SNP (Single Nucleotide Polymorphism) molecular marker related to grass carp feed utilization rate and application of SNP molecular marker
By screening for the SNP site at chromosome 51653399 of grass carp, primers were designed for PCR amplification to detect the individual genotype of grass carp. This solved the problems of long breeding cycle and low breeding efficiency of grass carp, and achieved high-efficiency breeding and high feed utilization of grass carp.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-10
- Publication Date
- 2026-04-07
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Grass carp have a long breeding cycle and low breeding efficiency, making it difficult to effectively improve feed utilization and affecting aquaculture benefits.
The SNP locus (G/T) at chromosome 51653399 of grass carp was screened through genome-wide association analysis, and primers were designed for PCR amplification to detect the genotype of grass carp individuals. Individuals with the GG genotype were selected for breeding to improve feed utilization.
It significantly shortens breeding time, improves breeding efficiency, reduces breeding costs, and enhances grass carp production performance and aquaculture profits.
Smart Images

Figure CN121802071A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of aquatic animal molecular markers and aquatic genetic breeding, and relates to a SNP molecular marker related to feed utilization rate of "Husu No. 1" grass carp and application thereof. BACKGROUND
[0002] Grass carp (Ctenopharyngodon idella) is a dominant economic fish in freshwater aquaculture in China, and genetic improvement of its growth traits is of great significance to improving the efficiency of aquaculture. However, the grass carp takes 4 to 5 years to mature, resulting in a very long breeding cycle and low breeding efficiency, which seriously restricts the development of grass carp seed industry. With the progress of molecular biology, molecular marker-assisted selection has been developed and gradually matured in breeding work; compared with traditional breeding techniques, molecular marker-assisted selection is less affected by environmental factors, has a short generation interval, and has high breeding accuracy, greatly accelerating the breeding process and improving the breeding efficiency. On this basis, thanks to the rapid development of high-throughput sequencing technology and the completion of resequencing of related genes of aquatic animals, a genome-wide association study (GWAS) method using single nucleotide polymorphism (SNP) as a molecular marker to screen SNPs related to the variation of target phenotypic traits in the whole genome has been increasingly applied to genetic breeding of aquatic animals, and has achieved a series of remarkable results.
[0003] As one of the important growth traits of grass carp, feed conversion ratio (FCR) reflects the efficiency of grass carp in utilizing nutrients in feed to maintain metabolism, promote muscle growth and fat deposition, and it is directly related to the cost of feed for breeding and is the key to whether an enterprise can make a profit. Improving the feed efficiency of grass carp is of great significance to the overall progress of the aquaculture industry. Therefore, screening SNP sites related to feed conversion ratio is beneficial to providing a theoretical basis and reference for subsequent grass carp breeding work.
[0004] Therefore, it is an urgent problem for those skilled in the art to provide a SNP molecular marker related to feed utilization rate of grass carp and application thereof. SUMMARY
[0005] The present application aims to provide a SNP molecular marker related to feed utilization rate of grass carp and application thereof. The DNA of 78 grass carp "Husu No. 1" collected is genotyped, and a GWAS method is used to further screen SNP sites significantly related to the feed utilization rate of grass carp, thereby successfully providing a new molecular marker for selection of the feed utilization rate of grass carp "Husu No. 1".
[0006] The specific technical solutions of the present application are as follows:
[0007] In a first aspect, the present application provides a SNP molecular marker related to feed utilization rate of grass carp. The present application determines and records the feed utilization rate of 78 grass carp "Husu No. 1", sequences the collected DNA and performs genotype quality control processing, then performs GWAS analysis on the remaining 6660311 markers and 78 individuals, screens out SNP sites significantly related to the feed utilization efficiency of grass carp, and finally obtains one significant SNP site according to the reference genome of grass carp, which is located at position 51653399 of the second chromosome of grass carp (abbreviated as Chr02: 51653399), and the polymorphic base is G / T.
[0008] Further, the nucleotide sequence containing the SNP marker is shown as SEQ ID NO: 3, and the SNP marker is located at position 201 of the sequence.
[0009] In a second aspect, the present application provides a primer for detecting the SNP molecular marker, and the primer sequence is as follows:
[0010] Forward primer: 5'-CCCAAGAATTACTCAGTTACTC-3' (SEQ ID NO: 1);
[0011] Reverse primer: 5'- CCACAGCCATCCATCATAA-3 (SEQ ID NO: 2).
