SNP molecular marker for identifying flower period of osmanthus fragrans and application thereof
Patent Information
- Application Number
- CN202610801169.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-04
- Publication Date
- 2026-08-04
AI Technical Summary
[0002]当前桂花花期鉴定依赖田间形态观察,周期长,且易受环境因素干扰导致结果失真
[0016]The beneficial effects of this invention are as follows: Unlike the prior art, this invention provides a SNP molecular marker that is significantly associated with the flowering period of Osmanthus fragrans, located at position 14870380 on chromosome 12 of Osmanthus fragrans, and with a polymorphism of A or C; furthermore, by detecting the genotype of this SNP molecular marker, the flowering period phenotype of Osmanthus fragrans can be efficiently determined. Therefore, this SNP molecular marker has good application prospects in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans assisted breeding; in addition, this SNP molecular marker can be detected in batches and then applied to the screening of flowering period in the seedling stage, which helps in molecular-assisted breeding, germplasm resource identification and variety rights protection of Osmanthus fragrans.
Smart Images

Figure CN122503533A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker technology for Osmanthus fragrans, specifically relating to an SNP molecular marker for identifying the flowering period of Osmanthus fragrans and its application. Background Technology
[0002] Currently, the identification of osmanthus flowering period relies on field morphological observation, which is time-consuming and easily affected by environmental factors, leading to distorted results. Existing molecular marker technology can only identify osmanthus varieties and cannot be linked to flowering period traits. There is a lack of specific SNP sites for osmanthus flowering period and supporting detection methods, which restricts the efficiency of osmanthus breeding and industrial development.
[0003] In view of this, it is necessary to develop a SNP molecular marker technology for identifying the flowering period of Osmanthus fragrans, so as to overcome the bottleneck that the flowering period cannot be predicted in the seedling stage and promote the transformation of Osmanthus fragrans breeding industry towards molecular precision. Summary of the Invention
[0004] The purpose of this invention is to provide a SNP molecular marker for identifying the flowering period of Osmanthus fragrans and its application. This addresses the problem in the prior art of lacking an efficient, rapid, and accurate SNP molecular marker for identifying the flowering period of Osmanthus fragrans.
[0005] In a first aspect, the present invention provides the application of SNP molecular markers in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans assisted breeding. The SNP molecular markers are located at position 14870380 on chromosome 12 of Osmanthus fragrans and have a polymorphism of A or C.
[0006] In this invention, the inventors performed whole-genome resequencing on 119 Osmanthus samples (including Osmanthus fragrans var. semperflorens, Osmanthus fragrans var. semperflorens, and other varieties with different flowering periods) to obtain whole-genome SNP loci. GWAS analysis was then performed on these whole-genome SNP loci and the Osmanthus fragrans flowering period phenotype to identify a SNP locus significantly associated with the flowering period, located at position 14870380 on chromosome 12 of Osmanthus fragrans, with polymorphism A or C. Furthermore, by detecting the genotype of this SNP locus, the flowering period phenotype of Osmanthus fragrans can be efficiently determined. Therefore, this SNP locus has good application prospects in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans assisted breeding.
[0007] In some implementations, the SNP molecular marker is located at the 281 bp of the nucleotide sequence shown in SEQ ID NO.1.
[0008] In a second aspect, the present invention provides a primer pair for identifying the flowering period of Osmanthus fragrans, the nucleotide sequence of which is shown in SEQ ID NO.2-3.
[0009] In a third aspect, the present invention provides a kit for identifying the flowering period of Osmanthus fragrans, comprising the aforementioned primer pair.
[0010] In some implementations, the kit also includes at least one of the reagents required for DNA extraction and the reagents required for PCR amplification.
[0011] In a fourth aspect, the present invention provides the application of the primer pairs described above or any of the kits described above in identifying the flowering period of Osmanthus fragrans and / or in Osmanthus fragrans assisted breeding.
[0012] In a fifth aspect, the present invention provides a method for identifying the flowering period of Osmanthus fragrans, comprising the following steps: extracting genomic DNA from a sample of Osmanthus fragrans to be tested; performing PCR amplification on the genomic DNA of the sample of Osmanthus fragrans to be tested using the primer pair or any of the above-mentioned kits to obtain amplification products; sequencing the amplification products to obtain the genotype of the SNP molecular marker in the genomic DNA of the sample of Osmanthus fragrans to be tested, and determining the flowering period of Osmanthus fragrans based on the genotype.
