An antibody reprogramming and screening method based on engineered cells and application thereof

Abstract

This invention relates to a method for antibody reprogramming and screening based on engineered cells and its applications. This method achieves efficient in vitro rearrangement and diversity generation of antibody genes in non-lymphocytes by constructing engineered human cells containing the RAG1 / 2 recombinase system and programmable recombination signal sequence (RSS) elements. Utilizing this invention, the V(D)J rearrangement mechanism of B cells can be simulated in engineered cells, allowing for the targeted introduction of insertions, deletions, and point mutations in the antibody complementarity-determining region (CDR), resulting in a structurally diverse antibody library. Combined with piggyBac transposase-mediated genome integration, mammalian cell surface display technology, and flow cytometry sorting, high-throughput antibody screening and functional identification are achieved. This invention is simple to operate, has high antibody gene rearrangement efficiency, and produces a rich diversity of antibody libraries, making it suitable for rapid optimization of antibody drugs and discovery of new antibodies.

Description

Technical Field

[0001] This invention relates to the fields of antibody engineering and cell engineering in the field of biotechnology, and in particular to a method for antibody reprogramming and screening based on engineered cells and its application. Background Technology

[0002] Antibody drugs are highly specific and effective (Paul S, Konig MF, Pardoll DM, Bettegowda C, Papadopoulos N, Wright KM, et al. Cancer therapy with antibodies. Nat RevCancer. 2024;24(6):399-426.), and are used in oncology (Raja A, Kasana A, Verma V. Next-Generation Therapeutic Antibodies for Cancer Treatment: Advancements, Applications, and Challenges. Mol Biotechnol. 2025;67(9):3345-65.), autoimmune diseases (Chan AC, Carter PJ. Therapeutic antibodies for autoimmunity and inflammation. Nat Rev Immunol. 2010;10(5):301-16.), and infectious diseases (Guerra VA, Ocampo M, Cusnir M. Sars-CoV2 Antibody Responses in Patients with Hematological Malignancies Following It is widely used in fields such as Anti-CD20 Therapy. Blood. 2021;138.Traditional antibody development relies on technologies such as hybridoma (Tomita M, Tsumoto K. Hybridoma technologies for antibody production. Immunotherapy-Uk. 2011;3(3):371-80.) and phage display (Bradbury ARM, Sidhu S, Dübel S, McCafferty J. Beyond natural antibodies: the power of display technologies. Nature Biotechnology. 2011;29(3):245-54.), which suffer from problems such as structural rigidity, low proportion of functional antibodies, and insufficient screening efficiency (Raja A, Kasana A, Verma V. Next-Generation Therapeutic Antibodies for Cancer Treatment: Advancements, Applications, and Challenges. Mol Biotechnol. 2025;67(9):3345-65.).In recent years, although technological advancements such as fully synthetic antibody libraries (Marinov TM, Wasdin PT, Jordaan G, Janke AK, Abu-Shmais AA, Georgiev IS. An expandable synthetic library of human paired antibody sequences. Plos Comput Biol. 2025;21(4).) and AI-assisted design (He XH, Li JR, Xu JM, Shan H, Shen SY, Gao SH, et al. AI-driven antibody design with generative diffusion models: current insights and future directions. Acta Pharmacol Sin.2025;46(3):565-74.) have accelerated antibody development, the generation of antibody diversity still mainly relies on AID-mediated random mutations or saturation mutations of fixed-length coding sequences. The proportion of positive antibodies is low and the screening efficiency is limited (Matsunaga R, Tsumoto K. Accelerating antibody discovery and optimization with high-throughput experimentation and machine learning. J Biomed Sci.2025;32(1).). V(D)J rearrangement is a core mechanism for antibody diversity in B cells, mediated by RAG1 / 2 recombinase (Schatz DG, Ji YH. Recombination centers and the orchestration of V(D)J recombination. Nat Rev Immunol. 2011;11(4):251-63.). It can introduce rich insertion, deletion and linkage diversity into the variable region of antibody genes (Bassing CH, Swat W, Alt FW. The mechanism and regulation of chromosomal V(D)J recombination. Cell. 2002;109:S45-S55.).However, this mechanism is thought to occur only in lymphocytes, limiting its application in universal cell platforms (Lescale C, Deriano L. The RAG recombinase: Beyond breaking. Mech Ageing Dev. 2017;165:3-9.). Meanwhile, the native V(D)J rearrangement occurs only in the CDR3 coding region of the antibody gene.

[0003] literature Generating combinatorial diversity via engineered V(D)J-like recombination in Saccharomyces cerevisiae A technique for achieving engineered V(D)J-like recombination in *Saccharomyces cerevisiae* by expressing mouse RAG1 / 2 and HMGB1 proteins and relying on homologous recombination repair to form coding links was disclosed. Optimized RAG protein truncated variants (such as RAG1core) and substrate design were also disclosed, but the recombination efficiency was extremely low (only 1% after 4 days) and lacked linker diversity (relying on homologous recombination repair). This technique can be used for generating combinatorial diversity of fluorescent proteins or antibody fragments, but is limited to the yeast system.

[0004] Patent CN118480526A discloses a transposase, transposon, transposon system, and their applications. It describes engineered PS transposase (JL transposase) and its mutants, improving transposition efficiency through amino acid mutations (e.g., TQS57-59KKA) or fusion with functional peptides (e.g., leucine zipper domains). Optimization of the transposon TIR sequence (e.g., multiple copy tandem) and flanking TA cleavage sites enhances gene integration capabilities. Applications include CAR-T cell preparation, transgenic animals, and cell therapy.

[0005] Currently, there is an urgent need in this field for a new method that enables controllable and efficient antibody reprogramming and screening in non-lymphocytes. Summary of the Invention

[0006] To address the problems of complex operation, limited diversity, and low screening efficiency in existing antibody discovery technologies, this invention provides an engineered cell reprogramming and screening method that is simple to operate, efficient, and can generate a highly diverse antibody library, and applies it to the directed evolution and functional screening of antibodies.

[0007] This invention constructs a programmable antibody gene rearrangement system by mimicking the V(D)J rearrangement mechanism of B cells in non-lymphocytes (such as HEK293T), enabling targeted diversity modification of antibody variable regions (especially CDR regions). This method utilizes modular recombinant signal sequence (RSS) elements (as shown in SEQ ID NO.1) for precise insertion into the CDR1, CDR2, or CDR3 regions of the antibody light chain, achieving stable integration using the PiggyBac transposon system. The rearranged antibodies are then displayed on the cell membrane using cell surface display technology, and functional antibodies with target binding properties are efficiently screened using dual-signal flow cytometry sorting of antigen binding and antibody expression.

[0008] The technical solution of the present invention is as follows: 1. Modular RSS components The present invention provides a modular recombinant signal sequence (RSS) element comprising 12RSS and / or 23RSS, wherein a poly(A) signal sequence may be inserted therebetween to terminate the expression of antibody genes that have not undergone rearrangement, thereby ensuring that only rearranged antibodies are effectively expressed.

[0009] Preferably, the nucleotide sequence of the RSS element is as shown in SEQ ID NO.1.

