Camellia oleifera baht acyltransferase and application thereof

Abstract

This invention discloses a BAHD acyltransferase from Camellia oleifera and its applications. It relates to the field of enzyme engineering technology. The amino acid and nucleotide sequences of the BAHD acyltransferase are provided, along with related applications. This invention provides an enzyme with acyl transfer function from Camellia oleifera, which can be directly used as a catalyst for the acylation reaction of C-22 saponins in Camellia oleifera. Furthermore, this enzyme exhibits strong stability and activity, and its preparation method is simple and efficient, making it suitable for use in the biosynthesis of secondary metabolites.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and more specifically to a BAHD acyltransferase in Camellia oleifera and its application. Background Technology

[0002] Camellia oleifera Abel., a plant belonging to the genus Camellia in the family Theaceae, is a woody oilseed tree species endemic to my country. The camellia oil cake left after oil extraction contains various active ingredients, such as flavonoids, triterpenoid saponins, and lignans. Among these, the triterpenoid saponins are considered of significant research value due to their pharmacological activities, including antitumor, cardiovascular protection, and antibacterial and anti-inflammatory effects. Most of the triterpenoid saponins with anticancer activity are acylated products. Specifically, the anticancer activity of camellia triterpenoid saponins is significantly enhanced after the C-22 group is acylated with angelic acid. In the process of angelic acid acylation of the C-22 group of camellia triterpenoid saponins, the acyl donor is Ang-CoA, and the enzyme involved in this reaction is BAHD acyltransferase. Since no BAHD acyltransferases involved in this process have been reported in Camellia oleifera, and research on BAHD acyltransferases in Camellia oleifera is relatively rare, this study fills a previous gap.

[0003] Therefore, providing a BAHD acyltransferase for camellia oil and its application is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0004] In view of this, the present invention provides a BAHD acyltransferase from Camellia oleifera and its application. The present invention involves screening the gene encoding this protease, constructing an expression vector through gene cloning and homologous recombination, and optimizing the conditions for protein expression induction using a prokaryotic expression system to select the most suitable environment for protein expression. Finally, the properties of the products in the enzymatic reaction are confirmed through in vitro enzymatic reactions and related detections.

[0005] Preservation Information: Escherichia coli ZKUN1 is deposited at the China Center for Type Culture Collection, Wuhan University, Wuhan, China; deposit date: April 27, 2026; accession number: CCTCCNO: M 2026811.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A BAHD acyltransferase from Camellia oleifera, the amino acid sequence of which is shown in SEQ ID No. 2.

[0008] Preferred: The nucleotide sequence of the enzyme encoding gene is shown in SEQ ID No. 1.

[0009] The present invention also provides a recombinant expression vector comprising the above-described coding gene.

[0010] The present invention also provides an engineered bacterium comprising the above-described recombinant expression vector.

[0011] This invention also provides a method for preparing BAHD acyltransferase from the above-mentioned Camellia oleifera, comprising the following steps:

[0012] (1) Construct the recombinant expression vector as described in claim 3;

[0013] (2) Transform the recombinant expression vector into competent cells to obtain engineered bacteria;

[0014] (3) Cultivating engineered bacteria and inducing expression: The engineered bacteria were amplified, and IPTG inducer was added to induce expression;

[0015] (4) Separation and purification: Collect bacterial cells, sonicate them, and purify them to obtain the target protein.

[0016] Preferred: Step (3) specifically involves: amplifying the engineered bacteria at 37°C until the OD600 is 0.6, adding 0.75 mM IPTG inducer, and inducing expression at 24°C for 8 hours.

[0017] The present invention also provides the application of the above-mentioned BAHD acyltransferase in Camellia oleifera, the above-mentioned encoding gene, the above-mentioned recombinant expression vector, or the above-mentioned engineered bacteria in the synthesis of Camellia oleifera saponin B1 intermediate.

