Nucleic acid compositions targeting homologous regions of the human chromosome 7q11.23 region, methods of constructing a williams syndrome animal model and uses thereof

CN122588084APending Publication Date: 2026-08-18ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610416268.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-03-31
Publication Date
2026-08-18

AI Technical Summary

Technical Problem

然而,现有动物模型在缺失基因范围上仍未完全覆盖临床Williams综合征中常见的连续缺失区间,在遗传模拟的完整性方面仍存在一定不足,限制对多基因协同致病机制的系统研究

Benefits of technology

[0024] At the gene design level, this application selects the Gtf2i and Trim50 genes as the 5' and 3' anchoring genes for continuous deletion regions, respectively. Specific gRNAs are designed in key exon regions upstream of the Gtf2i gene and downstream of the Trim50 gene to guide the Cas9 endonuclease to generate double-strand DNA breaks at the target sites. Through the cell's own non-homologous end joining (NHEJ) repair mechanism, a 1.0 Mb–1.2 Mb genomic fragment between the two break sites is completely deleted, thus obtaining stable continuous multi-gene deletion alleles in a single editing process. This design avoids the fragmentation problem in genetic structure caused by single-gene or non-continuous multi-gene knockout, making the resulting model closer to the real situation of clinical patients in terms of deletion region length, gene composition, and gene dosage effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122588084A_ABST
    Figure CN122588084A_ABST
Patent Text Reader

Abstract

The present application relates to nucleic acid compositions targeting the homologous region of the human chromosome 7q11.23 region, a method for constructing a Williams syndrome animal model and applications. The nucleic acid compositions include a first composition and a second composition, the first composition includes a first sgRNA and a second sgRNA, the nucleotide sequences of which are shown in SEQ ID NO: 1 and SEQ ID NO: 2 respectively, and the second composition includes a third sgRNA and a fourth sgRNA, the nucleotide sequences of which are shown in SEQ ID NO: 3 and SEQ ID NO: 4 respectively. By targeting the specific nucleic acid composition of the homologous region of the human chromosome 7q11.23 region, the complete genomic fragment of the Gtf2i gene and the Trim50 gene interval can be deleted at one time, and the synchronous deletion of multiple genes in the region is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of biotechnology, and specifically relates to nucleic acid compositions targeting the homologous region of human chromosome 7q11.23, methods for constructing animal models of Williams syndrome, and their applications. Background Technology

[0002] Williams syndrome is a neurodevelopmental disorder caused by a series of microdeletions in the 7q11.23 region of the long arm of human chromosome 7. This deleted region typically involves multiple functional genes, including GTF2I, GTF2IRD1, LIMK1, ELN, and TRIM50. Its deletion can lead to a range of neurobehavioral abnormalities, primarily cognitive impairment, learning and memory impairment, and motor disorders, often accompanied by cardiovascular and other systemic involvement.

[0003] Since Williams syndrome is a typical continuous polygenic deletion syndrome, its pathogenesis is not caused by a single gene abnormality, but rather by the synergistic effect of multiple gene deletions. Therefore, constructing an animal model that closely resembles the clinical characteristics of patients along the genetic deletion region is an important foundation for elucidating the pathogenesis of this disease.

[0004] In recent years, with the development of gene editing technology, some progress has been made in the study of animal models of Williams syndrome. However, existing animal models still do not fully cover the continuous deletion regions commonly found in clinical Williams syndrome in terms of the range of deleted genes, and there are still some deficiencies in the completeness of genetic simulation, which limits the systematic study of the multi-gene synergistic pathogenic mechanism.

[0005] Therefore, there is an urgent need for effective methods to construct animal models of Williams syndrome. Summary of the Invention

[0006] Based on this, this application designs a simple and effective method to rapidly knock out the Gtf2i~Trim50 continuous gene region using the CRISPR / Cas system. The CRISPR / Cas system used to construct the animal model of this disease can precisely cut DNA to cause double-strand breaks under the guidance of the first and second compositions. It can specifically knock out the Gtf2i~Trim50 continuous gene region on the homologous region of human chromosome 7q11.23, achieving the overall knockout of a 1.0 Mb~1.2 Mb genomic fragment between the two break sites, causing multiple genes in the continuous deletion region to lose function, thereby obtaining stable continuous multi-gene deletion alleles in a single editing process.

[0007] The specific proposal of this application is as follows:

[0008] One aspect of this application provides a nucleic acid composition targeting a homologous region of the 7q11.23 region of human chromosome. The nucleic acid composition includes a first composition and a second composition. The first composition includes a first sgRNA and a second sgRNA, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The second composition includes a third sgRNA and a fourth sgRNA, the nucleotide sequences of which are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0009] Another aspect of this application provides a gene inactivation kit targeting the homologous region of the 7q11.23 region of human chromosome, the kit comprising the above-described nucleic acid composition.

[0010] Another aspect of this application provides a method for constructing an animal model of Williams syndrome, comprising the following steps: using a CRISPR / Cas system to edit the homologous region of the 7q11.23 region of the human chromosome of the target animal to make its deletion length 1.0 Mb~1.2 Mb, thereby constructing an animal model of Williams syndrome;

[0011] The CRISPR / Cas system described herein includes the nucleic acid composition and Cas9 nuclease as described above.

[0012] In some embodiments, the CRISPR / Cas system processes the fertilized eggs of the target animal.

