A kit for detecting gi-type norovirus, a detection method and application

Abstract

The application provides a kit for detecting GI-type norovirus, a detection method and application, and belongs to the technical field of immunological detection. The kit for detecting GI-type norovirus comprises an enzyme label plate coated with GI-type norovirus VP1 protein, HRP-labeled secondary antibody, positive control, negative control, sample diluent, cleaning solution, color developing solution and termination solution. The kit is specific and high in sensitivity, and can accurately detect whether GI-type norovirus is contained in a sample. The application can greatly improve the detection efficiency of front-line inspection and quarantine personnel at ports, and maximally prevent the occurrence of imported infectious diseases.

Description

Technical Field

[0001] This invention belongs to the field of immunological detection technology, and particularly relates to a kit, detection method and application for detecting GI type norovirus. Background Technology

[0002] With the rapid development of economy and trade, increasingly frequent international trade has broken down the ecological and geographical limitations of disease outbreaks and has become an important route for the spread of infectious diseases and their vectors, exacerbating the risk of cross-border transmission of infectious diseases. At present, border ports are facing enormous challenges and tests in dealing with imported infectious disease outbreaks, and rapid and sensitive immunological detection methods are urgently needed for the monitoring of infectious diseases at ports.

[0003] Norovirus, belonging to the genus Norovirus (NV) within the family Caliciviridae, is a group of morphologically similar viral particles with slightly different antigenicities. Norovirus-related infectious diarrhea is prevalent worldwide, occurring year-round, primarily affecting adults and school-aged children, with higher incidence during colder seasons. In the United States, norovirus causes 60%–90% of all non-bacterial diarrhea outbreaks annually. Similar results have been observed in other developed countries such as the Netherlands, the United Kingdom, Japan, and Australia. Norovirus is highly contagious and rapidly spreads due to its rapid mutation, strong environmental resistance, low infectious dose, short incubation period, long viral shedding period, short duration of immune protection, diverse transmission routes, and universal susceptibility. In my country, it has consistently been classified as a Class C infectious disease for reporting and management.

[0004] Currently, most methods for detecting norovirus use genetic testing, with fewer methods using immunoassay, especially at ports of entry where rapid and sensitive testing methods are lacking. Summary of the Invention

[0005] In view of this, one of the objectives of the present invention is to provide a kit for detecting GI norovirus.

[0006] A second objective of this invention is to provide the application of the kit in the non-diagnostic detection of type GI norovirus.

[0007] The third objective of this invention is to provide a method for detecting type GI norovirus for non-diagnostic purposes.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution: A kit for detecting GI norovirus includes: an ELISA plate coated with GI norovirus VP1 protein, HRP-labeled secondary antibody, positive control, negative control, sample diluent, washing buffer, chromogenic solution, and stop solution.

[0009] Preferably, the method for preparing GI norovirus VP1 protein includes the following steps: The gene encoding the VP1 protein of type GI norovirus was ligated into a prokaryotic expression vector to obtain a recombinant prokaryotic expression vector; The recombinant prokaryotic expression vector was transformed into prokaryotic cells to obtain recombinant engineered bacteria; The recombinant engineered bacteria were induced to express the protein using IPTG, and the resulting induced bacterial cells contained the GI type norovirus VP1 protein.

[0010] Preferably, the amino acid sequence of the GI norovirus VP1 protein is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding the GI norovirus VP1 protein is shown in SEQ ID NO.2.

[0011] Preferably, the method for preparing an ELISA plate coated with GI norovirus VP1 protein includes the following steps: Norovirus VP1 protein of type GI was diluted with coating diluent and added to an ELISA plate. The plate was coated at 4°C for 14-18 hours, then blocked with blocking buffer and dried to obtain an ELISA plate coated with norovirus VP1 protein of type GI.

[0012] Preferably, the coating diluent is 0.05M carbonate buffer; the coating concentration of GI norovirus VP1 protein is 5 μg / mL; and the blocking buffer is 0.02M PBS buffer containing 5% w / v sucrose, 2.5% w / v casein, and 1% w / v BSA.

[0013] Preferably, the sample diluent is a 0.02M PBS buffer containing 10 g / L sucrose and 5 g / L casein; the washing buffer is a 0.02M PBS buffer containing 0.05% v / v Tween 20.

[0014] Preferably, the HRP-labeled secondary antibody is composed of HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-human IgG in a mass ratio of 1:1.

