A strain of miller yarrowia and its application in food fermentation

Abstract

This invention discloses a powdered *Miller's yeast* strain and its application in food fermentation, belonging to the field of food biotechnology. The invention provides a powdered *Miller's yeast* strain GZR-YJ-40, preservation number: GDMCC No: 64935. The powdered *Miller's yeast* GZR-YJ-40 has the following characteristics: rapid growth rate; tolerance to the gastrointestinal environment and excellent probiotic properties; sensitivity to common fungal antibiotics, non-hemolytic, and good safety; effective tolerance to high salt, acid, and ethanol; antioxidant properties; and the ability to produce high levels of flavor compounds during fermentation. Furthermore, the powdered *Miller's yeast* GZR-YJ-40 has biogenic amine degradation capabilities; therefore, as a starter culture, this strain can ensure the safety and flavor quality of fermented foods, shorten the fermentation cycle, and significantly improve the nutritional value of fermented foods.

Description

Technical Field

[0001] This invention relates to a powdered Miller's yeast and its application in food fermentation, belonging to the field of microbial biotechnology or food biotechnology. Background Technology

[0002] Fermented foods such as fermented soybean paste, soybean paste, soy sauce, and fermented black beans are beloved by consumers for their unique color, aroma, taste, and appearance. These products generally employ natural fermentation processes, but to ensure food safety, the amount of sodium chloride added typically exceeds 15%. Studies show that high salt concentrations significantly reduce the aroma compounds in fermented soybean paste. In the fermented food industry, the performance of microbial strains directly determines product quality, safety, and production efficiency. Traditional food fermentation processes often face various environmental stressors, such as high salt, low pH, and ethanol accumulation. These conditions severely restrict the activity and metabolic capacity of conventional fermentation strains. Simultaneously, abundant protein in raw materials can lead to excessive levels of biogenic amines. Excessive amounts of histamine, tyramine, cadaverine, and putrescine not only affect product safety but may also pose a potential threat to consumer health.

[0003] Currently, extensive research has been conducted both domestically and internationally on the improvement of microorganisms in fermented foods. Existing technology CN116463225A discloses the application of powdered Miller's yeast ZB427 in rice wine brewing. This strain can increase the content of esters in the wine, especially typical aroma compounds such as ethyl lactate and ethyl phenylacetate; however, the content of each substance is below 0.1 mg / L, which is relatively low. Existing technology CN110771777A discloses a powdered Miller's yeast strain capable of degrading biogenic amines, achieving a 60-day degradation efficiency of 57.13% for biogenic amines such as histamine, cadaverine, and putrescine, but it cannot achieve complete degradation of at least one biogenic amine.

[0004] Current research on powdered Miller's yeast is limited to rice wine fermentation, and most studies only demonstrate single-function characteristics of the strains, such as the ability to produce esters or degrade biogenic amines. Furthermore, existing powdered Miller's yeast strains show weak capabilities in producing flavor compounds and degrading biogenic amines. More importantly, existing powdered Miller's yeast strains struggle to adapt to the complex, multi-stress environments of fermented foods such as fermented soybean paste, soybean paste, soy sauce, and fermented black beans, and find it difficult to maintain stable metabolic activity under the combined stress of high salt, high acid, and ethanol.

[0005] Therefore, developing a fermentation strain that can simultaneously meet multiple stress conditions such as high salt, acid, and ethanol tolerance, and also has the properties of esterification, amine reduction, and antioxidant enhancement is of great practical significance for improving the quality of fermented foods. Summary of the Invention

[0006] This invention aims to provide a powdered Miller's yeast with high salt tolerance, flavor-producing properties, and biogenic amine reduction. Millerozyma farinosa GZR-YJ-40 was developed to address problems in related technical fields. This strain was isolated from a high-salt, dilute-state fermented soy sauce sample. It can tolerate a salinity of 23% and grow normally, producing flavor compounds such as phenylethanol, ethyl acetate, ethyl isovalerate, butyl acetate, and ethyl isovalerate. It also exhibits biogenic amine degradation characteristics and antioxidant properties, and demonstrates good safety, making it a multifunctional strain.

[0007] This invention is achieved through the following technical solution: This invention provides a powdered Miller's yeast strain isolated from fermented food. Millerozyma farinosa GZR-YJ-40, accession number GDMCC No: 64935. The powdered Miller's yeast GZR-YJ-40 involved in this invention was collected from soy sauce and deposited on August 1, 2024, at the Guangdong Provincial Center for Microbial Culture Collection. The deposit address is: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, China.

[0008] In one embodiment, the powdered Miller's yeast strain GZR-YJ-40 was isolated from high-salt dilute fermented soy sauce, and the nucleotide sequence of its 26S rRNA is shown in SEQ ID No. 1.

[0009] This invention provides a bacterial agent containing powdered Miller's yeast GZR-YJ-40.

[0010] In one embodiment, the powdered Miller's yeast GZR-YJ-40 in the above-mentioned bacterial agent exists in the form of live bacteria.

[0011] In one embodiment, the above-mentioned microbial agent may also contain a protectant.

[0012] In one embodiment, the protective agent includes one or more of inulin, maltodextrin, resistant dextrin, glycerol, and sucrose.

[0013] In one embodiment, the protective agent is a freeze-drying protective agent or a spray-drying protective agent.

[0014] In one embodiment, the microbial agent or fermentation agent is a liquid microbial agent, fermentation agent, or a solid microbial agent, fermentation agent.

