A complex microbial inoculum using wetland endogenous carbon and application thereof in treatment of sewage by artificial wetland

By leveraging the synergistic effect of compound microbial agents, the release and targeted utilization of carbon sources from plants are promoted, solving the problem of low nitrogen removal efficiency in constructed wetlands with low carbon-to-nitrogen ratios, and achieving efficient nitrogen removal and improved ecological safety.

CN122278700APending Publication Date: 2026-06-26INST OF AQUATIC LIFE ACAD SINICA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
INST OF AQUATIC LIFE ACAD SINICA
Filing Date
2026-03-31
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Constructed wetlands have low nitrogen removal efficiency under low C/N ratio wastewater conditions. External carbon sources are difficult to match precisely, endogenous carbon is not effectively utilized, and the number of denitrifying bacteria is insufficient, resulting in insufficient electron donors and low nitrogen removal efficiency.

Method used

A compound microbial agent containing Pseudomonas stutzeri JH-1 and Klebsiella pasteurii F19 was used to promote the release and targeted utilization of plant carbon sources through synergistic effects, thereby improving denitrification efficiency.

Benefits of technology

It significantly improves the denitrification efficiency of low carbon-to-nitrogen ratio wastewater, increases the electron utilization efficiency of unit carbon source, enhances system stability and plant growth, reduces greenhouse gas emissions, and achieves ecological safety and diversified pollutant removal.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

This invention belongs to the fields of environmental microbiology and wastewater treatment technology, specifically relating to a composite microbial agent utilizing endogenous carbon in wetlands and its application in constructed wetlands for wastewater treatment. The composite microbial agent consists of *Pseudomonas schlegelii* JH-1 and *Klebsiella pasteurellium* F19. *Pseudomonas schlegelii* JH-1 is an aerobic denitrifying bacterium responsible for nitrate reduction; *Klebsiella pasteurellium* F19 is a rhizosphere growth-promoting bacterium that promotes plant growth and accelerates endogenous carbon release. The two strains do not have antagonistic effects and form a synergistic relationship in constructed wetlands, significantly improving the nitrogen removal efficiency of low C / N wastewater while simultaneously promoting plant growth and reducing greenhouse gas emissions, resulting in good ecological benefits.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of environmental microbiology and wastewater treatment technology, specifically relating to a composite microbial agent utilizing endogenous carbon in wetlands and its application in wastewater treatment in constructed wetlands. Background Technology

[0002] Constructed wetlands are a highly efficient wastewater treatment technology based on natural processes and have been widely used in my country. However, in actual operation, low nitrogen removal efficiency remains a significant problem limiting its treatment effect, especially under low C / N ratio wastewater conditions. Studies have shown that insufficient electron donors due to carbon source deficiency are a major reason for the low efficiency of denitrification. In the classic heterotrophic denitrification pathway, nitrate nitrogen (NO3) is the primary nitrogen donor. - Starting with nitrate reductase (Nar / Nap), NO3- is converted into nitrogen by nitrate reductase (N-N). - -N is converted into nitrite nitrogen (NO2) - Nitrate (N-N) is then converted to nitric oxide (NO) by nitrite reductase (NirS / NirK), and finally reduced to nitrous oxide (N2O) by nitric oxide reductase (Nor), and then further reduced to nitrogen gas (N2) by nitrous oxide reductase (NosZ). This process is also an extension of an electron transport chain: the carbon source produces reducing coenzymes (such as NADH) through metabolic pathways such as glycolysis and the tricarboxylic acid cycle, and then electrons are transferred through the respiratory chain to nitrogen-containing oxides such as nitrates, thereby driving their reduction. Therefore, denitrification efficiency is affected by factors such as the rate of electron donor generation, electron transport capacity, and the distribution ratio of electrons among different metabolic pathways, and the lack of electron donors will directly lead to incomplete denitrification.

[0003] In traditional research, the addition of soluble carbon sources is typically used to supplement electron donors and improve nitrate reduction efficiency. However, this approach presents numerous technical challenges in actual operation. Firstly, it is difficult to precisely match the carbon source dosage to the nitrate load. Since the amount of electrons required for denitrification is influenced by various factors such as nitrogen source form, microbial growth status, and dissolved oxygen levels, the calculated carbon source dosage often deviates from actual needs, leading to insufficient or excessive electron supply. This results in reduced nitrogen removal efficiency, increased effluent COD, and increased greenhouse gas emissions, failing to meet the requirements for green and low-carbon operation of constructed wetlands. Furthermore, a large number of overlooked carbon sources exist within constructed wetland systems. Studies show that approximately 10%–40% of the carbon fixed by wetland plants during photosynthesis is released into the rhizosphere through root exudates. These root exudates mainly include low-molecular-weight organic acids, sugars, small-molecule proteins, and amino acids. These are simple, biodegradable organic substrates that can be rapidly absorbed by microorganisms, providing an electron source for their metabolic activities.