[0015] The present invention also provides the application of the kit in the detection of type GI norovirus for non-diagnostic purposes.

[0016] This invention also provides a method for detecting type GI norovirus for non-diagnostic purposes, comprising the following steps: Add the sample to be tested to an ELISA plate coated with GI norovirus VP1 protein, incubate, and wash the plate; Add HRP-labeled secondary antibody, incubate, and wash the plate; Add colorimetric reagent to develop color, add stop solution to terminate the reaction, and measure OD. 450 value.

[0017] Preferably, when OD 450 A value greater than the cut-off value is considered positive (OD). 450 If the value is less than or equal to the cut-off value, it is considered negative.

[0018] Compared with the prior art, the present invention has the following beneficial effects: This invention provides a kit for detecting Norovirus G1 (GI). This kit allows for rapid, simple, and sensitive detection of Norovirus G1 antibodies. It exhibits high specificity and sensitivity, accurately detecting the presence of Norovirus G1 in samples. This invention can significantly improve the detection efficiency of frontline inspection and quarantine personnel at ports of entry, maximizing the prevention of imported infectious diseases. Attached Figure Description

[0019] Figure 1 Electrophoresis results for VP1 protein of type GI norovirus; Figure 2 Western blotting results for VP1 protein of type GI norovirus. Detailed Implementation

[0020] This invention provides a kit for detecting GI norovirus, comprising: an enzyme-linked immunosorbent assay (ELISA) plate coated with GI norovirus VP1 protein, HRP-labeled secondary antibody, positive control, negative control, sample dilution buffer, washing buffer, chromogenic solution, and stop solution.

[0021]

[0022] In this invention, the method for preparing GI norovirus VP1 protein includes the following steps: ligating the gene encoding GI norovirus VP1 protein into a prokaryotic expression vector to obtain a recombinant prokaryotic expression vector; transforming the recombinant prokaryotic expression vector into prokaryotic cells to obtain recombinant engineered bacteria; inducing expression of the recombinant engineered bacteria with IPTG, and obtaining induced bacterial cells containing the GI norovirus VP1 protein.

[0023] In this invention, the nucleotide sequence of the gene encoding the VP1 protein of type GI norovirus is preferably as shown in SEQ ID NO.2; the nucleotide sequence of the gene encoding the VP1 protein of type GI norovirus is preferably prepared by gene synthesis, and the preparation steps are not particularly limited, and conventional gene synthesis steps in the art can be used. The prokaryotic expression vector is preferably a PET-28a(+) expression vector; when the prokaryotic expression vector is a PET-28a(+) expression vector, the gene encoding the VP1 protein of type GI norovirus is preferably inserted between the Bam HI and Hind III double restriction sites. This invention does not particularly limit the specific steps for constructing the recombinant prokaryotic expression vector, and conventional recombinant expression vector construction steps in the art can be used.

[0024] The prokaryotic cells used in this invention are preferably competent Escherichia coli cells, more preferably Escherichia coli BL21(DE3). This invention does not impose any particular limitation on the method for transforming the recombinant prokaryotic expression vector into prokaryotic cells; conventional steps in the art are sufficient.

[0025] The recombinant engineered bacteria obtained in this invention are preferably activated in Kan-resistant LB medium, preferably for 16 hours. After activation, the recombinant engineered bacteria are induced to express proteins using IPTG. The final concentration of IPTG in the bacterial culture is preferably 0.6-1.2 mmol / L, more preferably 0.7-1 mmol / L, and even more preferably 0.8 mmol / L. The induction culture temperature is preferably 36-38℃, more preferably 37℃. The induction culture time is preferably 3-5 hours, more preferably 4 hours. After induction culture, the bacterial culture is centrifuged to collect the bacterial cells. The centrifugation speed is preferably 5500-6500 rpm. The preferred time is 10 min; the collected bacterial cells are resuspended in Tris-HCl buffer, the preferred concentration of which is 20 mmol / L and the preferred pH is 8.0; after resuspending, the cells are sonicated under ice bath conditions, and the supernatant after sonication is collected by centrifugation. The present invention does not have any special limitation on the steps of sonication and centrifugation, and conventional sonication and centrifugation steps in the art can be used; the supernatant is preferably purified by Ni2+-NTA agarose gel column, and the norovirus VP1 protein eluted with 250 mM imidazole is preferably collected, and the protein is concentrated and ultrafiltered by 10 kDa ultrafiltration centrifuge tube to obtain the GI type norovirus VP1 protein.

