Artificial microRNAs targeting SNCA

By using artificial microRNA molecules that target SNCA mRNA and combining them with AAV vectors for gene therapy, the problem of existing treatments being unable to effectively reduce SNCA symptoms has been solved, achieving significant efficacy and improved quality of life in synucleinosis.

CN122641683APending Publication Date: 2026-08-25GENZYME CORP
View PDF 14 Cites 0 Cited by

Patent Information

Application Number
CN202580011729.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-04-25
Filing Date
2025-01-24
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

Current treatments for synucleinosis primarily target symptoms and cannot significantly reduce SNCA symptoms, resulting in ineffective relief of neurotoxicity and regional brain atrophy.

Method used

Artificial microRNA molecules targeting SNCA mRNA are used. By designing specific guide strand and non-guide strand sequences, a double strand is formed to target the SNCA gene and reduce its expression. Gene therapy is then carried out in combination with AAV vectors.

Benefits of technology

It significantly improves quality of life and slows disease progression, and can be widely used in neurodegenerative synucleinopathies, including Parkinson's disease and multiple system atrophy, by reducing SNCA protein expression and aggregation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

Provided herein are artificial microRNA (miRNA) molecules for treating synucleinopathies. In some embodiments, these miRNA molecules target the expression of SNCA protein. Further provided herein are expression constructs, vectors (e.g., rAAV), cells, viral particles, and pharmaceutical compositions containing these artificial miRNA molecules. Still further provided herein are methods and kits related to the use of these miRNA molecules, e.g., for treating synucleinopathies including Parkinson’s disease, multiple system atrophy, or Lewy body dementia.
Need to check novelty before this filing date? Find Prior Art

Description

Cross-reference to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 625,856, filed January 26, 2024, and U.S. Provisional Application No. 63 / 638,871, filed April 25, 2024, the contents of which are incorporated herein by reference in their entirety. Reference to electronic sequence listing

[0002] The contents of the electronic sequence list (159792018940seqlist.xml; size: 39,522 bytes; and creation date: January 23, 2025) are incorporated herein by reference in their entirety. Technical Field

[0003] This disclosure relates to artificial miRNA molecules. In some aspects, this disclosure relates to artificial miRNA molecules that reduce α-synuclein expression. Background Technology

[0004] The accumulation of α-synuclein (e.g., synuclein α or SNCA) drives neurotoxicity and regional brain atrophy in a group of neurodegenerative diseases called synucleinopathy (like Parkinson's disease). Current treatments for synucleinopathy are largely symptomatic and supportive, and none have been shown to significantly reduce SNCA symptoms. Summary of the Invention

[0005] This disclosure provides artificial microRNA (miRNA) molecules that target human SNCA mRNA. Gene therapy using artificial miRNAs targeting SNCA supports significant improvements in quality of life and slows disease progression. The constructs described herein have broad commercial applicability in neurodegenerative synucleinopathy.

[0006] On one hand, this disclosure provides an artificial miRNA comprising a first strand and a second strand, wherein (a) The first chain and the second chain form a double chain; (b) The first strand contains a guide region that contains a nucleotide sequence having at least about 90% or at least about 95% identity with the following sequence: SEQ ID NO: 1(5'-SEQ ID-3')、SEQ ID NO: 2(5'-SEQ ID NO: 2(5'-SEQ ID NO: 3(5'-SEQ ID-3' 4(5′-SEQ ID NO: 5(5′-SEQ ID NO: 5(5′-SEQ ID NO: 6(5′-SEQ ID NO: 3′)QNO:SE、 7(5'-SEQ ID NO: 8(5'-SEQ ID NO: 8(5'-SEQ IDNO: 9(5'-SEQ ID-3')、) 10(5'-SET-3')、SEQ ID NO: 11(5'-SEQ ID NO: 12(5'-SEQ ID NO: 12(5'-AACCGCCACUUCUASEQACCUUCAID〉ID-3') 13(5'-UAACCGCCACUUCUACUACUACUACUACUU-3')、SEQ IDNO: 14(5'-SEQ ID NO: 15(5'-SEQ ID NO: NUMBER:-3') 16(5'-SEQ ID NO: 17(5'-CCCCCACUGCAUUUCGGUG-3')、SEQ ID NO: 18(5'-SEQ ID-3') NO:19(5'-SEQ ID NO: 20(5'-SEQ IDNO: 20(5'-SEQ IDNO: 21(5'-SEQ ID NO:-3') 22(5'-REQUEST-3')、SEQ ID NO: 23(5'-SEQ ID NO: 23(5'-SEQ ID NO:SEQ ID NO: 24 (5'-UGACAAUAUAAUAUUCGAU-3'), SEQ ID NO: 25 (5'-GACAAUAAAAUAUUCGAUU-3'), SEQ ID NO: 26 (5'-GAAGGUUAAAGUGGCGGUU-3'), SEQ ID NO: 27 (5'-AAGGUUAGAGUGGCGGUUA-3') or SEQ ID NO: 28 (5'-CCUCAUAUCUCCACGGUUG-3'); and (c) The second strand (lazy strand) contains a non-guided region containing a nucleotide sequence that is fully or partially complementary to the nucleotide sequence of the guide region.

[0007] Sequence: SEQ ID NO: 1(5'-UUCGUAGUACCUCU-UUGACCUUCU-QUAQUUQ)ID NO: 2(5'-GUUCGUAGUCUUGAUACCCUU-3')、SEQ IDNO: 3(5'-UACCGAAAUGCUGAGUGGGGG-3')、SEQ ID NO: 4(5'-AUCGUAGAUUGAAGCCACAAA-3'(SEQ IDNO: 5(5'-UAUCGUAGAUUGAAGCCACAA-3')、SEQ ID NO: 6(5'-AACAUCGUAGAUUGAAGCCAC-3')、SEQ ID NO: 7(5'-AUACGUCAUUAUUCUUAGACA-3')、Q ID NO: 8(5'-AAUACGUCAUUAUUCUUAGAC-3')、SEQ ID NO: 9(5'-AUUUCGAGACAAAAAUAACAA-3')、SEQ ID NO: 10(5'-GUCGAAUAUUAUUUUUGUCA-3') SEQ ID NO: NO 11(5'-GGUCGAAUAUUAUUUUUGUC-3')、SEQ ID NO: 12(5'-AACCGCCACUUUCUAACCUUC-3')、SEQ IDNO: 13(5'-UAACCGCACUUUCUAACCUU-3') SEQ ID NO: 14(5'-UGACCGUGGAGUCAUGAGG-3')、SEQ ID NO: 15(5'-GAAGGGUAAAGACUACGAA-3')、SEQ ID NO: 16(5'-AAGGGUAUAGACUACGAAU-3')、 ID NO: NO 17(5'-CCCCCACUGCAUUUCGGUG-3')、SEQ ID NO:18(5'-UUUGUGGCCAAUCUACGAU-3')、SEQ ID NO: 19(5'-UUGUGGCUAAUCUACGAUG-3')SEQ ID NO: 20(5'-GUGGCUUCUACGAUGUU-3')、SEQ ID NO: 21(5'-UGUCUAAGUAAUGACGUAU-3')、SEQ ID NO: 22(5'-GUCUAAGAAUGACGUAUU-3')、Q ID NO: 23(5'-UUGUUAUUUGUCUCGAAAU-3')、SEQ ID NO:24 (5'-UGACAAUAUAAUAUUCGAU-3'), SEQ ID NO: 25 (5'-GACAAUAAAAUAUUCGAU-3'), SEQ ID NO: 26 (5'-GAAGGUUAAAGUGGCGGUU-3'), SEQ ID NO: 27 (5'-AAGGUUAGAGUGGCGGUUA-3') or SEQ ID NO: 28(5'-CCUCAUAUUCUCCACGGUUG-3').