[0015] This invention provides a method for preparing the bacterial agent or the fermentation agent, the method comprising the steps of culturing powdered Miller's yeast GZR-YJ-40 to obtain bacterial solution: picking a single colony of powdered Miller's yeast GZR-YJ-40 and inoculating it into 10 mL of YPD medium, and culturing it aerobically at 28-30℃ and 200-250 rpm for 24 h to obtain bacterial solution A; then taking 500 μL of bacterial solution A and inoculating it into 50 mL of YPD medium, and culturing it aerobically at 28-30℃ and 200-250 rpm for 24 h to obtain bacterial solution B; then taking 10 mL of bacterial solution B and inoculating it into 1000 mL of YPD medium, and culturing it aerobically at 28-30℃ and 200-250 rpm for 24 h to obtain bacterial solution C; placing the bacterial solution C in an 8000 mL container... After centrifugation at rpm for 10 min, the bacterial cells were collected. The powdered *Miller's yeast* GZR-YJ-40 cells were diluted with a 0.9% sodium chloride aqueous solution to prepare 10... 9 -10 10 CFU / mL bacterial suspension.

[0016] In one embodiment, the culture is carried out at 28 °C. The culture medium used includes, but is not limited to, commonly used yeast culture media such as YPD medium and nutrient broth medium.

[0017] The above-mentioned 10 9 -10 10 CFU / mL bacterial suspensions can be prepared directly or with the addition of excipients permitted in the field of microbial preparations to produce liquid bacterial agents or fermentation agents. Alternatively, bacterial cells in the bacterial suspension can be collected and mixed with excipients permitted in the field of microbial preparations, such as freeze-drying protectants and spray-drying protectants, and then prepared as fermentation agents by vacuum freeze-drying or spray-drying.

[0018] The present invention also provides products containing the powdered Miller's yeast GZR-YJ-40 or the aforementioned inoculum, the products including food, pharmaceuticals or health products.

[0019] In one embodiment, the food includes fermented food.

[0020] In one embodiment, the fermented food is preferably a fermented condiment; most preferably fermented soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, or shrimp paste.

[0021] This invention provides the application of powdered Miller's yeast strain GZR-YJ-40 or the aforementioned yeast agent in increasing the content of aroma substances in food.

[0022] In one embodiment, the food includes fermented food.

[0023] In one embodiment, the fermented food is preferably a fermented condiment; most preferably fermented soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, or fermented black beans.

[0024] In one embodiment, the flavoring substances in the enhanced fermented food include one or more of phenylethanol, ethyl acetate, ethyl isovalerate, butyl acetate, ethyl palmitate, and ethyl linoleate.

[0025] This invention provides the application of powdered Miller's yeast strain GZR-YJ-40 or the aforementioned bacterial agent in reducing the content of biogenic amines in food.

[0026] In one embodiment, the food includes fermented food.

[0027] In one embodiment, the fermented food is preferably a fermented condiment; most preferably fermented soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, or fermented black beans.

[0028] In one embodiment, the reduced biogenic amines in the fermented food include one or more of tryptophan, β-phenylethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine.

[0029] The present invention also provides a method for preparing fermented food, wherein the method comprises adding powdered Miller's yeast strain GZR-YJ-40 or the bacterial agent or the fermentation agent during the food fermentation process.

[0030] In one embodiment, the amount of the powdered Miller's yeast strain GZR-YJ-40 added is 10. 6 -10 9 CFU / kg or 10 6 -10 9 CFU / L.

[0031] The present invention also provides the application of the powdered Miller's yeast GZR-YJ-40 or the bacterial agent described herein in the preparation of antioxidant products.

[0032] Beneficial effects: This invention provides a powdered Miller's yeast strain ( Millerozyma farinosa GZR-YJ-40, this strain was isolated from high-salt, dilute-state fermented soy sauce and has the following characteristics: (1) Powdered Miller yeast GZR-YJ-40 grew well under conditions of 23% NaCl concentration, pH 2 and 18% ethanol concentration. It is tolerant to high salt, acid and ethanol.

[0033] (2) Powdered Miller's yeast GZR-YJ-40 can tolerate the gastrointestinal environment and has excellent probiotic properties.

[0034] (3) Powdered Miller's yeast GZR-YJ-40 has good antioxidant properties, with a DPPH scavenging rate of 85.77% and an ABTS scavenging rate of 74.1%.

[0035] (4) Powdered Miller's yeast GZR-YJ-40 is sensitive to common fungal antibiotics, does not hemolyze, and has good safety.

[0036] (5) Powdered Miller's yeast GZR-YJ-40 can produce high concentrations of flavor substances during fermentation.

[0037] (6) Powdered Miller's yeast GZR-YJ-40 has the function of bio-amine degradation.

[0038] Based on the aforementioned excellent characteristics of powdered Miller's yeast GZR-YJ-40, this strain, as a starter culture, can ensure the safety and flavor quality of fermented foods, shorten the fermentation cycle, and significantly improve the nutritional value of fermented foods.

[0039] Preservation of biological materials: The strain GZR-YJ-40 provided in this invention is taxonomically named *Miller's yeast*. Millerozyma farinosa It was deposited on August 1, 2024 at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 64935. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, China, Institute of Microbiology, Guangdong Academy of Sciences. Attached Figure Description

[0040] Picture 1 A streak image of powdered Miller's yeast GZR-YJ-40; Picture 2 Photographs showing the pH tolerance of powdered Miller's yeast GZR-YJ-40; Picture 3 Photographs showing the salt tolerance of powdered Miller's yeast GZR-YJ-40; Picture 4 Photographs of ethanol tolerance in powdered Miller's yeast GZR-YJ-40. Detailed Implementation

[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field; unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available.

[0042] All culture media used in this invention were prepared using conventional methods. Unless otherwise specified, the molecular biology operations involved in the examples refer to Sambrook J et al., eds., Science Press, 2002, Molecular Cloning: A Laboratory Manual (3rd Edition); or to the product instruction manual.

[0043] The culture medium used in this invention is prepared as follows: (1) YPD liquid culture medium: 20.0g peptone, 10.0g yeast powder, 20.0g glucose, distilled water to 1L, pH adjusted to 7.0, autoclave for 20min.

[0044] (2) YPD solid culture medium: 20.0g peptone, 10.0g yeast powder, 20.0g glucose, 15g agar, distilled water to 1L, pH adjusted to 7.0, autoclaved for 20min, and then poured into plates.