[0004] Furthermore, in low C / N ratio wastewater, besides the apparent "carbon source insufficiency" on the system surface, the inefficient and indirect guidance of endogenous carbon to the denitrification pathway is also a significant contributing factor. Increasing the carbon source does not directly promote denitrification; it requires a large number of denitrifying bacteria as the primary metabolic agents. If the number of denitrifying bacteria in the system is insufficient, their activity is low, or their expression is inhibited, even with sufficient exogenous carbon, electrons cannot be effectively transferred to the nitrate reduction pathway, leading to more electrons being consumed in biomass synthesis or aerobic respiration.

[0005] Given the challenges of controlling dosage and high cost associated with external carbon sources, and the fact that the inherent plant root exudates in constructed wetland systems, as endogenous carbon sources, have not been effectively utilized, while the activity and abundance of denitrifying microbial communities also urgently need to be improved, there is a pressing need to develop a technical solution suitable for constructed wetland systems. This solution should be able to synergistically regulate plant-microbe interactions without the addition of external carbon sources, achieving the effective release of endogenous carbon and its directional utilization towards the denitrification pathway, thereby improving the denitrification efficiency and system stability of low C / N ratio wastewater. Summary of the Invention

[0006] To address the aforementioned problems in existing technologies, this invention discloses a composite microbial agent that simultaneously promotes plant carbon source release and denitrification, along with its preparation method and application. Experimental results show that the composite agent can significantly promote plant growth and effectively improve the denitrification efficiency of wastewater with a low carbon-to-nitrogen ratio. The specific technical solution is as follows: A type of Klebsiella pasteurii F19, characterized in that the Klebsiella pasteurii F19 was deposited at the China Center for Type Culture Collection on January 22, 2026, with accession number CCTCC NO: M 2026196.

[0007] A compound microbial agent, wherein the active ingredients of the compound microbial agent include Pseudomonas stutzeri JH-1 and Klebsiella pasteurii F19; The *Pseudomonas stutzeri* JH-1 strain was deposited on October 23, 2013, at the China Center for Type Culture Collection (CCTCC), located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan, Hubei Province, with accession number CCTCCNO: M 2013488.

[0008] Furthermore, the effective viable count ratio of Klebsiella pasteurellum F19 to Pseudomonas schlegelii JH-1 in the bacterial agent is 0.5 to 2:1 (preferably 1:1). This ratio is achieved by adjusting the bacterial suspensions of the two strains to the same OD. 600 The mixture is then mixed according to the volume ratio, which is the effective live bacteria count ratio.

[0009] This invention also provides a method for preparing the above-mentioned composite microbial agent, comprising the following steps: (1) Klebsiella pasteurellum F19 and Pseudomonas schrenckii JH1 were inoculated into solid culture medium for activation culture to obtain activated single colonies of Klebsiella pasteurellum F19 and Pseudomonas schrenckii JH-1. (2) The activated Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1 strains were inoculated into liquid culture medium for propagation culture to obtain single strain propagation culture of Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1. (3) Centrifuge the single strains of Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1, remove the supernatant and collect the bacterial cells, wash with sterile water and resuspend 2-4 times (preferably 3 times) to obtain single strains of Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1. (4) Adjust the concentration of single-strain bacterial suspensions of Klebsiella pasteurellis F19 and Pseudomonas schwanniferus JH-1 to OD values ​​respectively. 600 The value is 0.5 to 1.0 (preferably 1.0); (5) Mix the adjusted concentration of Klebsiella pasteurellium F19 bacterial suspension with a single strain of Pseudomonas schrenckii JH1 bacterial suspension in a certain proportion to obtain the composite microbial agent.

[0010] Furthermore, the solid culture medium in step (1) is LB solid culture medium, and the culture conditions are static culture at 26-30℃ for 10-12h (preferably static culture at 28℃ for 12h); the liquid culture medium in step (2) is LB liquid culture medium, and the culture conditions are shaking culture at 26-30℃ and 180-220rpm for 6-8h (preferably shaking culture at 28℃ and 200rpm for 8h).

[0011] This invention also provides the application of the above-mentioned composite microbial agent in the treatment of low C / N wastewater.

[0012] Furthermore, the C / N ratio of the low C / N wastewater is not higher than 5 (preferably 2~5), and the C / N ratio is the ratio of chemical oxygen demand to total nitrogen (COD / TN).

[0013] Furthermore, the application is in the treatment of low C / N wastewater using constructed wetlands.

[0014] Furthermore, the application involves inoculating the compound microbial agent into the roots and / or substrate of artificial wetland plants.

[0015] Furthermore, the artificial wetland plants include canna lilies.

[0016] The mechanism of action of the compound microbial agent of this invention is as follows: Core degrading bacteria (promoting denitrification): *Pseudomonas schlegelii* JH-1 is an aerobic denitrifying bacterium. Even in the presence of dissolved oxygen, this strain can express key denitrifying enzymes such as nitrate reductase and nitrite reductase, sequentially reducing nitrate nitrogen to nitrogen gas, thus achieving the conversion of nitrogen from a high oxidation state to a low oxidation state. Its metabolic characteristic lies in its ability to achieve electron diversion in an aerobic environment, allowing some electrons to bypass the traditional aerobic respiration pathway and enter the nitrate reduction pathway, thereby overcoming the limitation of conventional denitrification being inhibited by dissolved oxygen. In this process, nitrate nitrogen, as the terminal electron acceptor, participates in the intracellular electron transport chain reaction and is the direct execution unit for nitrogen removal in the system.