[0010] 2. Antibody light chain expression cassette This invention provides an antibody light chain expression cassette, comprising: The aforementioned RSS element; Antibody light chains (such as Nivolumab light chain or Durvalumab light chain); pPGK-puro-polyA module; pCMV promoter (used to drive expression); 3×Flag tags; T2A-BSD peptide.

[0011] The RSS element is oriented and inserted into at least one of the CDR1, CDR2, or CDR3 regions of the antibody light chain. The pPGK-puro-polyA module is located at the 5′ end of the expression cassette and is used to screen stable cell lines. The 3×Flag tag is fused to the C-terminus of the antibody light chain for Western blotting detection. The T2A-BSD peptide is linked downstream of a 3×Flag tag for screening cells expressing antibodies after RAG1 / 2-mediated rearrangement.

[0012] The antibody light chain is a Nivolumab light chain or a Durvalumab light chain, and its nucleotide sequences are shown in SEQ ID NO. 6 and SEQ ID NO. 10, respectively. The nucleotide sequence of the pPGK-puro-polyA module is shown in SEQ ID NO.7; The nucleotide sequence of the 3×Flag tag is shown in SEQ ID NO.8; The nucleotide sequence of the T2A-BSD peptide is shown in SEQ ID NO.9.

[0013] 3. PiggyBac plasmid This invention provides a PiggyBac plasmid containing the aforementioned antibody light chain expression cassette, which enables efficient and stable integration into the host cell genome.

[0014] 4. Light chain reprogramming to stabilize cell lines The present invention provides a light chain reprogramming stable cell line, which includes the above-mentioned antibody light chain expression cassette, and can stably express antibody light chains containing RSS elements in cells.

[0015] 5. Antibody reprogramming and screening methods This invention provides a method for antibody reprogramming and screening based on engineered cells, comprising the following steps: S1: Construct engineered non-lymphocytes by introducing the PiggyBac plasmid containing the antibody light chain expression cassette into the engineered cells to construct a stable cell line for light chain reprogramming. S2: By transiently transfecting expression plasmids and / or mRNAs of RAG1, truncated RAG2 (1-161), and TdT rearrangement-related proteins, antibody gene reprogramming similar to the natural V(D)J rearrangement is initiated, thereby generating sequence diversity in the CDR1, CDR2, and CDR3 regions of the antibody gene. The nucleotide sequence of RAG1 is shown in SEQ ID NO.2, the nucleotide sequence of the truncated RAG2 (1-161) is shown in SEQ ID NO.3, and the nucleotide sequence of TdT is shown in SEQ ID NO.4. S3: The rearranged antibody is displayed on the cell membrane surface using mammalian cell surface display technology, wherein the cell surface display technology includes fusing the platelet-derived growth factor receptor (PDGFR) transmembrane domain and tag sequence to the C-terminus of the antibody encoding gene to be rearranged; The nucleotide sequence of the transmembrane domain of the PDGFR is shown in SEQ ID NO.5; S4: Flow cytometry is used to sort antibodies with target binding properties by utilizing the dual signals of antigen binding and antibody expression.

[0016] Preferably, the engineered non-lymphocytes are selected from one of HEK293, HEK293T, or HEK293F.

[0017] Furthermore, the flow cytometry sorting is based on a dual-positive selection of antigen-binding signals and antibody expression tag signals, which improves the specificity and efficiency of the screening.

[0018] Furthermore, this method can be used to generate diverse antibody libraries of variable length and sequence, suitable for affinity maturation or structural optimization of antibodies with known structures.

[0019] 6. Preferred antibody products This invention also provides antibodies or antigen-binding fragments thereof obtained by the above method, wherein: The antibody is an anti-PD-1 antibody, whose light chain complementarity-determining region (CDR-L1) contains a sequence change from QSVSSY to QSD; Alternatively, the antibody may be an anti-PD-L1 antibody, whose light chain complementarity-determining region (CDR-L2) contains a deletion mutation from PRLLIYDASSRAT to PRLLYDASSRAT or PRLYDASSRAT.

[0020] Furthermore, the antibody or its antigen-binding fragment is generated by multiple gene sequence mutations through RAG1 / 2-mediated V(D)J rearrangement and exhibits enhanced antigen-binding affinity for PD-1 or PD-L1.

[0021] Furthermore, compared with the parental antibody, the binding affinity to the PD-1 or PD-L1 antigen is increased by at least 1.1 to 2.01 times, as confirmed by EC50 values ​​measured by ELISA.

[0022] 7. Nucleic acid molecules, expression vectors, and host cells The present invention also provides an isolated nucleic acid molecule encoding the above-mentioned antibody or its antigen-binding fragment.

[0023] The present invention also provides an expression vector or host cell containing the nucleic acid molecule.

[0024] 8. Medical Uses The present invention also provides the use of the antibody or its antigen-binding fragment in the preparation of a medicament for treating cancer or immune-related diseases.

[0025] The present invention also provides a pharmaceutical composition comprising the antibody or an antigen-binding fragment thereof, and a pharmaceutically acceptable carrier or excipient.

[0026] The present invention also provides the use of the pharmaceutical composition in the preparation of medicaments for treating cancer or immune-related diseases.

[0027] Compared to recent pioneering research on V(D)J-like recombination in Saccharomyces cerevisiae (e.g., Cazier AP, Son J, Yellayi S, Chavez LS, Young C, Irvin OM, et al. Generating combinatorial diversity via engineered V(D)J-like recombination in. Nature Communications. 2025;16(1).), the approach provided in this application demonstrates significant advantages in terms of technical path, functional integrity, and application potential: While the approach also aims to reconstruct RAG-mediated recombination mechanisms in non-lymphocytes, Cazier et al.'s yeast system heavily relies on homologous recombination assistance and has limited recombination efficiency (approximately 1% within 4 days). In contrast, this approach, by deploying modular RSS elements in mammalian cells, not only achieves higher CDR region rearrangement efficiency (23-33%), but more importantly, successfully simulates the connectivity diversity in the natural antibody diversification process through the endogenous NHEJ repair pathway, including various forms such as base deletion, insertion, and point mutation; At the functional validation level, yeast systems mainly focus on reporter gene recombination, while this approach integrates PiggyBac stable integration, cell surface Fab display, and high-throughput flow cytometry sorting technologies to construct a complete closed loop from gene reprogramming to functional screening, successfully identifying antibody variants with 1.1-2.01-fold increased affinity. More importantly, this approach directly generates full-length IgG antibodies with correct folding and assembly in a mammalian cell environment, and its expression and purification process meets pharmaceutical standards (SEC-HPLC shows monomer purity >96%), effectively overcoming the limitations of microbial expression systems in post-translational modification and significantly shortening the cycle from antibody discovery to candidate drug development.

[0028] In summary, the combined advantages of this approach in terms of recombination efficiency, diversity generation mechanism, functional screening throughput, and ease of clinical translation provide a more competitive technical solution for antibody drug development.

