Specific dna fragment for identifying gender of yellowfin tuna, primer for identification, method for identification and application

Abstract

This invention discloses a specific DNA fragment, primers, identification method, and application for sex identification in yellowfin tuna. The specific DNA fragment has the following gene sequence: male as shown in SEQ ID NO.1 and female as shown in SEQ ID NO.2. Primers were designed based on the specific DNA fragment sequence for PCR amplification and Sanger sequencing analysis. The genotype at position 219 of the male yellowfin tuna DNA fragment is T / G heterozygous, and at position 292 it is A / G heterozygous. The genotype at position 219 of the female yellowfin tuna DNA fragment is T / T homozygous, and at position 292 it is A / A homozygous. This invention successfully achieves non-lethal sex identification during the fry or juvenile stage, which is beneficial for the implementation of asexual reproduction and seedling selection in yellowfin tuna, and has significant practical value and application potential.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to specific DNA fragments, primers, identification methods, and applications for sex identification in yellowfin tuna. Background Technology

[0002] Yellowfin tuna (Thunnus albacares), belonging to the order Perciformes, family Scombridae, and genus Thunnus, is an important pelagic migratory fish distributed in tropical and subtropical waters worldwide. Its flesh is delicious and highly nutritious, making it a crucial ingredient in sashimi, canned goods, and other foods, and it holds a vital position in the global fisheries economy. Due to overfishing and persistently strong market demand, its wild populations face immense pressure. Therefore, developing artificial breeding and aquaculture techniques for yellowfin tuna is of great significance for alleviating overfishing pressure and ensuring the sustainable development of the industry.

[0003] In yellowfin tuna farming, sex control is one of the key technologies for improving farming efficiency and breeding effectiveness. Male yellowfin tuna, after entering their rapid growth phase, often grow faster and reach a larger final size than females, resulting in higher yields and economic value per unit within the same farming cycle. Achieving male-dominated, all-male hermaphroditic farming can effectively unify the growth size of the farmed population, shorten the farming cycle, improve feed conversion ratio and yield, thereby significantly enhancing economic benefits. However, in yellowfin tuna farming and breeding practices, achieving sex control faces a fundamental bottleneck: this fish matures relatively late (usually 3-5 years), and during the long juvenile and immature stages, its gonads are undeveloped and it lacks external secondary sexual characteristics, making accurate sex identification through morphological methods impossible. Currently, the main method for sex identification in yellowfin tuna relies on traditional anatomical observation of the gonads. This method is destructive and cannot be used for live selection, especially for valuable broodstock or fry. If sex identification cannot be performed early in their growth, asexual reproduction cannot be implemented, and economic benefits cannot be improved. Furthermore, to ensure a sufficient number of broodstock of the target sex during breeding, it is necessary to maintain a far larger stock than actually needed for extended periods, increasing breeding costs; and mating can only be done after individuals reach sexual maturity, severely hindering genetic progress. Therefore, developing early and accurate sex identification technology is fundamental to achieving these goals.

[0004] In recent years, marker-based sex determination technology has become a hot topic in fish genetics and breeding research due to its high accuracy and non-lethal detection of trace tissues (such as fin rays) at any developmental stage. For example, Chinese patent document CN119955916B discloses a specific DNA fragment and method for sex determination in the Ussuri yellow catfish. This method uses high-throughput sequencing to screen for male-specific DNA fragments in the Ussuri yellow catfish, designs a pair of PCR primers for amplification, and rapidly distinguishes between males and females based on the presence or absence of a 356bp band, achieving simple and accurate sex determination. However, the development and application of sex-specific molecular markers for yellowfin tuna are still relatively lagging behind. Published, large-scale validated specific DNA markers and methods that can be stably used for identifying different geographical populations are still lacking.

[0005] Therefore, developing a technology that can accurately, quickly, and non-lethally identify sex during the fry or juvenile stage remains a key prerequisite for achieving precision breeding and efficient aquaculture of yellowfin tuna. Summary of the Invention

[0006] To address the shortcomings of existing yellowfin tuna identification techniques and to achieve the aforementioned objectives, this invention proposes a specific DNA fragment, identification primers, and a method and application for sex identification of yellowfin tuna, providing an effective molecular marker (specific DNA fragment) and technical means for sex identification of yellowfin tuna.

