A gene overexpression vector and gene expression strategy for non-model b. laterosporus

Abstract

This invention discloses a plasmid for gene overexpression in non-pattern *Bacillus laterosporus*. Its leader region contains a methyltransferase expression cassette derived from the *Bacillus laterosporus* i83 genome, enabling stable existence in specific hosts containing the RM system. Based on this, a PidR2 promoter is added to obtain the pMCPidR2 shuttle plasmid. The PidR2 promoter effectively drives target gene expression, the pWV01 replicon ensures plasmid replication in non-pattern hosts, and the chloramphenicol resistance gene is used for positive colony selection. The plasmid contains a TraJ element, allowing it to be introduced into non-pattern microbial hosts via conjugation transfer. This invention also provides a target gene expression strategy in non-pattern microorganisms, achieving high transformation efficiency and high strain yield through conjugation transfer transformation of donor bacteria, conjugation transfer helper bacteria, and recipient bacteria, resulting in stable expression of the target protein. This invention provides an effective vector for efficient and stable gene overexpression in specific non-pattern microorganisms, helping to solve the problem of difficult genetic manipulation of industrial production strains.

Description

Technical Field

[0001] This invention relates to the field of microbial genetic manipulation technology, specifically to a strategy and vector system for overcoming the barriers of the Brevibacillus laterosporus restriction modification system and achieving efficient gene expression. Background Technology

[0002] *Brevibacillus laterosporus* M811 is a microbial strain obtained through soil co-culture screening, capable of synthesizing the compound Brevicidine (Bre), which exhibits significant antibacterial activity. This compound shows broad application prospects in the pharmaceutical and agricultural fields. However, despite the great potential of strain M811, its in-depth development and large-scale application still face significant challenges, with the core bottleneck being the lack of an efficient and universal genetic manipulation tool system. Crucially, many non-model industrial microorganisms, including M811, commonly possess a restriction-modification system (RM system). This characteristic significantly inhibits the introduction and stable maintenance of exogenous DNA, thus severely hindering the genetic engineering and performance optimization of the strain, ultimately limiting its application potential in industrial fields such as biomanufacturing.

[0003] The restriction modification (RM) system is a natural bacterial immune defense mechanism that recognizes and cleaves exogenous DNA with methylation patterns different from those of the host. Our previous research confirmed the existence of an active RM system in strain M811. Overcoming the limitations of the RM system is key to achieving efficient genetic engineering. This typically requires methylation modification of exogenous DNA to match the host, but this method is cumbersome, time-consuming, and has poor experimental reproducibility, making it difficult to meet the needs of efficient research and development. Furthermore, as a non-model chassis microorganism, M811 has not yet found a suitable plasmid replicon for stable plasmid replication. In addition, this strain lacks responsiveness to standard gene expression regulatory elements derived from model organisms, making it difficult to achieve effective and controllable expression of target genes, further limiting its development potential as an engineered strain.

[0004] Therefore, there is an urgent need to develop new strategies and tools to overcome the barriers of the RM system in non-model microorganisms such as M811, and to establish efficient and reliable gene expression regulation systems suitable for these hosts, thereby unleashing their potential in the field of biomanufacturing. Summary of the Invention

[0005] To address the technical challenges in the existing technologies and meet the needs of industrial applications, this invention provides an innovative strategy and corresponding molecular tools designed to effectively circumvent the restriction modification (RM) system of Bacillus laterosporus M811 and achieve efficient and controllable gene expression in this non-model chassis microorganism.

[0006] This invention assembles the pMC plasmid backbone and the PidR2 repressor promoter functional element to obtain a novel expression vector, named pMCPidR2. This vector combines RM system evasion capability and gene expression regulation function, and can serve as a powerful tool to achieve efficient genetic transformation and controlled, repressed expression of target genes in non-model strain M811.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] This invention provides a plasmid containing a methyltransferase expression cassette derived from the genome of the non-model microorganism *Brevibacillus laterosporus* i83, with the sequence shown in SEQ No. 1 and named pMC. During the process of the plasmid entering host cells of non-model microorganisms such as M811 via conjugation transfer or other means, the methyltransferase gene carried by the plasmid itself can be expressed, and methylation modifications are performed on both the plasmid and host DNA, resulting in novel methylation modifications in the cells. Simultaneous methylation modification of the host genome induces inhibition of restriction enzyme activity, preventing non-specific degradation of any methylated DNA (including exogenous plasmid and host DNA), thereby protecting the plasmid from degradation by the M811 endogenous RM system and significantly improving transformation efficiency and stability.