[0013] In some embodiments, the CRISPR / Cas system transfers the above-described nucleic acid composition and Cas9 nuclease into the fertilized egg through in vitro transcription into mRNA.

[0014] In some embodiments, the CRISPR / Cas system is introduced into the fertilized egg via microinjection;

[0015] And / or, the concentration of the Cas9 nuclease is 50 ng / μL to 150 ng / μL;

[0016] And / or, the concentrations of the first sgRNA, the second sgRNA, the third sgRNA, and the fourth sgRNA are each independently 20 ng / μL to 80 ng / μL.

[0017] In some embodiments, the construction method further includes the following steps:

[0018] Fertilized eggs transferred into the CRISPR / Cas system were transplanted into pseudopregnant female animals and F0 generation was produced;

[0019] The F0 generation was mated with the wild type to obtain the F1 generation heterozygotes. The F1 generation heterozygotes were then mated with the wild type, and the offspring with stable heterozygotes were selected as the animal model of Williams syndrome.

[0020] In some embodiments, the target animal is a mouse or a rat.

[0021] In some embodiments, the target animal is a rat, and the construction method further includes a step of genotyping the rat:

[0022] Using genomic DNA extracted from rats as templates, PCR amplification was performed using the first amplification primer pair with forward primer sequence as shown in SEQ ID NO:5 and reverse primer sequence as shown in SEQ ID NO:6, and the second amplification primer pair with forward primer sequence as shown in SEQ ID NO:7 and reverse primer sequence as shown in SEQ ID NO:8. The genotype of the homologous region of the human chromosome 7q11.23 in rats was then identified by electrophoresis.

[0023] Another aspect of this application provides a method for screening or identifying drugs for treating Williams syndrome, using the above-described nucleic acid composition, the above-described kit, or a Williams syndrome animal model prepared by the above-described method for constructing an animal model of Williams syndrome, to screen or identify drugs for treating Williams syndrome.

[0024] At the gene design level, this application selects the Gtf2i and Trim50 genes as the 5' and 3' anchoring genes for continuous deletion regions, respectively. Specific gRNAs are designed in key exon regions upstream of the Gtf2i gene and downstream of the Trim50 gene to guide the Cas9 endonuclease to generate double-strand DNA breaks at the target sites. Through the cell's own non-homologous end joining (NHEJ) repair mechanism, a 1.0 Mb–1.2 Mb genomic fragment between the two break sites is completely deleted, thus obtaining stable continuous multi-gene deletion alleles in a single editing process. This design avoids the fragmentation problem in genetic structure caused by single-gene or non-continuous multi-gene knockout, making the resulting model closer to the real situation of clinical patients in terms of deletion region length, gene composition, and gene dosage effect.

[0025] The multigene heterozygous deletion model obtained by this method, covering key continuous deletion regions in Williams syndrome including Trim50, more closely resembles the actual deletion characteristics of clinical patients in terms of genetic structure. Furthermore, leveraging the advantages of rats in higher cognitive behavioral assessments such as learning and memory, and executive function, which exhibit more defined phenotypes and greater stability, a more reliable simulation of the cognitive impairment phenotype in Williams syndrome is achieved. In other words, this rat model can be used to fully investigate the pathogenesis of this disease and further develop treatment methods. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the specific embodiments of this application or the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0027] Figure 1 This is an electrophoresis diagram of the amplification products of the first amplification primers for the rat Gtf2i gene and Trim50 gene regions in Example 1;

[0028] Figure 2 This is an electrophoresis diagram of the amplification products of the second amplification primers for the rat Gtf2i gene and Trim50 gene regions in Example 1;

[0029] Figure 3 The image shows the single-nucleus sequencing results of wild-type and heterozygous rats in Example 1; where the horizontal axis represents UMAP_1 after dimensionality reduction and the vertical axis represents UMAP_2 after dimensionality reduction.

[0030] Figure 4 These are photographs of the wild-type and heterozygous rats in Example 1.

[0031] Figure 5 The curves show the statistical results of body weight of wild-type and heterozygous rats at 35 days, 42 days, 49 days and 56 days of age in Example 1. The horizontal axis represents the number of days and the vertical axis represents body weight.

[0032] Figure 6 This image shows the results of ladder walking behavior testing on wild-type and heterozygous rats at 43 days of age in Example 1. Figure 6 The results for A~C represent the findings of a survey of female rats. Figure 6 The results from the survey of male rats are shown in D~F. Figure 6 In the graph A, the horizontal axis represents the group, and the vertical axis represents the total number of steps to normalize to the wild type. Figure 6 In the diagram, the horizontal axis of B represents the group, and the vertical axis represents the number of steps. Figure 6In the diagram, the x-axis represents the group, and the y-axis represents the total number of error steps. Figure 6 In the graph, the x-axis represents the group, and the y-axis represents the total number of steps to normalize to the wild type. Figure 6 In the diagram, the horizontal axis of E represents the group, and the vertical axis represents the number of steps. Figure 6 In the diagram, the horizontal axis of F represents the group, and the vertical axis represents the total number of error steps.