[0018] The present invention also provides a method for in vitro enzymatic synthesis of camellia saponin B1 intermediate, comprising: using the above-mentioned BAHD acyltransferase as a catalyst, reacting camellia saponin aglycone and angelic acyl-CoA in a buffer system at pH 8.0 at 30°C for more than 12 hours to synthesize camellia saponin B1 intermediate.

[0019] As can be seen from the above technical solution, compared with the prior art, the present invention discloses a BAHD acyltransferase in Camellia oleifera and its application. The technical effect achieved is that the present invention provides an enzyme with acyl transfer function in Camellia oleifera, which can be directly used as a catalyst for the acylation reaction of C-22 saponin in Camellia oleifera. At the same time, the enzyme has strong stability and strong activity, and the preparation method is simple and efficient, making it applicable to the field of secondary metabolite biosynthesis.

[0020] Specifically:

[0021] 1. From the whole genome data of Camellia oleifera, a total of 158 BAHD acyltransferase family genes were screened, including 26 BAHD acyltransferase homologs with functional potential. These 26 homologs all carry the characteristic conserved motifs of the BAHD family, HXXXD and DFGWG, and possess the typical functional domains of BAHD acyltransferases. Analysis of the expression patterns of candidate genes in different tissue sites revealed that the Co07g1891.11 gene is a candidate gene for BAHD acyltransferase specifically expressed in Camellia oleifera seed kernel tissue; this invention names it CoBAHD1.

[0022] 2. Using Camellia oleifera seed kernels as material, the CoBAHD1 target gene was successfully cloned. Homology modeling analysis of its encoded protein was then performed. The protein's tertiary structure prediction results showed high structural reliability, and Laplace plot analysis also confirmed the good modeling quality. Based on this, the corresponding recombinant expression vector, CoBAHD1-4T1, was successfully constructed using homologous recombination.

[0023] 3. The Escherichia coli expression system was used to carry out heterologous expression experiments of the target protein. The optimal induction expression parameters of the target gene were finally obtained through condition optimization and screening: induction temperature 24℃, final concentration of IPTG inducer 0.75 mM, and induction time 28 h.

[0024] 4. The catalytic activity of the target protein was determined by in vitro enzymatic reaction. At the same time, a product detection method by high performance liquid chromatography (HPLC) and high performance liquid chromatography-mass spectrometry (LC-MS) was successfully established. The final HPLC and LC-MS detection results confirmed that the target product, tea saponin B1 intermediate, was successfully synthesized by using the recombinant enzyme provided by this invention as a catalyst to carry out the acylation reaction of tea saponin C-22. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0026] Figure 1 The attached figure is a sequence alignment diagram of the CoBAHD1 amino acid sequence provided by this invention.

[0027] Figure 2 The attached figure is a map of the CoBAHD1-4T1 recombinant plasmid provided by the present invention.

[0028] Figure 3 The attached figure shows the spectrum of the expression vector pGEX-4T-1 provided by the present invention.

[0029] Figure 4 The attached figure shows the optimization of protein induction conditions for the engineered strain provided by the present invention, wherein A: screening for optimal induction temperature; B: screening for optimal inducer concentration; and C: screening for optimal induction time.

[0030] Figure 5 The attached figure shows the SDS-PAGE image of the purified target protein provided by the present invention. M: protein label; a: bacterial supernatant before induction; b: bacterial supernatant before ultrasonic disruption; c: bacterial supernatant after ultrasonic disruption; dg: purified protein sample.

[0031] Figure 6 The attached figure shows the synthetic activity of CoBAHD1 acyltransferase provided by the present invention. A: HPLC chromatogram (1: Angelica acyl donor Ang-CoA, 2: Camellia oleifera saponin TS, 3: Camellia oleifera saponin B1 intermediate); B: Mass spectrum of product peaks; C: Schematic diagram of CoBAHD1 catalytic activity. Detailed Implementation

[0032] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] This invention discloses a BAHD acyltransferase in Camellia oleifera and its application.