[0008] In one embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 1 (5'-UUCGUAGUCUUGAUACCCUUC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 15 (5'-GAAGGGUAAAGACUACGAA-3'). In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 1 (5'-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 15 (5'-GAAGGGUAAAGACUACGAA-3').

[0009] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 2 (5'-GUUCGUAGUCUUGAUACCCUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 16 (5'-AAGGGUAUAGACUACGAAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 2 (5'-GUUCGUAGUCUUGAUACCCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 16 (5'-AAGGGUAUAGACUACGAAU-3').

[0010] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 3 (5'-UACCGAAAUGCUGAGUGGGGG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 17 (5'-CCCCCACUGCAUUUCGGUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 3 (5'-UACCGAAAUGCUGAGUGGGGG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 17 (5'-CCCCCACUGCAUUUCGGUG-3').

[0011] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 4 (5'-AUCGUAGAUUGAAGCCACAAA-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 18 (5'-UUUGUGGCCAAUCUACGAU-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 4 (5'-AUCGUAGAUUGAAGCCACAAA-3'), and the non-guide region comprises the sequence of SEQ ID NO: 18 (5'-UUUGUGGCCAAUCUACGAU-3').

[0012] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 5 (5'-UAUCGUAGAUUGAAGCCACAA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 19 (5'-UUGUGGCUAAUCUACGAUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 5 (5'-UAUCGUAGAUUGAAGCCACAA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 19 (5'-UUGUGGCUAAUCUACGAUG-3').

[0013] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 6 (5'-AACAUCGUAGAUUGAAGCCAC-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 20 (5'-GUGGCUUCUCUACGAUGUU-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 6 (5'-AACAUCGUAGAUUGAAGCCAC-3'), and the non-guide region comprises the sequence of SEQ ID NO: 20 (5'-GUGGCUUCUCUACGAUGUU-3').

[0014] In another embodiment, the guide sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 7 (5'-AUACGUCAUUAUUCUUAGACA-3'), and the non-guide region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 21 (5'-UGUCUAAGUAAUGACGUAU-3'). In one such embodiment, the guide sequence comprises the sequence of SEQ ID NO: 7 (5'-AUACGUCAUUAUUCUUAGACA-3'), and the non-guide region comprises the sequence of SEQ ID NO: 21 (5'-UGUCUAAGUAAUGACGUAU-3').

[0015] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 8 (5'-AAUACGUCAUUAUUCUUAGAC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 22 (5'-GUCUAAGAAAUGACGUAUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 8 (5'-AAUACGUCAUUAUUCUUAGAC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 22 (5'-GUCUAAGAAAUGACGUAUU-3').

[0016] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 9 (5'-AUUUCGAGACAAAAAUAACAA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 23 (5'-UUGUUAUUUGUCUCGAAAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 9 (5'-AUUUCGAGACAAAAAUAACAA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 23 (5'-UUGUUAUUUGUCUCGAAAU-3').

[0017] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 10 (5'-GUCGAAUAUUAUUUAUUGUCA-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 24 (5'-UGACAAUAUAAUAUUCGAU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 10 (5'-GUCGAAUAUAUUUAUUGUCA-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 24 (5'-UGACAAUAUAAUAUUCGAU-3').

[0018] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 11 (5'-GGUCGAAUAUUAUUUAUUGUC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 25 (5'-GACAAUAAAAUAUUCGAUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 11 (5'-GGUCGAAUAUUAUUUAUUGUC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 25 (5'-GACAAUAAAAUAUUCGAUU-3').

[0019] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 12 (5'-AACCGCCACUUUCUAACCUUC-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 26 (5'-GAAGGUUAAAGUGGCGGUU-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 12 (5'-AACCGCCACUUUCUAACCUUC-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 26 (5'-GAAGGUUAAAGUGGCGGUU-3').

[0020] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 13 (5'-UAACCGCCACUUUCUAACCUU-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 27 (5'-AAGGUUAGAGUGGCGGUUA-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 13 (5'-UAACCGCCACUUUCUAACCUU-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 27 (5'-AAGGUUAGAGUGGCGGUUA-3').

[0021] In another embodiment, the guiding sequence comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 14 (5'-UGACCGUGGAGUCAUAUGAGG-3'), and the non-guiding region comprises a sequence having at least about 90% or at least about 95% identity with the sequence of SEQ ID NO: 28 (5'-CCUCAUAUCUCCACGGUUG-3'). In one such embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 14 (5'-UGACCGUGGAGUCAUAUGAGG-3'), and the non-guiding region comprises the sequence of SEQ ID NO: 28 (5'-CCUCAUAUCUCCACGGUUG-3').

[0022] In any of the embodiments described herein, the guiding strand and the non-guiding strand may be joined by an RNA adapter capable of forming a loop structure. In some embodiments, the RNA adapter comprises 4 to 50 nucleotides. In some embodiments, the loop structure comprises 4 to 20 nucleotides.

[0023] In some embodiments of the above aspects and examples, these artificial miRNA molecules target the 3'-untranslated region (3'-UTR) of SNCA mRNA. In some embodiments, these artificial miRNA molecules exhibit low off-target potential.

[0024] In some embodiments of the foregoing aspects and examples, this disclosure provides an expression construct comprising a nucleic acid encoding an artificial miRNA molecule described herein. In some embodiments, the nucleic acid encoding these artificial miRNA molecules is embedded in a miRNA scaffold. In some embodiments, the nucleic acid encoding the artificial miRNA is operatively linked to a promoter. In some embodiments, the promoter is selected from cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter, CK6 promoter, thyroxine transporter promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG) promoter, elongation factor 1-α promoter (EF1-α) promoter, human β-glucuronidase promoter, chicken β-actin (CBA) promoter, RSV LTR promoter, dihydrofolate reductase promoter, and 13-actin promoter. In some embodiments, the expression construct further includes introns. In some embodiments, the intron is a CBA intron or an hEF1α intron. In some embodiments, the intron is a chimeric intron. In some embodiments, the expression vector is a self-complementary vector, and the intron is a δ-chimeric intron. In some embodiments, the expression construct further comprises a polyadenylation signal. In some embodiments, the polyadenylation signal is a bovine growth hormone polyadenylation signal, an SV40 polyadenylation signal, or an HSV TK polyadenylation signal.

[0025] In some embodiments, this disclosure provides a vector comprising any of the expression constructs described herein. In some embodiments, the vector is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the expression construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the expression construct is flanked by two AAV ITRs. In some embodiments, these AAV ITRs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV serotype ITRs. In some embodiments, these AAV ITRs are AAV2 ITRs. In some embodiments, the vector further comprises a filler nucleic acid. In some embodiments, the filler nucleic acid is located upstream or downstream of the nucleic acid encoding the artificial miRNA. In some embodiments, the vector is a self-complementary rAAV vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding the artificial miRNA and a second nucleic acid sequence encoding the complement of the artificial miRNA, wherein the first nucleic acid sequence may form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, wherein the mutated AAV ITR comprises a deletion of the D region and a mutation comprising a terminal resolution sequence.

[0026] In some embodiments, this disclosure provides cells comprising any rAAV vector as described herein.

[0027] In some embodiments, this disclosure provides recombinant AAV particles comprising any rAAV vector as described herein. In some embodiments, the AAV virus particle comprises AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, goat AAV, AAV1 / AAV2 chimeric capsid, bovine AAV or mouse AAV capsid, or rAAV2 / HBoV1 serotype capsid. In some embodiments, the ITR and the capsid of the rAAV viral particle originate from the same AAV serotype. In some embodiments, the ITR and the capsid of the rAAV viral particle originate from different AAV serotypes. In some embodiments, the ITR originates from AAV2 and the capsid of the rAAV particle originates from AAV1.