[0033] Figure 7 This is a graph showing the results of the first phase of the three-box social behavior experiment conducted on wild-type and heterozygous rats at 56 days of age in Example 1. Figure 7 The results for A~C represent the findings of a survey of female rats. Figure 7 In the diagram, the horizontal axis represents the group, and the vertical axis represents the investigation time. Figure 7 In the diagram, the horizontal axis of group B represents the group number, and the vertical axis represents the number of investigations. Figure 7 In the graph C, the horizontal axis represents the group, and the vertical axis represents the social index. Figure 7 The results from the survey of male rats are shown in D~F. Figure 7 In the diagram, the horizontal axis of D represents the group, and the vertical axis represents the investigation time. Figure 7 In the graph E, the horizontal axis represents the group, and the vertical axis represents the number of investigations. Figure 7 The horizontal axis of F represents the group, and the vertical axis represents the social index. Detailed Implementation

[0034] To facilitate understanding of this application, a more comprehensive description of the application will be provided below with reference to embodiments, and preferred embodiments of the application are given below. However, this application can be implemented in many different forms and is not limited to the embodiments described herein. These embodiments are provided to provide a more thorough and complete understanding of the disclosure of this application. It should be understood that experimental methods in the following embodiments, unless specific conditions are specified, are generally performed under conventional conditions or as recommended by the manufacturer. All commonly used reagents used in the embodiments are commercially available products.

[0035] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the application. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0036] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:

[0037] In this application, the terms "multiple", "various", "multiple times", "multi-dimensional", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0038] The terms “containing,” “comprising,” and “including” as used in this application are synonyms and are inclusive or open-ended, and do not exclude additional, uncited members, elements, or method steps.

[0039] The terms “first,” “second,” “third,” etc., are used for distinguishing descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features.

[0040] The concentration values ​​mentioned in this application include fluctuations within a certain range. For example, fluctuations are allowed within a corresponding precision range. For instance, 2% may fluctuate within ±0.1%. For larger values ​​or values ​​that do not require overly precise control, even greater fluctuations are allowed. For example, 100 mM may fluctuate within the ranges of ±1%, ±2%, ±5%, etc. Regarding molecular weight, fluctuations of ±10% are allowed.

[0041] In this application, the technical features described in an open-ended manner include both closed technical solutions consisting of the listed features and open technical solutions that include the listed features.

[0042] The principle behind CRISPR / Cas gene knockout is that tracrRNA-crRNA, when fused into a single-stranded guide RNA (sgRNA), guides the action of Cas9. Cas9 mRNA transiently expresses the Cas9 protease, which autonomously binds to and cleaves the target gene. Artificially designed sgRNA recognizes the target gene sequence and guides the Cas9 protease to effectively cleave the DNA double strand, forming a double-strand break. Normally, cells repair the broken DNA using efficient non-homologous end joining (NHEJ), but base insertion or deletion mismatches often occur during repair, causing frameshift mutations that render the target gene nonfunctional, thus achieving gene knockout.

[0043] Although existing studies have constructed continuous or multi-segment knockout models in mice covering multiple genes within the homologous region of human chromosome 7q11.23 to simulate some of the genetic and behavioral characteristics of Williams syndrome, current mouse models do not fully cover the continuous deletion regions found in clinical patients, particularly omitting the Trim50 gene. Since Trim50 is a crucial component of the WS deletion region, its deletion may be involved in the formation of disease-related phenotypes; therefore, existing models still fall short in terms of the completeness of genetic simulation.

[0044] The incompleteness of the aforementioned missing regions limits the ability of existing mouse models to assess the impact of multi-gene synergistic deletions on the overall disease phenotype, especially on cognitive impairment, and makes it difficult to fully reflect the true disease characteristics of clinical WS patients.

[0045] Furthermore, in behavioral and cognitive function research, the phenotypic performance of existing WS mouse models in behavioral tasks such as learning and memory, spatial cognition, and executive function is often not clear enough or has limited stability, and there are still some shortcomings in characterizing the cognitive impairment that is prevalent in patients with Williams syndrome.

[0046] Based on this, one embodiment of this application provides a nucleic acid composition targeting the homologous region of the 7q11.23 region of human chromosome. The nucleic acid composition includes a first composition and a second composition. The first composition includes a first sgRNA and a second sgRNA, whose nucleotide sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The second composition includes a third sgRNA and a fourth sgRNA, whose nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0047] Specifically, the nucleotide sequence shown in SEQ ID NO:1 is 5'- TGACCGATGTGTTATCTCGT-3'; the nucleotide sequence shown in SEQ ID NO:2 is 5'- CAGTATAATGCGGCTGTAGC-3'; the nucleotide sequence shown in SEQ ID NO:3 is 5'- GTCCGACTAAGTGAGGACGA-3'; and the nucleotide sequence shown in SEQ ID NO:4 is 5'- ACACCTTGGCAGCGCCTACC-3'.

[0048] At the gene design level, this application selects the Gtf2i and Trim50 genes as the 5' and 3' anchoring genes for continuous deletion regions, respectively. Specific gRNAs are designed in key exon regions upstream of the Gtf2i gene and downstream of the Trim50 gene, respectively, to guide the Cas9 endonuclease to generate double-strand DNA breaks at the target sites. Through the cell's own non-homologous end joining (NHEJ) repair mechanism, a complete deletion of a 1.0 Mb–1.2 Mb genomic fragment between the two break sites is achieved, thus obtaining stable continuous multi-gene deletion alleles in a single editing process. By using a specific nucleic acid composition targeting the homologous region of human chromosome 7q11.23, a complete genomic fragment between the two can be deleted in one go, achieving synchronous heterozygous deletion of multiple genes within this region. This design avoids the fragmentation problem in genetic structure associated with single-gene or non-continuous multi-gene knockout, making the resulting model closer to the realities of clinical patients in terms of deletion region length, gene composition, and gene dosage effects.