[0013] In some implementations, in the step of PCR amplification of genomic DNA from the Osmanthus fragrans sample to be tested, the PCR amplification reaction system includes: 2-4 μL of 4×VAHTS Multi-PCR Mix, 0.5-0.7 μL of upstream primer, 0.5-0.7 μL of downstream primer, 1-2 μL of genomic DNA, and 6-6.5 μL of ddH2O; and / or, the PCR amplification reaction program includes: pre-denaturation at 98-100℃ for 1-3 minutes; denaturation at 98-100℃ for 13-17 seconds, annealing at 60-65℃ for 3-5 minutes, 30-34 cycles; extension at 70-75℃ for 8-15 minutes, and storage of the product at 0-4℃.
[0014] In some implementations, the sequencing method used in the step of sequencing the amplified products includes at least one of Sanger sequencing and high-throughput sequencing.
[0015] In some implementation schemes, the step of obtaining the genotype of the SNP molecular marker in the genomic DNA of the Osmanthus sample to be tested and determining the flowering period of the Osmanthus based on the genotype includes the following specific determinations: when the genotype of the SNP molecular marker in the genomic DNA of the Osmanthus sample to be tested is AA or AC, the Osmanthus sample to be tested blooms in autumn; when the genotype of the SNP molecular marker in the genomic DNA of the Osmanthus sample to be tested is CC, the Osmanthus sample to be tested blooms in all four seasons.
[0016] The beneficial effects of this invention are as follows: Unlike the prior art, this invention provides a SNP molecular marker that is significantly associated with the flowering period of Osmanthus fragrans, located at position 14870380 on chromosome 12 of Osmanthus fragrans, and with a polymorphism of A or C; furthermore, by detecting the genotype of this SNP molecular marker, the flowering period phenotype of Osmanthus fragrans can be efficiently determined. Therefore, this SNP molecular marker has good application prospects in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans assisted breeding; in addition, this SNP molecular marker can be detected in batches and then applied to the screening of flowering period in the seedling stage, which helps in molecular-assisted breeding, germplasm resource identification and variety rights protection of Osmanthus fragrans. Attached Figure Description
[0017] Figure 1 This is a Manhattan diagram showing the genome-wide association analysis results of Osmanthus fragrans in Example 1 of this invention; Figure 2 This is the QQ diagram of the genome-wide association analysis of Osmanthus fragrans in Example 1 of this invention; Figure 3 This is a Sanger sequencing result diagram of sample 46 in Example 3 of the present invention. Detailed Implementation
[0018] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0019] Experimental methods not specifically described in the examples are generally performed according to conventional experimental methods in the field of molecular biology, including but not limited to those described in *Molecular Cloning: A Laboratory Manual* by M.R. Green and *Molecular Biology* by Robert F. Weaver, or according to the experimental methods recommended by the reagent kit and instrument manufacturers. Unless otherwise specified, all reagents and biological materials used in the examples are commercially available.
[0020] Currently, there is a lack of SNP molecular markers in existing technologies that can efficiently, rapidly, and accurately identify the flowering period of Osmanthus fragrans.
[0021] To address the lack of SNP molecular markers in existing technologies that can efficiently, rapidly, and accurately identify the flowering period of Osmanthus fragrans, this invention provides an SNP molecular marker for identifying the flowering period of Osmanthus fragrans and its application.
[0022] In a first aspect, the present invention provides the application of SNP molecular markers in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans assisted breeding. The SNP molecular markers are located at position 14870380 on chromosome 12 of Osmanthus fragrans and have a polymorphism of A or C.
[0023] In the above-mentioned application provided by this invention, the inventors first performed whole-genome resequencing on 119 Osmanthus samples (including Osmanthus fragrans var. semperflorens, Osmanthus fragrans var. semperflorens, and other varieties with different flowering periods) to obtain whole-genome SNP loci. GWAS analysis was then performed on these whole-genome SNP loci and their flowering period phenotypes to identify SNP loci significantly associated with the flowering period of Osmanthus fragrans. These SNP loci are located at position 14870380 on chromosome 12 of Osmanthus fragrans and exhibit polymorphisms of A or C. Furthermore, by detecting the genotype of this SNP locus, the flowering period phenotype of Osmanthus fragrans can be efficiently determined. Therefore, this SNP locus has good application prospects in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans assisted breeding. In addition, by detecting this SNP locus, the detection cycle is significantly shortened to 4-5 days, solving the technical problem of requiring more than 5 years of observation in the traditional field. Moreover, the method for detecting this SNP locus has the advantages of high accuracy and strong specificity.