[0017] Basic functional bacteria (carbon source activation and degradation auxiliary module): Klebsiella pasteurellium F19 is a rhizosphere growth-promoting bacterium that mainly plays a role in carbon source activation and degradation in the system. This strain can promote plant growth and utilize the organic acids, sugars, and small organic molecules secreted by the roots of constructed wetland plants to promote the conversion of complex organic matter into available small molecule substrates by secreting extracellular enzymes or enhancing metabolic activity, thereby accelerating the release and cycling of endogenous organic carbon. At the same time, this strain can indirectly increase the rate of generation of available electron donors in the system by improving the rhizosphere microenvironment, enhancing plant root activity, and promoting organic carbon secretion.

[0018] The optimal ratio of compound microbial agents was determined by setting different addition ratios in enrichment culture experiments to maximize the synergistic interaction and functional stability of the microbial community.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects: (1) The denitrification efficiency under low carbon-nitrogen ratio conditions is significantly improved: Through comparative experiments, it has been verified that the nitrate removal efficiency of the compound microbial agent of the present invention under the same operating conditions is significantly higher than that of the single aerobic denitrifying bacteria treatment system, with a removal rate increase of 20% to 40%.

[0021] (2) The electron utilization efficiency of a unit carbon source is improved: Compared with the technology of simply adding carbon source to enhance denitrification, the present invention reduces the ineffective diversion of electrons in aerobic respiration and non-target bacteria growth pathways through the division of labor and cooperation of functional bacteria, and increases the proportion of directional transfer of electrons to the nitrate reduction pathway, thereby increasing the nitrogen removal contribution rate per unit COD.

[0022] (3) Enhanced system stability and shock resistance: Through the improvement of the rhizosphere microenvironment by basic functional bacteria, plant growth and root activity can be promoted, and the sustainability and stability of endogenous carbon release can be improved; the core aerobic denitrifying bacteria can maintain denitrification function under dissolved oxygen fluctuation conditions, making the system more adaptable to changes in influent water quality and dissolved oxygen.

[0023] (4) Diversified Repair Functions and Enhanced System Synergy: Compared with the control group without added microbial agents, the plant growth indicators of the treatment group with the compound microbial agent of this invention were significantly improved. Among them, plant biomass increased by 52.32%, plant height increased by 38.06%, and root length increased by 42.07%. The above results indicate that this invention not only improves the removal efficiency of nitrates, but also enhances plant growth activity through the regulatory effect of basic functional bacteria on the rhizosphere environment, thereby forming a "microorganism-plant" synergistic repair mechanism and realizing diversified enhancement of pollutant removal and ecological restoration functions.

[0024] (5) Significant Ecological Safety and Greenhouse Gas Emission Reduction Effects: The compound microbial agent of this invention significantly improves the greenhouse gas emission characteristics of the system while enhancing the denitrification effect. Monitoring and analysis show that the carbon dioxide flux in the system is significantly reduced, and it changes from a net emission state to a net absorption state, indicating that the compound microbial agent helps to enhance the carbon sequestration capacity of the system and reduce the risk of greenhouse gas emissions. The technical effect demonstrates that this invention can achieve pollutant removal while taking into account ecological and environmental benefits, and has good ecological safety. Attached Figure Description

[0025] Figure 1 The colony morphology (a) and phylogenetic tree alignment results (b) of Pseudomonas schlegelii JH-1 in Example 1 are shown. Figure 2 The colony morphology (a) and phylogenetic tree alignment results (b) of Klebsiella pasteurellum F19 in Example 1 are shown. Figure 3 The growth curves of *Pseudomonas schrenckii* JH-1 and *Klebsiella pasteurellii* F19 in Example 1 are shown. *Pseudomonas schrenckii* JH-1 reaches the logarithmic growth phase in about 5 to 8 hours, while *Klebsiella pasteurellii* F19 reaches the logarithmic growth phase in about 4 to 8 hours. Figure 4 The results of the two-strain antagonism experiment between Pseudomonas schlegelii JH-1 and Klebsiella pasteurellis F19 in Example 2; Figure 5 The results of the denitrification condition optimization experiment of the compound microbial agent in Example 3 are shown, including (a) different inoculum ratios, (b) different initial inoculum concentrations, and (c) different initial COD / TN values. Figure 6 The results show the effluent water quality of the device after one month of operation in Example 4, including (a) total nitrogen (TN) and (b) nitrate nitrogen (NO3).- -N), (c) ammonia nitrogen (NH4) + -N), (d) nitrite (NO2) - -N), (e) Chemical oxygen demand (COD); where NB is the control group, ADB is the treatment group with only Pseudomonas schlegelii JH-1 added, PGPR is the treatment group with only Klebsiella pasteurellis F19 added, and SC is the treatment group with compound bacterial agent added. Figure 7 The greenhouse gas flux results for the control group (NB) and the compound microbial agent treatment group (SC) after one month of the experiment in Example 4 are shown, including (a) CO2 flux, (b) CH4 flux, and (c) N2O flux. Figure 8 The following are the results of plant growth status in the control group and the compound microbial agent treatment group after one month of experimentation in Example 4, including (a) plant height, (b) root length, (c) aboveground fresh weight, (d) underground fresh weight, (e) total dry weight, (f) total fresh weight, (g) aboveground dry weight, and (h) underground dry weight. Detailed Implementation

[0026] Culture medium formulation: Luria-Bertani medium (1L): Dissolve 5g yeast extract, 10g peptone, and 10g sodium chloride in deionized water and bring the volume to 1L. After preparation, autoclave at 121℃ for 30 minutes and cool before use.