[0045] The powdered *Milleria mollissima* strains CGMCC 2.2514, CGMCC 2.862, CGMCC 2.1651, and CGMCC 2.953 were all purchased from the China General Microbiological Culture Collection Center. *Aspergillus oryzae* strain 3.042 was purchased from Angel Yeast Co., Ltd.

[0046] Example 1: Isolation and Identification of Strains 1. Isolation and purification of strain GZR-YJ-40 (1) Sample: High-salt dilute fermented soy sauce samples were collected from Sichuan Province.

[0047] (2) The separation and screening method adopted is the enrichment-screening culture method, as follows: Take 1 mL of the fermented soy sauce sample at the fermentation endpoint, add it to 10 mL of YPD liquid medium, transfer it to a homogenizing bag, agitate for 30 min, centrifuge at 500 g for 5 min to remove the soy sauce residue, and aseptically transfer the turbid liquid containing bacteria to a 50 mL centrifuge tube. Add YPD medium to 10 mL and incubate at 28℃ and 200 rpm for 3 h. After appropriate dilution of the culture, spread it on YPD solid medium containing 12% NaCl. After the liquid is completely absorbed, incubate at 28℃ upside down for 24-48 h. After the strain grows, streak it onto YPD solid medium containing 12% NaCl to isolate single colonies. Purify for three generations, pick single colonies for microscopic examination, and after confirming that there is no contamination, freeze the strain and name it GZR-YJ-40.

[0048] The GZR-YJ-40 strain was first cultured in 10 mL of YPD liquid for 24 h, and then transferred at a 1% (v / v) inoculation rate to a 250 mL Erlenmeyer flask containing 50 mL of YPD medium. The culture was then continued for 2 days with shaking at 200-250 rpm and 28°C. After centrifugation at 8000 rpm for 10 min, the supernatant was collected for analysis.

[0049] 2. Identification of strain GZR-YJ-40: (1) The strain GZR-YJ-40 grew well on YPD solid plates. After being cultured at 30℃ for 24-48 h, it formed dry, round, protruding, rough, white colonies. Microscopic examination revealed that the bacterial cells were oval in shape.

[0050] (2) The genome of strain GZR-YJ-40 was extracted and identified by 26S rRNA PCR. The genome extraction method was carried out according to the glass bead method in the "Concise Guide to Molecular Biology Experiments".

[0051] The PCR conditions are as follows: The amplification system consisted of: 25 µL of 2×Taq Master Mix, 2 µL of primer D1, 2 µL of primer D2, 19 µL of sterile water, and 2 µL of template. The PCR reaction conditions were: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 15 s; 50 °C annealing for 15 s; 72 °C extension for 1 min; 72 °C for 15 min; 30 cycles; and indefinitely at 4 °C.

[0052] After PCR, agarose gel electrophoresis (1.0%) was performed to detect the PCR products of the yeast samples. Bright bands indicated successful PCR amplification of the genome, which could then be sent for sequencing. Primer sequences: D1: GCATATCAATAAGCGGAGGAAAAG, D2: GGTCCGTGTTTCAAGACGG.

[0053] The 26S rRNA sequence of strain GZR-YJ-40 is as follows (SEQ ID No. 1): .

[0054] Sequencing results showed that the bacterium possessed the nucleotide sequence of SEQ ID No. 1 in the sequence listing. Blasten analysis revealed that this bacterium was related to *Saccharomyces cerevisiae* (powdered Miller's yeast). Millerozyma farinosa The homology was highest, reaching 99.83%.

[0055] Based on morphological and 26S rRNA identification, this strain GZR-YJ-40 is... Millerozyma farinosa It was deposited on August 1, 2024, at the Guangdong Provincial Center for Microbial Culture Collection, with accession number GDMCC No: 64935. The address is: Institute of Microbiology, Guangdong Academy of Sciences, 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, China.

[0056] Example 2: Tolerance test of powdered Miller's yeast GZR-YJ-40 to salt, acid and alcohol. 1. Acid tolerance test of powdered Miller's yeast GZR-YJ-40 strain: After activating powdered Miller's yeast GZR-YJ-40 in YPD liquid medium, a viable cell count of 3 × 10⁻⁶ was prepared. 8 CFU / mL of powdered *Milleria pulverata* GZR-YJ-40 was inoculated into YPD liquid medium at pH values ​​of 2.0, 3.0, 4.0, 5.0, 6.0, and 7.0 at a ratio of 3% (v / v). The culture was incubated at 28°C, and OD values ​​were measured every 2 hours using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Picture 2 As shown, powdered Miller's yeast GZR-YJ-40 grows well at pH 2.0, and the strain still shows a significant growth trend at pH 1.0. This indicates that powdered Miller's yeast GZR-YJ-40 has good tolerance to acidic environments.

[0057] 2. Salt tolerance test of powdered Miller's yeast GZR-YJ-40: The number of live bacteria was 3×10 8 CFU / mL of powdered *Milleria pulverata* GZR-YJ-40 was inoculated at a ratio of 3% (v / v) into YPD liquid medium with sodium chloride mass fractions of 5%, 10%, 15%, 20%, 23%, and 25%, respectively, and incubated at 28°C. OD values ​​of the samples were measured every 2 hours using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Picture 3 As shown, the strain stopped growing when the sodium chloride content was 25%, but grew well when the sodium chloride content was 23%. This indicates that the powdered *Milleria pulveratum* GZR-YJ-40 has a certain tolerance to a salt concentration of 23%.

[0058] 3. Ethanol tolerance test of powdered Miller's yeast GZR-YJ-40: The number of live bacteria was 3×10 8 CFU / mL of powdered *Milleria pulverata* GZR-YJ-40 was inoculated at 3% (v / v) in YPD liquid medium with ethanol contents of 0%, 6%, 12%, and 18%, respectively, and incubated at 28°C. OD values ​​of the samples were measured every 2 hours using an automated growth curve analyzer. 600nm Value determination. Results are as follows: Picture 4 As shown, the strain still exhibited some growth when the ethanol content was 18%. This indicates that the powdered *Milleria mollissima* GZR-YJ-40 has a certain tolerance to an ethanol content of 18%.