[0024] Specifically, the physical location of the aforementioned SNP molecular marker sites was determined based on the Osmanthus fragrans genome sequence OFL v1.0.
[0025] In some implementations, the SNP molecular marker is located at the 281 bp of the nucleotide sequence shown in SEQ ID NO.1.
[0026] In this invention, the inventors discovered that primer pairs designed with nucleotide sequences containing the SNP molecular marker, such as those shown in SEQ ID NO.1, have high specificity, amplifying only fragments containing the SNP molecular marker. This facilitates subsequent genotyping of the SNP molecular marker in the fragments, thereby efficiently determining the flowering period of Osmanthus fragrans.
[0027] In a second aspect, the present invention provides a primer pair for identifying the flowering period of Osmanthus fragrans, the nucleotide sequence of which is shown in SEQ ID NO.2-3.
[0028] It is understood that primer pairs can be designed based on target sequences containing SNP molecular markers (preferably the nucleotide sequences shown in SEQ ID NO. 1) using conventional primer design software, as long as the target sequences containing SNP molecular markers can be amplified efficiently. For example, in this invention, the nucleotide sequences of the primer pairs are preferably as shown in SEQ ID NO. 2-3.
[0029] In a third aspect, the present invention provides a kit for identifying the flowering period of Osmanthus fragrans, comprising the aforementioned primer pair.
[0030] In this invention, the above-mentioned kit can be used to quickly identify the flowering period of Osmanthus fragrans, and the kit has the technical advantages of high specificity and high accuracy in identifying the flowering period of Osmanthus fragrans.
[0031] In some implementations, the kit also includes at least one of the reagents required for DNA extraction and the reagents required for PCR amplification.
[0032] Understandably, the reagents required for DNA extraction can be selected from conventional DNA extraction reagents in existing technologies, as long as they can efficiently and quickly extract genomic DNA with high purity. Similarly, the reagents required for PCR amplification can be selected from conventional PCR amplification reagents in existing technologies, as long as they can efficiently and quickly amplify products with high purity.
[0033] In a fourth aspect, the present invention provides the application of the primer pairs described above or any of the kits described above in identifying the flowering period of Osmanthus fragrans and / or in Osmanthus fragrans assisted breeding.
[0034] In this invention, the above primer pairs or the above kit can be used to efficiently amplify fragments containing SNP molecular markers, and then the SNP molecular markers in the fragments can be genotyped to efficiently determine the flowering period of Osmanthus fragrans.
[0035] In a fifth aspect, the present invention provides a method for identifying the flowering period of Osmanthus fragrans, comprising the following steps: extracting genomic DNA from a sample of Osmanthus fragrans to be tested; performing PCR amplification on the genomic DNA of the sample of Osmanthus fragrans to be tested using the primer pair or any of the above-mentioned kits to obtain amplification products; sequencing the amplification products to obtain the genotype of the SNP molecular marker in the genomic DNA of the sample of Osmanthus fragrans to be tested, and determining the flowering period of Osmanthus fragrans based on the genotype.
[0036] The method for identifying the flowering period of Osmanthus provided by this invention is simple, uses inexpensive and readily available raw materials, and is suitable for large-scale testing. Therefore, this method has good application prospects in seedling flowering period screening, assisting in molecular-assisted breeding, germplasm resource identification, and variety rights protection of Osmanthus.