[0012] In a third aspect, the present application provides a kit, which comprises the primers with sequences shown as SEQ ID NO: 1-2.
[0013] In a fourth aspect, the present application provides the application of the SNP molecular marker, primer or kit in the selection of grass carp with high feed utilization rate.
[0014] Further, individuals with genotype GG at Chr02: 51653399 site are selected for breeding, and the feed utilization rate of the strain with genotype GG is high.
[0015] Further, the breed of the grass carp is "Husu No. 1".
[0016] In a fourth aspect, the present application provides the application of the SNP molecular marker, primer or kit in the genetic breeding of grass carp.
[0017] In a fifth aspect, the present application provides a method for improving grass carp breed, which comprises the following steps: detecting the SNP molecular marker on the chromosome 2 of grass carp, and selecting the individual with genotype GG for breeding (the grass carp with this genotype has high feed utilization rate), so as to reduce the feed consumption of the offspring grass carp in the production process.
[0018] Further, the method for improving grass carp breed comprises the following steps:
[0019] Step one, extracting the fin DNA of the individual grass carp to be detected;
[0020] Step two, using the genomic DNA in step one as a template, and performing PCR amplification by using the primer with the sequence shown in SEQ ID NO: 1-2;
[0021] Step three, sequencing the amplification product obtained in step two, determining the genotype of the SNP molecular marker Chr02: 51653399 site of the individual grass carp to be detected, selecting the individual with genotype GG for breeding, and obtaining the grass carp strain with higher feed utilization rate.
[0022] Compared with the prior art, the present application has the following beneficial effects:
[0023] The present application provides a SNP molecular marker related to the feed utilization rate of grass carp "Husu No. 1" and the application thereof. After the DNA of 78 "Husu No. 1" grass carps collected by the present application is sequenced and subjected to genotype quality control treatment, a SNP site significantly related to the feed utilization rate of grass carp is identified through whole genome association analysis, which is located at the 51653399th nucleotide site on the chromosome 2. When the genotype of the site is GG, the grass carp has a higher feed utilization rate.
[0024] The SNP molecular marker of the present application can be used for early breeding of grass carp with high feed utilization rate, greatly reducing the breeding workload, significantly shortening the breeding time, accelerating the breeding process, improving the breeding efficiency, and reducing the breeding cost. It has important guiding significance for improving the production performance of grass carp, reducing the breeding cost of grass carp and increasing the breeding income, and is suitable for popularization and application. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1 Figure 2 is the distribution of the feed utilization rate phenotype of the experimental population of grass carp "Husu No. 1". The abscissa is the phenotype value of the experimental population.
[0026] Figure 2 Figure 3 is the Manhattan plot of the whole genome association analysis of the feed utilization rate trait. The present application selects one SNP located at Chr02: 51653399 with a smaller P value on the threshold line for further analysis.
[0027] Figure 3 Q-Qplot figure for the whole genome association analysis of feed utilization trait.
[0028] Figure 4 Figure of statistical results of feed utilization (FCR) of grass carp carrying different genotypes of SNP Chr02:51653399 G>T. 4A is the screening result of whole genome high-throughput sequencing in Example 1, and 4B is the verification result of first-generation sequencing in Example 2. The vertical coordinate in the figure is the phenotypic value of FCR, and the horizontal coordinate is the three genotypes GG, GT and TT. DETAILED DESCRIPTION
[0029] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application.
[0030] Example 1: Screening of SNP molecular markers related to the feed utilization trait of grass carp
[0031] 1. Sample collection
[0032] The grass carps used in the present study were collected from the National Four Major Carp Breeding Farms in Wujiang, Jiangsu Province, China. 78 healthy individuals of "Husu No. 1" grass carps were selected. At the beginning and end of the experiment, the experimental fish were starved for 24 h, and the fish body weight was measured. The food intake was calculated and the feed utilization was calculated, according to the following formula:
[0033] Feed utilization (%) = weight of ingested feed / (fish body weight at the end of the experiment - fish body weight at the beginning of the experiment) x 100%. Figure 1 The distribution of the feed utilization phenotype of the experimental population of "Husu No. 1" grass carps is shown.