[0026] In this invention, the method for preparing an ELISA plate coated with GI norovirus VP1 protein includes the following steps: diluting the GI norovirus VP1 protein with coating diluent and adding it to the ELISA plate, coating at 4°C for 14-18 hours, then blocking with blocking solution, and drying after blocking to obtain an ELISA plate coated with GI norovirus VP1 protein.

[0027] In the method for preparing an ELISA plate coated with GI norovirus VP1 protein of the present invention, the coating dilution solution is preferably 0.05M carbonate buffer; the coating concentration of GI norovirus VP1 protein is 5 μg / mL; coating is preferably performed at 4°C for 15-17 h, more preferably for 16 h; the blocking solution is 0.02M PBS (pH 7.4) buffer containing 5% w / v sucrose, 2.5% w / v casein, and 1% w / v BSA; the blocking temperature is preferably 37°C; and the obtained ELISA plate coated with GI norovirus VP1 protein is preferably stored at 2-8°C.

[0028] In this invention, the sample diluent is preferably a 0.02M PBS (pH 7.4) buffer containing 10 g / L sucrose and 5 g / L casein; the washing solution is a 0.02M PBS (pH 7.4) buffer containing 0.05% v / v Tween 20. All concentrations of the components in this invention refer to their final concentrations in solution.

[0029] In this invention, the HRP-labeled secondary antibody is composed of HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-human IgG in a mass ratio of 1:1.

[0030] In this invention, the positive control is rabbit positive serum against GI norovirus VP1 protein, and its preparation includes the following steps: the gene encoding GI norovirus VP1 protein is sequence optimized, and combined with the CureVac mRNA technology platform, a suitable coding region sequence (nucleotide sequence as shown in SEQ ID NO.2) is selected, and an EcoRI restriction site and an IL-6 signal peptide sequence (nucleotide sequence as shown in SEQ ID NO.3: tccaggagctcagctatgaactccttctccacaagcgccttcggtccagttgccttctccctg gggctgctcctggtgttgcctgct) are added to the 5' end, and a BamHI restriction site and a 120bp poly A tail are added to the 3' end. The designed sequence is synthesized by Nanjing GenScript Biotech Co., Ltd., and inserted into the MCS site of the pBluescript II KS(+) plasmid to prepare a recombinant plasmid. The recombinant plasmid was linearized by a single enzyme digestion to obtain a linearized DNA template. The DNA template was then used for in vitro mRNA transcription using the HiScribe® T7 High Yield RNA Synthesis Kit. The transcribed mRNA was precipitated using LiCl precipitation and then capped in vitro using a vaccinia virus capping system and mRNACap2'-O-methyltransferase. In vitro mRNA transfection was performed on New Zealand white rabbits using the EZ poly™ in vivo mRNA transfection reagent, administered via intramuscular injection three times at two-week intervals. After the third immunization, antiserum was collected from the ear vein. The titer of the antiserum was detected by indirect ELISA, with a titer ≥1:128000. Antiserum collected 10 days after the booster immunization served as the positive control. The negative control was serum from unimmunized New Zealand white rabbits.

[0031] This invention also provides the application of the kit in the non-diagnostic detection of GI norovirus. This invention can be used for the detection of GI norovirus in import and export quarantine; it can also be used in scientific research on GI norovirus, possessing the advantages of high sensitivity and strong specificity.

[0032] This invention also provides a method for detecting GI norovirus for non-diagnostic purposes, comprising the following steps: adding the sample to be tested to an ELISA plate coated with GI norovirus VP1 protein, incubating, and washing the plate; adding HRP-labeled secondary antibody, incubating, and washing the plate; adding chromogenic solution for color development, adding stop solution to terminate the reaction, and measuring OD. 450Value. The colorimetric solution described in this invention is preferably a TMB colorimetric solution; the stop solution is preferably a 2M sulfuric acid solution.

[0033] In this invention, when OD 450 A value greater than the cut-off value is considered positive, meaning the sample contains type GI norovirus; OD 450 A value ≤ cut-off is considered negative, meaning the sample does not contain type GI norovirus. The cut-off value is the OD obtained from testing 60 human negative serum samples. 450 Absorbance value, calculate cut-off value = mean + 3 × variance (Vcut-off = X + 3 × SD).