[0027] Trace element formula (1L): CuSO4·5H2O 0.03g, FeCl3·6H2O 1.5g, MnCl2·4H2O 0.12g, Na2MoO4·2H2O 0.06g, ZnSO4·7H2O 0.12g, KI 0.18g, H3BO3 0.15g, dissolve in deionized water and bring to a final volume of 1 L.

[0028] Aerobic denitrification medium (1L): Potassium nitrate 0.577g, potassium dihydrogen phosphate 1.5g, magnesium sulfate heptahydrate 0.1g, trace elements 1mL, glucose, dissolved in deionized water and brought to a final volume of 1L. The amount of glucose to be added is determined based on the required C / N ratio (Chemical Oxygen Demand to Total Nitrogen, COD / TN). After actual measurement and correction, the amount of glucose added to achieve the initial C / N ratio is as follows: C / N=2 culture medium: glucose 0.1021g; C / N=3 culture medium: glucose 0.1532g; C / N=4 culture medium: glucose 0.2043g; C / N=5 culture medium: 0.2553g glucose.

[0029] (Taking C / N=3 as an example, the measured initial COD was 316.899 mg / L and TN was 100.064 mg / L, which was basically consistent with the set values ​​of COD 300 mg / L and TN 100 mg / L).

[0030] After preparation, autoclave at 121℃ for 30 minutes, then cool and set aside.

[0031] Example 1: Isolation and Identification of Strains I. Source of the strain Strain JH-1 was collected from the surface of soil in an artificial wetland. After collection, the samples were subjected to aseptic conditions, followed by shaking and serial dilution with sterile water, and then spread onto LB agar using a spreader. The samples were incubated at 28°C for 24 hours. Single colonies were obtained after multiple isolation and purification processes and preserved. Colonies of strain JH-1 activated at 28°C for 24 hours on LB agar were pale yellow, opaque, oval, with smooth edges, a moist surface, and a diameter of 1–3 mm (colony morphology as shown). Figure 1 (as shown in a).

[0032] Strain F19 was obtained from the rhizosphere soil of the submerged plant *Vallisneria natans*. After collection, the samples were subjected to aseptic conditions, diluted serially with sterile water, and then spread onto LB agar plates. The plates were incubated at 28°C for 24 hours, and single colonies were obtained after multiple isolation and purification processes. The plant growth-promoting functions of the isolated strain were then assessed. The ACC deaminase activity of the isolated and purified strains was qualitatively determined according to the method of Penrose and Glick (Penrose DM, Glick BR. 2003. Methods for isolating and characterizing ACC deaminase-containing plant growth-promoting rhizobacteria[J]. Physiologia Plantarum, 118:10-15. DOI:10.1034 / j.1399-3054.2003.00086.x). Colonies that could successfully grow in ACC deaminase selective medium were screened as primary screening strains with plant growth-promoting potential. All primary screening strains were further tested for plant growth-promoting function. The indoleacetic acid (IAA) synthesis capacity was determined according to the method of Gordon and Weber (Gordon SA, Weber R P. 1951. Colorimetric estimation of indoleacetic acid[J]. Plant Physiology, 26:192-195. DOI: https: / / doi.org / 10.1104 / pp.26.1.192). The siderophore secretion capacity was further determined according to the method of Schwyn and Neilands (Schwyn B, Neilands J B. 1987. Universal chemical-assay for the detection and determination of siderophores[J]. Analytical Biochemistry, 160:47-56. DOI: 10.1016 / 0003-2697(87)90612-9), expressed as the diameter of the orange halo. Based on the combined results of the two assays, strain F19 exhibited a high IAA synthesis capacity of 42.42 ± 1.09 μg / mL and a high hepatophilic secretion capacity of 0.85 ± 0.006 cm, both indicating a high level of activity. Therefore, it was selected as the target strain. These results demonstrate that this strain possesses excellent plant growth-promoting potential. Colonies of strain F19, activated at 28°C for 24 hours on LB solid medium, were pale yellow, opaque, oval, with smooth edges, a moist surface, and a diameter of 1–3 mm (colon morphology as shown). Figure 2 (as shown in a).