[0034] The tail fin tissue of the experimental fish was also collected for extraction of genomic DNA.
[0035] 2. Extraction of genomic DNA
[0036] The magnetic bead method was used for DNA extraction. The concentration of the DNA sample was detected by Qubit fluorescence quantification instrument, and the integrity of the DNA sample was detected by 1% agarose gel electrophoresis.
[0037] 3. SNP quality control and population structure analysis
[0038] The raw high-throughput sequencing data were processed using quality control and filtering. Thresholds were set using PLINK software, including a deletion rate > 0.1, minor allele frequency (MAF) < 0.05, recall rate < 0.1, and Hardy-Weinberg precision (HWE) < 1e-6, to remove low-quality SNPs from the raw data. Ultimately, 6,660,311 high-quality SNP loci were obtained for subsequent analysis.
[0039] Before starting the genome-wide association analysis, to avoid the influence of population structure, principal component analysis (PCA) was performed on the quality-controlled data using PLINK software, and the data was visualized using the R package ggplot2. The phylogenetic tree was constructed using raxml-ng software and visualized using the website (https: / / itol.embl.de).
[0040] 4. Genome-wide association analysis of feed utilization trait
[0041] Genome-wide association analysis (GWA) was performed using rMVP software based on the General Linear Model (GLM) method for the feed utilization trait of 78 individuals, taking into full account population structure and inter-individual phylogenetic relationships. The statistical model is as follows:
[0042] y = Xα + Zβ + e
[0043] In the formula, y represents the phenotypic trait; Xα is the population structure, which is a fixed effect; Zβ is the marking effect; and e is the residual.
[0044] Bonferroni correction (Bonferroni 1936) was used to determine the significance threshold for the whole genome. The calculation formula was p = 0.05 / N, where N represents the total markers used for association analysis. QQ plots and Manhattan plots were drawn using the CMplot package in R. Phenotypic variance interpretation (PVE) and F-values were calculated using rMVP software.
[0045] 5. Results Analysis
[0046] After PLINK quality control washing, 6,660,311 SNP loci were obtained from 78 grass carp individuals for further GWAS analysis. The Bonferroni-corrected threshold for genome-wide significant SNP markers was set at P = 0.05 / 6660311 = 7.51 × 10⁻⁶. -9 The GWAS results for grass carp feed utilization traits are as follows: Figure 2As shown: A single SNP locus, Chr02:51653399 G>T, was detected on chromosome 2, which was most strongly associated with the grass carp feed utilization trait (P< 0.001). Figure 3 The QQ graph shows that the GWAS analysis performed was of good quality.
[0047] In this example, 78 grass carp carrying SNP Chr02: 51653399 G>T had feed utilization rates of individuals with different genotypes as follows: Figure 4 As shown in Figure A, there were significant differences in the average feed utilization of grass carp among the three genotypes at the SNP Chr02:51653399 G>T locus. Among them, the average feed utilization of grass carp carrying the GG genotype was significantly higher than that of individuals carrying the GT and TT genotypes.
[0048] Example 2: Validation of SNP molecular markers related to feed utilization trait in grass carp
[0049] The validation experiment used different grass carp populations, randomly selecting 50 experimental fish. Feed utilization traits of each fish were measured and recorded, and caudal fin samples were collected and preserved from each fish for DNA extraction. The specific DNA extraction procedure was the same as in Example 1. Subsequently, using the extracted DNA as a template, PCR amplification was performed using SEQ ID NO:1 and SEQ ID NO:2 as primers to obtain a gene fragment containing SNP Chr02:51653399 G>T (i.e., a molecular marker sequence, such as SEQ ID NO:3). Among them:
[0050] The sequences of the upstream and downstream primer pairs for SNP Chr02:51653399 are as follows:
[0051] Forward primer: 5'-CCCAAGAATTACTCAGTTACTC-3' (SEQ ID NO: 1);
[0052] Reverse primer: 5'-CCCACAGCCATCCATCATAA-3' (SEQ ID NO: 2);
[0053] The molecular marker sequence is shown in SEQ ID NO:3. SNP Chr02:51653399 G>T is located at position 201 of the gene fragment SEQ ID NO:3, and the mutation type is G / T.