[0034] The enzyme-labeled plate of this invention is coated with GI norovirus VP1 protein. Anti-VP1 protein antibodies in positive controls or positive samples will specifically bind to GI norovirus VP1 protein. After being captured by HRP-labeled secondary antibody, TMB chromogenic solution is added. Horseradish peroxidase on the HRP-labeled secondary antibody reacts chemically with the substrate chromogenic solution to produce luminescence. The intensity of the luminescence is positively correlated with the content of GI norovirus in the sample solution.

[0035] In a specific embodiment of the present invention, the ELISA plate was purchased from Nunc, the ELISA reader was purchased from Thermo Fisher Scientific, the TMB chromogenic solution was purchased from Beijing Solarbio Biotechnology Co., Ltd., the mixed fluorescent secondary antibody of HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-human IgG was purchased from Jackson Immuno Research, and the HiScribe® T7 High Yield RNA Synthesis Kit was purchased from NEB.

[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1 A kit for detecting GI norovirus includes: an ELISA plate coated with GI norovirus VP1 protein, HRP-labeled secondary antibody, positive control, negative control, sample diluent, washing buffer, chromogenic solution, and stop solution.

[0038] The preparation method of GI norovirus VP1 protein is as follows: The gene sequence (SEQ ID NO.2) encoding the VP1 protein of type GI norovirus was synthesized by gene synthesis and ligated between the BamHI and Hind III restriction sites of the pET-28a(+) prokaryotic expression vector to obtain the recombinant prokaryotic expression vector.

[0039] The recombinant prokaryotic expression vector was transformed into Escherichia coli BL21(DE3). After activation in Kan-resistant LB medium for 16 h, IPTG was added to a final concentration of 0.8 mmol / L. Expression was induced at 37 °C for 4 h. The bacterial culture was collected, and the bacterial cells were collected after centrifugation at 6000 rpm for 10 min. The collected bacterial cells were resuspended in Tris-HCl buffer (20 mmol / L, pH 8.0) and then sonicated under ice bath conditions. After disruption, the supernatant was collected by centrifugation and purified by Ni2+-NTA agarose gel column. Norovirus VP1 protein was obtained by elution with 250 mM imidazole. Then, the protein was concentrated and ultrafiltered using a 10 kDa concentrating ultrafiltration centrifuge tube to obtain GI norovirus VP1 protein.

[0040] The method for preparing an ELISA plate coated with GI norovirus VP1 protein is as follows: Norovirus VP1 protein of type GI was diluted to a final concentration of 5 μg / mL with coating dilution buffer (0.05 M carbonate buffer). 100 μL was added to each well of the microplate and coated at 4 °C for 16 hours. After coating, the liquid was discarded, and the plate was blocked with blocking buffer (0.02 M PBS (pH 7.4) buffer containing 5% w / v sucrose, 2.5% w / v casein, and 1% w / v BSA). After adding the blocking buffer, the plate was incubated at 37 °C for 2 hours. The blocking buffer was then discarded, and the plate was dried at 37 °C for 4 hours. The plate was then stored at 2-8 °C.

[0041] HRP-labeled secondary antibody: HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-human IgG were composed at a mass ratio of 1:1; the working concentration was obtained by diluting with sample diluent at a mass ratio of 1:3000.

[0042] Positive control: The positive control was rabbit positive serum against GI norovirus VP1 protein, prepared as follows: The gene encoding GI norovirus VP1 protein was sequence optimized, and a suitable coding region sequence (nucleotide sequence as shown in SEQ ID NO.2) was selected using the CureVac mRNA technology platform. An EcoRI restriction site and an IL-6 signal peptide sequence (nucleotide sequence as shown in SEQ ID NO.3) were added to the 5' end, and a 120bp poly A tail and a BamHI restriction site were added to the 3' end. The resulting plasmid was synthesized by Nanjing Genscript Biotech Co., Ltd., and inserted into the MCS site of the pBluescript II KS(+) plasmid to prepare a recombinant plasmid. The recombinant plasmid was digested with a linearized single enzyme to obtain a linearized DNA template. The DNA template was used for in vitro transcription of mRNA using the HiScribe® T7 High Yield RNA Synthesis Kit. After transcription, the mRNA was precipitated using LiCL precipitation, and then capped in vitro using a vaccinia virus capping system and mRNA Cap2'-O-methyltransferase. In vitro mRNA transfection was performed on New Zealand white rabbits using EZ poly™ in vivo mRNA transfection reagent, administered via intramuscular injection three times, with each injection spaced two weeks apart. After the third immunization, blood was collected from the ear vein to collect antiserum. The titer of the antiserum was detected by indirect ELISA. Antiserum with a titer ≥1:128000 was collected 10 days after the booster immunization and served as a positive control.