[0033] II. Strain Identification Using DNA from strains JH-1 and F19 as templates, 16S rDNA was amplified using universal 16S rDNA primers, and its sequence was determined. The universal 16S rDNA primers were: 27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO: 1); 1492R: TACGGCTACCTTGTTACGACGACTT (SEQ ID NO: 2). The 16S rDNA sequencing results of strains JH-1 and F19 were entered into the NCBI database for BLAST alignment. The 16S rRNA gene sequence of the model strain with the highest homology was selected as a reference. After preliminary processing of the target sequence and the model strain sequence using MEGA 12.0, a phylogenetic tree was constructed according to the Neighbor-joining method, with a bootstrap value set to 1000 replicates to assess the confidence level of the tree. The results are as follows: Figure 1 b and Figure 2 As shown in b, strain JH-1 shares 99.03% similarity with the 16S rRNA gene sequence of *Stutzerimonas stutzeri*. Therefore, strain JH-1 is identified as *Stutzerimonas stutzeri*. This strain was deposited on October 23, 2013, at the China Center for Type Culture Collection (CCTCC), located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: M 2013488. This bacterium originally belonged to *Pseudomonas stutzeri*, but was reclassified to *Stutzerimonas stutzeri* in 2022. Strain F19 shared a 99.21% sequence similarity with the 16S rRNA gene of Klebsiella pasteurii, and was therefore identified as Klebsiella pasteurii. This strain was deposited on January 22, 2026, at the China Center for Type Culture Collection (CCTCC), located at Luojia Mountain, Bayi Road, Wuchang District, Wuhan City, Hubei Province, with accession number CCTCC NO: M 2026196.

[0034] The 16S rRNA sequence of Klebsiella pasteurii F19 (SEQ ID NO: 4): III. Growth Characteristics of Strains Activated *Stutzerimonas stutzeri* JH-1 and *Klebsiella pasteurii* F19 were inoculated into LB liquid medium, and the absorbance (OD) at 600 nm was measured using a visible spectrophotometer. 600 ), initial OD 600 Adjust the pH to approximately 0.1 and incubate at 28℃ with shaking at 200 rpm. Take samples every 0.5–2 hours (every 0.5 hours during the early growth phase and every 2 hours during the plateau phase) to measure OD. 600 Continuous measurements were taken for 12 hours, with incubation time as the x-axis and OD value as the y-axis. 600 Plot the growth curve with the ordinate as the vertical axis, and the result is as follows: Figure 3 As shown, *Pseudomonas schlegelii* JH-1 reaches the logarithmic growth phase in 5–8 hours, while *Klebsiella pasteurellium* F19 reaches the logarithmic growth phase in 4–8 hours. These growth characteristics provide a basis for selecting appropriate culture times in subsequent experiments.

[0035] Example 2: Antagonistic Experiment of Strains The antagonism experiment was conducted using the plate-punching method. First, LB liquid medium was prepared, and single colonies of JH-1 and F19 were inoculated separately. The growth curves of F19 and JH-1 were then analyzed. Figure 3 The culture was incubated at 28℃ and 200 rpm for 7 h until the logarithmic phase, and then stored for later use. LB solid medium was prepared, sterilized, and cooled to 45-50℃. JH-1 bacterial suspension was inoculated at a 1:100 volume ratio, shaken well, and poured into plates. After the plates solidified, a 5 mm diameter hole was punched in the center of each plate using a sterile plate puncher. 50 μL of F19 bacterial suspension was then injected into each hole, and the plates were incubated at 28℃ for 24 h. The antagonistic results were obtained as shown below. Figure 4 As shown.

[0036] like Figure 4 As shown, around the injection wells of F19 bacterial culture, JH-1 colonies grew uniformly and continuously, completely consistent with the area far from the wells (control area), without any transparent inhibition zones or obvious growth inhibition areas. This indicates that strain F19 did not secrete any antagonistic substances that could inhibit the growth of strain JH-1 during its metabolism, and there is no mutual inhibition relationship between the two strains. Simultaneously, the good growth of strain F19 within the wells demonstrates its normal growth and metabolism under these culture conditions, ruling out the possibility of false negative results due to insufficient strain viability, and further confirming the reliability of the observation results.

[0037] The above results indicate that there is no antagonistic relationship between *Pseudomonas stearothermii* JH-1 and *Klebsiella pasteurellis* F19. The two strains can coexist and grow and metabolize normally in the same system, providing a biological basis for constructing a compound microbial agent, which can be used simultaneously.

[0038] Example 3: Optimization Experiment of Denitrification Conditions for Compound Microbial Agent A single-factor experimental design was used to investigate the effects of strain ratio, initial inoculum concentration, and C / N ratio of the aerobic denitrification liquid culture medium on the denitrification efficiency of the compound microbial agent. The specific experimental methods are as follows: (1) Take out the cryopreservation tubes of strains F19 and JH-1, and inoculate them on LB solid medium using the four-zone streak method. Incubate at 28℃ for 12h to obtain activated single colonies.

[0039] (2) Select activated F19 and JH-1 single colonies and inoculate them into LB liquid medium, and culture them at 28℃ and 200 rpm for 7 h until the logarithmic growth phase.

[0040] (3) Centrifuge the activated bacterial solution in a refrigerated centrifuge at 4 ℃ and 5000 rpm for 20 min, remove the supernatant, wash the bacterial precipitate with sterile water (to remove residual culture medium components), resuspend the bacterial cells using a vortex mixer, centrifuge again to remove the supernatant, repeat this step 3 times to obtain the bacterial suspension.