[0059] Example 3: Safety assessment of powdered Miller's yeast GZR-YJ-40 (1) Antibiotic susceptibility test of powdered Miller's yeast GZR-YJ-40: The antibiotic susceptibility spectrum of powdered *Saccharomyces mulliganum* GZR-YJ-40 was characterized using the disk diffusion method. The activated cells were prepared into 1×10⁻⁶ cells. 8 A CFU / mL bacterial suspension was prepared, and 200 μL of the suspension was spread onto YPD plates. Six common antifungal susceptibility testing discs (fluconazole (25 μg), ketoconazole (50 μg), miconazole (10 μg), fluriconazole (10 μg), itraconazole (10 μg), and nystatin (100 μg)) were carefully placed on the discs, with a spacing of at least 24 mm between each disc. After incubation at 28℃ for 48 h, the diameter of the inhibition zone was measured and counted to analyze resistance (≤14 mm), mid-term inhibition (14-20 mm), or susceptibility (≥20 mm). Triple replicates were performed. The results showed that *Milleria pulveratum* GZR-YJ-40 was sensitive to all six fungal antibiotics and did not exhibit resistance to these antibiotics, indicating good strain safety.

[0060] (2) Hemolysis experiment of powdered Miller's yeast GZR-YJ-40 Culture medium preparation: Columbia agar + 5% defibrinated sheep blood will be prepared. Isolate the bacterial culture (approximately 1 × 10⁻⁶). 8 (CFU / mL) Powdered *Milleria pulveratum* GZR-YJ-40 was streaked onto a Columbia agar plate containing 5% defibrinated sheep blood and incubated at 28 °C for 48 h. The presence of a clear zone was then observed. *Staphylococcus aureus* ATCC 25923 was used as a positive control.

[0061] The results showed that the Staphylococcus aureus ATCC 25923 positive control strain exhibited a wide (6-8 mm), well-defined, and completely transparent hemolytic zone around its colonies, typical of β-hemolysis. In contrast, the powdered *Saccharomyces cerevisiae* GZR-YJ-40 strain provided by this invention showed no hemolysis around its colonies, indicating good strain safety.

[0062] Example 4: Evaluation of the prebiotic properties of powdered Miller's yeast strain GZR-YJ-40 (1) Simulated gastric acid tolerance test of powdered Miller's yeast GZR-YJ-40: The number of live bacteria was 3×10 8 A CFU / mL suspension of powdered *Milleria pulveratum* GZR-YJ-40 was collected by centrifugation and resuspended in simulated gastric fluid at pH 3.0. The suspension was incubated at 37°C, and samples were collected at 0 h and 2 h for plate counting to calculate the viability of the strains. The results showed that after 2 h of incubation in simulated gastric fluid at pH 3.0, the viable count of powdered *Milleria pulveratum* GZR-YJ-40 increased from 10... 8 CFU / mL decreased to 10 7 The CFU / mL concentration and survival rate reached 90%, indicating that powdered Miller's yeast GZR-YJ-40 exhibits good tolerance to simulated gastric acid environment.

[0063] (2) Bile salt tolerance test of powdered Miller's yeast GZR-YJ-40: In a simulated gastric acid tolerance experiment (pH 3.0), powdered Miller's yeast GZR-YJ-40 reached the intestines via the stomach after 2 hours, with the viable count decreasing to 3 × 10⁻⁶. 7 CFU / mL. Therefore, the starting viable count for the bile salt tolerance test was adjusted to 3 × 10⁻⁶ CFU / mL. 7 CFU / mL. The activated powdered *Miller's yeast* GZR-YJ-40 was centrifuged to collect the cells, washed twice with YPD medium, and resuspended in YPD medium containing 0.3% (w / v) sodium taurocholate, adjusting the viable cell concentration to 3 × 10⁻⁶ CFU / mL. 7 CFU / mL, incubated at 37℃, samples were taken at 0 h and 3 h for colony counting to calculate the survival rate of the strain. The results showed that the viable number of powdered *Miller's yeast* GZR-YJ-40 decreased under 0.3% (w / v) bile salt conditions, but the viable number was still 10 after 3 h. 6 The CFU / mL level is above the critical value for live bacteria to exert their functional characteristics, indicating that powdered *Miller's yeast* GZR-YJ-40 has good tolerance to the small intestinal environment.

[0064] (3) Antioxidant experiment of powdered Miller's yeast GZR-YJ-40 ①DPPH free radical scavenging test: 0.2 mmol / L DPPH: 0.0078 g DPPH, dissolved in anhydrous ethanol, diluted to 100 mL, stored in the dark, and used immediately. Add 10... 8 CFU / mL of powdered *Milleria pulverata* GZR-YJ-40 culture was mixed with 0.2 mM DPPH solution at a volume ratio of 1:1 and incubated in the dark at 25°C for 30 min. (Note: The last sentence appears to be incomplete and possibly refers to a different product, "10," which is not directly related to the preceding sentence.) 8 CFU / mL of powdered *Milleria pulverata* GZR-YJ-40 culture and ethanol were used as blanks, while PBS and 0.2 mmol / L DPPH were used as controls. The supernatant was collected after centrifugation at 2330×g (4120 rpm) for 10 minutes. The absorbance was measured in triplicate at 517 nm.

[0065] Calculation of DPPH free radical scavenging rate: ; Ai is the absorbance of 1 mL of the bacterial culture to be tested plus 1 mL of DPPH ethanol solution; Aj is the absorbance of 1 mL of the bacterial solution to be tested plus 1 mL of anhydrous ethanol; Ac is the absorbance of 1 mL PBS plus 1 mL DPPH ethanol solution.