[0028] In some embodiments, the capsid protein of the rAAV particle is a modified AAV9 capsid. In some such embodiments, the modified AAV9 capsid protein of the AAV viral particle contains targeting peptides inserted into the AAV9 capsid that alter the transduction and / or endosomal release of the viral particle upon administration to a patient. As disclosed herein, these rAAV particles containing modified AAV9 capsid proteins comprise three structural capsid proteins, VP1, VP2, and VP3. These three capsid proteins are alternative splice variants. In some embodiments, targeting peptides are inserted into the VP1, VP2, and VP3 capsid proteins within the rAAV particle.

[0029] In certain embodiments, the targeting peptide of the modified AAV9 capsid is inserted after residue 588 (numbered based on the VP1 number of AAV9) of the AAV9 structural protein. In some embodiments, the targeting peptide has SEQ ID NO: 60. In some embodiments, the targeting peptide is flanked by linker sequences at the N-terminus and C-terminus of the targeting peptide. In some embodiments, the linker sequence on the N-terminal side has sequence AAA. In some embodiments, the linker sequence on the C-terminal side is AS. In some embodiments, the complete sequence inserted after residue 588 of the AAV9 capsid structural protein has SEQ ID NO: 61. In some embodiments, the complete modified AAV9 capsid structural protein has SEQ ID NO: 62. In some embodiments, the complete modified AAV9 capsid structural protein is at least 90% (e.g., at least 92%, at least 95%, at least 98%, at least 98.5%, at least 99%, at least 99.2%, at least 99.5%, or at least 99.8%) identical to SEQ ID NO: 62, wherein the modified AAV9 structural capsid contains the targeting peptide of SEQ ID NO: 60. The capsid with SEQ ID NO: 62 is also referred to herein as SAN006 or AAV.SAN006.

[0030] In some embodiments, this disclosure provides a composition comprising any of the rAAV particles described herein. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier.

[0031] In some embodiments, this disclosure provides a kit comprising any artificial miRNA molecule described herein. In some embodiments, this disclosure provides a kit comprising any AAV particles described herein. In some embodiments, this disclosure provides a kit comprising any composition described herein. In some embodiments, the kit further comprises instructions for use.

[0032] In some aspects, this disclosure provides methods for treating synucleinopathy in patients of need, methods comprising administering to the patient a composition comprising an artificial miRNA comprising a guide strand and a non-guided (follower) strand that binds SNCA mRNA, wherein the guide strand and the non-guided strand have sequences as disclosed herein. In some embodiments, the synucleinopathy may include Parkinson's disease, multiple system atrophy, or Lewy body dementia.

[0033] In some aspects, this disclosure provides methods for reducing SNCA expression in patients with synucleinopathy, methods comprising administering to the patient a composition comprising a miRNA containing a guide strand and a non-guided (follower) strand that binds SNCA mRNA, wherein the guide strand and the non-guided strand have sequences as disclosed herein. In some embodiments, administration of the artificial miRNA molecule disclosed herein prevents SNCA aggregation. In some embodiments, administration of the artificial miRNA molecule disclosed herein results in a reduction of existing SNCA aggregates. Attached Figure Description

[0034] Figure 1 The reduction of exogenous human SNCA protein after treatment with artificial miRNA is shown according to some embodiments.

[0035] Figure 2 According to some embodiments, a dose-dependent reduction in endogenous human SNCA was shown after treatment with artificial miRNA.

[0036] Figures 3A-3B The ratio of the guide chain to the follower chain and chain processing in human cells are shown according to some embodiments.

[0037] Figures 4A-4D According to some embodiments, tandemly linked artificial miRNAs improve the reduction of SNCA in human cells.

[0038] Figure 5A The reduction of human SNCA mRNA in vivo is shown according to some embodiments. Figure 5B The x-axis shows that for SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 8, the 3x130bp strand variants exhibited increased expression levels of amiRNA relative to a single miRNA hairpin. The increased expression levels of the strand variants ranged from 2-fold to 10-fold relative to a single miRNA hairpin. Detailed Implementation

[0039] The accumulation of pathological synuclein drives neurotoxicity and regional brain atrophy in a group of neurodegenerative diseases known as synucleinopathy (e.g., Parkinson's disease, multiple system atrophy, Lewy body dementia). Neurodegeneration manifests as progressive and fatal cognitive, autonomic, and motor impairments, and there are no known approved treatments to alter the course of the disease. Synuclein is a well-proven therapeutic target; copy number changes and missense mutations in the α-synuclein (SNCA) gene cause Parkinson's disease. In preclinical models, SNCA reduction not only prevents further accumulation but also enables the clearance of existing protein aggregates. In some embodiments, this document provides methods for artificial miRNA gene therapies targeting SNCA that can improve quality of life and slow disease progression and are readily available for use by clinicians and patients. According to some embodiments, the constructs described herein have broad commercial applicability in both rare and common neurodegenerative synucleinopathy.

[0040] In some embodiments, this document provides for the design of artificial miRNAs that can bind to previously unclaimed sequences within the SNCA gene. In some embodiments, the artificial miRNAs may be a priori designed to have a lower seed-mediated off-target tendency, and / or to have rationally designed sequence variations to optimize guide strand loading, thereby increasing potency and / or reducing off-target effects via the lagging strand.

[0041] In some embodiments, the therapeutic constructs described herein may relate to fields including RNA inhibition, molecular biology, and / or central nervous system (CNS) gene therapy. In some embodiments, the therapeutic constructs described herein may be designed to reduce the expression of SNCA proteins and may provide a method for treating neurodegenerative synucleinopathy, including Parkinson's disease, multiple system atrophy, and Lewy body dementia.

[0042] In some embodiments, this document provides therapeutic constructs encompassing the fields of RNA repression, molecular biology, and / or central nervous system (CNS) gene therapy. In some embodiments, these constructs are designed to potentially reduce α-synuclein expression and can provide a method for treating neurodegenerative diseases characterized by the accumulation of α-synuclein aggregates and including, but not limited to, Parkinson's disease (PD) and multiple system atrophy (MSA).

[0043] In some respects, this article provides selective and effective artificial miRNAs that target SNCA mRNA for the treatment of neurodegenerative synucleinopathy by reducing α-synucleinin.

[0044] In some embodiments, this document provides artificial miRNA sequences, wherein a guide strand and a follower strand sequence are specified for each sequence. In some embodiments, the guide strand may target antisense sequences of human and NHP SNCA mRNA, and / or the semi-complementary follower strand may be designed to have specific mismatches to cause a loading bias of the guide strand in the RISC complex to reduce the target mRNA.