[0029] Compared to the PnP system, which mainly relies on in vitro library construction and site-directed integration via CRISPR-Cas9 homology-directed repair (e.g., Mason DM, Weber CR, Parola C, Meng SM, Greiff V, Kelton WJ, et al. High-throughput antibody engineering in mammalian cells by CRISPR / Cas9-mediated homology-directed mutagenesis. Nucleic Acids Research. 2018;46(14):7436-49.;Parola C, Neumeier D, Friedensohn S, Csepregi L, Di Tacchio M, Mason DM, et al. Antibody discovery and engineering by enhanced CRISPR-Cas9integration of variable gene cassette libraries in mammalian cells. Mabs-Austin. 2019;11(8):1367-80.), the core breakthrough of this approach lies in its disruptive diversity generation mechanism and efficient, universal intracellular reprogramming process. While the PnP system can efficiently integrate pre-designed mutant libraries into specific sites, its screening process is essentially "selective," and the resulting diversity is usually limited to point mutations, making it difficult to simulate the sequence length variability of the most critical structural feature in natural antibody libraries—the complementarity-determining region (CDR). In contrast, this approach successfully simulates the formation process of a primary antibody library by precisely inserting programmable RSS elements into the CDR1, CDR2, and CDR3 regions of the antibody gene and inducing rearrangements in the cell using RAG1 / 2 recombinases. This mechanism not only introduces point mutations but also generates extensive insertions and deletions in all CDR regions, especially CDR1 / CDR2, which are difficult to perturb using traditional methods, thereby creating deep diversity with the structural characteristics of natural antibody libraries. The decoupling of library integration and diversity generation allows this invention to achieve efficient and controllable reprogramming in engineered non-lymphocytes, fundamentally overcoming the dependence of HDR efficiency on specific cell types and providing a more universal and reliable path for constructing high-quality, highly complex mammalian cell display libraries.

[0030] Compared with the prior art, the present invention has the following beneficial effects: 1. For the first time, RAG1 / 2-mediated antibody CDR region reprogramming was achieved in engineered non-lymphocytes, overcoming the limitations of lymphocytes being difficult to culture and manipulate.

[0031] 2. Diversity, especially sequence length diversity, can be introduced in the CDR1 / 2 / 3 regions of heavy and light chains.

[0032] 3. Combined with TDT co-expression, it further increases the non-template-dependent nucleotide insertion and enhances the diversity of the antibody variable region.

[0033] 4. Combining stable integration of the genome with cell surface display enables long-term, repeatable antibody screening.

[0034] 5. The integration of antibody sequence reprogramming and antibody screening shortens the antibody development cycle and is applicable to various antibody optimization scenarios. Attached Figure Description

[0035] Figure 1 A schematic diagram of the Nivolumab rearrangement module design.

[0036] Figure 2 A schematic diagram illustrating the efficiency analysis of antibody gene integration mediated by the PiggyBac transposon system.

[0037] Figure 3 A schematic diagram of the process for constructing stable cell lines for antibody expression cassettes and reprogramming antibody genes.

[0038] Figure 4 This is a schematic diagram of agarose gel electrophoresis analysis of the efficiency of RAG1 / 2-mediated antibody gene rearrangement; where A is the agarose gel electrophoresis image of PCR amplification products, and B is the quantitative analysis of the gray values ​​of each band.

[0039] Figure 5 This is a schematic diagram of Western blotting detection of antibody light chain protein expression in cells after reprogramming.

[0040] Figure 6 This is a schematic diagram of high-throughput sequencing evaluation for the diversity of reprogrammed antibody light chain sequences; where A is a statistical graph of the CDR length distribution of the variable region (VL) of the antibody light chain after reprogramming, and B is a spectrum of RAG cleavage site mutations, showing the frequency and distribution of insertions, deletions and point mutations introduced during the rearrangement process.

[0041] Figure 7 A schematic diagram illustrating the immunofluorescence verification of Fab antibody fragments on the cell membrane surface.

[0042] Figure 8 This is a schematic diagram of flow cytometry sorting of cells that are positive for both antibody expression and antigen binding.

[0043] Figure 9This is a schematic diagram of the ELISA assay for the affinity of reprogrammed antibodies for PD-1 antigen; where A is the binding curve of Nivolumab (N0) and the reprogrammed antibody variants (N1, N2, N3) to PD-1 antigen, and B is a brief table of Nivolumab (N0) and the reprogrammed antibody variants (N1, N2, N3).

[0044] Figure 10 This diagram illustrates the reprogramming and affinity maturation process of the PD-L1 antibody Durvalumab. A shows the DNA gel electrophoresis analysis of the rearrangement efficiency of the Durvalumab CDRL-1 / 2 / 3 regions; B shows Western blotting detection of Durvalumab light chain protein expression after reprogramming; C shows immunofluorescence verification of cell surface display of the rearranged antibody binding to the PD-L1 antigen; D shows flow cytometry sorting of cells showing double-positive results for both antibody expression and antigen binding; E shows ELISA measurements of the affinity of Durvalumab (Dur0) and the reprogrammed antibody variants (Dur1, Dur2) for the PD-L1 antigen; F shows a brief table of Durvalumab (Dur0) and the reprogrammed antibody variants (Dur1, Dur2); and G shows the structural model of the PD-L1 / Durvalumab complex (based on PDB 5X8M) and the structural model of the Dur1 / Dur2 mutation sites based on this structure. PD-L1, the Durvalumab heavy chain (nucleotide sequence as shown in SEQ ID NO.12), and the Durvalumab light chain are represented in white, gray, and light blue, respectively. Residues in the Durvalumab Fab light chain that directly interact with PD-L1 are marked in red (sites on the antibody) and blue (sites on the antigen). Deletion sites specific to Dur1 and Dur2 are highlighted in magenta.

[0045] Figure 11 Schematic diagram of antibody reprogramming and screening method based on engineered cells. Detailed Implementation

[0046] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are based on the technical solution of the present invention and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0047] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions as described in Molecular Cloning: A Laboratory Manual, 3rd Edition by Sambrook & Russell, or as recommended by the manufacturer.

[0048] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be used in this invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0049] Example 1 The method provided by this invention is used to reprogram the PD-1 antibody light chain gene and screen for Fab antibodies. Nivolumab is a high-affinity humanized anti-PD-1 monoclonal antibody whose mechanism of action is based on the specific blocking of the negative regulatory pathway of T cells (Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et al. Safety, Activity, and Immune Correlates of Anti-PD-1 Antibody in Cancer. New Engl J Med. 2012;366(26):2443-54.). In the tumor microenvironment, tumor cells upregulate the expression of PD-L1 ligand, which binds to the PD-1 receptor on the surface of T cells, initiating downstream inhibitory signals and inducing T cell exhaustion, thereby achieving immune escape (see Sharma P, Allison JP. The future of immune checkpoint therapy. Science. 2015;348(6230):56-61.; Francisco LM, Sage PT, Sharpe AH. The PD-1 pathway in tolerance and autoimmunity. Immunol Rev. 2010;236:219-42.).