[0043] Negative control: serum from non-immunized New Zealand white rabbits.

[0044] Sample dilution buffer: 0.02M PBS (pH 7.4) buffer containing 10g / L sucrose and 5g / L casein.

[0045] Washing solution: 0.02M PBS (pH 7.4) buffer containing 0.05% v / v Tween 20.

[0046] Developing solution: TMB developing solution.

[0047] Termination solution: 2M sulfuric acid solution Example 2 A method for detecting type GI norovirus for non-diagnostic purposes, using the kit provided in Example 1, comprises the following steps: The sample was diluted with sample diluent at a mass ratio of 1:100 to obtain the sample to be tested; Add 100 μL of the sample to be tested to an ELISA plate coated with GI norovirus VP1 protein and incubate at room temperature for 45 min. After incubation, discard the liquid and wash the plate (add 300 μL of washing buffer to each well, soak for 10 seconds, shake off the washing buffer, pat dry on absorbent paper, and repeat three times). Add 100 μL of HRP-labeled secondary antibody to each well and incubate at room temperature for 30 min. After incubation, discard the liquid and wash the plate (add 300 μL of washing buffer to each well, soak for 10 seconds, shake off the washing buffer, pat dry on absorbent paper, and repeat three times). Add 100 μL of TMB chromogenic solution to each well and develop color at room temperature in the dark for 10 min. Add 50 μL of stop solution to each well to stop the reaction. Measure the OD using a microplate reader. 450 Values. Among them, the positive control OD... 450 ≥1.2, negative control OD 450 ≤0.2, when OD 450 A value greater than the cut-off value is considered positive, meaning the sample contains type GI norovirus; OD 450 A result ≤ cut-off value is considered negative, meaning the sample does not contain type GI norovirus. The cut-off value is calculated by testing 60 negative samples and obtaining the OD value. 450 Absorbance value, calculate cut-off value = mean + 3 × variance (Vcut-off = X + 3 × SD).

[0048] Example 3 Performance verification of the kit in Example 1 and the method in Example 2.

[0049] 1. Results of VP1 protein expression in type GI norovirus: The obtained GI norovirus VP1 protein was subjected to protein electrophoresis. The molecular weight of the norovirus strain protein should be 58.64 kDa. A clear band around 58 kDa was observed in the protein electrophoresis image. See [link to electrophoresis image]. Figure 1 The results of the western blot are shown below. Figure 2 .

[0050] 2. Potency results of the positive control: The potency of the positive control was determined using the kit described in Example 1 and the method described in Example 2. The positive control was diluted with sample diluent at ratios of 1:1000, 1:2000, 1:4000, 1:8000, 1:16000, 1:32000, 1:64000, 1:128000, 1:256000, and 1:512000. The negative sample was serum from non-immunized New Zealand white rabbits. The OD of the positive control was... 450 >2.1 times the OD of negative serum 450 Valence. The results are shown in Table 1.

[0051] Table 1 Positive control titer

[0052] According to the results in Table 1, the titer of the positive control was 1:128000.

[0053] 3. Determining the cut-off value: Sixty negative samples were tested using the kit from Example 1 and the method from Example 2 to obtain OD values. 450 The absorbance was calculated, and the cut-off value was calculated as mean + 3 × variance (Vcut-off = X + 3 × SD). The results are shown in Table 2.

[0054] Table 2 Determination of cut-off value

[0055] Based on the formula cut-off value = mean + 3 × variance (Vcut-off = X + 3 × SD), the cut-off value is calculated to be 0.54. When OD... 450 A value >0.54 is considered positive (OD). 450 ≤0.54 is negative.

[0056] 4. Specific detection: The kit from Example 1 and the method from Example 2 were used to conduct experiments to detect GI norovirus-negative serum (clinically diagnosed as negative), while also detecting the positive and negative controls in the kit. The results are shown in Table 3.

[0057] Table 3 Specific detection results

[0058] Note: "-" indicates a negative test result, and "+" indicates a positive test result.