[0049] One embodiment of this application provides a gene inactivation kit targeting the homologous region of the 7q11.23 region of human chromosome, the kit comprising the above-mentioned nucleic acid composition.

[0050] The above kit, guided by a specific nucleic acid composition, can precisely cut DNA to create double-strand breaks, specifically knocking out the Gtf2i~Trim50 continuous gene region on the homologous region of human chromosome 7q11.23, achieving the overall knockout of a genomic fragment of about 1.1 Mb between the two break sites.

[0051] Another embodiment of this application provides a method for constructing an animal model of Williams syndrome, including the following steps S10 to S40.

[0052] Step S10: Edit the homologous region of the human chromosome 7q11.23 of the target animal using the CRISPR / Cas system to make the deletion length 1.0 Mb~1.2 Mb. The CRISPR / Cas system includes the above-mentioned nucleic acid composition and Cas9 nuclease. Transfer the CRISPR / Cas system into the fertilized egg to obtain the fertilized egg transferred into the CRISPR / Cas system.

[0053] In some embodiments, the CRISPR / Cas system described above processes the fertilized eggs of the target animal.

[0054] In some embodiments, the CRISPR / Cas system described above transfers the above-described nucleic acid composition and Cas9 nuclease into the fertilized egg through in vitro transcription into mRNA.

[0055] In some embodiments, the method by which the CRISPR / Cas system is transferred into the fertilized egg is microinjection.

[0056] In some of these embodiments, the concentration of the Cas9 nuclease is 50 ng / μL to 150 ng / μL.

[0057] In some embodiments, the concentrations of the first sgRNA, the second sgRNA, the third sgRNA, and the fourth sgRNA are each independently 20 ng / μL to 80 ng / μL.

[0058] Step S20: The fertilized eggs transferred into the CRISPR / Cas system in step S10 are transplanted into a pseudopregnant female animal and F0 generation is produced.

[0059] Step S30: Cross the F0 generation from step S20 with the wild type to obtain the F1 generation heterozygotes.

[0060] Step S40: Cross the F1 generation heterozygotes from step S30 with wild-type individuals, and select the offspring of stable heterozygotes as animal models of Williams syndrome.

[0061] In some embodiments, mating occurs for at least three generations in step S40 above.

[0062] In some of these embodiments, the target animal includes a mouse or a rat.

[0063] In some embodiments, the target animal is a rat. The steps of obtaining the F0 generation, F1 generation and offspring in steps S20, S30 and S40 respectively include the step of genotyping the rat. The step of genotyping the rat includes steps a, b, c, d and e.

[0064] Step a: Extract genomic DNA from rat toes and / or tail.

[0065] Understandably, compared with mice, rats are more developed in terms of nervous system structure, cortical development, and neural circuit complexity. Their performance in cognitive behavioral tasks such as learning and memory, working memory, and executive function is more stable and the differences are more significant, which is more conducive to revealing the behavioral phenotypes and neural mechanisms related to cognitive function impairment.

[0066] Step b: Using genomic DNA extracted from rat toes and / or tails as templates, PCR amplification was performed using the first amplification primer pair with forward primer sequence as shown in SEQ ID NO:5 and reverse primer sequence as shown in SEQ ID NO:6, and the second amplification primer pair with forward primer sequence as shown in SEQ ID NO:7 and reverse primer sequence as shown in SEQ ID NO:8, to obtain the amplification products.

[0067] Specifically, the first amplification primer pair has the following sequences: forward primer (SEQ ID NO:5): 5'-GAGCTGGTCATGCTGTGAGA-3'; reverse primer (SEQ ID NO:6): 5'-CAGCCAATTCTACTGGGTTCTG-3'; the second amplification primer pair has the following sequences: forward primer (SEQ ID NO:7): 5'-GCAGAGCGTTAAGTCATCCAGT-3'; reverse primer (SEQ ID NO:8): 5'-CTTGGTGCCGAGCATCCAAA-3'.

[0068] Understandably, the first amplification primer pair is designed primarily for the deletion variant fragment. The forward primer is designed in the 4,009–4,028 bp region of the target genome sequence to amplify the upstream region of the CRISPR / Cas9 editing site, thereby detecting the deletion link fragment formed after knockout. The reverse primer is located in the 1,176,451–1,176,472 bp region, downstream of the CRISPR target region, and is used to pair with the upstream forward primer to amplify the deletion fragment formed after knockout, thus verifying the gene knockout event. In other words, because the first amplification primer pair is located on both sides of the mutant region, the normal Gtf2i~Trim50 continuous gene region does not have a deletion region that matches the first amplification primer pair, so amplification cannot occur. However, in the Gtf2i~Trim50 continuous gene region with deletion mutations, the deletion of a specific segment shortens the distance between primers, thereby improving the efficiency of PCR amplification and enabling the amplification of fragments of a specific length. The designed second amplification primer pair is mainly targeted at the normal Gtf2i~Trim50 continuous gene region. Since the forward primer in the second amplification primer is located in the 9,299~9,320 bp region and the reverse primer is located in the 9,912~9,931 bp region, the DNA sequence of the mutant region does not have a region that matches the second amplification primer, so amplification cannot occur. Thus, the presence of deletion mutations in the sample can be determined by observing the length of the amplification product.