[0034] In the embodiments, raw materials not mentioned are all conventional or commercially available materials, and methods not mentioned are conventional experimental methods, which will not be described in detail here.

[0035] Example 1

[0036] CoBAHD1 gene cloning

[0037] RNA extraction:

[0038] RNA was extracted from different tissues of Camellia oleifera using liquid nitrogen grinding, and the steps are as follows:

[0039] (1) Place freshly collected or frozen Camellia oleifera tissue materials at -70°C in a liquid nitrogen environment and grind them thoroughly until they form a fine and uniform powder.

[0040] (2) Accurately weigh 100 mg-200 mg of finely ground powder and quickly transfer it to a preheated centrifuge tube containing lysis buffer CLB with added β-mercaptoethanol. Immediately mix thoroughly by vigorous shaking for 60 s or by repeatedly blowing with a pipette tip to completely lyse the material and form a homogenate. During this process, the lysis buffer can play a role in shearing DNA, reducing the viscosity of the system and increasing the yield of RNA extraction.

[0041] (3) Place the centrifuge tube back into a 65°C water bath and continue heating for 5-10 minutes, inverting it 1-2 times during the process to promote complete lysis;

[0042] (4) After the lysis step is completed, centrifuge the centrifuge tube containing the lysate at 13,000 rpm for 10 min;

[0043] (5) Take out the supernatant and add 1 / 2 volume of anhydrous ethanol to the supernatant. The precipitate that appears at this time should be immediately blown and mixed, and centrifugation is not required.

[0044] (6) Transfer the mixture in batches (each batch not exceeding 720 μL; if the volume is too large, it can be added in two batches) to the genome clearance column. Place the clearance column into the matching collection tube, centrifuge at 13,000 rpm for 2 min at room temperature, and then pour the waste liquid in the collection tube into the waste liquid bucket.

[0045] (7) Add 500 μL of lysis buffer (RLTPlus), centrifuge at 13,000 rpm for 30 s, add 1 / 2 volume of anhydrous ethanol to the filtrate, and immediately mix the precipitate by blowing and blowing. Do not centrifuge.

[0046] (8) Add the mixture to the RA adsorption column in batches (place the adsorption column in the collection tube), centrifuge at 13,000 rpm for 2 min, and discard the effluent in the collection tube;

[0047] (9) Slowly add 700 μL of protein removal solution RW1 to the RA adsorption column, let it stand at room temperature for 1 min to fully wet the column matrix, centrifuge at 13,000 rpm for 30 s, and discard the eluent;

[0048] (10) Add 500 μL of washing buffer RW (containing anhydrous ethanol) to the RA adsorption column, centrifuge at 13,000 rpm for 30s and discard the waste liquid. Repeat this washing buffer addition and centrifugation step once.

[0049] (11) After the rinsing step, the RA adsorption column was placed back into an empty collection tube. Then it was centrifuged at 13,000 rpm for 2 min to completely remove the residual RW components in the column and prevent ethanol residue from interfering with subsequent enzymatic or amplification reactions;

[0050] (12) Take an RNase-free centrifuge tube and transfer the adsorption column into it. Then, add 40 μL of RNase-free water preheated to 85°C to the adsorption membrane in the center of the column bed (preheating helps to improve the elution efficiency of RNA), let stand for 1 min, and then centrifuge at 12,000 rpm for 1 min;

[0051] (13) Measure the RNA concentration. If the yield exceeds 30 μg, add 40 μL of RNase-free water again to elute.

[0052] RNA is reverse transcribed into cDNA:

[0053] cDNA was generated using a reverse transcription kit (Full Gold), as shown in Table 1:

[0054]

[0055] The reaction procedure was as follows: 42℃ for 30 min, 85℃ for 5 s, and stored at 12℃.