[0009] Furthermore, upstream of the multiple cloning region of the above plasmid is the PidR2 repressor promoter, the sequence of which is shown in SEQ No. 3 and named pMCPidR2. The full sequence of the plasmid is shown in SEQ No. 2. The PidR2 promoter is a rationally designed and modified version of the known P43 promoter, with optimization of its ribosome binding site (RBS) region. This promoter has good regulatory performance; in the presence of 250 μM 2-aminopurine (2AP), the transcriptional activity of the PidR2 promoter is inhibited, thereby achieving "off" or "on" control of downstream gene expression. It is suitable for the expression of target genes in non-model microbial host cells such as M811.

[0010] Furthermore, the replicon of the pMCPidR2 plasmid is pWV01, and the resistance gene is chloramphenicol (Cm).

[0011] Furthermore, the pMCPidR2 plasmid contains a TraJ element, the sequence of which is shown in SEQ No. 4. The plasmid can be used to transform non-model microorganisms via conjugation transfer.

[0012] This invention also provides a method for expressing a target gene in non-model microorganisms, comprising the following steps:

[0013] Step 1: Insert the target gene into the multiple cloning region of the pMCPidR2 plasmid by PCR or enzyme digestion subcloning.

[0014] Step 2: Transform the donor bacteria with the pMCPidR2 plasmid containing the target gene;

[0015] Step 3: Inoculate the donor bacteria, the binding transfer helper bacteria HB101, and the recipient bacteria (non-model microorganism) into the optimal culture medium and temperature containing the corresponding antibiotics for expansion culture. Mix the donor bacteria: helper bacteria: recipient bacteria in a volume ratio of 2:2:0.5 and wash off the antibiotics. Finally, resuspend in 300 μl of NB blank medium.

[0016] Step 4: Take 300 μl of the mixture of the above three bacterial cells and drop it onto a sterile filter membrane (0.22 μm pore size). Place the filter membrane on an antibiotic-free solid culture medium in advance and incubate overnight at 33°C. Collect the filter membrane containing bacterial cells into a 15 ml centrifuge tube, add NB liquid culture medium, vortex to collect bacterial cells, spread on Cm antibiotic plates, and incubate at 33°C for about 2 days to grow single colonies.

[0017] Step 5: Pick a single colony, expand the culture, extract plasmids, and use PCR to identify the expression of the target gene.

[0018] Furthermore, the optimal usage conditions for each strain after the expansion culture in step 3 of the above method are as follows: the OD600 value of the donor and auxiliary bacteria is 0.5, and the OD600 value of the recipient bacteria is 0.7.

[0019] Furthermore, the non-model microorganisms described in the above methods include, but are not limited to, *Brevibacillus laterosporus* M811.

[0020] The beneficial effects of this invention are as follows:

[0021] 1. This invention provides a pMCPidR2 plasmid containing a methyltransferase expression cassette from the non-model Brevibacillus laterosporus i83 genome. When introduced into non-model microbial host cells such as M811, the plasmid carries its own gene to express methyltransferases, which can methylate the plasmid and host DNA, induce restriction enzyme activity inhibition, thereby protecting the plasmid from degradation by the M811 endogenous RM system and significantly improving transformation efficiency and stability.

[0022] 2. The PidR2 promoter on the plasmid of this invention is a repressive promoter modified from the P43 promoter. It can inhibit the expression of the target gene at 250 μm 2AP and can be expressed in strains including but not limited to Brevibacillus laterosporus M811. It works synergistically with the methyltransferase expression cassette in the non-model Brevibacillus laterosporus i83 genome and other elements of the pMCPidR2 plasmid.

[0023] 3. The plasmid provided by this invention is a shuttle plasmid, which can be directly constructed in Escherichia coli and then used to transform non-model microorganisms for overexpression.

[0024] 4. The plasmid provided by this invention contains Traj elements, and can be transformed by conjugation transfer. It also employs Cm resistance to reduce plasmid length, resulting in high transformation efficiency and high yield of transformed strains. This invention helps to solve the problem of difficult genetic manipulation of industrial production strains and has broad application prospects in the overexpression of target proteins in non-model microorganisms.