[0037] In some implementations, in the step of PCR amplification of the genomic DNA of the Osmanthus fragrans sample to be tested, the PCR amplification reaction system includes: 2-4 μL (e.g., 2 μL, 2.5 μL, 3 μL, 3.5 μL, 4 μL or other values within this range) of 4×VAHTS Multi-PCR Mix, 0.5-0.7 μL (e.g., 0.5 μL, 0.55 μL, 0.6 μL, 0.65 μL, 0.7 μL or other values within this range) of upstream primer, 0.5-0.7 μL (e.g., 0.5 μL, 0.55 μL, 0.6 μL, 0.65 μL, 0.7 μL or other values within this range) of downstream primer, and 1-2 μL (e.g., 1 μL, 1.2 μL, 1.5 μL, 1.8 μL, 2 μL or other values within this range) of genomic DNA. A. 6-6.5 μL (e.g., 6 μL, 6.1 μL, 6.2 μL, 6.3 μL, 6.4 μL, 6.5 μL, or other values within this range) of ddH2O; and / or, the PCR amplification reaction program includes: pre-denaturation at 98-100℃ (e.g., 98℃, 98.5℃, 99℃, 99.5℃, 100℃, or other values within this range) for 1-3 minutes, e.g., 1 minute, 1.5 minutes, 2 minutes, 2.5 minutes, 3 minutes, or other values within this range; 98-10 Denaturation at 0℃ (e.g., 98℃, 98.5℃, 99℃, 99.5℃, 100℃, or other values within this range) for 13-17 seconds, e.g., 13 seconds, 14 seconds, 15 seconds, 16 seconds, 17 seconds, or other values within this range; annealing at 60-65℃ (e.g., 60℃, 61℃, 62℃, 63℃, 64℃, 65℃, or other values within this range) for 3-5 minutes, e.g., 3 minutes, 3.5 minutes, 4 minutes, 4.5 minutes, 5 minutes, or other values within this range; annealing at 30-3... Four cycles, for example, 30, 31, 32, 33, 34 cycles or other values within this range; extended at 70-75°C (for example, 70°C, 71°C, 72°C, 73°C, 74°C, 75°C or other values within this range) for 8-15 minutes, for example, 8 minutes, 10 minutes, 12 minutes, 14 minutes, 15 minutes or other values within this range; product stored at 0-4°C (for example, 0°C, 1°C, 2°C, 3°C, 4°C or other values within this range).
[0038] In some preferred embodiments, the PCR amplification reaction system comprises: 3 μL of 4×VAHTS Multi-PCRMix, 0.6 μL of upstream primer, 0.6 μL of downstream primer, 1.5 μL of genomic DNA, and 6.3 μL of ddH2O; and / or, the PCR amplification reaction program comprises: 99°C pre-denaturation for 2 minutes; 99°C denaturation for 15 seconds, 63°C annealing for 4 minutes, 32 cycles; 72°C extension for 10 minutes, and product storage at 4°C.
[0039] In this invention, by optimizing the PCR amplification reaction system and reaction procedure, a target fragment containing SNP molecular markers with good purity can be obtained, which facilitates further genotyping of the SNP molecular markers in the fragment, thereby efficiently determining the flowering period of Osmanthus fragrans.
[0040] In some implementations, the sequencing method used in the step of sequencing the amplified products includes at least one of Sanger sequencing and high-throughput sequencing.
[0041] It is understandable that the sequencing method can be selected from conventional sequencing methods in existing technologies according to actual needs, as long as the genotype of the SNP molecular marker can be obtained. For example, in this invention, the sequencing method preferably includes at least one of Sanger sequencing and high-throughput sequencing.
[0042] In some implementation schemes, the step of obtaining the genotype of the SNP molecular marker in the genomic DNA of the Osmanthus sample to be tested and determining the flowering period of the Osmanthus based on the genotype includes the following specific determinations: when the genotype of the SNP molecular marker in the genomic DNA of the Osmanthus sample to be tested is AA or AC, the Osmanthus sample to be tested blooms in autumn; when the genotype of the SNP molecular marker in the genomic DNA of the Osmanthus sample to be tested is CC, the Osmanthus sample to be tested blooms in all four seasons.
[0043] In this invention, the flowering period phenotype of osmanthus samples can be accurately and efficiently determined by the genotype of SNP molecular markers in the genomic DNA of the osmanthus sample.
[0044] The following are some specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain the present invention, and should not be construed as limiting the present invention.
[0045] Example 1 In this embodiment, the aim is to develop SNP molecular markers (SNP sites) that are significantly associated with the flowering phenotypic characteristics of Osmanthus samples.
[0046] Specifically, it includes the following steps: 1) Whole-genome resequencing was performed on 119 Osmanthus samples (including Osmanthus fragrans var. florida, os ...) using a compressed mixed linear model (GWAS analysis of the above whole-genome SNPs and Osmanthus fragrans florida phenotypes is shown in the figure). Figure 1 As shown in the figure, this model can simultaneously correct for population structure and kinship, improving the accuracy of association analysis.