[0041] (4) Adjust the bacterial suspension to OD using sterile water. 600 = 0.5 ~ 1.0, to obtain inoculum for later use.

[0042] (5) Prepare aerobic denitrification liquid culture medium, adjust the C / N ratio to 2, 3, 4, and 5 respectively, and initially inoculate with OD. 600 The values ​​were 0.5, 0.8, and 1.0 (controlling the OD values ​​of the two strains). 600 (Equal), the two bacterial suspensions were mixed at volume ratios (F19:JH-1) of 1:1, 1:2, and 2:1 respectively, and inoculated into denitrification medium at a volume ratio of 1:100.

[0043] (6) Place the culture medium inoculated with the compound microbial agent into a shaker, set the temperature to 28℃ and 200 rpm, and incubate for 12 hours. Then remove the culture medium, measure the nitrate nitrogen content, and calculate the removal rate. The calculation formula is as follows: Removal rate = (initial value - final value) / initial value × 100%.

[0044] Based on the above experiments and data analysis, the following results were obtained: (1) Effect of strain ratio on denitrification effect (fixed C / N=3, initial OD 600=1.0): When the ratio of F19 to JH-1 was 1:1, the nitrate removal effect was the best, with a nitrate content of 80.51 mg / L and a removal rate of 19.49%. When the ratios were 1:2 and 2:1, the nitrate contents were 82.34 mg / L and 82.11 mg / L, respectively, with removal rates of 17.66% and 17.89%. The results indicate that the synergistic effect is best when the two strains are mixed in equal proportions; excessively high or low ratios are not conducive to improving denitrification efficiency. Figure 5 a).

[0045] (2) Effect of initial inoculum concentration on denitrification (fixed C / N=3, F19:JH-1=1:1): The initial inoculum suspension concentration was OD 600 At a concentration of 1.0, the nitrate removal rate was the highest, with a nitrate content of 80.51 mg / L and a removal rate of 19.49%; OD 600 The nitrate contents at concentrations of 0.5 and 0.8 were 82.46 mg / L and 82.04 mg / L, respectively, with removal rates of 17.54% and 17.95%. The results indicate that appropriately increasing the initial inoculum size within a certain range helps improve denitrification efficiency, possibly because a higher initial bacterial load facilitates the rapid establishment of a dominant bacterial community. Figure 5 b).

[0046] (3) Effect of carbon-nitrogen ratio on denitrification efficiency (fixed F19:JH-1=1:1, initial OD 600 =1.0): When the C / N ratio is 5, the nitrate removal rate is the highest, with a nitrate content of 74.18 mg / L and a removal rate of 25.82%. When the C / N ratios are 2, 3, and 4, the nitrate contents are 81.96 mg / L, 80.51 mg / L, and 80.46 mg / L, respectively, with nitrate removal rates of 18.04%, 19.49%, and 19.54%. The results show that denitrification is more effective under conditions with sufficient carbon sources. Notably, even under low-carbon conditions with a C / N ratio of only 2, the compound bacterial agent still maintains a nitrate removal rate of 18.04%, indicating that the agent has good low-carbon adaptability and has application potential in carbon-limited water bodies. Figure 5 c).

[0047] Based on the above optimization results, the optimal application conditions for the compound microbial agent are determined to be: a 1:1 ratio of F19 to JH-1, and an initial inoculum concentration of OD0. 600 =1.0, and good denitrification effect can be obtained in the range of carbon-nitrogen ratio of 2 to 5.

[0048] Example 4: Verification of the treatment effect of compound microbial agents in simulated constructed wetlands Microcosm Experimental Validation of Compound Microbial Preparations Specific preparation method of compound microbial preparations: (1) Take out the cryopreservation tubes of strains F19 and JH-1, and inoculate them on LB solid medium with four-zone streak. Incubate them upside down in a constant temperature incubator at 28℃ for 12h to obtain activated single colonies.

[0049] (2) Select activated F19 and JH-1 single colonies and inoculate them into LB liquid medium. Incubate at 28℃ and 200 rpm for 7 h until the logarithmic growth phase to obtain activated bacterial solution.

[0050] (3) Centrifuge the activated bacterial solution in a refrigerated centrifuge at 4 ℃ and 5000 rpm for 20 min, remove the supernatant, wash the bacterial precipitate with sterile water (to remove residual culture medium components), resuspend the bacterial cells using a vortex mixer, centrifuge again to remove the supernatant, repeat this step 3 times to obtain the bacterial suspension.

[0051] (4) Adjust the bacterial suspension to OD using sterile water. 600 = 1.0, obtain the inoculum for later use.

[0052] (5) Mix the adjusted concentration of Klebsiella pasteurellium F19 bacterial solution with Pseudomonas schwanniferum JH-1 bacterial solution at a volume ratio of 1:1 to obtain the composite microbial agent.