[0025] 5. This invention provides a method for expressing a target gene in a non-model microbial host cell containing a restriction modification system, which can achieve stable high expression of the target protein in important industrial production strains. Attached Figure Description

[0026] Figure 1 The plasmid maps of vectors pMCPidR2, pMCPidR2gfp, and pBL2 from Example 1 are shown.

[0027] Figure 2 The plate shown in Example 2 is an M811 plate after transformation with pMCPidR2gfp, pM2CPidR2gfp, pM3CPidR2gfp, and pM4CPidR2gfp plasmids.

[0028] Figure 3 This is a gel electrophoresis image of the colony PCR in Example 3.

[0029] Figure 4The green fluorescence intensity is shown for the positive strain in Example 4.

[0030] Figure 5 The green fluorescence phenomenon is observed in the positive strain in Example 4.

[0031] Figure 6 This shows the repression expression of the PidR2 promoter in Example 4. Detailed Implementation

[0032] The following experimental examples are further illustrative of the present invention and are not intended to limit the invention. Specific experimental conditions and methods are not specified in the following examples. Experimental methods not specified in the following examples are performed according to conventional methods and conditions, or as selected according to the product instructions. In this patent, "h" represents hours and "min" represents minutes.

[0033] In this invention, all the materials and reagents described are commonly used in the field and can be obtained through conventional commercial channels.

[0034] NB liquid medium: 10.0g tryptone, 3.0g yeast extract, 5.0g sodium chloride, and double-distilled water are thoroughly mixed and brought to a final volume of 1L with double-distilled water. The medium is then autoclaved at 121℃ for 20min. The agar powder concentration of the solid medium is 2%.

[0035] LB liquid medium: 10.0g peptone, 5.0g yeast extract, 10.0g sodium chloride and double-distilled water are thoroughly mixed and brought to a final volume of 1L with double-distilled water. Sterilize at 121℃ for 20min. The agar powder concentration of the solid medium is 1.5%.

[0036] Chloramphenicol: Cm; Kanamycin: Kana.

[0037] The non-pattern brevibacillus laterosporus M811 was isolated and preserved by the Antimicrobial Peptide Laboratory of the Institute of Nutrition and Feed Research, Chongqing Academy of Animal Sciences, and deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC-M2024715. It is available to the public from the Chongqing Academy of Animal Sciences.

[0038] plasmid vectors pMCPidR2, pMCPidR2gfp, and pBL2 (see schematic diagram) Figure 1 The pBL2 plasmid is available to the public from the Chongqing Academy of Animal Sciences. The pBL2 plasmid is the second-generation basal plasmid assembled at the start of the research.

[0039] Example 1: Construction of plasmids containing different methylases

[0040] We amplified three methyltransferase sequences from the non-type strain *Brevibacillus laterosporus* i83: methyltransferase 1 (M1, GenBank: WP_003339856.1, site-specific DNA-methyltransferase); methyltransferase 2 (M2, GenBank: NKQ18408.1, DNA (cytosine-5-)-methyltransferase); and methyltransferase 3 (M3, GenBank: WP_121472666.1, DNA cytosine-methyltransferase). Simultaneously, we amplified methyltransferase 4 (M4, Dam, GenBank: CP147024.1, adenine-specific DNA-methyltransferase) from the model microorganism *Escherichia coli* MC1061. The amplified methyltransferase was assembled with the plasmid backbone pBL2 to form the following novel plasmid backbones: pMC (containing M1); pM2C (containing M2); pM3C (containing M3); pM4C (containing M4). Then, the PidR2 promoter was assembled into a plasmid backbone containing different methylases to obtain shuttle plasmids pMCPidR2 (containing M1); pM2CPidR2 (containing M2); pM3CPidR2 (containing M3); and pM4CPidR2 (containing M4). The green fluorescent expression cassette gfp fragment was then inserted into the multiple cloning region of the shuttle plasmid to assemble new expression plasmids, namely: pMCPidR2gfp (containing M1); pM2CPidR2gfp (containing M2); pM3CPidR2gfp (containing M3); and pM4CPidR2gfp (containing M4). The plasmid maps of pMCPidR2 (containing M1) and pMCPidR2gfp (containing M1) are shown in Figure 1. The plasmid construction work has been completed in the previous experiments.