[0056]

[0057] Table 2 CoBAHD1 gene cloning reaction system

[0058] reagents Volume (20 μL) cDNA 10 μL aaccgaccttggaatagtcac, as shown in SEQ ID No. 3; 0.4 μL aacagaccaaaacagagggct, as shown in SEQ ID No. 4; 0.4 μL 2 × Phanta Max Master Mix 9.2 μL

[0059] Among them, the primers aaccgaccttggaatagtcac and aacagaccaaaacagagggct are designed to be located in the uncoding regions (UTRs) at both ends of the gene, and can encode the full-length gene.

[0060] The reaction procedure was as follows: pre-denaturation at 95℃ for 3 min, denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, extension at 72℃ for 2:30 min, final extension at 72℃ for 5 min, storage at 12℃, infinity.

[0061] PCR products were detected by 1% agarose gel electrophoresis;

[0062] After PCR products were subjected to agarose gel electrophoresis, the target gene bands were detected in a gel imaging system, and the gel was recovered using the GeneJET gel recovery kit.

[0063] Example 2

[0064] Construction of engineered bacteria

[0065] The ligation vector pClone007 Versatile Simple Vector was purchased from Qingke Biotechnology Co., Ltd., and the ligation system is shown in Table 3.

[0066]

[0067] The above ligation system was placed in a PCR instrument or metal bath at 25°C for 10 min (if the fragment is large, the ligation time can be extended to 20 min to improve ligation efficiency). After the reaction, the cloning vector was transformed into E. coli DH5α competent cells:

[0068] (1) Remove the frozen competent cells from -80℃ and thaw them slowly on ice. Under aseptic conditions, aspirate 33 μL of competent cells, add 10 μL of ligation product, gently pipette to mix 5-8 times, and then place on ice for 25 minutes.

[0069] (2) Place the centrifuge tube in a 42°C water bath for 50 seconds to heat shock, and then quickly transfer it to an ice bath and let it stand for 2 minutes (avoid shaking during this period to prevent a decrease in conversion efficiency).

[0070] (3) Add 700 μL of LB liquid medium to the centrifuge tube and incubate at 37°C and 200 rpm for 1 h. After incubation, centrifuge at 4000 rpm for 10 min and discard the supernatant.

[0071] (4) Resuspend the remaining culture medium and bacterial cells at the bottom of the tube by pipetting. Take 100 μL and spread it on an LB agar plate, and incubate at 37°C for 12-16 h.

[0072] The bacterial culture PCR identification method is as follows: A single colony in good growth condition is picked using a pipette tip and inoculated into 1 mL of LB liquid medium containing Amp. The culture is then incubated at 37℃ and 200 rpm until the logarithmic growth phase (approximately 6 h). 1 μL of the bacterial culture is used as a PCR template, and the universal primers M13F(R) are used for bacterial amplification and identification.

[0073] The PCR reaction system is shown in Table 4:

[0074]

[0075] The reaction procedure was as follows: pre-denaturation at 98℃ for 1 min; denaturation at 98℃ for 10 s, annealing at 60℃ for 10 s, extension at 72℃ for 20 s, repeated 35 times; final extension at 72℃ for 2 min; and storage at 12℃.

[0076] Agarose gel electrophoresis was used to detect the bands. Positive clones containing the target band were preserved and sent to the company for sequencing. The sequencing results were compared with the Camellia oleifera genome screening results; sequences matching the comparison were used for subsequent experiments (see appendix). Figure 1 After successful sequencing, primers for the CoBAHD1-4T1 expression vector were designed (see attached). Figure 2 Using the above-mentioned positive bacterial strains as templates, clone the target gene fragment and perform PCR according to the reaction conditions in Table 5:

[0077] Primer sequences (5'-3'): Forward primer F: gatctggttccgcgtggatccatggaagttaaactcatttccaaaga, as shown in SEQ ID No. 5;

[0078] Reverse primer R: ctcgagtcgacccgggaattcctaggatagaattataggtgggttcatg, as shown in SEQ ID No. 6;

[0079] Among them, both F and R primers contain a sequence of pGEX-4T-1 and a segment of the target gene, with gatctggttccgcgtggatcc and ctcgagtcgacccgggaattc corresponding to pGEX-4T-1;

[0080]

[0081] Place the sample in a PCR instrument and run the following reaction program: pre-denaturation at 94 ℃ for 5 min; 35 cycles: 94 ℃ for 30 s, 66 ℃ for 30 s, 72 ℃ for 2 min; final extension at 72 ℃ for 7 min; store at 12 ℃.