[0050] The specific content of this embodiment includes: 1) Design of modular RSS elements and their insertion sites In the natural system, RAG1 / 2 can only recognize and cleave paired 12-RSS and 23-RSS, ensuring the correctness of V(D)J recombination. Simultaneously, the antibody's V(D)J rearrangement process only affects the diversity of the CDR3 sequence. The diversity of CDR1 and CDR2 is mainly caused by AID-mediated somatic high-frequency mutations (SHM). Following the 12RSS / 23RSS sequence of the natural system, the SV40 poly(A) component is inserted between the 12RSS and 23RSS fragments, forming a modular RSS element (nucleotide sequence shown in SEQ ID NO.1). When RAG1 / 2 rearrangement does not occur, the presence of poly(A) prevents the expression of the complete antibody. Next, modular RSS elements were inserted into CDR1, CDR2, and CDR3 of the Nivolumab light chain sequence (the nucleotide sequence of the Nivolumab light chain is shown in SEQ ID NO. 6, which was synthesized by Genscript Biotech Co., Ltd. with reference to the NCBI database and codon optimization based on human cell expression preferences). At the same time, a pPGK-puro-polyA module (sequence shown in SEQ ID NO. 7) was added to the 5' end of the antibody light chain expression cassette for screening stable cell lines. A 3×Flag tag (sequence shown in SEQ ID NO. 8) was added to the C-terminus of the Nivolumab light chain sequence for Western blotting detection. The T2A peptide sequence was linked to the downstream blast fungicide S resistance gene BSD to obtain the T2A-BSD fragment (T2A-BSD fragment sequence shown in SEQ ID NO. 9), which was used to screen cells expressing antibodies after RAG1 / 2 rearrangement.

[0051] Using a seamless cloning kit (Novizan, #C115-02), the pPGK-puro-polyA module, antibody light chain expression cassette (containing RSS elements and 3×Flag tags), and T2A-BSD selection fragment were assembled and ligated into the plasmid backbone pcDNA3.1 after incubation at 50°C for 1 hour. This yielded the Nivolumab antibody light chain expression cassette to be reprogrammed. The detailed design scheme is attached. Figure 1 As shown, Figure 1 A modular RSS element structure for antibody reprogramming is demonstrated, comprising paired 12-RSS and 23-RSS fragment sequences with an interposed SV40 poly(A) signal sequence. The element is directionally inserted into the complementarity-determining region (CDR1) of the Nivolumab antibody light chain, with CDR1 in red, CDR2 in green, and CDR3 in blue. The vector design also includes a puromycin resistance gene (pPGK-puro) for stable transfection selection and a C-terminal 3×Flag tag for expression detection. Expression cassette. 2) Construction of the PiggyBac plasmid vector The PiggyBac vector system, based on the "cut-and-paste" mechanism of class II transposons, can efficiently integrate target genes into the mammalian cell genome. The system includes a transposon plasmid containing the target gene and an auxiliary plasmid encoding the transposase PBase. In practice, both plasmids are co-transfected into target cells. The expressed transposase PBase recognizes terminal inverted repeat (ITR) elements on the transposon plasmid, and the sequence located between the two ITRs is inserted as a transposon into the host genome. This transposon insertion preferentially occurs at chromosomal sites containing TTAA sequences, forming TTAA repeat sequences flanking the integrated transposon.

[0052] In this invention, a Fab fragment is used as the antibody structure. The Fab fragment (Antigen-binding fragment), also known as the antigen-binding fragment, is the region in the antibody structure that can bind to the antigen. It consists of a complete light chain (variable and constant regions) and a partial heavy chain structure (variable and a constant region fragment). The C-terminus of the heavy chain gene is fused with the transmembrane domain PDGFR and the myc tag (Nivolumab heavy chain nucleotide sequence is shown in SEQ ID NO. 11) for subsequent antibody surface display and expression detection. The light and heavy chains are linked by a disulfide bond, with a molecular weight of 47-48 kDa. The Nivolumab heavy chain encoding gene and the Nivolumab antibody light chain expression cassette to be reprogrammed are constructed between two ITR elements as part of a transposon. The PBase transposase encoded by the helper plasmid enters the cell via transient transfection and is gradually lost during cell division, thereby achieving permanent integration of the transposon into the host genome.

[0053] In the specific implementation process, the PiggyBac plasmid backbone and the helper plasmid encoding the transposase PBase provided by Yunzhou Biotechnology Co., Ltd. were used. The vector backbone fragment, the Nivolumab antibody light chain fragment to be reprogrammed, and the Nivolumab heavy chain encoding gene were obtained by PCR amplification, with an overlap region of approximately 20 bp. Fragment assembly was completed by incubation at 50℃ for 1 hour using a seamless cloning kit (Novizan, C115-02). Subsequently, the recombinant plasmid was transformed into DH5α E. coli competent cells (Weidi Biotechnology, DL1001) using a heat shock method. After ampicillin resistance selection (100 μg / ml), positive single clones were selected for expansion culture, and plasmid integrity was verified by sequencing. Finally, transfection-grade plasmids were prepared using an endotoxin-free plasmid extraction kit (Tiangen, DP117) for subsequent cell transfection experiments.

[0054] 3) Construction of stable cell lines for Nivolumab light chain reprogramming a. Cell preparation: Seed HEK293T cells in six-well plates to achieve a density of 60%-80% (approximately 1×10⁻⁶) before transfection. 6 (1 cell / well) were routinely cultured in a 37°C, 5% CO2 incubator.

[0055] b. Solution preparation: DNA solution: Take 1.5 μg PiggyBac transposon plasmid and 1 μg PBase helper plasmid, add them to 250 μL Opti-MEM medium (Gibco, 31985070) and dilute, then mix gently.

[0056] Transfection reagent solution: Take 4 μL of Lipo8000 transfection reagent (Beyotime, C0533), add it to 250 μL of Opti-MEM medium and dilute, then mix well.

[0057] c. Complex formation: Mix the DNA solution with the transfection reagent solution and incubate at room temperature for 15 minutes to form a DNA-liposome complex.

[0058] d. Cell transfection: Add the complex dropwise to the cell culture medium, shake gently, and incubate at 37°C in a 5% CO2 incubator for 4-8 hours.

[0059] e. Culture medium replacement: Replace with fresh complete culture medium (DMEM containing 10% FBS) after incubation.

[0060] f. Resistance screening: 48 hours after transfection, puromycin was added to the culture medium to a final concentration of 10 μg / mL, and screening was continued to enrich successfully integrated cells.

[0061] g. Establishment of stable cell lines: Culture continuously in puromycin-containing medium for 5-6 days, passage 3-4 times during this period, and observe cell status daily.

[0062] h. Validation of efficacy: Cells transfected only with the transposon plasmid (without helper plasmid) served as a negative control. Stable cell lines reprogrammed with Nivolumab light chain were obtained 14 days after transfection.

[0063] i. System efficiency validation: After co-transfection of piggyBAC-mCherry reporter plasmid and PBase helper plasmid, and selection with 10 μg / mL puromycin for 2 weeks, flow cytometry analysis showed that the proportion of mCherry-positive cells reached 96.56%. Figure 2 This confirms that the PiggyBac system has efficient gene integration and screening capabilities in this system.