[0007] The technical solution of this invention mainly includes the following:

[0008] I. This invention provides a specific DNA fragment for sex identification of yellowfin tuna, the sequence of which is shown in SEQ ID NO.1 and the sequence of which is shown in SEQ ID NO.2.

[0009] II. This invention provides a primer for sex determination of yellowfin tuna, the primer sequence of which is:

[0010] Forward primer: 5'-GCTTCATTTTTCAGCCCCGT-3';

[0011] Reverse primer: 5'-TGTCGTGGGGCTCTTGGTA-3'.

[0012] III. This invention provides a method for sex determination of yellowfin tuna, comprising the following steps:

[0013] PCR amplification and agarose gel electrophoresis were performed using the above primers. After confirming the amplification of a bright target band, the PCR amplification products were sequenced by Sanger sequencing.

[0014] If the genotype at position 219 of the amplified fragment is T / G heterozygous, and / or the genotype at position 292 of the amplified fragment is A / G heterozygous, then the tested individual is a male yellowfin tuna.

[0015] If the genotype at position 219 of the amplified fragment is T / T homozygous, and / or the genotype at position 292 of the amplified fragment is A / A homozygous, then the tested individual is a female yellowfin tuna.

[0016] The sequence of the PCR amplification fragment is shown in SEQ ID NO.1 or SEQ ID NO.2.

[0017] Preferably, in the aforementioned method for sex determination of yellowfin tuna, the PCR amplification reaction system is a 50 μL PCR reaction system, comprising: 2 μL DNA template, 25 μL 2×Premix Taq™, 2 μL each of 10 μM forward and reverse primers, and 19 μL ddH2O.

[0018] Preferably, the aforementioned method for sex determination of yellowfin tuna includes the following PCR amplification conditions: run the following program on a thermal cycler: pre-denaturation at 94°C for 1 minute; followed by 35 cycles, each cycle including denaturation at 98°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds; after the cycle, final extension at 72°C for 5 minutes; and finally storage at 4°C.

[0019] IV. This invention provides an application of the aforementioned primers for sex identification in yellowfin tuna, specifically their application in the preparation of a yellowfin tuna sex identification detection kit. Preferably, it is used to achieve monosex aquaculture during the fry or juvenile stage.

[0020] V. This invention provides another application of the aforementioned primers for sex identification in yellowfin tuna, specifically in yellowfin tuna breeding. Preferably, it is used to control the number of broodstock of the target sex during the fry or juvenile stage.

[0021] The beneficial effects of this invention are:

[0022] 1) This invention identifies two loci (locus 1 and locus 2) that are significantly associated with the sex phenotype of yellowfin tuna. The genotype of the loci can be detected by taking any tissue (preferably fin rays) of yellowfin tuna. This invention successfully achieves accurate, rapid and non-lethal sex identification during the seedling or juvenile stage, enabling the implementation of asexual aquaculture, improving economic benefits, ensuring the number of breeding parents, shortening the breeding time, improving breeding efficiency, and reducing breeding costs.

[0023] 2) Based on the screened key sites, this invention designed specific primers and verified the sex dimorphism of these two sites in independent samples by PCR amplification combined with Sanger sequencing, thus establishing a stable and reliable molecular identification method.

[0024] 3) The identification method of this invention extracts relevant locus genes for sequencing and compares para base sequences to determine sex. It has high accuracy and causes little harm to the fish. It is of great significance for promoting precision breeding and efficient farming of yellowfin tuna and population propagation. Attached Figure Description

[0025] Figure 1 This is a scan result within the genome of the yellowfin tuna, as presented in this invention.

[0026] Figure 2 The results of the genome-wide association study (GWAS) of yellowfin tuna in this invention;

[0027] Figure 3 The results of the sex-specific loci information of yellowfin tuna screened in this invention;

[0028] Figure 4 This is a gel electrophoresis image used in the present invention to identify the sex of yellowfin tuna;

[0029] Figure 5 This is a sequencing peak diagram near site 1, used in the present invention to identify the sex variation site in yellowfin tuna.