[0047] 2) Significant site screening: This is achieved by using a statistical significance threshold (e.g., ...). Figure 1 The dashed line in the Manhattan plot corresponds to (-log) 10 ( p Value (results are as follows) Figure 2 As shown in the figure, SNP loci that are significantly associated with flowering period traits were screened out; the SNP locus at 14870380bp on chromosome 12 was finally located, and its polymorphism was A or C.
[0048] The physical location of this SNP site was determined based on the Osmanthus fragrans genome sequence OFL v1.0.
[0049] Example 2 In this embodiment, based on the SNP sites in Example 1, the aim is to develop primer pairs for identifying the flowering period of Osmanthus fragrans.
[0050] Specifically, firstly, based on the SNP site in Example 1, the upstream and downstream fragments of the SNP site are combined to obtain a gene fragment containing the SNP site (nucleotide sequence as shown in SEQ ID NO.1); then, based on the gene fragment, primer pairs for identifying the flowering period of Osmanthus fragrans are designed.
[0051] The gene fragment containing this SNP site is shown below: TGCCATGATTGGAAGCAAGAGCTATAATCTGAACATTGAAAGTACGGATTCGATGACGAATCCTTTTGAAGAGAAAGAGTCTGATACGATCTAGCATAAAGTTATTTTTGGATGATTATTTTCTATTTGAGCGAGTTTTCATATTTCACTATAATTCTTAATTTTGGCAACTTTTGTTATTTTTTGGACTTTTTAAATTCCGTTTTTAATTA TTTCCTAGGGTTCGTATAAATAGTTTATTATTTTCATTGTATTGGAGAAGCTTTTTATTATGAATAAAAWTTGAGACTTTTCTTTCCATGATTCTTGATGAACTTTATAGAACTTATCAAATATTCTTCAATATTTGTGGCATTCAAACCTAGAACTTATCAAAGGATTAGACACCCTTTGTGGAGTTCACAATTCGAGGTTCGTTGA(SEQ ID NO.1); The W at 281bp in this sequence represents either A or C.
[0052] The primer pair sequences are as follows: Upstream primer F: 5′-TGCCATGATTGGAAGCAAGAGC-3′ (SEQ ID NO.2); Downstream primer R: 5′-TCAACGAACTC-3′ (SEQ ID NO.3).
[0053] Example 3 In this embodiment, a method for identifying the flowering period of Osmanthus fragrans was established based on the primer pair developed in Example 2, and the accuracy of the primer pair detection was verified.
[0054] Specifically, it includes the following steps: 1) Select 119 fresh leaves from the seedling stage of Osmanthus fragrans, wash them and store them at -80℃, then take 0.2g and grind them into powder with liquid nitrogen.
[0055] 2) Genomic DNA extraction: Genomic DNA from 119 Osmanthus samples in step 1) was automatically extracted using a nano-magnetic bead plant DNA extraction kit and a 96-well plate high-throughput magnetic bead extractor.
[0056] 3) Using the genomic DNA of the osmanthus sample obtained in step 2) as a template, PCR amplification was performed to obtain the amplification product; The PCR amplification reaction system included: 3 μL of 4×VAHTS Multi-PCR Mix, 0.6 μL of upstream primer, 0.6 μL of downstream primer, 1.5 μL of genomic DNA, and 6.3 μL of ddH2O. The PCR amplification reaction program included: 99℃ pre-denaturation for 2 minutes; 99℃ denaturation for 15 seconds, 63℃ annealing for 4 minutes, 32 cycles; 72℃ extension for 10 minutes; and storage of the product at 4℃.
[0057] 4) The amplification products obtained in step 3) were subjected to Sanger sequencing to obtain the genotypes of SNP sites in the genomic DNA of 119 Osmanthus samples to be tested. The results are shown in Table 1 below.
[0058] For example, the Sanger sequencing results of sample 46 (Danling Xiangyun) are as follows: Figure 3 As shown.
[0059] from Figure 3 As can be seen from the figure, the genotype of the SNP locus in sample 46 is AC (the arrow in the figure indicates the heterozygous peak).
[0060] Table 1. Names, flowering period phenotypes, genotypes, and sequencing results of the Osmanthus fragrans samples to be tested.