[0045] In some embodiments, the artificial miRNA comprises a guide strand having a nucleotide sequence having at least about 90% or at least about 95% identity with the following sequences: SEQ ID NO: 1 (5'-UUCGUAGUCUUGAUACCCUUC-3'), SEQ ID NO: 2 (5'-GUUCGUAGUCUUGAUACCCUU-3'), SEQ ID NO: 3 (5'-UACCGAAAUGCUGAGUGGGGG-3'), SEQ ID NO: 4 (5'-AUCGUAGAUUGAAGCCACAAA-3'), SEQ ID NO: 5 (5'-UAUCGUAGAUUGAAGCCACAA-3'), SEQ ID NO: 6 (5'-AACAUCGUAGAUUGAAGCCAC-3'), SEQ ID NO: 7 (5'-AUACGUCAUUAUUCUUAGACA-3'), SEQ ID NO: 8 (5'-AAUACGUCAUUAUUCUUAGAC-3'), SEQ ID NO: 3 (5'-UACCGAAAUGCUGAGUGGGGG-3'), SEQ ID NO: 4 (5'-AUCGUAGAUUGAAGCCACAAA-3'), SEQ ID NO: 5 (5'-UAUCGUAGAUAUUGAAGCCACAA-3'), SEQ ID NO: 6 (5'-AACAUCGUAGAUAUUGAAGCCAC-3'), SEQ ID NO: 7 (5'-AUACGUCAUUAUUCUUAGACA-3'), SEQ ID NO: 8 (5'-AAUACGUCAUUAUUCUUAGAC-3'), SEQ ID NO: 3 (5'-UACCGUAGAU ... ID NO: 9 (5'-AUUUCGAGACAAAAAUAACAA-3'), SEQ ID NO: 10 (5'-GUCGAAUAUUAUUUAUUGUCA-3'), SEQ ID NO: 11 (5'-GGUCGAAUAUUAUUUAUUGUC-3'), SEQ ID NO: 12 (5'-AACCGCCACUUUCUAACCUUC-3'), SEQ ID NO: 13 (5'-UAACCGCCACUUUCUAACCUU-3'), SEQ ID NO: 14 (5'-UGACCGUGGAGUCAUAUGAGG-3'), SEQ ID NO: 15 (5'-GAAGGGUAAAGACUACGAA-3'), SEQ ID NO: 16 (5'-AAGGGUAUAGACUACGAAU-3'), SEQ ID NO: 17 (5'-CCCCCACUGCAUUUCGGUG-3'), SEQ ID NO: 18 (5'-UUUGUGGCCAAUCUACGAU-3'), SEQ ID NO: 19 (5'-UUGUGGCUAAUCUACGAUG-3'), SEQ ID NO: 20 (5'-GUGGCUUCUCUACGAUGUU-3'), SEQ ID NO: 21 (5'-UGUCUAAGUAAUGACGUAU-3'), SEQ ID NO: 22 (5'-GUCUAAGAAAUGACGUAUU-3'), SEQ ID NO:23 (5'-UUGUUAUUUGUCUCGAAAU-3'), SEQ ID NO: 24 (5'-UGACAAUAUAAUAUUCGAU-3'), SEQ ID NO: 25 (5'-GACAAUAAAAUAUUCGAUU-3'), SEQ ID NO: 26 (5'-GAAGGUUAAAGUGGCGGUU-3'), SEQ ID NO: 27 (5'-AAGGUUAGAGUGGCGGUUA-3') or SEQ ID NO: 28 (5'-CCUCAUAUCUCCACGGUUG-3).

[0046] In some embodiments, the artificial miRNA comprises a second strand (lagging strand) containing a non-guided region comprising a nucleotide sequence partially complementary to the nucleotide sequence of the guide region. In one embodiment, the guide sequence comprises the sequence of SEQ ID NO: 1, and the non-guided region comprises the sequence of SEQ ID NO: 15. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 2, and the non-guided region comprises the sequence of SEQ ID NO: 16. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 3, and the non-guided region comprises the sequence of SEQ ID NO: 17. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 4, and the non-guided region comprises the sequence of SEQ ID NO: 18. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 5, and the non-guided region comprises the sequence of SEQ ID NO: 19. In another embodiment, the guide sequence comprises the sequence of SEQ ID NO: 6, and the non-guided region comprises the sequence of SEQ ID NO: 20. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 7, and the unguided region comprises the sequence of SEQ ID NO: 21. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 8, and the unguided region comprises the sequence of SEQ ID NO: 22. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 9, and the unguided region comprises the sequence of SEQ ID NO: 23. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 10, and the unguided region comprises the sequence of SEQ ID NO: 24. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 11, and the unguided region comprises the sequence of SEQ ID NO: 25. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 12, and the unguided region comprises the sequence of SEQ ID NO: 26. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 13, and the unguided region comprises the sequence of SEQ ID NO: 27. In another embodiment, the guiding sequence comprises the sequence of SEQ ID NO: 14, and the non-guiding region comprises the sequence of SEQ ID NO: 28.

[0047] In some aspects, this disclosure provides expression constructs, vectors (e.g., recombinant AAV vectors), cells, viral particles (e.g., AAV particles), and pharmaceutical compositions comprising the artificial miRNAs disclosed herein. In other aspects, this disclosure provides methods for treating synucleinosis in mammals, methods comprising administering to the mammal a pharmaceutical composition comprising the artificial miRNAs disclosed herein. In some embodiments, synucleinosis may include Parkinson's disease, multiple system atrophy, and Lewy body dementia. I. General Technology

[0048] The techniques and procedures described or cited herein are generally well known to those skilled in the art and are typically employed using conventional methods, such as those widely used as described in the following literature: *Molecular Cloning: A Laboratory Manual* (Sambrook et al., 4th ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 2012); *Current Protocols in Molecular Biology* (FM Ausubel et al., eds., 2003); *Methods in Enzymology* series (Academic Press, Inc.); *PCR 2: A Practical Approach* (MJ MacPherson, BD Hames, and GR Taylor, eds., 1995); *Antibodies, A Laboratory Manual* (Harlow and Lane, eds., 1988); *Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications*. [Animal Cell Culture: Basic Techniques and Professional Applications] (RIFreshney, 6th Edition, J. Wiley and Sons, 2010); Oligonucleotide Synthesis (edited by MJ Gait, 1984); Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (edited by JE Cellis, Academic Press, 1998); Introduction to Cell and Tissue Culture (JP Mather and PE...)Roberts, Plenum Press, 1998); Cell and Tissue Culture: Laboratory Procedures (edited by A. Doyle, JB Griffiths and DG Newell, J. Wiley and Sons, 1993-8); Handbook of Experimental Immunology (edited by DM Weir and CC Blackwell, 1996); Gene Transfer Vectors for Mammalian Cells (edited by JM Miller and MP Calos, 1987); PCR: The Polymerase Chain Reaction (edited by Mullis et al., 1994); Current Protocols in Immunology (edited by JE Coligan et al., 1991); Short Protocols in Molecular Biology (edited by Ausubel et al., J. Wiley and Sons (2002); Immunobiology (CA Janeway et al., 2004); Antibodies (P. Finch, 1997); Antibodies: A Practical Approach (D. Catty, ed., IRL Press, 1988-1989); Monoclonal Antibodies: A Practical Approach (P. Shepherd and C. Dean, ed., Oxford University Press, 2000); Using Antibodies: A Laboratory Manual (E. Harlow and D.Lane, Cold Spring Harbor Laboratory Press, 1999; The Antibodies (edited by M. Zanetti and JD Capra, Harwood Academic Publishers, 1995); and Cancer: Principles and Practice of Oncology (edited by VT DeVita et al., JB Lippincott Company, 2011). II. Definition

[0049] As used in this article, “vector” refers to a recombinant plasmid or virus containing nucleic acid to be delivered to a host cell in vitro or in vivo.

[0050] As used herein, the term "polynucleotide" or "nucleic acid" refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Therefore, the term includes, but is not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derived nucleotide bases. The backbone of a polynucleotide may contain sugar and phosphate groups (as commonly found in RNA or DNA), or modified or substituted sugar or phosphate groups. Alternatively, the backbone of a polynucleotide may contain polymers of synthetic subunits such as aminophosphates, and thus may be oligodeoxynucleotide aminophosphates (P-NH2) or mixed aminophosphate-phosphodiester oligomers. Furthermore, double-stranded polynucleotides can be obtained from chemically synthesized single-stranded polynucleotide products by synthesizing the complementary strand and annealing it under appropriate conditions, or by de novo synthesis of the complementary strand using a DNA polymerase with appropriate primers.

[0051] The terms “peptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues, and are not limited to a minimum length. Such polymers of amino acid residues can contain native or non-native amino acid residues, and include, but are not limited to, peptides, oligopeptides, dimers, trimers, and polymers of amino acid residues. Full-length proteins and fragments thereof are included in this definition. These terms also include post-expression modifications of peptides, such as glycosylation, sialylation, acetylation, phosphorylation, etc. Furthermore, for the purposes of this disclosure, “peptide” refers to a protein that includes modifications to its native sequence, such as deletions, additions, and substitutions (generally conserved in nature), provided that the protein maintains the desired activity. These modifications can be intentional, such as by site-directed mutagenesis, or accidental, such as by mutations in the host that produces the protein or by errors due to PCR amplification.