[0053] Experimental Grouping and Apparatus Operation: Canna seedlings were used as the experimental subject. The seedling cultivation method was as follows: Seeds from the same canna variety were selected and placed at 4℃ to break dormancy. The seeds were then evenly buried in nutrient soil, with a light intensity of 20,000 lux and a photoperiod of 12 hours of light / 12 hours of darkness, and allowed to germinate. After 15 days of germination, the seedlings were removed from the soil, the soil around the roots was shaken off, the roots were washed with deionized water, and then soaked overnight in a corresponding bacterial solution to allow microorganisms to colonize the root surface in advance.

[0054] Self-prepared water formula (1L): 0.0866g potassium nitrate, 0.0223g ammonium chloride, 0.0383g glucose, 0.0048g potassium dihydrogen phosphate, 1mL trace elements, dissolve in deionized water and bring to a final volume of 1L.

[0055] Parameters of self-prepared water: Fifteen-day-old canna lily seedlings were transplanted into a simulated vertical flow constructed wetland device filled with quartz sand (4-6 mesh), and 2.5L of self-prepared water (C / N=3) was added. The hydraulic retention time (HRT) was set to 4 days. A bacterial suspension was inoculated at a volume ratio of 1:100 (F19:JH-1=1:1, OD... 600=1.0), and set as the compound microbial agent treatment group (SC), the device was acclimatized for 1 month in the following manner: indoor temperature set to 28 ℃, light intensity set to 20000 lux, and light cycle set to 12 h light / 12 h dark; at the same time, treatment groups inoculated only with JH-1 (ADB group) and treatment groups inoculated only with F19 (PGPR group) were set up, and the inoculation concentration of both was OD. 600 =1.0, inoculation volume ratio 1:100, other conditions are the same as the compound bacterial agent treatment group; the control group (NB) is not inoculated with any bacterial solution, and other operations are the same as the treatment group. Each group has 3 parallel experiments.

[0056] Sample collection and measurement: After the effluent from the apparatus stabilized and the experiment was conducted for one month, total nitrogen (TN) was determined using alkaline potassium persulfate digestion and ultraviolet spectrophotometry, and nitrate nitrogen (NO3) was determined using ultraviolet spectrophotometry. - -N), ammonia nitrogen (NH4) was determined by Nessler's reagent spectrophotometry. + Nitrite nitrogen (NO2) was determined by spectrophotometry. - -N), the chemical oxygen demand (COD) was determined using a rapid digestion method, and the results are as follows: Figure 6 As shown; simultaneously, the emission fluxes of three greenhouse gases, carbon dioxide (CO2), methane (CH4), and nitrous oxide (N2O), were determined using gas chromatography, and the results are as follows. Figure 7 As shown; after the experiment, the plants were removed, and physiological and biochemical indicators were measured. The results are as follows. Figure 8 As shown.

[0057] Based on the above experiments and data analysis, the following results were obtained: (1) Water purification effect: such as Figure 6 As shown, the combined microbial agent treatment group (SC) showed effects on TN and NO3. - The removal efficiency of NO3- was the highest in all groups. After one month of experimentation, the NO3- concentration in the compound microbial agent treatment group (SC) was significantly lower. - The removal rate of -N reached 53.14% ( Figure 6 b); The TN removal rate reached 66.61%, which was 40.57% higher than the control group, 23.71% higher than the treatment group with aerobic denitrifying bacteria alone (ADB), and 8.19% higher than the treatment group with rhizosphere growth-promoting bacteria alone (PGPR). Figure 6 a); Meanwhile, the NH4 in the compound microbial agent treatment group (SC) + The removal rate of -N was 98.42% ( Figure 6 c) NO2 in the compound microbial agent treatment group (SC) - -N was significantly lower than that of the treatment group treated with rhizosphere growth-promoting bacteria ( Figure 6 d), the COD removal rate of the compound microbial agent treatment group (SC) was 62.62% ( Figure 6 e). Figure 6 The results clearly show that the effluent concentrations of all water quality indicators in group SC were significantly lower than those in the other three groups, indicating that the compound bacterial agent has a synergistic removal effect on nitrogen and organic matter in wastewater with a low carbon-to-nitrogen ratio, which is significantly better than the treatment with a single bacterial agent.

[0058] (2) Plant growth promoting effect: such as Figure 8 As shown, the plant growth status in the compound microbial agent treatment group (SC) was significantly better than that in the control group. Compared with the control group, the plant height in the compound microbial agent treatment group (SC) increased by 38.06% ( Figure 8 a), root length increased by 42.07% ( Figure 8 (b) The fresh weight of the plant increased by 63.85% ( Figure 8 f), of which the above-ground and underground fresh weight increased by 67.69% and 50.20% respectively. Figure 8 c, d), plant dry weight increased by 52.33% ( Figure 8 e), of which the above-ground and underground dry weights increased by 55.17% and 58.73% respectively. Figure 8 g, h). Figure 8 The comparative photos of plant growth status visually demonstrate that the SC group plants are more robust and have more developed root systems. The results indicate that the rhizosphere growth-promoting bacteria F19 in the compound microbial agent effectively promotes plant growth, enhances root activity, facilitates the release of root exudates, and provides more endogenous carbon sources for the denitrification process.