[0069] In some embodiments, the identification methods include one or more of PCR and Sanger sequencing.

[0070] In some embodiments, in step b, the PCR amplification program is set as follows: 95°C pre-denaturation for 5 min; 98°C denaturation for 30-45 s, 55°C-72°C annealing for 30-60 s, 72°C extension for 30-60 s, for a total of 20-40 cycles; and finally, 72°C extension for 5-10 min, with the PCR amplification product stored at 10°C. It is understood that in other specific examples, the PCR program can be reasonably adjusted.

[0071] In a specific example, the PCR amplification program was set as follows: 95℃ pre-denaturation for 5 min, 98℃ denaturation for 30 s, 65℃ annealing for 30 s, 72℃ extension for 45 s, for 20 cycles; 98℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for 20 cycles; and finally, 72℃ extension for 5 min. The PCR amplification products were stored at 10℃.

[0072] Step c: Perform agarose gel electrophoresis on the PCR amplification products.

[0073] In one embodiment, in step c, 3 μL to 5 μL of PCR amplification product and DNA marker are respectively spotted into the gel wells, electrophoresed at 220 V for 10 min to 20 min, and then imaged.

[0074] In one embodiment, in step c, the band size of the PCR amplification product is confirmed to be correct by agarose gel electrophoresis.

[0075] Step d: Sequencing the amplified products.

[0076] In one embodiment, in step d, the sequencing method is Sanger sequencing.

[0077] In one embodiment, in step d, sequencing analysis is performed using the same primer pair as the PCR amplification primer pair.

[0078] Step e: Identify the genotype of the rat.

[0079] In one embodiment, in step e, the sequence obtained from step d is compared with the corresponding DNA sequence of the wild-type Gtf2i~Trim50 continuous gene region to analyze whether it is a Gtf2i~Trim50 continuous gene region knockout rat.

[0080] In one embodiment, in step e, a DNA fragment of approximately 1.1 Mb on the continuous gene region of Gtf2i~Trim50 in the knockout rat is excised.

[0081] (1) An animal model of Williams syndrome with neurodevelopmental disorder was constructed by inactivating the Gtf2i~Trim50 continuous gene region by using a first nucleic acid composition and a second nucleic acid composition targeting the Gtf2i~Trim50 continuous gene region.

[0082] (2) This construction method can achieve continuous Gtf2i~Trim50 gene knockout at specific times and spaces through conditional gene knockout.

[0083] Another embodiment of this application provides a method for screening or identifying drugs for treating Williams syndrome, using the above-described nucleic acid composition, the above-described kit, or a Williams syndrome animal model prepared by the above-described method for constructing an animal model of Williams syndrome, to screen or identify drugs for treating Williams syndrome.

[0084] The above-described method for screening or identifying drugs for treating Williams syndrome utilizes the above-described nucleic acid composition, the above-described kit, or the above-described method for constructing an animal model of Williams syndrome to screen or identify drugs for treating Williams syndrome. Since the above-described animal model of Williams syndrome is a neurodevelopmental disorder animal model of Williams syndrome, it is more accurate for screening or identifying drugs related to Williams syndrome.

[0085] The following detailed description is provided with reference to specific embodiments. Unless otherwise specified, the embodiments do not include components other than unavoidable impurities. Unless otherwise specified, the reagents and instruments used in the embodiments are conventionally selected in the art. Experimental methods not specifying specific conditions in the embodiments are implemented according to conventional conditions, such as those described in literature, books, or methods recommended by the manufacturer.

[0086] Example 1

[0087] (a) Experimental materials

[0088] (1) Laboratory animals:

[0089] Sprague-Dawley (SD) rats, 8–10 weeks old, SPF grade (purchased from the Shanghai Branch of the National Rodent Experimental Animal Seed Center).

[0090] (2) Gene editing reagents:

[0091] Cas9 mRNA or Cas9 protein;

[0092] Two pairs of sgRNAs designed targeting the 5' end of the Gtf2i gene and the 3' end of the Trim50 gene;

[0093] The above-mentioned sgRNAs can be obtained through in vitro transcription or commercial synthesis.

[0094] (II) sgRNA Design Principles

[0095] Using the rat genome sequence as a reference, sgRNAs were designed in the key exon region upstream of the Gtf2i gene and the key exon region downstream of the Trim50 gene, respectively, to induce double-strand breaks in Cas9 at the two target sites, thereby deleting the complete genomic fragment between the two break points through the non-homologous end joining (NHEJ) mechanism.

[0096] sgRNA must meet the following conditions:

[0097] (1) High targeting efficiency and low off-target risk;

[0098] (2) The target site is located in a functionally critical region to ensure that the deletion is a stable genetic deletion;

[0099] (3) The two targets cover a continuous region of key WS genes.

[0100] The following sgRNAs were designed and synthesized in the key exon region upstream of the Gtf2i gene and the key exon region downstream of the Trim50 gene, respectively:

[0101] First sgRNA (SEQ ID NO:1): 5'-TGACCGATGTGTTATCTCGT-3';

[0102] Second sgRNA (SEQ ID NO:2): 5'-CAGTATAATGCGGCTGTAGC-3';

[0103] The third sgRNA (SEQ ID NO:3): 5'- GTCCGACTAAGTGAGGACGA -3';

[0104] Fourth sgRNA (SEQ ID NO:4): 5'-ACACCTTGGCAGCGCCTACC-3'.