[0030] Figure 6 The sequencing peak diagram near site 2, which is used to identify the sex variation site in yellowfin tuna in this invention. Detailed Implementation

[0031] The following detailed description of specific embodiments of the present invention is provided in conjunction with examples. Reagents not provided in the following experiments are all commercially available reagents, and methods not described in detail are all conventional and well-known experimental methods.

[0032] The specific implementation method is as follows:

[0033] Example 1: Screening for sex-specific genetic loci

[0034] Using the male yellowfin tuna genome (accession number: GCA_054135465.1) from a public database as a reference genome, population genetics analysis was conducted to screen for sex-associated molecular markers. Details are as follows:

[0035] 1) Population Sample and Resequencing: Twenty-eight gonadally mature yellowfin tuna individuals were collected, including 14 males and 14 females, to ensure sample representativeness. Genomic DNA was extracted from each individual by Wuhan Fraser Gene Information Co., Ltd., and whole-genome sequencing was performed using the MGI high-throughput sequencing platform, with an average sequencing depth of 33.85×.

[0036] 2) Data Analysis and Site Screening: Sequencing data from 28 individuals were aligned to the male reference genome using standard procedures such as BWA and GATK for single nucleotide polymorphism (SNP) and insertion / deletion (InDel) variant detection. Details are as follows:

[0037] First, the raw sequencing reads were aligned to the male reference genome using BWA-MEM (v0.7.18) software with default parameters. The resulting SAM files were converted to BAM format, sorted, and indexed using SAMtools (v1.21). Subsequently, the "MarkDuplicates" function in Picard Tools was used to remove PCR repetitive sequences.

[0038] The variant detection employed the best practice workflow of the Genome Analysis Toolkit (GATK v4.1.2.0): First, variants were identified individually for each sample in GVCF mode using the "HaplotypeCaller" tool; then, the GVCF files of all samples were merged using "CombineGVCFs", and finally, joint genotyping was performed using "GenotypeGVCFs" to obtain the set of single nucleotide polymorphisms (SNPs) and insertion / deletion (InDel) variants in the genome of all samples.

[0039] To ensure the reliability of variant detection, the original variant dataset was strictly filtered using the following hard filtering thresholds: QD<2.0, MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, and ReadPosRankSum<-8.0, ultimately obtaining a high-quality variant dataset for subsequent analysis.

[0040] 3) Population genetic differentiation data analysis and locus screening: A genome-wide variation dataset was scanned to identify genomic regions with Fst values ​​significantly higher than the genomic background level in both male and female populations. Functional annotation was performed on these regions, and sex-related regions were further screened. A total of 14,871,656 variation loci were obtained, such as... Figure 1 As shown.

[0041] 4) Genome-wide association analysis (GWAS): Using individual sex (male / female) as a phenotypic trait, genome-wide association analysis is performed on detected variant sites. A mixed linear model (MLM) is used to correct for the influence of population structure, and sites significantly associated with sex phenotypes are screened, such as... Figure 2 As shown.

[0042] 5) Discovery of key sites: Combining Fst analysis and GWAS results, two highly reliable sex-specific SNP sites were identified in a specific genomic fragment. These two sites are only 73 bp apart. Figure 3 As shown. Wherein:

[0043] Locus 1: At this locus, all 14 male individuals exhibited the "T / G" heterozygous genotype, while all 14 female individuals exhibited the "T / T" homozygous genotype. This locus shows a completely differentiated genotype pattern between males and females.

[0044] Locus 2: At this locus, all 14 female individuals exhibited the homozygous "A / A" genotype, while all 14 male individuals exhibited the heterozygous "A / G" genotype. This locus also exhibited strict sexual dimorphism.

[0045] Example 2: PCR-Sanger Sequencing and Validation of Sex-Specific Molecular Markers

[0046] 1) Primer Design: A pair of specific PCR primers was designed and synthesized using Primer-BLAST software for the genomic fragments containing sites 1 and 2 screened in Example 1. The primer sequences are as follows:

[0047] Forward primer (FP): 5'-GCTTCATTTTTCAGCCCCGT-3';

[0048] Reverse primer (RP): 5'-TGTCGTGGGGCTCTTGGTA-3'.