[0064] 4) Reprogramming antibody genes by expressing RAG1 / 2 RAG1 expression plasmid (SEQ ID NO.2), truncated RAG2 (1-361) mRNA (i.e., RAG2 1-361, SEQ ID NO.3), and TdT expression plasmid (SEQ ID NO.4) were co-transfected into the aforementioned Nivolumab light chain stable cell line to activate in vitro reprogramming of the antibody gene. The specific steps are as follows (see flowchart). Figure 3 ): a. Cell preparation: One day before transfection, cells were prepared at 6 × 10⁶ cells / day. 6 Inoculate at a density of 10 cm² per dish into 10 cm culture dishes and incubate overnight until confluence reaches 70%-90%.

[0065] b. Dilution of nucleic acid and transfection reagent: Nucleic acid mixture: Take 10 μg RAG1 expression plasmid, 10 μg RAG2(1-361) mRNA and 10 μg TdT expression plasmid, dilute with Opti-MEM to a total volume of 450 μL, add 50 μL P3000 reagent and mix well.

[0066] Transfection reagent solution: Take 50 μL of Lipofectamine 3000 (Invitrogen, L3000015) and dilute it to 500 μL with Opti-MEM.

[0067] c. Preparation of transfection complex: Mix the nucleic acid mixture with the transfection reagent solution to a total volume of 1 mL, mix gently, and let stand at room temperature for 15 minutes.

[0068] d. Cell transfection: Aspirate the old culture medium, gently wash once with PBS, add 10 mL of fresh complete culture medium, then add the transfection complex dropwise to the dish, gently shake to mix, and continue culturing at 37°C and 5% CO2. Replace with fresh complete culture medium after 4-6 hours.

[0069] e. Resistance selection: 48 hours after transfection, blast fungicide S (final concentration 10 μg / mL) was added for selection to remove cells that had not undergone rearrangement or did not express antibodies. Cells were cultured for at least one week, passaged 2-3 times, and cell morphology was observed daily to obtain a cell population that had completed RAG1 / 2-mediated reprogramming and stably expressed antibodies. Expression cassette 5) PCR was used to determine the reprogramming efficiency of RAG1 / 2 in the cell pool after drug screening (refer to Gan TT, Wang YH, Liu Y, Schatz DG, Hu JZ. RAG2 abolishes RAG1 aggregation to facilitate V(D)J recombination. Cell Rep. 2021;37(2).) Using a commercially available genomic DNA extraction kit (Beyotime, D0063), DNA was extracted from approximately 5 × 10⁻⁶ cells / day. 6 Genomic DNA was extracted from reprogrammed cells. Specific primers were designed upstream and downstream of the RSS element insertion site (upstream primer Efficiency-Nivolumab-F, SEQ ID NO.15: cccagtttcagataccactggag; downstream primer Efficiency-Nivolumab-R, SEQ ID NO.16: cgaccttccactgcaccttg). Using genomic DNA from the selected cell pool as a template, amplification was performed using KOD One™ PCR Master Mix (Toyobo, KMM-201). The reaction mixture consisted of 25 μL Master Mix, 1 μg template DNA, 0.3 μM each of forward and reverse primers, and water to a final volume of 50 μL. The PCR program was as follows: 94℃ pre-denaturation for 2 minutes; 25 cycles of 98℃ for 10 seconds, 58℃ for 10 seconds, and 68℃ for 10 seconds; and a final extension at 68℃ for 3 minutes. The products were analyzed by 1% agarose gel electrophoresis.

[0070] The results are as follows Figure 4 As shown in Figure A: After transfection with RAG1 / 2, all three CDR-RSS on the light chain backbone underwent rearrangement, resulting in three characteristic bands in the electrophoresis image: uncleaved, hybrid, and cleaved. Quantitative analysis using grayscale (...) Figure 4 B), the rearrangement efficiencies of CDRL1, CDRL2 and CDRL3 regions were 28.42%, 33.49% and 23.45%, respectively, indicating that RAG1 / 2 effectively mediated the sequence reprogramming of the CDR region in engineered cells.

[0071] 6) Western Blot analysis of antibody protein expression in the reprogrammed cell pool. a. Protein sample preparation: Cells were lysed using RIPA lysis buffer (Sheng'er Biotech, SB-BR040) containing protease inhibitors, incubated on ice for 10 minutes, and centrifuged at 12,000 rpm for 5 minutes at 4°C. The supernatant was collected. Protein concentration was determined using the BCA method and adjusted to a uniform level. Loading buffer (Sheng'er Biotech, SB-PR037) containing SDS and the reducing agent TCEP was added, and the protein was denatured by heating at 95°C for 10 minutes.

[0072] b. Gel electrophoresis: Prepare a 4-20% gradient SDS-polyacrylamide gel (Sheng'er Biotech, SB-TG1542015), load 50 μg of protein sample into each well, and electrophores at a constant voltage of 70-120 V until the bromophenol blue reaches the bottom of the gel.

[0073] c. Protein transfer: After activating the PVDF membrane with methanol, immerse it, along with the gel and filter paper, in transfer buffer. Assemble in the order of "negative electrode - filter paper - gel - membrane - filter paper - positive electrode" and transfer at a constant current of 280 mA for 75 minutes.

[0074] d. Immunological assay: Block with 5% skim milk / TBST for 1 hour; add diluted primary antibody (anti-FLAG 1:5000, anti-β-tubulin 1:5000), incubate overnight at 4°C; wash with TBST, add HRP-labeled secondary antibody (1:6000), incubate at room temperature for 1 hour; wash again.

[0075] e. Signal detection and quantification: ECL developing solution (Sheng'er Biotechnology, SB-WB011) was added, and the signal was acquired using a chemiluminescence imaging system with an exposure time of 1 second. The gray values ​​of the target band (FLAG) and the internal control band (β-tubulin) were analyzed using ImageJ software, and the ratio of the two bands was used to represent the relative expression level of the target protein.

[0076] The results are as follows Figure 5 As shown, a clear Flag tag band is visible near 28 kDa, consistent with the theoretical molecular weight of the light chain; the β-tubulin internal control band is located at 50 kDa, indicating uniform sample loading. Western blot results confirm that cells with CDR-RSS insertions after RAG1 / 2 rearrangement can effectively express light chain proteins, further validating the feasibility of the reprogramming system.

[0077] 7) NGS sequencing was used to assess the sequence diversity of the antibody screening cell pool (refer to Mason DM, Weber CR, Parola C, Meng SM, Greiff V, Kelton WJ, et al. High-throughput antibody engineering in mammalian cells by CRISPR / Cas9-mediated homology-directed mutationnesis. Nucleic Acids Research. 2018;46(14):7436-49.) a. Genomic DNA extraction from samples: A commercial genomic DNA extraction kit (Beyotime, D0063) was used to extract genomic DNA from approximately 5 × 10⁻⁶ samples. 6 Genomic DNA was extracted from the reprogrammed cells.

[0078] b. Step 1 PCR amplification: Using specific primers containing partial Illumina adapter sequences (forward primer NGS-Nivo-VL-F, SEQ ID NO. 13: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTGGCTAGCGTTTAAACTTAAGCTTG; reverse primer NGS-Nivo-VL-R, SEQ ID NO. 14: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGTGGAAAGATGAACACAGAAGG), the extracted genomic DNA was used as a template to amplify the variable region (VL) of the antibody light chain. PCR was performed using Q5 high-fidelity DNA polymerase (NEB, M0491S) in a 50 µL system. The program was: 98℃ pre-denaturation for 30 seconds; followed by 16 cycles: 98℃ for 10 seconds, 70℃ for 20 seconds, 72℃ for 30 seconds; and a final extension at 72℃ for 1 minute. The products were separated by 1% agarose gel electrophoresis, and the target fragment was recovered by gel excision.