[0052] "Recombinant viral vector" refers to a recombinant polynucleotide vector containing one or more heterologous sequences (i.e., nucleic acid sequences not derived from viruses). In the case of recombinant AAV vectors, the recombinant nucleic acid is flanked by at least one (and in some embodiments, two) inverted terminal repeat (ITR) sequences.

[0053] “Recombinant AAV vector (rAAV vector)” refers to a polynucleotide vector containing one or more heterologous sequences (i.e., non-AAV-derived nucleic acid sequences) flanked by at least one (and in this example, two) AAV inverted terminal repeat (ITR) sequences. Such rAAV vectors can be replicated and packaged into infectious viral particles when present in host cells that have been infected with a suitable helper virus (or are expressing a suitable helper function) and are expressing AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When the rAAV vector is incorporated into a larger polynucleotide (e.g., into a chromosome or into another vector such as a plasmid used for cloning or transfection), it can be referred to as a “pro-vector”, which can be “rescued” by replication and capsidation in the presence of AAV packaging function and a suitable helper function. rAAV vectors can be in any of a variety of forms, including but not limited to plasmids, linear artificial chromosomes, lipid complexes, encapsulated in liposomes, and capsidated within viral particles, particularly AAV particles. The rAAV vector can be packaged into the capsid of the AAV virus to produce "recombinant adeno-associated virus particles (rAAV particles)".

[0054] "Heterologous" means originating from an entity that is genotypically different from the entity being compared to it or which is introduced or incorporated into it. For example, polynucleotides introduced into different cell types through genetic engineering are heterologous polynucleotides (and when expressed, can encode heterologous polypeptides). Similarly, cellular sequences (e.g., genes or portions thereof) incorporated into viral vectors are heterologous nucleotide sequences relative to the vector.

[0055] The term "transgenic" refers to a polynucleotide introduced into a cell that is capable of being transcribed into RNA and optionally translated and / or expressed under appropriate conditions. In some respects, it confers desired properties to the cell into which it is introduced, or otherwise produces desired therapeutic or diagnostic outcomes. In other respects, it can be transcribed into molecules that mediate RNA interference, such as miRNA, siRNA, or shRNA.

[0056] “Chicken β-actin (CBA) promoter” refers to a polynucleotide sequence derived from the chicken β-actin gene (e.g., Gallus gallus β-actin, represented by GenBank Entrez gene ID 396526). As used herein, “chicken β-actin promoter” can refer to a promoter containing a cytomegalovirus (CMV) early enhancer element, the promoter and first exon and intron of the chicken β-actin gene, and the splice acceptor of the rabbit β-globin gene, such as the sequence described in Miyazaki, J. et al. (1989) Gene [Gene] 79(2):269-77. As used herein, the term “CAG promoter” is used interchangeably. As used herein, the terms “CMV early enhancer / chicken β-actin (CAG) promoter” are used interchangeably.

[0057] The terms “genomic particles (gp),” “genomic equivalent,” or “genomic copy” used in relation to viral titers refer to the number of virions containing the recombinant AAV DNA genome, and are unrelated to infectivity or functionality. The number of genomic particles in a particular vector formulation can be measured using procedures as illustrated in the examples herein or described, for example, in the following literature: Clark et al. (1999) Hum. Gene Ther. [Human Gene Therapy], 10:1031-1039; Veldwijk et al. (2002) Mol. Ther. [Molecular Therapy], 6:272-278.

[0058] As used herein, the term "vector genome (vg)" can refer to one or more polynucleotides comprising a set of polynucleotide sequences of a vector (e.g., a viral vector). The vector genome may be capsidated within the viral particle. Depending on the specific viral vector, the vector genome may comprise single-stranded DNA, double-stranded DNA, or single-stranded RNA, or double-stranded RNA. The vector genome may include endogenous sequences associated with the specific viral vector and / or any heterologous sequences inserted into the specific viral vector via recombination techniques. For example, a recombinant AAV vector genome may include at least one ITR sequence flanking the promoter, filler sequence, target sequence (e.g., miRNA), and polyadenylated sequence. A complete vector genome may comprise a complete set of polynucleotide sequences of the vector. In some embodiments, the nucleic acid titer of the viral vector may be measured in vg / mL. Suitable methods for measuring such titers are known in the art (e.g., quantitative PCR).

[0059] As used herein, the term “inhibition” can refer to an action that blocks, reduces, eliminates, or otherwise antagonizes the presence or activity of a particular target. Inhibition can refer to partial or complete inhibition. For example, inhibiting gene expression can refer to any action that results in the arrest, reduction, elimination, or any other antagonism of gene expression, including a decrease in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, inhibition of mRNA translation, etc. In some embodiments, inhibiting SNCA protein expression can refer to the arrest, reduction, elimination, or any other antagonism of SNCA protein expression, including a decrease in synuclein α mRNA abundance (e.g., silencing SNCA mRNA transcription), SNCA mRNA degradation, inhibition of SNCA mRNA translation, etc. As another example, inhibiting protein accumulation in cells can refer to any action that results in the arrest, reduction, elimination, or any other antagonism of protein expression, including a decrease in mRNA abundance (e.g., silencing mRNA transcription), mRNA degradation, inhibition of mRNA translation, protein degradation, etc. In some embodiments, inhibiting the accumulation of SNCA proteins in cells refers to blocking, reducing, eliminating, or other antagonistic effects on the expression of SNCA proteins in cells, including reducing the abundance of SNCA mRNA (e.g., silencing SNCA mRNA), degrading SNCA mRNA, inhibiting SNCA mRNA translation, and degrading SNCA proteins.

[0060] The terms “infectious unit (iu),” “infectious particle” or “replication unit” used in relation to viral titers refer to the number of infectious and reproducible recombinant AAV vector particles as measured by an infection center assay (also known as a replication center assay), as described, for example, in McLaughlin et al. (1988) J. Virol. [Journal of Virology], 62:1963-1973.

[0061] For example, the term “transduction unit (tu)” used in relation to viral titers refers to the number of infectious recombinant AAV vector particles that cause the production of functional transgenic products, as measured in functional assays such as those described in the examples herein or in, for example, the following literature: Xiao et al. (1997) Exp. Neurobiol. [Experimental Neurobiology], 144:113-124; or Fisher et al. (1996) J. Virol. [Journal of Virology], 70:520-532 (LFU assay).

[0062] "Inverted terminal repeat" or "ITR" sequence is a well-known term in the field, referring to a relatively short sequence with opposite orientation found at the end of a viral genome.

[0063] The term "AAV inverted terminal repeat (ITR)" is well-known in the art and refers to a sequence of approximately 145 nucleotides located at both ends of a natural single-stranded AAV genome. The outermost 125 nucleotides of the ITR can be present in either of two optional orientations, resulting in heterogeneity between different AAV genomes and between the two ends of a single AAV genome. These outermost 125 nucleotides also contain several shorter, self-complementary regions (named A, A', B, B', C, C', and D regions), allowing intrastrand base pairing to occur within this portion of the ITR.

[0064] The "terminal dissociation sequence" or "trs" is a sequence in the D region of the AAV ITR that is cleaved by the AAV rep protein during viral DNA replication. The mutant terminal dissociation sequence is resistant to AAV rep protein cleavage.

[0065] "AAV helper functions" refer to the functions that allow AAV to be replicated and packaged by the host cell. AAV helper functions can be provided in any of a variety of forms, including but not limited to helper viruses or helper virus genes that assist AAV replication and packaging. Other AAV helper functions are known in the art, such as genotoxic agents.