[0082] Double-digested expression vector pGEX-4T-1 (see appendix) Figure 3 To linearize it, the enzyme digestion system is shown in Table 6:

[0083]

[0084] Enzyme digestion at 37 ℃ for 1 h, followed by agarose gel electrophoresis of the PCR product and linearized vector. After confirming the target band, the gel was recovered (using a gel recovery kit).

[0085] The CoBAHD1-4T1 recombinant vector was constructed using homologous recombinase. The ligation system was incubated at 37 °C for 30 min. The ligation system of the recombinant vector is shown in Table 7.

[0086]

[0087] The reaction was carried out at 37 ℃ for 30 min, and immediately cooled on ice after the reaction to obtain a recombinant vector containing the target fragment. After cooling the recombinant product on ice, E. coli competent cells were transformed, and single clones were selected for bacterial culture by plate culture. Positive clones were detected by CoBAHD1-4T1 PCR. Plasmids were extracted from the bacterial culture containing the target band, and the concentration was determined.

[0088] Transformed Escherichia coli expression strain Rosetta(DE3) competent cells (using the same method as transforming Escherichia coli clone strain DH 5α competent cells) and preserved using patent procedures.

[0089] Plasmids were extracted from positive clone strains.

[0090] Plasmids were extracted from the bacterial culture using the Tiangen plasmid extraction kit.

[0091] Example 3

[0092] Protein expression induction and optimization of induction conditions (see appendix) Figure 4 )

[0093] The steps for inducing protein expression are as follows:

[0094] (1) Pick morphologically regular single colonies from Amp-resistant LB plates and inoculate them into 1 mL of LB liquid medium containing Amp. Shake overnight at 37°C and 200 rpm.

[0095] (2) Take 20 μL of overnight bacteria and transfer it to 6 mL of LB liquid medium containing Amp. Continue to shake the bacteria at 37°C and 200 rpm.

[0096] (3) Take 6 mL of bacterial culture and transfer it to 200 mL of antibiotic-free LB liquid medium. Shake at 37°C and 200 rpm until OD is reached. 600 The value was 0.6, and 1 mL of bacterial culture was taken as a control before induction;

[0097] (4) Add IPTG to a final concentration of 0.75 mM and induce at 24℃ and 200 rpm for 28 h; record OD after induction. 600 Take 1 mL of bacterial culture as a control after induction;

[0098] (5) Centrifuge at 4℃ and 8,000 rpm for 10 min to collect the bacteria. Wash the bacteria once with 20 mL of pre-cooled 50 mM PBS (pH 7.3). Centrifuge again and discard the supernatant. Resuspend the bacteria in pre-cooled 1×PBS until the OD600 is 15. Sonicate on ice to disrupt the bacteria: sonicate for 5 s, stop for 5 s, power 50%, total duration 20-30 min.

[0099] (6) After the ultrasound is completed, centrifuge at 4℃ and 12,000 rpm for 10 min and discard the precipitate.

[0100] Samples before induction, after induction, and after sonication were subjected to SDS-PAGE electrophoresis.

[0101] After protein electrophoresis, the bands were observed using Coomassie brilliant blue staining.

[0102] Experimental conclusion: The optimal induction time for the Escherichia coli expression system is an induction temperature of 24 ℃, an IPTG concentration of 0.75 mM, and an induction time of 28 h.