[0079] c. Second-step PCR amplification: Using the product recovered in step one as a template, add the full-length Illumina adapter sequence. Program: 98℃ pre-denaturation for 30 seconds; 2 cycles (98℃ 10 seconds, 40℃ 20 seconds, 72℃ 1 minute); followed by 6 cycles (98℃ 10 seconds, 65℃ 20 seconds, 72℃ 1 minute); final extension at 72℃ for 5 minutes. Purify the correctly sized bands after electrophoresis.

[0080] d. Library quality control and sequencing: The library concentration was determined using Nanodrop. After passing the quality control, 2×250 bp paired-end sequencing was performed on the Illumina MiSeq platform to cover the full length of the light chain variable region.

[0081] e. Bioinformatics analysis: FastQC was used to assess data quality; Trimmomatic was used to remove low-quality bases and adapters; data were split by sample index; Bowtie2 was used to align reads to antibody reference sequences; IgBLAST was used to extract variable region sequences; CD-HIT was used to remove duplicates and count clone frequencies; MEGA was used for multiple sequence alignment, SNV and Indel detection, mutation distribution was statistically analyzed and plotted.

[0082] Sequencing results analysis: MiSeq sequencing yielded >1 Gb of high-quality data per sample (Q30 > 90%), with >2 × 10⁻⁶ effective reads after preprocessing. 6 The unique sequences with more than 100 reads were counted as follows: Without TdT, 734, 712, and 564 unique DNA sequences were detected in CDRL1 / 2 / 3 regions, respectively; after adding TdT, the number of sequence types increased to 1040, 1118, and 1051, respectively, with diversity increases of 41.7%, 57%, and 86.3%.

[0083] like Figure 6 As shown in Figure A: The CDR length distribution reveals that CDR-L1 is concentrated in the range of 0-6 aa (parental length is 6 aa), CDR-L2 is 8-15 aa (parental length is 13 aa), and CDR-L3 is 2-8 aa (parental length is 7 aa). The median length of all three CDR regions is lower than that of the parent (black dashed line), indicating that deletion mutations are dominant. Furthermore, the sequence diversity of the TdT expression group (red) is higher than that of the non-TdT group (blue) in all length ranges, demonstrating that TdT-mediated N-nucleotide insertion can broadly enhance CDR sequence diversity.

[0084] like Figure 6 As shown in Figure B, mutations are mainly concentrated within ±5 bp of the RAG1 / 2 cleavage site, with a mutation rate >10%. Deletion, insertion, point mutations, and mixed types can be detected, with deletion mutations having the highest frequency. TdT expression increases the frequency of all mutation types, indicating that TdT can further increase sequence diversity, which is consistent with the function of TdT in the antibody diversification process of native B cells. The proportion of mutation types varies in different CDR regions, reflecting the sequence heterogeneity and randomness of the reprogramming process.

[0085] 8) Display of antibodies on mammalian cell surfaces (Reference: Bowers PM, Horlick RA, Kehry MR, Neben TY, Tomlinson GL, Altobell L, et al. Mammalian cell display for the discovery and optimization of antibody therapeutics. Methods. 2014;65(1):44-56.) This invention uses a Fab fragment as the display unit, which maintains the correct folding and antigen-binding ability of natural antibodies. To achieve membrane surface display, the myc tag and PDGFR transmembrane domain are fused to the C-terminus of the CH1 domain of the heavy chain, anchoring the heavy chain to the cell membrane and facilitating expression detection; the light chain assembles with the heavy chain through interchain disulfide bonds to form a complete membrane display Fab.

[0086] Immunofluorescence assay procedure: Cells were seeded on coverslips and cultured to 60-80% confluence. After washing with PBS, cells were fixed with 4% paraformaldehyde at room temperature for 15-20 minutes. Blocked with 1% BSA for 30 minutes. After washing three times with PBS, AF700-labeled anti-Myc antibody (CellSignaling Technology, 42136S, 1:1000) and FITC-labeled PD-1 antigen (GenScript, Z03424, 1:100) were added, and the cells were incubated at room temperature in the dark for 1 hour. After washing three times with PBS, nuclei were stained with DAPI (1 µg / mL) for 5 minutes. After mounting, cells were observed using a confocal microscope (FITC: Ex / Em = 488 / 520 nm; AF700: Ex / Em = 696 / 719 nm).

[0087] The results are as follows Figure 7 As shown, red fluorescence (HC-myc) and green fluorescence (PD-1) co-localize on the cell membrane, and blue DAPI labels the cell nucleus, confirming that the Fab fragment was successfully displayed on the membrane surface and maintained its antigen-binding ability. Only weak background fluorescence was observed in the control group, while the experimental group showed clear membrane fluorescence signals and high display efficiency. The differences in fluorescence intensity among different cells may be related to transfection and expression levels.

[0088] Conclusion: Immunofluorescence results directly validated the effectiveness of this surface display system, laying the foundation for subsequent flow cytometry sorting.

[0089] 9) Flow cytometry sorting of cells that are positive for both antibody expression and antigen binding (Reference: Beerli RR, Bauer M, Buser RB, Gwerder M, Muntwiler S, Maurer P, et al. Isolation of human monoclonal antibodies by mammalian cell display. P Natl Acad Sci USA. 2008;105(38):14336-41.) Cells were cultured to a confluence of 60% to 80%, the culture medium was removed, and the cells were gently washed 2 to 3 times with pre-warmed phosphate-buffered saline (PBS). Cells were then digested with trypsin, followed by two more washes with PBS. AF700-labeled anti-Myc antibody (Cell Signaling Technology, 42136S) was added to detect antibody expression, and FITC-labeled PD-1 antigen (GenScript, Z03424) was added to detect antigen binding. The cells were incubated at 4°C in the dark for 30 minutes. After incubation, the cells were washed twice with PBS to remove unbound antibodies.

[0090] Flow cytometry was used to detect and analyze cell surface antibody display. To accurately define the gating region for flow cytometry analysis, cells without RAG1 / 2 rearrangement were used as a control group. Comparative analysis was conducted to evaluate the proportion of positive cells and their fluorescence intensity within the target cell group.

[0091] like Figure 8 As shown, in a cell population simultaneously expressing the heavy chain and the reprogrammed light chain, a double-positive cell population exhibiting antibody expression (AF700+) and PD-1 antigen binding (FITC+) was observed. The results indicate that cells without RAG1 / 2 rearrangement cannot effectively bind to the fluorescently labeled antigen (FITC-PD-1). In Nivolumab stable cell line samples after RAG1 / 2 rearrangement, the first round of flow cytometry sorting yielded 1.96% double-positive cells, and the second round of flow cytometry sorting after scale-up culture yielded 5.88% double-positive cells. Finally, these double-positive cells were collected using flow cytometry sorting and enriched through scale-up culture. The resulting cell population can be used for subsequent sequence diversity analysis and multiple rounds of antibody screening.