[0066] A "helper virus" in AAV refers to a virus that allows AAV (a defective parvovirus) to be replicated and packaged by host cells. Helper viruses provide the "accessory function" that allows AAV replication. Many such helper viruses have been identified, including adenoviruses, herpesviruses, and poxviruses such as vaccinia and baculoviruses. Adenoviruses encompass many different subgroups, but subgroup C-type 5 adenovirus (Ad5) is the most commonly used. Many adenoviruses of human, non-human mammalian, and avian origin are known and available from collections such as the ATCC. Herpesviruses also available from collections such as the ATCC include, for example, herpes simplex virus (HSV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), and pseudorabies virus (PRV). Examples of adenovirus helper functions used for AAV replication include E1A, E1B, E2A, VA, and E4orf6 functions. Baculoviruses available from collections include the nucleopolyhedrovirus of the alfalfa silver-striped moth (Autographa californica).

[0067] If the ratio of infectious AAV particles to infectious helper virus particles is at least about 10... 2 : 1; at least about 10 4 1. At least about 10 6 : 1; or at least about 10 8 If the level is 1 or greater, the rAAV formulation is said to be "substantially free" of helper virus. In some embodiments, the formulation also does not contain an equivalent amount of helper virus proteins (i.e., proteins present due to this level of helper virus if the aforementioned helper virus particle impurities are present in cleaved form). Viral and / or cellular protein contamination can typically be observed as the presence of Coomassie staining bands on an SDS gel (e.g., the appearance of bands other than those corresponding to AAV capsid proteins VP1, VP2, and VP3).

[0068] The “sequence identity percentage (%)” for a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in a candidate sequence that are identical to those in a reference polypeptide or nucleic acid sequence after sequence alignment and the introduction of vacancies (if necessary) to obtain the maximum sequence identity percentage, and without considering any conserved substitutions as part of the sequence identity. Alignments used to determine the amino acid or nucleic acid sequence identity percentage can be performed in various ways within the scope of the art, for example, using publicly available computer software programs, such as those described in Current Protocols in Molecular Biology (edited by Ausubel et al., 1987), Supplement 30, Chapter 7.7.18, Table 7.7.1, and including BLAST, BLAST-2, ALIGN, or Megalign (DNASTAR) software. A preferred alignment program is ALIGN Plus (Scientific and Educational Software, Pennsylvania). Those skilled in the art can determine appropriate parameters for measuring alignments, including any algorithms required to achieve maximum alignment across the full length of the sequences being compared. For the purposes of this paper, the percentage of amino acid sequence identity between a given amino acid sequence A and, and, with respect to a given amino acid sequence B (which can be alternatively expressed as a given amino acid sequence A having or containing a certain percentage of amino acid sequence identity with, and, and, with respect to a given amino acid sequence B) is calculated as follows: 100 multiplied by the fraction X / Y, where X is the number of amino acid residues that are identified as identical matches in the alignment of A and B by a sequence alignment program, and Y is the total number of amino acid residues in B. It should be understood that when the lengths of amino acid sequences A and B are not equal, the percentage of amino acid sequence identity between A and B will not be equal to the percentage of amino acid sequence identity between B and A. For the purposes of this paper, the percentage of nucleic acid sequence identity between a given nucleic acid sequence C and, or with respect to a given nucleic acid sequence D (which can be alternatively expressed as a given nucleic acid sequence C having or containing a certain percentage of nucleic acid sequence identity with, or with respect to, a given nucleic acid sequence D) is calculated as follows: 100 multiplied by the fraction W / Z, where W is the number of nucleotides that are identified as identical matches in the alignment of C and D by the sequence alignment program, and Z is the total number of nucleotides in D. It should be understood that when the lengths of nucleic acid sequences C and D are not equal, the percentage of nucleic acid sequence identity between C and D will not be equal to the percentage of nucleic acid sequence identity between D and C.

[0069] "Isolated" molecules (e.g., nucleic acids or proteins) or cells mean that they have been identified and separated from and / or recovered from their natural environment.

[0070] An "effective dose" is a dose sufficient to achieve a beneficial or desired outcome (including clinical outcomes, such as symptom improvement, achievement of clinical endpoints, etc.). An effective dose can be administered once or multiple times. In terms of disease state, an effective dose is a dose sufficient to improve, stabilize, or delay disease progression.

[0071] "Individual" or "subject" is a mammal. Mammals include, but are not limited to, domesticated animals (e.g., cattle, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0072] As used herein, “treatment” is a method used to obtain a beneficial or desired clinical outcome. For the purposes of this disclosure, a beneficial or desired clinical outcome includes, but is not limited to, relief of symptoms, reduction of disease severity, stabilization of disease status (e.g., no worsening), prevention of disease spread (e.g., metastasis), delay or slowing of disease progression, improvement or mitigation of disease status, and remission (partial or complete), whether detectable or undetectable. “Treatment” may also mean prolonged survival compared to expected survival in the untreated condition.

[0073] As used herein, the term "preventive treatment" refers to treatment in which an individual is known or suspected of having a disorder or is at risk of developing a disorder, but has not yet exhibited symptoms of the disorder or has exhibited the minimum symptoms of the disorder. Individuals undergoing preventive treatment may receive treatment before symptoms develop.

[0074] A “miRNA scaffold” can refer to a polynucleotide containing: (i) a double-stranded sequence targeting a target gene for miRNA knockdown and (ii) an additional sequence forming a stem-loop structure similar to that of an endogenous miRNA. The target gene sequence (e.g., a short sequence of about 20 nt) can be linked to a sequence that produces a miRNA-like stem-loop and a sequence that base-pairs with the target sequence to form a double strand when the polynucleotide is assembled into a miRNA-like secondary structure. As described herein, this double strand may not be fully hybridized; for example, it may contain one or more unpaired or mispaired bases. When the polynucleotide is cleaved by Dicer, the double strand containing the target gene sequence can be unfolded and incorporated into the RISC complex. A miRNA scaffold can refer to the miRNA itself or to the DNA polynucleotide encoding the miRNA. An example of a miRNA scaffold is the miR-155 sequence (Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9). Commercially available kits for cloning sequences into miRNA scaffolds are known in the art (e.g., the Invitrogen™ BLOCK-iT™ Pol II miRNA interference expression vector kit, from Life Technologies, Thermo Fisher Scientific, Waltham, MA).

[0075] As used herein, a "bulge" refers to a region in a nucleic acid that is not complementary to its counterpart in the duplex nucleic acid. For example, a bulge can refer to a nucleic acid sequence that is not complementary to its counterpart in the duplex nucleic acid, where the flanks of the bulge are regions in the nucleic acid complementary to its counterpart in the duplex nucleic acid. In some instances, the length of a bulge can be any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10 bases. In some instances, a bulge may be the result of mispairing (e.g., the counterpart contains non-complementary bases), or it may be the result of unpairing (e.g., the counterpart contains a nucleic acid complementary to the nucleic acid flanking the bulge, but the counterpart does not contain the nucleic acid opposite the bulge).

[0076] As used herein, the term "sense" nucleic acid is a nucleic acid that contains all or part of the sequence encoding a transgene. In some instances, the mRNA of a transgene is a sense nucleic acid.

[0077] As used in this article, "antisense" nucleic acid is a nucleic acid sequence that is complementary to "sense" nucleic acid. For example, antisense nucleic acid can be complementary to mRNA encoding transgenes.

[0078] As used in this article, the “guide region” of a miRNA is the strand of the miRNA that binds to the target mRNA, typically based on complementarity binding. The complementarity region may encompass all or part of the guide region. Typically, the complementarity region includes at least the seed region. In many cases, the antisense region of the miRNA is the guide region.

[0079] As used herein, the “lazy region” or “non-directing region” of a miRNA, which can be used interchangeably here, is a region of the miRNA that is complementary to the directing region. In many cases, the sense region of a miRNA is the lazy region.

[0080] As used in this article, the "seed region" of a miRNA is a region of approximately 1–8 nucleotides in length within the miRNA. In some instances, the seed region and its 3'-UTR of the target mRNA may be key determinants in miRNA recognition.

[0081] As used in this article, “off-target gene silencing” refers to the pairing of the seed region of a miRNA with a sequence in the 3'-UTR of an unintended mRNA, and the resulting translational repression and destabilization of those transcripts (e.g., reducing the expression of the unintended mRNA).