[0103] Example 4

[0104] Protein purification (see appendix) Figure 5 )

[0105] The target protein was purified using the GST fusion protein purification kit, and the steps are as follows:

[0106] (1) Washing medium: Load the lower sieve plate and medium into the gravity column in sequence, rinse with ultrapure water, add 6 mL of well mixed GST protein purification medium, and wash the high affinity GST purification medium with 10 column volumes of cold 1×PBS (4°C).

[0107] (2) Incubation: After sonication, the sample was centrifuged at 12,000 rpm for 10 min. The supernatant was filtered through a 45 μm filter membrane and then placed into a 50 mL centrifuge tube. The washed medium was added to the centrifuge tube and incubated overnight at 4°C and 45 rpm on a shaker.

[0108] (3) Gravity column loading: The mixture of protein solution incubated overnight and purification medium is loaded into a pre-prepared gravity column, and the upper sieve plate is loaded into the top of the gravity column to fix the medium.

[0109] (4) Flow-through: The protein solution is allowed to flow out of the gravity column by gravity, and the flow-through liquid is collected. After the first flow-through is completed, the flow-through liquid is put back into the gravity column for flow-through. The operation is repeated three times to facilitate better binding between the target protein and the medium.

[0110] (5) Washing: After the flow-through solution has completely drained, immediately add about 20 column volumes of 1×PBS buffer to wash the chromatography column.

[0111] (6) Elution: Take 10-15 column volumes of 10 mM glutathione elution buffer to elute the target fusion protein. The elution buffer should be prepared and used immediately to ensure elution efficiency. Elution buffer formula: 0.308 g of reduced glutathione dissolved in 100 mL of 50 mM Tris-HCl buffer at pH 8.0.

[0112] (7) Electrophoretic identification: Take 20 μL each of the flow-through buffer, washing buffer and elution buffer corresponding to the GST fusion protein and detect the protein elution effect by SDS-PAGE electrophoresis.

[0113] Experimental conclusion: The purified target protein was obtained with a concentration of 0.356 mg / mL.

[0114] Example 5

[0115] In vitro enzymatic reaction (see appendix) Figure 6 )

[0116] In vitro enzyme activity assays were performed using the purified protein as a catalyst. A blank reaction without the enzyme was included as a control. Each group was independently replicated in triplicate. The reaction system consisted of: 100 μL total volume, 12.5 μL 20 mM ATP, 15 μL CoBAHD purified enzyme, 12.5 μL 10 μg / mL-1 camellia saponin, 12.5 μL 100 mM MgCl2, 35 μL 50 mM Tris-HCl (pH 7.0), and 12.5 μL Angelica sinensis-CoA. The reaction was incubated at 28℃ for 12 h. An equal volume of water-saturated n-butanol was then added to the system, and the mixture was vigorously shaken for 30 minutes to complete the extraction. The upper organic phase was separated and the solvent was evaporated. The residue was redissolved in 200 μL of 50% chromatographically pure methanol, filtered through a 0.22 μm filter membrane, and transferred to a sample vial for high performance liquid chromatography (HPLC) and chromatography-mass spectrometry (LC-MS) analysis.

[0117] Furthermore, the above reaction conditions are preliminary conditions for the enzymatic reaction, under which products are generated. Therefore, subsequent experiments optimized the enzymatic reaction conditions, and the optimal conditions were finally determined to be 30 °C and pH 8.0.

[0118] Samples were analyzed by high-performance liquid chromatography (HPLC) using a BEH C18 column (2.1 × 50 mm, 1.7 μm). Mobile phase A: 0.05% aqueous phosphoric acid solution; mobile phase B: chromatographic grade acetonitrile; flow rate: 0.25 mL / min; column temperature: 35℃; detection wavelength: 203 nm; injection depth: 5 μL. Gradient elution was used with the following program: 0–2 min, hold at 30% B; 2–7 min, 30% B to 60% B; 7–8 min, 60% B linearly increased to 90% B; 8–10 min, 90% B linearly increased to 100% B; 10–11 min, hold at 100% B; 11–11.5 min, 100% B linearly decreased to 30% B; 11.5–12 min, hold at 30% B to equilibrate the column.

