 1.0 μl (10 μmol / L) upstream primer, 1.0 μl (10 μmol / L) downstream primer, 1 μl (-50 μg / L) DNA template, 12.0 μL 2×Taq PCR Master Mix, and 10 μL ddH2O. The PCR amplification conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, and 72℃ extension for 30 s, for 35 cycles; and 72℃ extension for 10 min. The length of the target fragment obtained was 413 bp, and the PCR product was detected by 1% agarose gel electrophoresis.
[0025] (4) The PCR products were directly sequenced and the sequence results were compared with the bovine EDIL3 gene sequence provided by the NCBI GenBank database. There are three genotypes, CC, CG and GG, at the g.84324020 site. The GG homozygous genotype is the dominant genotype for heat adaptation. This individual is a dominant bovine individual for heat adaptation. Selecting individuals with dominant genotypes for heat adaptation to improve heat-resistant cattle breeds is beneficial to improving the heat tolerance of cattle, reducing heat stress response and reducing breeding costs.
[0026] Table 3. Statistical results of the association between SNP loci genotypes and heat adaptation in the validation cohort. This article uses specific examples to illustrate the inventive concept in detail. The description of the above embodiments is only for the purpose of helping to understand the core idea of the present invention. It should be noted that any obvious modifications, equivalent substitutions or other improvements made by those skilled in the art without departing from the inventive concept should be included within the protection scope of the present invention.
Claims
1. The application of bovine heat adaptation-related SNP molecular markers, characterized in that, The heat adaptability of cattle was assessed by detecting the genotype of SNP molecular markers related to heat adaptability. The SNP molecular marker was located at position 125 of the sequence shown in SEQ ID NO:1, which was g.84324020 C>G, located on the EDIL3 gene. The EDIL3 gene sequence was based on the region from 83843439 to 84324060 bp in NCBI:NC_037334.
1. Cattle with the SNP molecular marker genotype GG have significantly better high-temperature adaptation performance than cattle with the SNP molecular marker genotypes CC or CG. Cattle with SNP molecular marker genotypes CC or CG showed significantly better low-temperature adaptation than cattle with SNP molecular marker genotype GG.
2. The application according to claim 1, characterized in that, The heat adaptability of cattle can be assessed by detecting the genotypes of SNP molecular markers related to heat adaptability, which can then be used to screen for cattle breeds that are adapted to high or low temperatures, or for genetic improvement breeding.
3. The application of reagents for detecting SNP molecular markers in the preparation of products for assessing bovine thermocompatibility, characterized in that, The SNP molecular marker is located at position 125 of the sequence shown in SEQ ID NO:1, which is g.84324020 C>G, located on the EDIL3 gene. The EDIL3 gene sequence is based on the region from 83843439 to 84324060 bp in NCBI:NC_037334.
1. Cattle with the SNP molecular marker genotype GG have significantly better high-temperature adaptation performance than cattle with the SNP molecular marker genotypes CC or CG. Cattle with SNP molecular marker genotypes CC or CG showed significantly better low-temperature adaptation than cattle with SNP molecular marker genotype GG.
4. The application according to claim 3, characterized in that, The reagents include primer pairs, the nucleotide sequences of which are shown in SEQ ID NO:2~3.
Citation Information
Patent Citations
CN110079613A
CN116590422A
CN119979717A
US20150301058A1
US7041801B1