[0061] As shown in Table 1, when the genotype of the detected SNP locus is AA or AC, 100% of the samples are osmanthus flowers that bloom in autumn; when the genotype of the detected SNP locus is CC, 100% of the samples are osmanthus flowers that bloom in all four seasons. This demonstrates that the primer pairs used in this invention can specifically amplify gene fragments containing SNP loci. Sanger sequencing of these gene fragments allows for the genotyping of the SNP loci, thus accurately identifying the flowering period of osmanthus. Therefore, this SNP locus has promising applications in identifying the flowering period of osmanthus or in osmanthus-assisted breeding. Furthermore, batch detection of this SNP locus can be applied to seedling flowering period screening, contributing to molecular-assisted breeding, germplasm resource identification, and variety rights protection of osmanthus, demonstrating extremely high application value.
[0062] In summary, this invention provides a SNP molecular marker that is significantly associated with the flowering period of Osmanthus fragrans. The marker is located at position 14870380 on chromosome 12 of Osmanthus fragrans and has a polymorphism of A or C. Furthermore, by detecting the genotype of this SNP molecular marker, the flowering period phenotype of Osmanthus fragrans can be efficiently determined. Therefore, this SNP molecular marker has good application prospects in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans assisted breeding.
[0063] It should be noted that all the above embodiments belong to the same inventive concept, and the descriptions of each embodiment have different focuses. Where the description in a particular embodiment is not detailed, please refer to the description in other embodiments.
[0064] The embodiments described above are merely illustrative of implementation methods of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.
Claims
1. The application of SNP molecular markers in identifying the flowering period of Osmanthus fragrans or in Osmanthus fragrans-assisted breeding, characterized in that, The SNP molecular marker is located at position 14870380 on chromosome 12 of Guihua, and its polymorphism is A or C.
2. The application according to claim 1, characterized in that, The SNP molecular marker is located at 281 bp of the nucleotide sequence shown in SEQ ID NO.
1.
3. A primer pair for identifying the flowering period of Osmanthus fragrans, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO. 2-3.
4. A reagent kit for identifying the flowering period of Osmanthus fragrans, characterized in that, Includes the primer pair as described in claim 3.
5. The reagent kit according to claim 4, characterized in that, The kit also includes at least one of the reagents required for DNA extraction and the reagents required for PCR amplification.
6. The application of the primer pair as described in claim 3 or the kit as described in any one of claims 4-5 in identifying the flowering period of Osmanthus fragrans and / or in Osmanthus fragrans assisted breeding.
7. A method for identifying the flowering period of Osmanthus fragrans, characterized in that, Includes the following steps: Genomic DNA was extracted from the osmanthus samples to be tested; The genomic DNA of the Osmanthus fragrans sample to be tested was amplified by PCR using the primer pair described in claim 3 or the kit described in any one of claims 4-5 to obtain the amplification product. The amplified products were sequenced to obtain the genotypes of SNP molecular markers in the genomic DNA of the Osmanthus sample to be tested, and the flowering period of Osmanthus was determined based on the genotypes.
8. The method according to claim 7, characterized in that, In the step of PCR amplification of the genomic DNA of the Osmanthus fragrans sample to be tested, the PCR amplification reaction system includes: 2-4 μL of 4×VAHTS Multi-PCR Mix, 0.5-0.7 μL of upstream primer, 0.5-0.7 μL of downstream primer, 1-2 μL of genomic DNA, and 6-6.5 μL of ddH2O; and / or, The PCR amplification reaction procedure includes: pre-denaturation at 98-100℃ for 1-3 minutes; denaturation at 98-100℃ for 13-17 seconds, annealing at 60-65℃ for 3-5 minutes, 30-34 cycles; extension at 70-75℃ for 8-15 minutes, and storage of the product at 0-4℃.
9. The method according to claim 7, characterized in that, In the step of sequencing the amplified product, the sequencing method includes at least one of Sanger sequencing and high-throughput sequencing.
10. The method according to claim 7, characterized in that, In the step of obtaining the genotype of SNP molecular markers in the genomic DNA of the osmanthus sample to be tested, and determining the flowering period of the osmanthus based on the genotype, the determination specifically includes: When the genotype of the SNP molecular marker in the genomic DNA of the osmanthus sample to be tested is AA or AC, the osmanthus sample to be tested is an autumn-flowering osmanthus. When the genotype of the SNP molecular marker in the genomic DNA of the osmanthus sample to be tested is CC, the osmanthus sample to be tested is flowering in all four seasons.