[0119] High-performance liquid chromatography-mass spectrometry (LC-MS) was used for qualitative detection of the target product. A Kinetex C18 100A column (Phenomenex, 150 × 4.6 mm, 2.6 μm) was used for sample separation. Mobile phase A was 0.1% v / v formic acid-water solution, and mobile phase B was chromatographically pure acetonitrile. The flow rate was set at 0.6 mL / min, the column temperature was controlled at 40℃, and the injection volume was 5 μL. Gradient elution was performed according to the following program: 0–1 min, 5% B; 1–10 min, 5% B linearly increased to 95% B; 10–12 min, 95% B; 12–12.1 min, 95% B linearly decreased to 5% B; 12.1–15 min, maintaining 5% B equilibrium. Signal acquisition was performed using an AB Sciex Triple TOF 6600 mass spectrometer with electrospray ionization (ESI) as the ion source, and data were acquired in negative ion mode (IDA). Relevant mass spectrometry parameters: spray voltage 4500 V, curtain gas temperature 550℃, collision energy 25 V, mass scan range 50~1500 m / z.

[0120] Experimental conclusion: At 30 ℃ and pH 8.0, the purified enzyme can catalyze the synthesis of camellia saponin B1 intermediate from angelic acyl donor Ang-CoA, while the enzyme does not exhibit catalytic function at 23 ℃, 37 ℃, pH 5.0, and pH 11.0. Therefore, the enzymatic reaction system in this invention has the highest efficiency in synthesizing camellia saponin B1 intermediate at 30 ℃ and pH 8.0.

[0121] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0122] Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A BAHD acyltransferase for camellia oil, characterized in that, The amino acid sequence of the enzyme is shown in SEQ ID No.

2.

2. The BAHD acyltransferase in Camellia oleifera as described in claim 1, characterized in that, The nucleotide sequence of the gene encoding the enzyme is shown in SEQ ID No.

1.

3. A recombinant expression vector, characterized in that, It includes the coding gene as described in claim 2.

4. An engineered bacterium, characterized in that, It includes the recombinant expression vector as described in claim 3.

5. The engineered bacteria as described in claim 4, characterized in that, The accession number is: CCTCC NO: M 2026811.

6. A method for preparing BAHD acyltransferase from Camellia oleifera according to claim 1, characterized in that, Includes the following steps: (1) Construct the recombinant expression vector as described in claim 3; (2) Transform the recombinant expression vector into competent cells to obtain engineered bacteria; (3) Cultivating engineered bacteria and inducing expression: The engineered bacteria were amplified, and IPTG inducer was added to induce expression; (4) Separation and purification: Collect bacterial cells, sonicate them, and purify them to obtain the target protein.

7. The method for preparing BAHD acyltransferase in Camellia oleifera as described in claim 6, characterized in that, Step (3) specifically involves: amplifying the engineered bacteria to OD at 37°C. 600 The concentration was 0.6, and 0.75 mM IPTG inducer was added. Expression was induced at 24°C for 8 hours.

8. The application of the BAHD acyltransferase in Camellia oleifera according to claim 1, the encoding gene according to claim 2, the recombinant expression vector according to claim 3, or the engineered bacteria according to claim 4 in the synthesis of Camellia oleifera saponin B1 intermediate.

9. A method for the in vitro enzymatic synthesis of camellia saponin B1 intermediate, characterized in that, include: Using the BAHD acyltransferase from Camellia oleifera as described in claim 1 as a catalyst, Camellia oleifera saponin and Angelica acyl-CoA were reacted in a buffer system at pH 8.0 at 30°C for more than 12 hours to synthesize Camellia oleifera saponin intermediate.

Images