[0066] ②ABTS free radical scavenging rate test: ABTS (14 mM) and potassium persulfate (5 mM) were dissolved in 0.1 M potassium phosphate buffer (pH 7.4) at a 1:1 ratio and reacted at 25°C for 12–16 h to obtain the ABTS working solution. 100 μL of powdered Miller's yeast GZR-YJ-40 (10 8 Add CFU / mL to 900 μL of ABTS working solution and incubate in the dark at 25°C for 15 min. After centrifugation (14000 g, 1 min), measure the absorbance of the supernatant at 734 nm.

[0067] Calculation of ABTS radical scavenging rate: ; As is the absorbance of 100 μL of the bacterial culture to be tested plus 900 μL of ABTS working solution; Ac is 1 mL of ABTS working solution; The results showed that the DPPH scavenging activity of powdered Miller's yeast GZR-YJ-40 was 85.77% and the ABTS scavenging activity was 74.10%, indicating that strain GZR-YJ-40 has certain antioxidant activity.

[0068] Comparative Example 1: For specific implementation methods, refer to Example 4. The antioxidant activity of the comparative strain was tested. The powdered Miller's yeast GZR-YJ-40 used in Example 4 was replaced with the comparative strain powdered Miller's yeast CGMCC 2.2514 for testing.

[0069] The results showed that the comparative strain, *Milletia gigantea* powder CGMCC 2.2514, had a DPPH radical scavenging activity of 45.23% and an ABTS radical scavenging activity of 38.57%. Its antioxidant activity was low, and its antioxidant capacity was lower than that of the strain in this patent.

[0070] Comparative Example 2: For specific implementation methods, refer to Example 4. The antioxidant activity of the comparative strain was tested. The powdered Miller's yeast GZR-YJ-40 used in Example 4 was replaced with the comparative strain powdered Miller's yeast CGMCC 2.862 for testing.

[0071] The results showed that the comparative strain, *Milletia gigantea* powder CGMCC 2.862, had a DPPH radical scavenging activity of 42.67% and an ABTS radical scavenging activity of 40.09%. Its antioxidant activity was low, and its antioxidant capacity was lower than that of the strain in this patent.

[0072] Comparative Example 3: For specific implementation methods, refer to Example 4. The antioxidant activity of the comparative strain was tested. The powdered Miller's yeast GZR-YJ-40 used in Example 4 was replaced with the comparative strain powdered Miller's yeast CGMCC 2.1651 for testing.

[0073] The results showed that the comparative strain, *Milletia gigantea* powder CGMCC 2.1651, had a DPPH radical scavenging activity of 45.96% and an ABTS radical scavenging activity of 41.42%. Its antioxidant activity was low, and its antioxidant capacity was lower than that of the strain in this patent.

[0074] Comparative Example 4: For specific implementation methods, refer to Example 4. The antioxidant activity of the comparative strain was tested. The powdered Miller's yeast GZR-YJ-40 used in Example 4 was replaced with the comparative strain powdered Miller's yeast CGMCC 2.953 for testing.

[0075] The results showed that the comparative strain, *Milletia gigantea* powder CGMCC 2.953, had a DPPH radical scavenging activity of 47.93% and an ABTS radical scavenging activity of 42.58%. Its antioxidant activity was low, and its antioxidant capacity was lower than that of the strain in this patent.

[0076] Example 5: Preparation of powdered Miller's yeast GZR-YJ-40 bacterial culture 1) Dispensing of YPD medium: Sterile YPD medium is aseptically dispensed into 50 mL centrifuge tubes (10 mL), 250 mL Erlenmeyer flasks (50 mL), and 3 L baffled Erlenmeyer flasks (750 mL).

[0077] 2) Remove the glycerol tube containing powdered *Miller's yeast* GZR-YJ-40 from the -80℃ freezer. Transfer one loopful of the bacterial ice residue to a centrifuge tube containing 10 mL of LB medium and incubate at 200-250 rpm and 28℃ with shaking for 24 h. Then, transfer the inoculum at 1% (v / v) to a 250 mL Erlenmeyer flask containing 50 mL of LB medium and continue incubating at 200-250 rpm and 28℃ with shaking for 24 h. Finally, transfer the inoculum at 1% (v / v) to a 3 L Erlenmeyer flask containing 750 mL of LB medium and incubate at 200-250 rpm and 28℃ with shaking for 24 h. Centrifuge the resulting bacterial culture at 8000 rpm for 10 min and collect the bacterial cells. Dilute the powdered *Miller's yeast* GZR-YJ-40 cells with a 0.9% sodium chloride aqueous solution to prepare 10... 9 -10 10 Prepare a bacterial suspension of CFU / mL for later use.

[0078] Example 6: Preparation of powdered Miller's yeast GZR-YJ-40 starter culture Powdered Miller's yeast GZR-YJ-40 was inoculated into YPD medium, cultured at 28°C for 48 h, and then centrifuged to prepare 10 cells. 8 A bacterial suspension of CFU / mL (dissolved in 1×PBS solution) was mixed with an equal mass of lyophilization protectant (3g inulin, 2g maltodextrin, and 2g resistant dextrin added per 100 mL of 10% skim milk). The mixture was pre-frozen at -20℃ and then vacuum-dried in a freeze dryer (cold trap temperature -45℃, vacuum degree 10-20 Pa) for 22-24 hours. Drying was stopped when the moisture content of the bacterial powder decreased to 2.5%-3%, yielding a dry powder bacterial agent. The viable cell content of the powdered *Saccharomyces cerevisiae* GZR-YJ-40 was 10... 12 CFU / g.