[0105] (III) Construction of Gtf2i~Trim50 continuous gene knockout mice

[0106] 3.1 Construct plasmids containing the first, second, third, and fourth sgRNAs described above.

[0107] Using the CRISPR Design tool (http: / / crispr.mit.edu / ), two pairs of 20bp oligonucleotide sequences targeting the target DNA were designed based on their score to prepare sgRNA. The designed sequences were synthesized and purified by PAGE. The synthesized single-stranded oligonucleotide sgRNA sequences were annealed (95℃ for 5 min, then allowed to cool to room temperature) to form double-stranded DNA, and an sgRNA expression vector was constructed. The recombinant plasmid was transformed into DH5α competent cells. Positive clones were screened and identified by kanamycin resistance and target DNA sequencing. Correct colony clones were selected, expanded, and the plasmids were extracted for in vitro transcription template preparation. The sgRNA expression vector was linearized, purified by phenol-chloroform extraction, and used as a template for in vitro transcription. The HiScribe T7 Quick High Yield RNA Synthesis Kit was used for in vitro transcription of sgRNA, and the sgRNA was purified and recovered using a Monarch® centrifuge column RNA purification kit.

[0108] 3.2 Linearization and purification of plasmid DNA and in vitro transcription into mRNA with Cas9 nuclease

[0109] 3.3 Preparation of fertilized eggs

[0110] Cas9 mRNA (or Cas9 protein) is mixed with the first and second compositions in a certain proportion, wherein the first composition includes the first and second sgRNAs, and the second composition includes the third and fourth sgRNAs. This mixture is then injected into the cytoplasm or pronucleus of rat single-cell fertilized eggs. The specific steps are as follows: DAY 0-DAY 2: Female rats aged 4-6 weeks are given a superovulation injection. DAY 3: Sperm from male rats is collected and capativized. During sperm capacitation, the superovulated female rats are sacrificed, and oocytes are retrieved. Sperm is then added to the oocytes, and fertilized eggs are obtained after 12 hours of culture.

[0111] The final concentration of Cas9 mRNA was 400 ng / μL; the final concentration of each sgRNA was 200 ng / μL.

[0112] 3.4 Recipient mouse preparation and embryo transfer

[0113] 1) Preparation of pseudopregnant female mice: Select fertile female mice of appropriate age and mate them with male mice that have been sterilized after vasectomy to stimulate a series of pregnancy changes in the female mice and obtain pseudopregnant female mice, which will serve as recipient mice for transgenic fertilized eggs.

[0114] 2) After a short period of in vitro culture, the injected fertilized eggs were transplanted into the oviduct of a pseudopregnant female rat to obtain F0 generation rats.

[0115] 3) The F0 generation rats that were identified as positive were mated with wild-type rats to obtain the Gtf2i~Trim50 heterozygous F1 generation rats.

[0116] 4) Further crossbreed the above-mentioned F1 generation positive rats with SD rats for at least three generations to eliminate the potential off-target effects of CRISPR / Cas9 technology and obtain stable heterozygotes.

[0117] 5) The stable heterozygotes obtained in the above steps were mated with wild-type rats to obtain genetically stable Gtf2i~Trim50 heterozygous rats, which served as WS transgenic rat models.

[0118] 3.5 Genotyping

[0119] After the F0 generation rats were born and weaned, DNA was extracted from their tail tips. PCR amplification and Sanger sequencing were performed using specific primers targeting the target gene to screen offspring with integrated exogenous genes.

[0120] 3.5.1 Extraction and purification of gDNA from knockout mice

[0121] Take 2-3 mm of mouse tail / ear tissue and use Rebecca Biotech GP311-96 kit to extract tissue DNA using a 96-channel nucleic acid extractor with magnetic beads. For details, please refer to the relevant instructions of the kit.

[0122] 3.5.2 Genotyping using PCR and Sanger sequencing

[0123] The offspring rats bred through hybridization were genotyped based on toe genomic DNA using PCR and Sanger sequencing. The primers used included: a first amplification primer pair with the following sequences: forward primer (SEQ ID NO:5): 5'-GAGCTGGTCATGCTGTGAGA-3'; reverse primer (SEQ ID NO:6): 5'-CAGCCAATTCTACTGGGTTCTG-3'; and a second amplification primer pair with the following sequences: forward primer (SEQ ID NO:7): 5'-GCAGAGCGTTAAGTCATCCAGT-3'; reverse primer (SEQ ID NO:8): 5'-CTTGGTGCCGAGCATCCAAA-3'.

[0124] Understandably, the primers described above can also be used to identify the genotypes of F0 generation rats, F1 generation rats, F2 generation rats and their offspring.

[0125] The PCR amplification reaction system (25 μL) included: 1 μL rat tail tissue DNA sample, 1 μL F1 primer, 1 μL R1 primer, 12.5 μL Green Taq Mix (Vazyme P112-03), and 9.5 μL ddH2O.