[0059] Judgment criteria: OD 450 >0.54 is considered positive; OD 450 ≤0.54 is considered negative; negative control OD≤0.2, positive control ≥1.2.

[0060] Specificity (true negative rate) refers to the proportion of samples that are actually negative but are judged as negative. It is calculated by dividing the proportion of true negatives by the proportion of (true negatives + false positives) (Crowther JR. The ELISA Guidebook [M]. Humana Press, 2009, p. 315.).

[0061] Based on the results in Table 3, the specificity of this kit is determined to be 98.94%. This invention can specifically identify type GI norovirus, indicating that this invention has high specificity.

[0062] 5. Sensitivity testing: The kit from Example 1 and the method from Example 2 were used to detect 94 serum samples that were clinically diagnosed as positive for type GI norovirus. Positive and negative controls from the kit were also tested. The results are shown in Table 4.

[0063] Table 4 Detection Sensitivity

[0064] Note: "-" indicates a negative test result, and "+" indicates a positive test result.

[0065] Judgment criteria: OD 450 >0.54 is considered positive; OD 450 ≤0.54 is considered negative; negative control OD≤0.2, positive control ≥1.2.

[0066] Sensitivity (true positive rate) refers to the proportion of samples that are actually positive but are judged as positive. It is calculated by dividing the proportion of true positives by the proportion of (true positives + false negatives) (Crowther JR. The ELISA Guidebook [M]. Humana Press, 2009, p. 315.).

[0067] Table 4 shows that the sensitivity of this kit is 95.74%, indicating that the present invention can accurately identify type GI norovirus, demonstrating that the present invention has high sensitivity.

[0068] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A kit for detecting GI norovirus, characterized in that, include: ELISA plate coated with GI norovirus VP1 protein, HRP-labeled secondary antibody, positive control, negative control, sample dilution buffer, washing buffer, chromogenic solution and stop solution; The preparation method of GI norovirus VP1 protein includes the following steps: The gene encoding the VP1 protein of type GI norovirus was ligated into a prokaryotic expression vector to obtain a recombinant prokaryotic expression vector; The recombinant prokaryotic expression vector was transformed into prokaryotic cells to obtain recombinant engineered bacteria; The recombinant engineered bacteria were induced to express the protein by IPTG, and the induced bacterial cells contained the GI type norovirus VP1 protein. The amino acid sequence of the GI norovirus VP1 protein is shown in SEQ ID NO.1, and the nucleotide sequence of the gene encoding the GI norovirus VP1 protein is shown in SEQ ID NO.2; The sample diluent was a 0.02M PBS buffer containing 10 g / L sucrose and 5 g / L casein.

2. The reagent kit according to claim 1, characterized in that, The method for preparing an ELISA plate coated with GI norovirus VP1 protein includes the following steps: Norovirus VP1 protein of type GI was diluted with coating diluent and added to an ELISA plate. The plate was coated at 4°C for 14-18 hours, then blocked with blocking buffer and dried to obtain an ELISA plate coated with norovirus VP1 protein of type GI.

3. The reagent kit according to claim 2, characterized in that, The coating diluent was 0.05M carbonate buffer; the coating concentration of GI norovirus VP1 protein was 5 μg / mL; the blocking buffer was 0.02M PBS buffer containing 5% w / v sucrose, 2.5% w / v casein, and 1% w / v BSA.

4. The reagent kit according to claim 1, characterized in that, The washing solution is a 0.02M PBS buffer containing 0.05% v / v Tween 20.

5. The reagent kit according to claim 1, characterized in that, The HRP-labeled secondary antibody is composed of HRP-labeled goat anti-rabbit IgG and HRP-labeled goat anti-human IgG in a mass ratio of 1:

1.

6. The use of the kit according to any one of claims 1 to 5 in the detection of type GI norovirus for non-diagnostic purposes.

7. A method for detecting type GI norovirus for non-diagnostic purposes, characterized in that, The detection using the kit according to any one of claims 1 to 5 includes the following steps: Add the sample to be tested to an ELISA plate coated with GI norovirus VP1 protein, incubate, and wash the plate; Add HRP-labeled secondary antibody, incubate, and wash the plate; Add colorimetric reagent to develop color, add stop solution to terminate the reaction, and measure OD. 450 value.

8. The method according to claim 7, characterized in that, When OD 450 A value greater than the cut-off value is considered positive (OD). 450 If the value is less than or equal to the cut-off value, it is considered negative.

Images