[0054] SEQ ID NO:3 (where the underlined single base in the middle indicates the mutation site, and the underlines on both sides indicate the positions of the upstream and downstream primers):
[0055] ATGTTTGAAGTAAAGCGACATATTAGAGAAAATCCTATGTGTCTGTATATTGGATCAGTGCATTAGTTCTTAAAGAATTGGTTCCATTTAAAATGAAAATTA CCCCAAGAATTACTCAGTTACT CAACGTCAGTTACGCTTTTTCCGTAATGCTGAATACAGAAGATGTAGAACGTAGCGAAGTGTTTTCAACTGCGAGA G GCGTTAAACTTCCTTCATAAGTTGAATACTTAAGGTGGTCTGGCAGAAGCTAGATATTTTACTTCATAACTTGTTAAATATGATTTTTTTTTTTTTTTTTTTTTTTTTTTTTAACACAAACGCATAGTTTCGCTTCAGAAGGCCTTTATTATGTGGAGTATGT TTATGATGGATG GCTGTGG ATGGAAGAACTTTCTTC
[0056] The PCR amplification reaction system, in 20 μl increments, consisted of: 1 μl of 100 ng / μl template DNA, 0.5 μl each of 10 pmol / μl forward and reverse primers, 10 μl of Taq Mix, and the remainder being double-distilled water. The reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 55℃ or 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 30-35 cycles; and incubation at 72℃ for 7 min.
[0057] The amplified products were sequenced using first-generation sequencing to obtain the genotype of each individual, and the feed utilization rate data of individuals with different genotypes were statistically analyzed. Figure 4 B presents the results of experimental verification of SNP Chr02:51653399. Figure 4 B indicates that there are significant differences in feed utilization among individuals with different genotypes of grass carp SNP Chr02: 51653399; among them, individuals carrying the GG genotype have a higher feed utilization rate than individuals carrying the GT and TT genotypes. (Compared to Example 1) Figure 4 Result A is consistent.
[0058] In summary, this invention successfully screened a SNP marker (SNPChr02: 51653399) that is significantly associated with the feed utilization rate trait of grass carp. Its genotype can be determined by a pair of primers, which is simple and reliable. This SNP site has promising applications in molecular marker-assisted breeding and genome selection breeding of grass carp.
[0059] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A SNP molecular marker associated with grass carp feed utilization rate, characterized in that, The SNP molecular marker is located at position 51653399 on chromosome 2 of grass carp, and the polymorphic base is G / T.
2. The SNP molecular marker related to grass carp feed utilization as described in claim 1, characterized in that, The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID NO.3; the SNP molecular marker is located at position 201 of the nucleotide sequence shown in SEQ ID NO.
3.
3. A primer for detecting the SNP molecular marker of claim 1 or 2, characterized in that, The primer sequences are as follows: Forward primer: 5'-CCCAAGAATTACTCAGTTACTC-3'; Reverse primer: 5'-CCCACAGCCATCCATCATAA-3'.
4. A reagent kit, characterized in that, Includes the primers described in claim 3.
5. The application of the SNP molecular marker of claim 1 or 2, the primer of claim 3, or the kit of claim 4 in the breeding of grass carp with high feed utilization.
6. The application according to claim 5, characterized in that, Individuals with the genotype GG at the SNP molecular marker Chr02:51653399 locus were selected for breeding, as strains with the genotype GG have high feed utilization rates.
7. The application according to claim 5, characterized in that, The grass carp in question is of the variety "Hu-Su No. 1".
8. The application of the SNP molecular marker of claim 1 or 2, the primer of claim 3, or the kit of claim 4 in the genetic breeding of grass carp.
9. A method for improving grass carp varieties, characterized in that, The method involves detecting the SNP molecular markers as described in claim 1 or 2 on chromosome 2 of grass carp, and selecting individuals with the genotype GG for breeding.
10. The method for improving grass carp varieties according to claim 9, characterized in that, Includes the following steps: Step 1: Extract DNA from the fin rays of the grass carp to be tested; Step 2: Using the genomic DNA from Step 1 as a template, perform PCR amplification using the primers described in claim 3; Step 3: Sequencing the amplification products obtained in Step 2 to determine the genotype of the SNP molecular marker Chr02:51653399 locus in the grass carp individuals to be tested. Individuals with the genotype GG are selected for breeding to obtain grass carp strains with higher feed utilization.