[0126] PCR conditions: 95℃ 5 min → (98℃ 30 s → 65℃ (-0.5℃ / cycle) 30s → 72℃ 45 s) 20×cycle → (98℃ 30 s → 55℃ 30 s → 72℃ 45 s) 20×cycle → 72℃ 5 min → 10℃ hold.

[0127] After confirming the target band was correct by agarose gel electrophoresis, the remaining PCR amplification products were sequenced using the Sanger method.

[0128] 3.5.3 Single-core sequencing

[0129] Eight wild-type (WT) and heterozygous rats (two males and two females) at day 35 (P35) were selected. The anterior cingulate cortex (ACC), primary motor cortex (M1), and corpus callosum were isolated and sampled together to prepare a mononuclear suspension. High-quality nuclei were obtained through mechanical homogenization, filtration, and nuclear separation. Single-nuclear RNA sequencing libraries were constructed using the 10x Genomics platform, including single-nuclear encapsulation, reverse transcription, barcoding, and cDNA amplification. Sequencing was then performed on a high-throughput sequencing platform. The raw data underwent standard quality control, alignment, and expression matrix construction. Further normalization and removal of low-quality nuclei resulted in a high-confidence dataset. The UMAP method was then used for dimensionality reduction and visualization of the high-dimensional transcriptome data, and unsupervised clustering was used to segment different cell populations. Based on this, feature mapping analysis was performed on the expression of key genes.

[0130] (iv) General physiological phenotype assessment of transgenic mice

[0131] Body size photos were taken of rats at 35 days of age, and wild-type rats and heterozygous rats were weighed at 35, 42, 49 and 56 days of age, respectively.

[0132] (v) Behavioral assessment of transgenic mice

[0133] At 43 days of age, wild-type and heterozygous rats underwent ladder walking behavior testing. A 1-m horizontal metal ladder was used to assess the rats' fine motor coordination. The ladder bars were spaced 1–3 cm apart and arranged irregularly. Rats underwent two days of environmental acclimatization training before the experiment. During the formal test, the rats were placed at the starting point and spontaneously traversed the ladder to the finish line in a dark box. The entire process was recorded on video. Each rat completed three consecutive attempts, and the completion status and number of foot placement errors were recorded each time. The average of the three attempts was calculated for statistical analysis to assess motor coordination and sensorimotor integration.

[0134] At 56 days of age, wild-type and heterozygous rats underwent the first phase of a three-box social behavior test: a standard three-box setup was used to assess the rats' social interest behavior. At the start of the experiment, the rats were placed in the central area of ​​the setup and allowed to explore freely for 5 minutes to acclimatize. Subsequently, an age- and sex-matched unfamiliar social rat was placed in a wire cage on one side, while an empty cage was placed on the other side, allowing the rats to explore freely for 10 minutes. The entire process was video recorded. The time spent on the social rat side and the exploration time on the empty cage side were recorded to assess social preference behavior.

[0135] (vi) Results Analysis

[0136] Genotypes were determined by agarose gel electrophoresis and Sanger sequencing of the PCR products.

[0137] The criteria for determining genotype identification results are specifically based on PCR products:

[0138] Heterozygous: Both the first amplification primer (SEQ ID NO:5~6) (924 bp) and the second amplification primer (SEQ ID NO:7~8) (633 bp) showed bands;

[0139] Wild type: Only the band of the second amplification primer (SEQ ID NO:7~8) (633 bp) is visible.

[0140] Sanger sequencing is performed according to the KO-type reference sequence. If subsequent sequences are amplified, the embryo is identified as KO-type; if no subsequent sequences are amplified, it is identified as wild-type. Homozygous deletion causes embryo lethality.

[0141] Individuals that can simultaneously amplify short-fragment specific bands of the corresponding consecutively deleted alleles, and can still amplify long-fragment bands of wild-type alleles, are identified as Gtf2i~Trim50 consecutive deletion heterozygous positive individuals.

[0142] 6.1 Analysis of results for each rat genotype

[0143] ① Wild type: Using the first and second amplification primers respectively, perform the PCR procedure in step 3.5.2 according to the system described in 3.5.2. The PCR product of the second amplification primer has a 633 bp band. Sanger sequencing was performed on the PCR product, and the agarose gel electrophoresis image is shown below. Figures 1-2 As shown.

[0144] ② Heterozygous type: Using the first and second amplification primers respectively, perform the PCR procedure in step 3.5.2 according to the system in 3.5.2. The agarose gel electrophoresis image is shown below. Figures 1-2 As shown, the PCR products of the first and second amplification primers will show bands at positions 924bp and 633bp, respectively.

[0145] Figure 1 and Figure 2 In the image, lanes 140, 142, 143, 146, 148, 150, 151, and 192 represent electrophoresis images of PCR amplification products from heterozygous rats. This shows that the PCR products of the first and second primers show bands at positions 924 bp and 633 bp, respectively. The remaining lanes represent wild-type rats.

[0146] Figure 3 The results are from single-nuclear sequencing. The top image shows the WT group, and the bottom image shows the heterozygous knockout group. The comparison shows that after knockout, the expression levels of key genes Gtf2i, Gtf2ird1, Limk1, and Eln in multiple cell populations of heterozygous rat brain tissue were significantly lower than those in the WT group. This difference can be visually demonstrated by overlaying gene expression signals onto a UMAP map. This method can systematically reveal transcriptomic changes in mixed samples from multiple brain regions at single-nuclear resolution, providing a reliable technical means and experimental basis for research on related gene functions and disease mechanisms.