[0049] In theory, the product amplified by this primer pair is 477 bp in length, which can completely cover site 1 and site 2, making it convenient to perform genotyping of both sites simultaneously through a single PCR reaction and sequencing.

[0050] The gene sequence of the male yellowfin tuna-specific DNA fragment is as follows:

[0051] GCTTCATTTTTCAGCCCCGTGGGTTGCCTCTCAGCCTCCCCCTGCTAATTGTTGATTTTTTGATCAATATATTACTTCTGGACAAGTCTGGGAGCACATTAATGCACCTTTTCTCATGAAGGGAGAGATGGTTTGATCAAAAACAGCTGCTGGGATGCAGGAGTAGTTGGCCATCGGGTTCTCCTTCATGTTCTTAAATGATGTAAGCTCCACAATACKAGTGATGACCTCATCATGGAGCGATAAGTCCAGGTACCTCATGATGCGCTCCACTTCACACCGAGGATTCTGRGGGAATAAAAATCTTGTAGGGGTATCCTCAGCAAGCTTTGATAATATTGTATGTAACTGTAGTTAGTGCCCAAATGTTGATCATCATTACCTCTTTCATGTCTTCATAGAAGAGGTAAAGAATGTTCCTCTTCTCTTTCTCCATCCAGTAACCTTTCACATGGTCATACCAAGAGCCCCACGACA (SEQ ID NO.1);

[0052] The gene sequence of the female yellowfin tuna specific DNA fragment is:

[0053] GCTTCATTTTTCAGCCCCGTGGGTTGCCTCTCAGCCTCCCCCTGCTAATTGTTGATTTTTTGATCAATATATTACTTCTGGACAAGTCTGGGAGCACATTAATGCACCTTTTCTCATGAAGGGAGAGATGGTTTGATCAAAAACAGCTGCTGGGATGCAGGAGTAGTTGGCCATCGGGTTCTCCTTCATGTTCTTAAATGATGTAAGCTCCACAATACTAGTGATGACCTCATCATGGAG CGATAAGTCCAGGTACCTCATGATGCGCTCCACTTCACACCGAGGATTCTGAGGGAATAAAAATCTTGTAGGGGTATCCTCAGCAAGCTTTGATAATATTGTATGTAACTGTAGTTAGTGCCCAAATGTTGATCATCATCATTCTTTCATGTCTTCATAGAAGAGGTAAAGAATGTTCCTCTTCTCTTTCTCCATCCAGTAACCTTTCACATGGTCATACCAAGAGCCCCACGACA (SEQ ID NO.2).

[0054] 2) PCR amplification: Eight male and eight female individuals were randomly selected from the yellowfin tuna farmed population, and high-quality genomic DNA was extracted from their fin tissue using a genomic DNA extraction kit (Aikerui Biotechnology, SteadyPure universal genomic DNA extraction kit).

[0055] The PCR reaction system used was 50 μL, which contained: 2 μL DNA template, 25 μL 2×PCR premix enzyme (Premix Taq™), 2 μL each of upstream and downstream primers (10 μM), and 19 μL sterile double-distilled water (ddH2O).

[0056] Run the following program on a thermal cycler: pre-denaturation at 94°C for 1 minute; followed by 35 cycles, each consisting of denaturation at 98°C for 30 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 30 seconds; after the cycle, final extension at 72°C for 5 minutes; and finally storage at 4°C.

[0057] 3) Sanger sequencing and genotyping analysis: The PCR products were analyzed by agarose gel electrophoresis. Once a bright 477bp band was confirmed, [further details are needed]. Figure 4 As shown, the PCR product was purified.

[0058] Using forward and reverse primers as sequencing primers, the purified PCR products were sequenced using the Sanger dideoxy chain termination method. The obtained sequencing peak diagrams were analyzed, with particular attention paid to the sequence results at bases 219 (corresponding to site 1) and 292 (corresponding to site 2) in the amplified fragment. Figure 5 and Figure 6 As shown.