[0082] When this document refers to a value or parameter “about”, it includes (and describes) embodiments relating to that value or parameter itself. For example, a description of “about X” includes a description of “X”.

[0083] As used herein, unless otherwise indicated, the singular articles “a”, “an”, and “the” include plural indicators.

[0084] It should be understood that the aspects and embodiments described herein include “comprising aspects and embodiments,” “consisting of aspects and embodiments,” and / or “substantially consisting of aspects and embodiments.” III. Artificial miRNA molecules

[0085] In some aspects, this disclosure provides artificial miRNA molecules comprising the sequences disclosed herein. miRNAs are known in the art as RNA molecules that induce RNA interference in cells, comprising a short (e.g., 19-25 base pairs) sequence of a double-stranded RNA linked by a loop and one or more additional sequences containing one or more bumps (e.g., mispaired or unpaired base pairs) of the double-stranded RNA. In some embodiments, “miRNA” may refer to a primary miRNA (pri-miRNA) or a precursor miRNA. During miRNA processing, a primary miRNA transcript is produced. Primary miRNA is processed by Drosha-DGCR8 to produce a precursor miRNA by excising one or more sequences to leave a precursor miRNA having a 5' flanking region, a guiding strand, a loop region, an unguided strand, and a 3' flanking region; or a 5' flanking region, an unguided strand, a loop region, a guiding strand, and a 3' flanking region. The precursor miRNA is then exported to the cytoplasm and processed by Dicer to produce a miRNA having a guiding strand and an unguided (or lagging) strand. The RISC complex then uses a guide strand to catalyze gene silencing, for example by recognizing a target RNA sequence complementary to the guide strand. miRNA recognition of target sequences is primarily determined by the pairing between the target and the miRNA seed sequence (e.g., nucleotides 1–8 (5' to 3') of the guide strand) (see, for example, Boudreau, RL et al. (2013) Nucleic Acids Res. [Nucleic Acid Research] 41:e9).

[0086] In the primary / precursor miRNA structure, the guide strand:non-guide strand interface in the duplex is partially formed by complementary base pairing (e.g., Watson-Crick base pairing). However, in some embodiments, this complementary base pairing does not extend throughout the entire duplex. In some embodiments, a protrusion in this interface may be present at one or more nucleotide sites. As used herein, the term "protrusion" may refer to a region in the nucleic acid that is not complementary to its opposite nucleic acid in the duplex. In some embodiments, a protrusion is formed when regions of complementary nucleic acids bind to each other, while regions of the central non-complementary region do not bind. In some embodiments, a protrusion is formed when the two nucleic acid strands located between two complementary regions have different lengths. As described below, a protrusion may comprise one or more nucleotides. In some embodiments, the miRNA includes an internal protrusion created by deleting two bases (bases 9-10, counted from the start of the lagging strand) from the lagging strand of the miRNA.

[0087] In certain aspects, the artificial miRNA molecules described in this disclosure are inhibitory to SNCA mRNA. In some embodiments, the SNCA mRNA is human SNCA mRNA. In some embodiments, the artificial mRNA targets the coding sequence of the SNCA mRNA. In some embodiments, the artificial miRNA targets the 3'-UTR region of the mRNA encoding SNCA. In some embodiments, the artificial miRNA inhibits SNCA expression in a subject. In some embodiments, the artificial miRNA inhibits the accumulation of SNCA protein in a subject. In some embodiments, the subject is a mammal. In some embodiments, the mammal is a human.

[0088] The safety of miRNA-based therapies can be hampered by the ability of miRNAs to bind to and reduce the expression of unintended mRNAs (an effect known as off-target gene silencing). Off-target effects primarily occur when the seed region (nucleotides 2–8 of the small miRNA) pairs with sequences in the 3'-UTR of the unintended mRNA, leading to translational repression and destabilization of those transcripts. Reduced off-target miRNAs can be engineered by substituting bases within both the guiding and unguided sequences; for example, by generating CpG motifs. Potential substitutions that could produce significantly lower off-target scores can be evaluated using the SiSPOTR algorithm, a specificity-focused design algorithm that identifies candidate sequences with the lowest off-target potential and effective silencing ability (Boudreau et al., Nucleic Acids Res. 2013 Jan; 41(1) e9). Reduced SiSPOTR scores predict a lower number of potential human off-target sequences compared to the parental miRNA molecule. In some embodiments disclosed herein, miRNAs are modified to reduce off-target gene silencing. In some embodiments, the miRNA contains one or more CpG motifs. In some embodiments, the miRNA contains one or more CpG motifs in a seed region.

[0089] In some embodiments, the first and second strands are joined by an RNA capable of forming a loop structure (e.g., an RNA adapter). As is generally known in the art, RNA loop structures (e.g., stem-loops or hairpins) are formed when an RNA molecule contains two RNA sequences whose bases are paired together and separated by an RNA sequence whose bases are not paired together. For example, a loop structure can be formed in RNA molecule ABC if sequences A and C are complementary or partially complementary such that their bases are paired together, but the bases in sequence B are not paired together. In some embodiments, the loop sequence is 5'-GTTTTGGCCACTGACTGAC-3' (SEQ ID NO: 45) in DNA form or 5'-GUUUUGGCCACUGACUGAC-3' (SEQ ID NO: 46) in RNA form.

[0090] In some embodiments, the RNA capable of forming a loop structure comprises 4 to 50 nucleotides. In some embodiments, the RNA capable of forming a loop structure comprises 13 nucleotides. In some embodiments, the number of nucleotides in the RNA capable of forming a loop is 4 to 50 nucleotides or any integer between them. In some embodiments, 0-50% of the loop may be complementary to another portion of the loop. As used herein, the term "loop structure" is a sequence that connects two complementary strands of a nucleic acid. In some embodiments, 1-3 nucleotides of the loop structure are adjacent to the complementary strand of the nucleic acid and may be complementary to 1-3 nucleotides of the distal portion of the loop structure. For example, the three nucleotides at the 5' end of the loop structure may be complementary to the three nucleotides at the 3' end of the loop structure.

[0091] In some embodiments, the nucleic acid encoding the miRNA disclosed herein comprises a heterologous miRNA scaffold. In some embodiments, the use of the heterologous miRNA scaffold is for regulating miRNA expression; for example, increasing or decreasing miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9; and Invitrogen™ BLOCK-iT™ Pol II miR RNA interference expression vector kit, from Life Sciences, Thermo Fisher Scientific, Waltham, MA).

[0092] In some embodiments, the first strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any guide sequence. In some embodiments, the first strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with any guide sequence, but maintaining the CpG motif. In some embodiments, the second strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the corresponding follower sequence. In some embodiments, the second strand comprises a nucleic acid sequence having more than one of about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with the corresponding follower sequence, but maintaining the CpG motif.

[0093] Table 1 presents the sequence IDs and sequence information (e.g., sequences) of the follower RNA sequences designed for low-predictability off-target effects targeting human and NHP SNCA homology, according to some embodiments. Seventeen sequences were selected based on: 1) their low off-target potential calculated using an algorithm to reduce the confluence of candidate seed sequences (Boudreau et al., 2013); 2) avoidance of known pathogenic SNCA mutations and high-frequency single nucleotide polymorphisms (SNPs); and / or 3) homology between human and non-human primate SNCAs to promote translatability.

[0094] In some embodiments, miRNAs (e.g., artificial miRNAs) are selected from Table 1. Table 1 IV. miRNA Expression Constructs and Vectors

[0095] This disclosure provides expression constructs, vectors, and viral particles for expressing the miRNA molecules described herein.