[0079] Another method involves inoculating powdered Miller's yeast GZR-YJ-40 into YPD medium, culturing at 28°C for 48 hours, and then centrifuging to prepare the bacterial cells into 10⁻⁶ cells. 8 A bacterial suspension of CFU / mL was mixed with an equal mass of spray drying protectant (containing 2g glycerol and 3g sucrose per 100 mL of 10% skim milk) and spray-dried at 35°C to obtain a dry powder form of bacterial agent. The viable cell content of the powdered *Milleria pulveratum* GZR-YJ-40 in the bacterial agent was 10... 11 CFU / g.

[0080] Example 7: Application of powdered Miller's yeast strain GZR-YJ-40 in soy sauce fermentation According to the SB / T 10312-1999 High-Salt Dilute-State Fermentation Soy Sauce Brewing Process Specification, soy sauce fermentation was carried out. The raw materials, soybean meal and wheat bran, were mixed in a ratio of 7:3. The mixture underwent wetting, steaming, cooling, and inoculation treatments, followed by inoculation for 10 days. 8 CFU / mL of Aspergillus oryzae was added to the Shanghai-brewed koji mold, and then 10 was added during 24 hours of koji preparation. 9 Powdered Miller's yeast strain GZR-YJ-40 was inoculated at a ratio of CFU / mL (g), and the mixture was kept at a constant temperature of 30℃ for 42 h. The mixture was then loosened, weighed, and salt and water were added (final salinity 14%). Fermentation was carried out at a constant temperature of 30℃ for 6 months. The finished soy sauce was obtained through pressing, sterilization, filtration, and packaging. The flavor substance content, biogenic amine content, and Escherichia coli content of the finished product were determined.

[0081] Example 8: Application of powdered Miller's yeast strain GZR-YJ-40 in the fermentation of Pixian broad bean paste According to GB / T 20560-2006, the standard for geographical indication product Pixian Doubanjiang (Pixian broad bean paste), Pixian Doubanjiang fermentation is carried out. During the sweet bean stage, when the Doubanjiang starter is placed in the fermentation container, the salt content is controlled at 3-5% and the water content at 15-25%, according to a 10... 7Inoculate with powdered Miller's yeast GZR-YJ-40 at a CFU / mL ratio and ferment for 30 days; after mixing the pepper embryos and sweet pepper petals, control the salinity at 12% and ferment at a ratio of 10... 7 The powdered *Saccharomyces cerevisiae* GZR-YJ-40 was inoculated again at a CFU / mL ratio, and subsequent fermentation was continued. Fermentation was terminated when the amino acid nitrogen (as nitrogen) / (g / 100 g) ratio in both the experimental and control groups was greater than 0.18. Flavor compound content, biogenic amine content, and *E. coli* levels were then determined.

[0082] Example 9: Application of powdered Miller's yeast strain GZR-YJ-40 in soybean paste fermentation Fermentation of soybean paste is carried out according to GB / T 24399-2009. Process flow: Soaking soybeans → Steaming → Cooling → Draining → Crushing → Inoculation (10) 8 CFU / mL Aspergillus oryzae (Shanghai-style brewing) 3.042 → Making sauce blocks → Making koji → Making koji → Washing sauce blocks → Cutting into small pieces → Adding salt to a final concentration of 10% → Stirring and skimming off foam → Press 10 8 CFU / mL viable count was inoculated into powdered Miller's yeast GZR-YJ-40 starter culture. Fermentation → Packaging → Sterilization → Finished product. After fermentation, the finished product was tested for flavor compound content, biogenic amine content, and E. coli.

[0083] Example 10: Application of powdered Miller's yeast strain GZR-YJ-40 in fermented bean curd Referring to the SB / T 10170-2007 standard for fermented bean curd, the fermentation process is as follows: Soaking soybeans → Grinding → Soy milk → Boiling → Filtering → Adding coagulant → Pressing → Tofu → Cutting into blocks → Raw bean curd → Steaming → Pickling → Pickled bean curd → Inoculation → Initial fermentation → Raw bean curd → Pressing at 10 6 Inoculate powdered Miller's yeast strain GZR-YJ-40 at a ratio of CFU / mL (g) → pack into fermentation tanks → secondary fermentation → fermented bean curd → seasoning broth → finished product. After fermentation, the finished product is tested for flavor compounds and biogenic amines, as well as for E. coli.

[0084] Example 11: Application of powdered Miller's yeast strain GZR-YJ-40 in fish sauce fermentation Referring to GB / T 45810-2025, the technical specification for fish sauce processing, the process flow for fish sauce fermentation is as follows: receiving raw fish → pretreatment, adding 10%–20% edible salt by weight of the fish to maintain raw material quality → salting (increasing the edible salt content to 35%) → (according to 10...) 9 Inoculate powdered Miller's yeast GZR-YJ-40 starter culture with a live bacteria count of CFU / mL (g) → Ferment naturally for 6 months → Take the clear juice as "first oil" and add low-amino acid nitrogen fish sauce or saturated brine to the residue at a ratio of 10:10. 9Inoculate the live bacteria count (CFU / mL (g)) into powdered Miller's yeast GZR-YJ-40 inoculum and ferment again for 8 months. Collect the clear liquid as "second oil," and add low-amino acid nitrogen fish sauce or saturated brine to the second residue at a ratio of 10... 9 Powdered Miller's yeast strain GZR-YJ-40 was inoculated at a ratio of CFU / mL (g) and fermented again for 6 months. The clear juice was collected as "three oils". The first, second, and third oils were mixed and sterilized by membrane filtration. The product was then clarified and stored. After fermentation, the flavor compound content, biogenic amine content, and E. coli content of the finished product were determined.

[0085] Example 12: Application of powdered Miller's yeast strain GZR-YJ-40 in shrimp paste fermentation Referring to DB44 / T 947—2011 Shrimp Paste Processing Technical Specification, the shrimp paste fermentation process is as follows: Raw material shrimp receiving → Pre-treatment, frozen raw materials are first thawed at room temperature below 15℃ → Salting (the amount of edible salt added is 30% of the weight of the raw materials) → (according to 10...) 6 Inoculate powdered Miller's yeast GZR-YJ-40 at a ratio of CFU / mL (g) → Natural fermentation for 30 days → Color turns slightly red → Fermentation ends → Cooking → Homogenization → Filling → Pasteurization. The finished product is then tested for flavor compounds, biogenic amines, and E. coli.