[0059] (3) Greenhouse gas emission reduction effect: such as Figure 7 As shown, the combined microbial agent treatment group (SC) also showed significant effects on greenhouse gas emission reduction. Compared with the control group, the N2O emission flux in the combined microbial agent treatment group (SC) was reduced by 31.97% ( Figure 7 c), CO2 decreased by 316.04% ( Figure 7 a) indicates a shift from net emission to net absorption, meaning the CH4 flux increased by 226.75%. Figure 7 (b) However, its absolute emissions are low, and the overall greenhouse effect of the system is still significantly reduced. Figure 7 The bar chart clearly shows the significant reduction in N2O and CO2 emissions in the SC group. The results indicate that the compound microbial agent, while enhancing denitrification, significantly improved the greenhouse gas emission characteristics of the system, avoided the secondary pollution problems that may occur in traditional denitrification processes, and demonstrated good ecological safety.

[0060] As can be seen from the above embodiments, the composite microbial agent (Pseudomonas stearothermii JH-1 and Klebsiella pasteurellium F19) provided by the present invention exhibits a significant synergistic effect in the simulated artificial wetland system. There is no antagonistic effect between the two strains; they can form a synergistic relationship in the system: the aerobic denitrifying bacterium Pseudomonas stearothermii JH-1 is responsible for the efficient reduction of nitrate nitrogen, while the rhizosphere growth-promoting bacterium Klebsiella pasteurellium F19 promotes plant growth and enhances rhizosphere carbon source release, thereby improving electron supply efficiency.

[0061] Compared with the control group and the single-strain treatment group, the TN and NO3 in the compound microbial agent treatment group were significantly lower. - -N removal rate significantly improved ( Figure 6 ); at the same time NH4 + -N and COD also maintained high removal levels; the compound microbial agent significantly promoted plant growth, and various biomass indicators were significantly improved ( Figure 8 ), and effectively reduce N2O and CO2 emission fluxes ( Figure 7 The results showed that the compound bacterial agent achieved enhanced denitrification and synergistic improvement of ecological benefits in wastewater with low carbon-to-nitrogen ratio through a synergistic mechanism of "growth promotion-denitrification," demonstrating a comprehensive effect superior to that of single-strain applications and showing good application prospects.

Claims

1. A type of Klebsiella pasteurii F19, characterized in that, The Klebsiella pasteurii F19 strain was deposited at the China Center for Type Culture Collection on January 22, 2026, with accession number CCTCC NO: M 2026196.

2. A compound microbial agent, characterized in that, The active ingredients of the compound microbial agent include Pseudomonas stutzeri JH-1 and Klebsiella pasteurii F19 as described in claim 1. The *Pseudomonas stutzeri* JH-1 strain was deposited at the China Center for Type Culture Collection on October 23, 2013, with accession number CCTCC NO: M 2013488.

3. The compound microbial agent according to claim 2, characterized in that, The effective viable count ratio of Klebsiella pasteurellum F19 to Pseudomonas schlegelii JH-1 in the compound microbial agent is 0.5 to 2:

1.

4. A method for preparing the composite microbial agent as described in claim 2 or 3, characterized in that, Includes the following steps: (1) Klebsiella pasteurellum F19 and Pseudomonas schrenckii JH1 were inoculated into solid culture medium for activation culture to obtain activated Klebsiella pasteurellum F19 and Pseudomonas schrenckii JH-1 strains. (2) The activated Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1 strains were inoculated into liquid culture medium for propagation culture to obtain single strain propagation culture of Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1. (3) Centrifuge the bacterial suspensions of single strains of Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1, remove the supernatant and collect the bacterial cells, wash with sterile water and resuspend 2 to 4 times to obtain single strain suspensions of Klebsiella pasteurellium F19 and Pseudomonas schrenckii JH-1. (4) Adjust the concentration of single-strain bacterial suspensions of Klebsiella pasteurellis F19 and Pseudomonas schwanniferus JH-1 to OD values ​​respectively. 600 The value is 0.5 to 1.0; (5) Mix the adjusted concentration of Klebsiella pasteurellium F19 bacterial suspension with a single strain of Pseudomonas schrenckii JH1 bacterial suspension in a certain proportion to obtain the composite microbial agent.

5. The preparation method according to claim 4, characterized in that, The solid culture medium in step (1) is LB solid culture medium, and the culture conditions are 26-30℃ static culture for 10-12h; the liquid culture medium in step (2) is LB liquid culture medium, and the culture conditions are 26-30℃, 180-220rpm shaking culture for 6-8h.

6. The application of the composite microbial agent according to claim 2 or 3 or the composite microbial agent prepared by the method according to claim 4 or 5 in the treatment of low C / N wastewater.

7. The application according to claim 6, characterized in that, The low C / N wastewater has a C / N ratio of no more than 5, where C / N is the ratio of chemical oxygen demand to total nitrogen (COD / TN).

8. The application according to claim 6 or 7, characterized in that, The application is in the treatment of low C / N wastewater using constructed wetlands.

9. The application according to claim 8, characterized in that, The compound microbial agent is inoculated into the roots and / or substrate of artificial wetland plants.

10. The application according to claim 9, characterized in that, The artificial wetland plants include canna lilies.