[0041] Example 2: Transformation with different plasmids

[0042] The transformation is performed using a conjugation transfer method, and the specific steps are as follows:

[0043] First, *E. coli* MC1061 donor bacteria containing plasmids pBL2, pMCPidR2gfp, pM2CPidR2gfp, pM3CPidR2gfp, and pM4CPidR2gfp, respectively, were inoculated with transfer helper bacteria HB101 and recipient bacteria M811 overnight in optimal medium and temperature containing the corresponding antibiotics. The recipient bacteria were cultured in antibiotic-free NB medium, the donor bacteria in LB medium containing 25 μg / mL Cm, and the helper bacteria HB101 in NB medium containing 50 μg / mL Kana. The next day, the donor bacteria were inoculated at 3% in 5 ml of LB medium, and the helper and recipient bacteria were inoculated at 5% and 8% in 30 ml of NB medium for expansion culture. The optimal conditions were an OD600 value of 0.5 for the donor and helper bacteria and an OD600 value of 0.7 for the recipient bacteria. The conversion efficiency of conjugation transfer = number of conjugates / total number of donor bacteria. When OD600 = 0.5, 2 ml of donor bacteria will have a conversion efficiency of approximately 5 × 10⁻⁶. 8 Transformation of donor bacteria. A mixture of donor bacteria:helper bacteria:recipient bacteria at a volume ratio of 2 ml:2 ml:0.5 ml was prepared, centrifuged to remove antibiotics, and finally resuspended in 300 μl of NB blank medium. 300 μl of the above three bacterial mixture was dropped onto a UV-sterilized filter membrane (0.22 μm pore size). The filter membrane was pre-placed on antibiotic-free solid medium and incubated overnight at 33°C. The next day, the filter membrane containing bacteria was collected into a 15 ml centrifuge tube, NB liquid medium was added, and the bacteria were vortexed to collect the cells. The collected cells were then plated onto 10 μg / mL Cm antibiotic plates and incubated at 33°C for approximately 2 days. Colony counts were then observed on the plates. Figure 2 Among the plasmids pBL2, pM2CPidR2gfp, pM3CPidR2gfp, and pM4CPidR2gfp, no single colonies grew on the plates after transformation of M811. Therefore, the basic plasmid and these three methylases did not achieve the desired effect, and the transformation rate was almost 0%. However, pMCPidR2gfp transformed the plates and produced a large number of single colonies. In three non-repeated experiments, the colony count was 120-150, indicating that this method has a good transformation efficiency of 2.4-3 × 10⁻⁶. −7 (i.e., every 10) 8 The donor bacteria produce 24-30 conjugates.

[0044] Example 3: Testing after plasmid transformation

[0045] We randomly selected eight single colonies from the plate in Case Study 2 for PCR identification. The specific procedure is as follows:

[0046] Non-model microorganisms generally have thicker cell walls, therefore, a boiling water bath for 15 minutes is required before colony PCR. PCR identification mainly uses M811-specific primers (811-F: CTGGTGCAAATTTGGCAAGAGGTA; 811-R: ATCCTCCTGGCCAGTATATTTATGC) to identify the strain. No band indicates contamination, while a 1000 bp band indicates the non-model microorganism M811. TraJ (Plasmid RP4 relaxosome protein) primers (traJ-F: GCCTTCCAGACGAACGAAGA; traJ-R: TAGTGCTTTACGGCACCTCG) are used to determine if the plasmid has successfully transferred into the host. A 229 bp band indicates successful transfer. Gel results are shown below. Figure 3 As shown, the results were as expected, with all 8 single colonies being positive transformants, resulting in a 100% yield. This demonstrates that the plasmid transformation efficiency and yield are high when using this transformation method in non-model microorganisms.