[0092] 10) ELISA detection of antigen-antibody affinity (Reference: Feng YP, Yuan M, Powers JM, HuMY, Munt JE, Arunachalam PS, et al. Broadly neutralizing antibodies against sarbecoviruses generated by immunization of macaques with an AS03-adjuvanted COVID-19 vaccine. Sci Transl Med. 2023;15(695).) a. Antigen Coating: Dilute the PD-1 antigen (His-tagged recombinant human protein, GenScript, Z03424) to a working concentration of 1 µg / mL with coating buffer (0.05 M carbonate buffer, pH 9.6, Sigma Aldrich, C3041). Add 100 µL to each well of a 96-well high-binding polystyrene microplate (Corning, catalog number 9018) and coat overnight at 4°C. Set up wells with only coating buffer as a blank control.

[0093] b. Washing and Blocking: Discard the liquid in each well. Add 300 µL of PBST buffer to each well, let stand for 30 seconds, then discard. Repeat washing 3 times. Add 200-300 µL of blocking buffer to each well and incubate at 37°C for 2 hours to block protein binding sites not occupied by antigen. After blocking, discard the blocking buffer and wash 3 times with PBST buffer as described above.

[0094] c. Primary antibody (test antibody) incubation: Perform a series of serial dilutions of the test antibody using antibody diluent (1% BSA / PBST) (e.g., starting from 10 nM, perform 10-fold serial dilutions for a total of 8 concentration points). Add 100 µL of antibody diluent at different concentrations to each well coated with antigen. Set up 3 replicates for each concentration. Incubate the ELISA plate at 37°C for 1.5 hours to allow the antibody to fully bind to the solid-phase antigen.

[0095] d. Incubation with enzyme-labeled secondary antibody: Discard the primary antibody solution and wash three times with PBST buffer. Dilute the HRP-labeled secondary antibody to the working concentration (1:100) with blocking buffer according to the instructions. Add 100 µL of the diluted secondary antibody solution to each well and incubate at 37°C in the dark for 1 hour.

[0096] e. Colorimetric reaction: Discard the secondary antibody solution and wash three times with PBST buffer to completely remove unbound enzyme-labeled secondary antibody. Add 100 µL of TMB substrate solution to each well and incubate at room temperature in the dark for 15 minutes, until a clear blue color appears in the positive control wells.

[0097] f. Termination and Detection: Add 50 µL of 2 M sulfuric acid stop solution to each well; the solution color will change from blue to yellow. Within 20 minutes after the reaction is terminated, measure the absorbance of each well at 450 nm using a microplate reader.

[0098] g. Data Analysis and Affinity Calculation: Subtract the average value of the blank control wells from the OD450nm readings of each replicate well. Plot a dose-response curve with the logarithm of antibody concentration on the x-axis and the corresponding average OD450nm value on the y-axis. Perform nonlinear regression fitting on the curve using a four-parameter logistic model (4-PL) or a single-site combined model. The fitting software will automatically calculate the EC50 value of the curve, which is approximately equal to the antibody dissociation constant Kd.

[0099] The dose-response curves of antibody-solid-coated antigen binding were obtained by detecting the OD450nm absorbance values ​​at different antibody concentrations. Figure 9 As shown in Figure A, all data points exhibit a good S-shaped distribution, indicating a specific saturation binding between the antibody and the antigen. A four-parameter logistic (4-PL) model was used to perform nonlinear regression fitting on the data, and the resulting fitted curve showed a high degree of agreement with the experimental data points (R²). 2 The result (>0.99) confirms the applicability of the model. For example... Figure 9 As shown in Figure B, the half-maximal effective concentrations (EC50) of the three antibodies N1, N2, and N3 bound to the antigen PD-1, as calculated by fitting, all reached the pM level. Among them, N1 showed a 1.1-fold increase in affinity for PD-1 compared to Nivolumab (4.44 pM / 4.06 pM). In ELISA experiments based on the direct binding mode, the EC50 value can approximately represent the apparent dissociation constant (Kd) of the antibody, used to assess its affinity. This result indicates that the antibodies detected in this experiment have extremely high affinity for the target antigen. In the blank control wells containing only coating buffer, the measured OD450nm signal value remained below 0.1, confirming the low background characteristics of the experimental system and the absence of significant false positive signals caused by non-specific adsorption. At the highest antibody concentration test point of 10 nM, the OD450nm signal reached a plateau value of 3.1, showing a wide signal dynamic range and ensuring the accuracy of the EC50 value calculation.

[0100] In summary, the ELISA method established in this application has been successfully used to quantitatively assess antigen-antibody interactions. The results show that the reprogrammed and screened antibodies can bind efficiently and specifically to the target antigen, exhibiting strong affinity at the nanomolar level, providing crucial functional data for their subsequent applications.

[0101] The above results demonstrate that the antibody reprogramming system provided by this invention can perform targeted optimization based on known antibody structures, effectively screening antibody mutants with higher affinity, and providing a reliable technical platform for the development of novel antibody drugs.

[0102] Example 2: Application in reprogramming and screening of the PD-L1 antibody Durvalumab Durvalumab (trade name Imfinzi) is a humanized IgG1κ monoclonal antibody targeting programmed death-ligand-1 (PD-L1). It restores the T-cell immune killing function against tumor cells by blocking the binding of PD-L1 to the PD-1 receptor on the surface of T cells (Reference: Brahmer JR, Tykodi SS, Chow LQM, Hwu WJ, Topalian SL, Hwu P, et al. Safety and Activity of Anti-PD-L1 Antibody in Patients with Advanced Cancer. New Engl J Med. 2012;366(26):2455-65.). Similar to Example 1 above, this invention can also be applied to the reprogramming and screening of the PD-L1 antibody Durvalumab.

[0103] Durvalumab light chain expression cassettes (light chain sequences shown in SEQ ID NO. 10) and heavy chain encoding genes (Nivolumab heavy chain nucleotide sequences shown in SEQ ID NO. 11) targeting CDR1, CDR2, and CDR3 respectively, were integrated into the genome of HEK293T cells using the PiggyBac transposon system. Quantitative PCR analysis showed that the integration copy numbers of Durvalumab-CDRL1-RSS and Durvalumab-CDRL2-RSS were 1.07 and 1.39 copies / cell, respectively. After rearrangement induced by co-expression of RAG1 / 2 and TdT, agarose gel electrophoresis (…) was performed. Figure 10 A) The data shows that each CDR-RSS exhibits three characteristic bands: uncleaved, hybrid, and cleaved, indicating successful rearrangement. Further quantitative analysis with grayscale values ​​reveals rearrangement efficiencies of 38.24%, 47.27%, and 32.23% in the CDRL1, CDRL2, and CDRL3 regions, respectively, demonstrating that this system can efficiently simulate the V(D)J-like rearrangement process in non-lymphocytes.