[0147] 6.2 General Physiological Phenotypic Assessment of Transgenic Mice

[0148] The results are as follows Figures 4-5 As shown, compared with the wild type, female heterozygous rats had significantly lower body weight at 35 days, 49 days and 56 days of age.

[0149] 6.3 Behavioral assessment of transgenic mice

[0150] The results are as follows Figure 6 As shown, compared with wild-type rats, heterozygous rats exhibited an increased number of incorrect steps during walking, demonstrating stable motor coordination dysfunction.

[0151] At 56 days of age, wild-type and heterozygous rats underwent the first phase of a three-box social behavior test. Results are as follows: Figure 7As shown, heterozygous rats showed a trend toward enhanced social behavior compared to wild-type rats, exhibiting an oversocial phenotype associated with Williams syndrome.

[0152] In summary, this application constructs a multi-gene heterozygous deletion model covering the continuous range from Gtf2i to Trim50 in rats, which compensates for the deficiency in existing Williams syndrome rat models that do not include the Trim50 gene in the deletion range. This makes the resulting animal model more closely resemble the actual genetic characteristics of clinical Williams syndrome patients in terms of deletion gene composition and gene dosage effect, thereby significantly improving the genetic simulation integrity and clinical relevance of the disease model.

[0153] Secondly, by introducing the aforementioned continuous multi-gene deletions into rats, a model species more suitable for conducting complex behavioral studies, the transgenic rats constructed in this application exhibited a stable and reproducible oversocial phenotype in the first phase of the three-box social behavior experiment, and this abnormal social behavior characteristic has a clear behavioral orientation.

[0154] Furthermore, the aforementioned technical effects enable the Williams syndrome transgenic rat model provided in this application to not only more realistically reflect the neurodevelopmental abnormalities caused by continuous multi-gene deletions, but also serve as a reliable research tool for the neurodevelopmental disorder Williams syndrome, suitable for applications such as disease mechanism research, intervention screening, and efficacy evaluation.

[0155] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0156] The embodiments described above are merely illustrative of several implementation methods of this application, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of this patent application. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.

Claims

1. A nucleic acid composition targeting a homologous region of the 7q11.23 region of human chromosome, characterized in that, The nucleic acid composition includes a first composition and a second composition. The first composition comprises a first sgRNA and a second sgRNA, the nucleotide sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. The second composition includes a third sgRNA and a fourth sgRNA, the nucleotide sequences of which are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

2. A gene inactivation kit targeting the homologous region of human chromosome 7q11.23, characterized in that, The kit comprises the nucleic acid composition as described in claim 1.

3. A method for constructing an animal model of Williams syndrome, characterized in that, Includes the following steps: A Williams syndrome animal model was constructed by editing the homologous region of the human chromosome 7q11.23 in the target animal using the CRISPR / Cas system to make the deletion length 1.0 Mb~1.2 Mb. The CRISPR / Cas system described herein comprises the nucleic acid composition as claimed in claim 1 and the Cas9 nuclease.

4. The method for constructing an animal model of Williams syndrome according to claim 3, characterized in that, The CRISPR / Cas system processes the fertilized eggs of the target animal.

5. The method for constructing an animal model of Williams syndrome according to claim 4, characterized in that, The CRISPR / Cas system transfers the nucleic acid composition and Cas9 nuclease into the fertilized egg through in vitro transcription into mRNA.

6. The method for constructing an animal model of Williams syndrome according to claim 5, characterized in that, The method by which the CRISPR / Cas system is transferred into the fertilized egg is microinjection; And / or, the concentration of the Cas9 nuclease is 50 ng / μL to 150 ng / μL; And / or, the concentrations of the first sgRNA, the second sgRNA, the third sgRNA, and the fourth sgRNA are each independently 20 ng / μL to 80 ng / μL.

7. The method for constructing an animal model of Williams syndrome according to claim 6, characterized in that, The construction method further includes the following steps: Fertilized eggs transferred into the CRISPR / Cas system were transplanted into pseudopregnant female animals and F0 generation was produced; The F0 generation was mated with the wild type to obtain the F1 generation heterozygotes. The F1 generation heterozygotes were then mated with the wild type, and the offspring with stable heterozygotes were selected as the animal model of Williams syndrome.

8. The method for constructing an animal model of Williams syndrome according to claim 7, characterized in that, The target animal is a mouse or a rat.

9. The method for constructing an animal model of Williams syndrome according to claim 8, characterized in that, The target animal is a rat, and the construction method further includes a step of genotyping the rat: Using genomic DNA extracted from rats as templates, PCR amplification was performed using the first amplification primer pair with forward primer sequence as shown in SEQ ID NO:5 and reverse primer sequence as shown in SEQ ID NO:6, and the second amplification primer pair with forward primer sequence as shown in SEQ ID NO:7 and reverse primer sequence as shown in SEQ ID NO:

8. The genotype of the homologous region of the human chromosome 7q11.23 in rats was then identified by electrophoresis.

10. A method for screening or identifying drugs for treating Williams syndrome, characterized in that, Using an animal model of Williams syndrome prepared by means of the nucleic acid composition as described in claim 1, the kit as described in claim 2, or the method for constructing an animal model of Williams syndrome as described in any one of claims 3 to 9, drugs for the treatment of Williams syndrome are screened or identified.