[0086] Example 13: Application of powdered Miller's yeast strain GZR-YJ-40 in fermented soybeans Referring to DB 43 / T 3009—2024 Technical Specification for Fermented Black Beans, the fermentation process for fermented black beans is as follows: Soybean selection and cleaning → soaking and rehydration → steaming at 121℃ for 20 min → draining → cooling to 30℃ → inoculation with Aspergillus oryzae (Hu Niang 3.42) → koji making → incubation at 28℃ for 5 days → breaking up the soybean curds and mixing in 12% salt (by dry weight of soybeans) and 2% white wine (by dry weight of soybeans), at a ratio of 10... 7 Inoculate powdered Miller's yeast GZR-YJ-40 at a ratio of CFU / mL (g), stir well, seal and ferment at room temperature for 30 days until mature. The finished product is then tested for flavor compounds, biogenic amines, and Escherichia coli.

[0087] Comparative Example 5 For the specific implementation method, refer to Example 7 to carry out soy sauce fermentation. The powdered Miller's yeast GZR-YJ-40 used in Example 7 was replaced with the control strain powdered Miller's yeast CGMCC 2.2514 for fermentation.

[0088] Comparative Example 6 For a specific implementation method, refer to Example 7 to carry out soy sauce fermentation. The powdered Miller's yeast GZR-YJ-40 used in Example 7 was replaced with the control strain powdered Miller's yeast CGMCC 2.862 for fermentation.

[0089] Comparative Example 7 For the specific implementation method, refer to Example 8. Ferment the fermented soybeans, but replace the powdered Miller's yeast GZR-YJ-40 used in Example 8 with the control strain powdered Miller's yeast CGMCC 2.1651 for fermentation.

[0090] Comparative Example 8 For the specific implementation method, refer to Example 8 to carry out fermentation of fermented soybeans. The powdered Miller's yeast GZR-YJ-40 used in Example 8 was replaced with the control strain powdered Miller's yeast CGMCC 2.953 for fermentation.

[0091] Comparative Example 9 For the specific implementation method, refer to Example 9. The fermentation of soybean paste was carried out by replacing the powdered Miller's yeast GZR-YJ-40 used in Example 9 with the control strain powdered Miller's yeast CGMCC 2.2514.

[0092] Comparative Example 10 For the specific implementation method, refer to Example 9. The fermentation of soybean paste was carried out by replacing the powdered Miller's yeast GZR-YJ-40 used in Example 9 with the control strain powdered Miller's yeast CGMCC 2.862.

[0093] Comparative Example 11 For the specific implementation method, refer to Example 10 to carry out fermented bean curd fermentation. The powdered Miller's yeast GZR-YJ-40 used in Example 10 was replaced with the control strain powdered Miller's yeast CGMCC 2.1651 for fermentation.

[0094] Comparative Example 12 For the specific implementation method, refer to Example 10. Fermented bean curd was carried out, but the powdered Miller's yeast GZR-YJ-40 used in Example 10 was replaced with the control strain powdered Miller's yeast CGMCC 2.953 for fermentation.

[0095] Comparative Example 13 For the specific implementation method, refer to Example 11. Fish sauce fermentation was carried out, but the powdered Miller's yeast GZR-YJ-40 used in Example 11 was replaced with the control strain powdered Miller's yeast CGMCC 2.2514 for fermentation.

[0096] Comparative Example 14 For the specific implementation method, refer to Example 11. Fish sauce fermentation was carried out, but the powdered Miller's yeast GZR-YJ-40 used in Example 11 was replaced with the control strain powdered Miller's yeast CGMCC 2.862 for fermentation.

[0097] Comparative Example 15 For the specific implementation method, refer to Example 12. Shrimp paste fermentation was carried out, but the powdered Miller's yeast GZR-YJ-40 used in Example 12 was replaced with the control strain powdered Miller's yeast CGMCC 2.1651 for fermentation.

[0098] Comparative Example 16 For the specific implementation method, refer to Example 12. Shrimp paste fermentation was carried out, but the powdered Miller's yeast GZR-YJ-40 used in Example 12 was replaced with the control strain powdered Miller's yeast CGMCC 2.953 for fermentation.

[0099] Comparative Example 17 For the specific implementation method, refer to Example 13 to carry out fermented soybean fermentation. The powdered Miller's yeast GZR-YJ-40 used in Example 13 was replaced with the control strain powdered Miller's yeast CGMCC 2.2514 for fermentation.

[0100] Comparative Example 18 For the specific implementation method, refer to Example 13 to carry out fermented soybean fermentation. The powdered Miller's yeast GZR-YJ-40 used in Example 13 was replaced with the control strain powdered Miller's yeast CGMCC 2.862 for fermentation.

[0101] Example 14: Determination of Flavor Compound Content The flavor compound content was determined using gas chromatography-mass spectrometry (GC-MS) (chromatographic conditions: Agilent 5977B MSD, capillary column HP-5MS (30 m × 0.25 mm × 0.25 µm). The oven temperature gradient was: 35°C for 5 min, then 3°C / min to 50°C for 3 min; 4°C / min to 150°C; 20°C / min to 250°C, then held for 5 min). Results showed that the flavor compound content of fermented food samples inoculated with powdered *Milleria mirifica* GZR-YJ-40 was significantly higher than that of samples inoculated with the control strain, indicating that powdered *Milleria mirifica* GZR-YJ-40 can increase the flavor compound content of soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, and fermented black beans during fermentation (Table 1).

[0102] Table 1. Analysis of flavor compounds in fermented foods (unit: μg / mL or μg / g)

[0103] Note: - indicates below the detection limit; # indicates that phenylethanol is in mg / L.