[0047] Example 4: Detection of Plasmid Fluorescent Expression

[0048] From the plate in Case Study 2, we randomly selected 8 single colonies for green fluorescence testing. The specific procedure is as follows:

[0049] Positive transformants of strain M811 were picked from the plate and inoculated into NB+Cm medium. The culture was incubated at 33℃ and 222 rpm in a plate shaker until OD600 = 1. 1 mL of the bacterial suspension was centrifuged to collect the cells, washed three times with 0.1 M phosphate-buffered saline (PBS, pH 7.4), and resuspended in 1 mL PBS. 200 μL of the bacterial suspension was transferred to an ELISA plate, and fluorescence intensity was detected using a fluorescence microplate reader (excitation wavelength 485 nm, emission wavelength 528 nm). For strains with significant fluorescence signals, 10 μL of the washed bacterial suspension was further spread on a glass slide, and fluorescence expression was observed using an inverted fluorescence microscope. The results showed that pMCPidR2gfp exhibited extremely strong fluorescence signal intensity in M811. Figure 4 Furthermore, a distinct green fluorescence phenomenon was observed under an inverted fluorescence microscope. Figure 5 All eight single colonies were green fluorescent positive, indicating that this method achieved stable expression of the target protein. We used different concentrations of 2AP to inhibit the expression of the PidR2 promoter, and the results showed that the optimal inhibitory concentration was 250 μM. The pMCPidR2 plasmid, through the PidR2 repressive promoter, enables controlled expression of the target gene.

[0050] In addition to Brevibacillus laterosporus M811, this transformation method can also be used to achieve efficient transformation of plasmids and stable expression of target proteins in other non-model streptococci and Clostridium spp. containing the RM system.

[0051] In summary, the overexpression vector pMCPidR2 of this invention can be used for the transformation of non-model microorganism M811 with high transformation efficiency. The preparation of the overexpression vector pMCPidR2 by inserting GFP and its transformation into *Bacillus laterosporus* M811 via conjugation transfer demonstrated the controllable activation activity of the PidR2 promoter in M811. Using the expression vector of this invention, overexpression and other operations can be performed in non-model microorganisms, helping to solve the problem of difficult metabolic modification of industrial production strains.

Claims

1. A plasmid, characterized in that: The plasmid contains a methyltransferase expression cassette derived from the genome of non-patterned Bacillus brevis i83, with the sequence shown in SEQ No. 1, and is named pMC.

2. A plasmid, characterized in that: The sequence is shown in SEQ No. 2, wherein the leader region contains a methyltransferase expression cassette derived from the genome of non-patterned Bacillus brevis i83, the sequence of which is shown in SEQ No. 1, and the upstream of the multiple cloning region is the PidR2 promoter, the sequence of which is shown in SEQ No. 3; the plasmid is named pMCPidR2.

3. The pMCPidR2 plasmid as described in claim 2, wherein the replicon is pWV01 and the resistance gene is chloramphenicol (Cm).

4. The pMCPidR2 plasmid as described in claims 2-3, containing the TraJ element, the sequence of which is shown in SEQ No. 4, is used to transform non-model microorganisms by conjugation transfer.

5. A method for expressing a target gene in a non-model microorganism, comprising the following steps: Step 1: Insert the target gene into the pMCPidR2 plasmid as described in claim 4 by PCR or enzyme digestion subcloning. Step 2: Transform the donor bacteria with the pMCPidR2 plasmid containing the target gene; Step 3: Inoculate the donor bacteria, the binding transfer helper bacteria HB101, and the recipient bacteria (non-model microorganism) into the optimal culture medium and temperature containing the corresponding antibiotics for expansion culture. Mix the donor bacteria: helper bacteria: recipient bacteria in a volume ratio of 2:2:0.5 and wash off the antibiotics. Finally, resuspend in 300 μl of NB blank medium. Step 4: Take 300 μl of the mixture of the above three bacterial cells and drop it onto a sterile filter membrane. Place the filter membrane on an antibiotic-free solid culture medium in advance and incubate overnight at 33°C. Then, collect the filter membrane containing bacterial cells into a 15 ml centrifuge tube, add NB liquid culture medium, vortex to collect the bacterial cells, spread it on a Cm antibiotic plate, and incubate at 33°C for about 2 days to grow single colonies. Step 5: Pick a single colony, expand the culture, extract plasmids, and use PCR to identify the expression of the target gene.

6. The method as described in claim 5, further characterized in that: After step 3, the optimal usage conditions for each strain after expansion culture are: OD600 value of 0.5 for the donor and auxiliary strains, and OD600 value of 0.7 for the recipient strain.

7. The method as described in claim 5 or 6, further characterized in that: Non-model microorganisms include, but are not limited to, Bacillus lateralis M811.

Images