[0059] from Figure 5 and Figure 6 It can be seen from this:

[0060] At position 219 (position 1), the sequencing peaks of all 8 male individuals showed overlapping "T" and "G" peaks at this position, confirming that their genotype was T / G heterozygous; while all 8 female individuals showed clear "T" single peaks at this position, confirming that their genotype was T / T homozygous.

[0061] At position 292 (position 2), the sequencing peaks of all 8 female individuals showed a clear single peak of "A" at this location, confirming that their genotype was A / A homozygous; while all 8 male individuals showed overlapping peaks of "A" and "G" at this location, confirming that their genotype was A / G heterozygous.

[0062] The sequencing results were consistent with the results of the anatomical examination of the gonads, with an accuracy rate of 100%. This verifies that the designed pair of specific primers can achieve the purpose of identifying the sex of yellowfin tuna.

Claims

1. A method for sex determination of yellowfin tuna, characterized in that: Includes the following steps: Genomic DNA of yellowfin tuna was amplified by PCR and detected by agarose gel electrophoresis using sex identification primers. After confirming the amplification of a bright 477bp band, the PCR amplification product was sequenced by Sanger sequencing. The sex identification primer sequence is as follows: Forward primer: 5'-GCTTCATTTTTCAGCCCCGT-3', Reverse primer: 5'-TGTCGTGGGGCTCTTGGTA-3'; The sequence of the PCR amplification fragment is shown in SEQ ID NO.

1. If the genotype at position 219 of the amplified fragment is T / G heterozygous and the genotype at position 292 is A / G heterozygous, then the tested individual is a male yellowfin tuna. If the genotype at position 219 of the amplified fragment is T / T homozygous and the genotype at position 292 is A / A homozygous, then the tested individual is a female yellowfin tuna.

2. The method for sex determination of yellowfin tuna according to claim 1, characterized in that: The PCR amplification reaction system is a 50 μL PCR reaction system, containing: 2 μL DNA template, 25 μL 2×Premix Taq™, 2 μL each of 10 μM forward and reverse primers, and 19 μL ddH2O.

3. The method for sex determination of yellowfin tuna according to claim 2, characterized in that: The PCR amplification conditions were as follows: the following program was run on a thermal cycler: 94°C pre-denaturation for 1 minute; followed by 35 cycles, each cycle consisting of 98°C denaturation for 30 seconds, 55°C annealing for 30 seconds, and 72°C extension for 30 seconds; after the cycle, 72°C final extension for 5 minutes; and finally, storage at 4°C.

4. The application of a yellowfin tuna sex identification primer in the preparation of a yellowfin tuna sex identification detection kit, characterized in that: The sex identification primer sequence is as follows: Forward primer: 5'-GCTTCATTTTTCAGCCCCGT-3', Reverse primer: 5'-TGTCGTGGGGCTCTTGGTA-3'; The sequence of the amplified fragment of the sex identification primer is shown in SEQ ID NO.

1. When the genotype at position 219 of the amplified fragment is T / G heterozygous and the genotype at position 292 is A / G heterozygous, the tested individual is a male yellowfin tuna; When the genotype at position 219 of the amplified fragment is T / T homozygous and the genotype at position 292 is A / A homozygous, the tested individual is a female yellowfin tuna.

5. The application of a yellowfin tuna sex identification primer in yellowfin tuna breeding, characterized in that: The sex identification primer sequence is as follows: Forward primer: 5'-GCTTCATTTTTCAGCCCCGT-3', Reverse primer: 5'-TGTCGTGGGGCTCTTGGTA-3'; The sequence of the amplified fragment of the sex identification primer is shown in SEQ ID NO.

1. When the genotype at position 219 of the amplified fragment is T / G heterozygous and the genotype at position 292 is A / G heterozygous, the tested individual is a male yellowfin tuna; When the genotype at position 219 of the amplified fragment is T / T homozygous and the genotype at position 292 is A / A homozygous, the tested individual is a female yellowfin tuna; The breeding refers to achieving single-sex culture or controlling the number of parent fish of the target sex during the seedling or juvenile stage.

Images