[0104] Example 15: Determination of biogenic amine content The biogenic amine test was performed according to GB 5009.208-2016, National Food Safety Standard, Determination of Biogenic Amines in Food. The results showed that the biogenic amine content of fermented food samples inoculated with powdered Miller's yeast GZR-YJ-40 was significantly lower than that of the control strain samples, with reductions ranging from 60% to 885%. Regardless of whether powdered Miller's yeast GZR-YJ-40 was added, the biogenic amine content in all groups was below the limit under the experimental conditions. This indicates that powdered Miller's yeast GZR-YJ-40 can significantly reduce the biogenic amine content in fermented foods such as soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, and fermented black beans during fermentation.

[0105] The results showed that neither the fermentation samples inoculated with powdered Miller's yeast GZR-YJ-40 nor the control samples without powdered Miller's yeast GZR-YJ-40 showed E. coli contamination. Furthermore, the aroma compound content of the fermentation samples inoculated with powdered Miller's yeast GZR-YJ-40 was significantly higher than that of the control samples inoculated with powdered Miller's yeast GZR-YJ-40.

[0106] Table 2 Analysis of biogenic amines in fermented foods (unit: mg / 100g)

[0107] Note: - indicates below the detection limit.

[0108] Example 16: Testing of the product's antioxidant properties (1) DPPH free radical scavenging rate test: Weigh 5.0 g of uniformly ground soybean paste sample, add water and stir until fully dissolved, then bring the volume to 100 mL, centrifuge at 5000×g for 5 min, filter, take 2 mL of filtrate into a 10 mL centrifuge tube, add 2 mL of 100% ethanol DPPH solution (0.2 mM) and mix, incubate in the dark at 25℃ for 30 min. Fermentation broth and ethanol were used alone as blanks, while PBS and DPPH ethanol solution were used as controls. After centrifugation at 2330×g for 10 min, the supernatant was collected. The absorbance was measured at 517 nm in triplicate.

[0109] Calculation of DPPH free radical scavenging rate: ; Ai is the absorbance of 1 mL of the filtrate plus 1 mL of DPPH ethanol solution; Aj is the absorbance of 1 mL of the filtrate plus 1 mL of anhydrous ethanol; Ac is the absorbance of 1 mL PBS plus 1 mL DPPH ethanol solution.

[0110] (2) ABTS free radical scavenging rate test: ABTS (14 mM) and potassium persulfate (5 mM) were dissolved in 0.1 M potassium dihydrogen phosphate buffer (pH 7.4) at a ratio of 1:1 and reacted at 25℃ for 12-16 hours. 900 µL of ABTS solution was added to 100 µL of fermented soybean paste filtrate and incubated in the dark at 25℃ for 15 min. After centrifugation (14,000×g, 1 min, 4℃), the absorbance of the supernatant was measured at 734 nm and calculated as follows, with three parallel measurements performed.

[0111] Calculation of ABTS radical scavenging rate: ; As is the absorbance of 100 µL of fermented soybean paste filtrate plus 900 μL of ABTS working solution; Ac is 1 mL of ABTS working solution; Table 3. Detection of antioxidant activity in fermented foods (unit: %)

[0112] All fermented seasonings, regardless of whether they were inoculated with powdered Miller's yeast GZR-YJ-40, had an amino acid nitrogen content greater than 4.0 g / L, which meets the product requirements.

[0113] In summary, powdered Miller's yeast GZR-YJ-40 produces more aroma compounds during fermentation and has not been found to contain pathogenic Escherichia coli, Staphylococcus aureus, or other pathogens. It also exhibits excellent salt, acid, and ethanol tolerance, effectively preserving the flavor and quality of fermented products. Furthermore, powdered Miller's yeast GZR-YJ-40 is tolerant of the gastrointestinal environment and possesses excellent probiotic properties. As a starter culture, this strain can ensure the safety and flavor quality of fermented foods, shorten the fermentation cycle, and significantly improve the nutritional value of fermented soy products.

[0114] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A powdered Miller's yeast ( Millerozyma farinosa GZR-YJ-40, characterized in that, It was deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 1, 2024, with accession number GDMCC No: 64935.

2. A microbial agent, characterized in that, Contains the powdered Miller's yeast GZR-YJ-40 as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The microbial agent also contains a protectant; the protectant includes one or more of inulin, maltodextrin, resistant dextrin, glycerol, and sucrose.

4. A product containing the powdered Miller's yeast GZR-YJ-40 of claim 1 or the inoculum of claim 2 or 3, characterized in that, The products include food, medicine, or health products; the food includes fermented food.

5. The application of the powdered Miller's yeast GZR-YJ-40 according to claim 1 or the inoculum agent according to claim 2 or 3 in improving the quality of fermented foods, characterized in that, Improving the quality of fermented foods refers to increasing the content of flavor compounds and / or reducing the content of biogenic amines.

6. The application according to claim 5, characterized in that, The fermented foods include soybean paste, broad bean paste, fermented bean curd, soy sauce, fish sauce, shrimp paste, and fermented black beans.

7. The application according to claim 5, characterized in that, The flavoring substances include one or more of phenylethanol, ethyl acetate, ethyl isovalerate, butyl acetate, ethyl palmitate, and ethyl linoleate.

8. The application according to claim 5, characterized in that, The biogenic amines include one or more of tryptamine, β-phenylethylamine, putrescine, cadaverine, histamine, tyramine, spermidine, and spermine.

9. The application according to any one of claims 5 to 8, characterized in that, During food fermentation, add the powdered Miller's yeast GZR-YJ-40 as described in claim 1 or the inoculum agent as described in claim 2 or 3; the amount of powdered Miller's yeast GZR-YJ-40 added to the food raw materials is 10. 6 -10 9 CFU / kg or 10 6 -10 9 CFU / L.

10. The use of the powdered Miller's yeast GZR-YJ-40 of claim 1 or the inoculum of claim 2 or 3 in the preparation of antioxidant products.

Images