[0104] Western Blot analysis Figure 10B) confirmed that the rearranged cell population stably expressed Durvalumab light chain protein (approximately 28 kDa). A surface display system was constructed by fusing the PDGFR transmembrane domain to the C-terminus of the heavy chain, and immunofluorescence confocal microscopy was used for imaging. Figure 10 C) shows that the expression signal of HC-myc-AF700 labeled antibody (red) and the antigen binding signal of PD-L1-Cy3 labeled antigen (yellow) are simultaneously present on the cell membrane, and the two are significantly co-localized on the membrane, indicating that the reprogrammed antibody can fold, assemble and be displayed on the cell surface correctly, and retains the ability to specifically recognize PD-L1.

[0105] Using AF700 (antibody expression) and FITC (PD-L1 binding) as dual signals, reprogrammed cells were sorted in two rounds. Figure 10 (D) Enrichment yielded a double-positive cell population for both antigen binding and antibody expression. The proportions of double-positive cell populations obtained in the two rounds of screening were 1.34% and 4.37%, respectively. After single-cell clone amplification and preliminary screening by cell ELISA, the two single clones with the strongest binding signals, Dur1 and Dur2, were selected for further analysis.

[0106] Two representative variants, Dur1 and Dur2, selected from the screening process, along with the parental Durvalumab (Dur0), were expressed and purified in full length as IgG. Their affinity for the PD-L1 antigen was then determined using ELISA. Results ( Figure 10 E) shows that the CDRL2 sequence of the Dur1 variant, mutated from the parental sequence PRLLIYDASSRAT to PRLLYDASSRAT (deleting an isoleucine residue I), has an EC50 of 2.31 ± 0.02 pM for binding to PD-L1, representing a 2.01-fold increase in affinity compared to wild-type Durvalumab (Dur0, 4.65 ± 0.16 pM). The CDRL2 sequence of the Dur2 variant is further mutated to PRLYDASSRAT (additionally deleting a leucine residue L), resulting in a 1.53-fold increase in affinity. (Structural diagram follows) Figure 10 F) visually illustrates the location of the deletion mutation in the CDRL2 region, suggesting that this region plays a crucial role in antigen binding. Structural simulation analysis shows ( Figure 10 F), both variants have deletion mutations in the CDRL2 region, which is far from the site where CDRL3 directly interacts with the antigen (magenta). This suggests that the deletion mutations in the variants may cause conformational changes in CDRL2, thereby enhancing the binding affinity of the antibody to PD-L1 through indirect effects (such as fine-tuning the overall conformation of the antibody-binding interface, optimizing spatial arrangement, or enhancing structural rigidity), rather than directly participating in antigen contact.

[0107] This study successfully applied an antibody reprogramming platform to the light chain reprogramming and screening of the PD-L1 antibody Durvalumab. Experimental results showed that this system can efficiently achieve directed rearrangement of the antibody CDR region in non-lymphocytes and successfully introduce sequence diversity, including deletion mutations. Cell surface display and flow cytometry sorting enabled the rapid enrichment and identification of antibody variants with higher affinity. The screened Dur1 and Dur2 variants, validated by ELISA, showed 2.01-fold and 1.53-fold increases in affinity compared to the parent antibody, respectively, demonstrating the effectiveness and universality of this method in antibody affinity maturation.

[0108] In summary, this embodiment further verifies the universality of the antibody reprogramming platform of the present invention, which is independent of the target or antibody backbone, and provides a reliable and efficient technical path for the rapid optimization and development of therapeutic antibodies targeting different targets.

Claims

1. A modular recombination signal sequence element, characterized in that, That is, the RSS element, the nucleotide sequence of which is shown in SEQ ID NO.

1.

2. An antibody light chain expression cassette, characterized in that, Includes the RSS element, antibody light chain, pPGK-puro-polyA module, 3×Flag tag, and T2A-BSD peptide as described in claim 1; The RSS element is oriented and inserted into at least one of the CDR1, CDR2, or CDR3 regions of the antibody light chain. The pPGK-puro-polyA module is located at the 5′ end of the antibody light chain; The 3×Flag tag is located at the C-terminus of the antibody light chain; The T2A-BSD peptide is linked downstream of the 3×Flag tag; The antibody light chain is either the Nivolumab light chain or the Durvalumab light chain. The nucleotide sequence of the Nivolumab light chain is shown in SEQ ID NO.6, and the nucleotide sequence of the Durvalumab light chain is shown in SEQ ID NO.

10. The nucleotide sequence of the pPGK-puro-polyA module is shown in SEQ ID NO.7; The nucleotide sequence of the 3×Flag tag is shown in SEQ ID NO.8; The nucleotide sequence of the T2A-BSD peptide is shown in SEQ ID NO.

9.

3. A PiggyBac plasmid, characterized in that, It includes the antibody light chain expression cassette as described in claim 2.

4. A light chain reprogrammed stable cell line, characterized in that, The genome contains the antibody light chain expression cassette as described in claim 2.

5. A method for antibody reprogramming and screening based on engineered cells, characterized in that, Includes the following steps: S1: Construct engineered non-lymphocytes by introducing the PiggyBac plasmid as described in claim 3 into the genome of the engineered non-lymphocytes to construct the light chain reprogramming stable cell line as described in claim 4; S2: By transiently transfecting expression plasmids and / or mRNAs of RAG1, truncated RAG2 (1-161), and TdT rearrangement-related proteins, antibody gene reprogramming similar to the natural V(D)J rearrangement is initiated, thereby generating sequence diversity in the CDR1, CDR2, and CDR3 regions of the antibody gene. The nucleotide sequence of RAG1 is shown in SEQ ID NO.2, the nucleotide sequence of the truncated RAG2 (1-161) is shown in SEQ ID NO.3, and the nucleotide sequence of TdT is shown in SEQ ID NO.

4. S3: The rearranged antibody is displayed on the cell membrane surface using mammalian cell surface display technology, wherein the cell surface display technology includes fusing the platelet-derived growth factor receptor (PDGFR) transmembrane domain and tag sequence to the C-terminus of the antibody encoding gene to be rearranged; The nucleotide sequence of the transmembrane domain of the PDGFR is shown in SEQ ID NO.5; S4: Flow cytometry is used to sort antibodies with target binding properties by utilizing the dual signals of antigen binding and antibody expression.

6. The antibody reprogramming and screening method based on engineered cells according to claim 5, characterized in that, In step S1, the engineered non-lymphocytes are selected from one of HEK293, HEK293T, or HEK293F.

7. An antibody or antigen-binding fragment thereof obtained based on the method of claim 5 or 6, characterized in that, The antibody is an anti-PD-1 antibody, whose light chain complementarity-determining region (CDR-L1) contains a sequence change from QSVSSY to QSD; Alternatively, the antibody may be an anti-PD-L1 antibody, whose light chain complementarity-determining region contains a deletion mutation from PRLLIYDASSRAT to PRLLYDASSRAT or PRLYDASSRAT.

8. An isolated nucleic acid molecule encoding the antibody of claim 7 or an antigen-binding fragment thereof.

9. An expression vector or host cell comprising the nucleic acid molecule of claim 8.

10. Use of the antibody or antigen-binding fragment thereof as claimed in claim 7 in the preparation of a medicament for treating cancer or immune-related diseases.

Images