[0096] In some embodiments, the nucleic acid encoding the artificial miRNA disclosed herein comprises a heterologous miRNA scaffold. In some embodiments, the use of the heterologous miRNA scaffold is for regulating miRNA expression; for example, increasing or decreasing miRNA expression. Any miRNA scaffold known in the art can be used. In some embodiments, the miRNA scaffold is derived from the miR-155 scaffold (see, for example, Lagos-Quintana, M. et al. (2002) Curr. Biol. [Current Biology] 12:735-9; and Invitrogen™ BLOCK-iT™ Pol II miR RNA interference expression vector kit, from Life Sciences, Thermo Fisher Scientific, Waltham, MA). In some embodiments, the nucleic acid encoding the miRNA disclosed herein comprises a miRNA scaffold. In some embodiments, the miRNA scaffold comprises the sequence ctggaggcttgctgaaggctgtatgctgcaggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 47), wherein the miRNA is inserted between bolded gc residues.

[0097] In some embodiments, the miRNA in the scaffold contains a sequence ctggaggcttgctgaaggctgtatgctg tacgatctaatatcgctcgttttggccactgac tgacgagcgatatgatcgtacga caggacacaaggcctgttactagcactcacatggaacaaatggc (SEQ ID NO: 48), where underlined plain text represents 5'-flank, italic text represents the guiding sequence, bold text represents the loop, underlined italic text represents the non-guiding sequence, and plain text represents 3'-flank.

[0098] In some embodiments, the miRNA targets RNA encoding a polypeptide associated with synucleinopathy. In some embodiments, the polypeptide is SNCA.

[0099] In some embodiments, the transgene (e.g., the miRNA disclosed herein) is operatively linked to a promoter. Exemplary promoters include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, RSV LTR, MoMLV LTR, phosphoglycerate kinase-1 (PGK) promoter, simian virus 40 (SV40) promoter and CK6 promoter, thyroxine transporter promoter (TTR), TK promoter, tetracycline-responsive promoter (TRE), HBV promoter, hAAT promoter, LSP promoter, chimeric liver-specific promoter (LSP), E2F promoter, telomerase (hTERT) promoter; cytomegalovirus enhancer / chicken β-actin / rabbit β-globin promoter (CAG promoter; Niwa et al., Gene [Gene], 1991, 108(2):193-9) and elongation factor 1-α promoter (EFl-α) promoter (Kim et al., Gene [Gene], 1990, 91(2):217-23 and Guo et al., Gene Ther. [Gene Therapy], 1996, 3(9):802-10). In some embodiments, the promoter comprises a human β-glucuronidase promoter or a cytomegalovirus enhancer linked to a chicken β-actin (CBA) promoter. The promoter may be a constitutive promoter, an inducible promoter, or a repressive promoter. In some embodiments, this disclosure provides a recombinant vector comprising a nucleic acid encoding a heterologous transgene of the present disclosure operatively linked to a CBA promoter. Exemplary promoters and descriptions can be found, for example, in U.S. Pre-Publication Publication 20140335054. In some embodiments, the promoter is a CBA promoter, a minimal CBA promoter, a CMV promoter, or a GUSB promoter. In some embodiments, the promoter is an hEF1a promoter.

[0100] Examples of constitutive promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with an RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) [see, for example, Boshart et al., Cell, 41:521-530 (1985)], the SV40 promoter, the dihydrofolate reductase promoter, the 13-actin promoter, the glycerol phosphokinase (PGK) promoter, and the EFi promoter [Invitrogen].

[0101] Inducible promoters allow for the regulation of gene expression and can be modulated by the presence of exogenously supplied compounds, environmental factors (such as temperature), or specific physiological states, such as the acute phase, a specific differentiation state of the cell, or only in replicating cells. Inducible promoters and inducible systems are available from a variety of commercial sources, including but not limited to Ingenium, Clontech, and Ariad. Many other systems have been described and can be readily selected by those skilled in the art. Examples of inducible promoters regulated by exogenously supplied promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); the ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), the tetracycline repressor system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), the tetracycline inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol. [Current Views in Chemical Biology]), 2:512-518 (1998)), the RU486 inducible promoter system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., GeneTher., 4:432-441 (1997)), and the rapamycin inducible promoter system (Magari et al., J. Clin. Invest., 100:2865-2872 (1997)). Other types of inducible promoters available in this context are promoters regulated by specific physiological states, such as temperature, acute phase, specific differentiation state of the cell, or only in replicating cells.

[0102] In another embodiment, a natural promoter or fragment thereof for transgene expression will be used. A natural promoter may be preferred when it is desired that transgene expression mimics natural expression. A natural promoter can be used when transgene expression must be regulated temporally or developmentally, or in a tissue-specific manner, or in response to a specific transcriptional stimuli. In another embodiment, other natural expression control elements (such as enhancer elements, polyadenylation sites, or Kozak concordant sequences) may also be used to mimic natural expression.

[0103] In some embodiments, regulatory sequences confer tissue-specific gene expression capabilities. In some cases, tissue-specific regulatory sequences bind to tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are well known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: neuron promoters, such as neuron-specific enolase (NSE) promoters (Andersen et al., Cell. Mol. Neurobiol., 13:503-15(1993)), neurofilament light chain gene promoters (Piccioli et al., Proc. Natl. Acad. Sci. USA, 88:5611-5(1991)), and neuron-specific vgf gene promoters (Piccioli et al., Neuron, 15:373-84(1995)). In some embodiments, the tissue-specific promoter is a promoter selected from the following genes: neuronal nucleus (NeuN), glial fibrillary acidic protein (GFAP), adenomatous colonic polyp (APC), and ionized calcium-binding adaptor molecule 1 (Iba-1). Other suitable tissue-specific promoters will be apparent to those skilled in the art. In some embodiments, the promoter is the chicken β-actin promoter.

[0104] In some embodiments, the promoter expresses a heterologous nucleic acid in cells of the CNS. Therefore, in some embodiments, the therapeutic peptides or therapeutic nucleic acids disclosed herein can be used to treat synucleinosis. In some embodiments, the promoter expresses a heterologous nucleic acid in brain cells. Brain cells can refer to any brain cells known in the art, including but not limited to neurons (such as sensory neurons, motor neurons, interneurons, dopaminergic neurons, medium-sized spinous neurons, cholinergic neurons, GABAergic neurons, pyramidal neurons, etc.), glial cells (such as microglia, macroglia, astrocytes, oligodendrocytes, ependymal cells, radial glial cells, etc.), brain parenchymal cells, microglia, ependymal cells, and / or Purkinje cells. In some embodiments, the promoter expresses a heterologous nucleic acid in neurons and / or glial cells. In some embodiments, neurons are medium-sized spinous neurons of the caudate nucleus, medium-sized spinous neurons of the putamen, neurons of cortical layer IV, and / or neurons of cortical layer V.

[0105] Various promoters for expressing transcripts (e.g., heterologous transgenes) in CNS cells, brain cells, neurons, and glial cells are known in the art and described herein. Such promoters may contain either a control sequence typically associated with the selected gene or a heterologous control sequence. Typically, useful heterologous control sequences include those derived from sequences encoding mammalian or viral genes. Examples include, but are not limited to, the SV40 early promoter, the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter (Ad MLP), the herpes simplex virus (HSV) promoter, cytomegalovirus (CMV) promoters (such as the CMV immediate early promoter region (CMVIE)), Rous sarcoma virus (RSV) promoters, synthetic promoters, heterozygous promoters, etc. Alternatively, sequences derived from non-viral genes (such as the mouse metallothionein gene) may also be used. Such promoter sequences are commercially available, for example, from Stratagene (San Diego, California). CNS-specific promoters and inducible promoters may be used. Examples of CNS-specific promoters include, but are not limited to, those isolated from CNS-specific genes such as myelin basic protein (MBP), glial fibrillary acidic protein (GFAP), and neuron-specific enolase (NSE). Examples of inducible promoters include, in particular, ecdysone, tetracycline, metallothionein, and hypoxia-responsive DNA elements.

[0106] This disclosure contemplates the use of recombinant viral genomes to introduce or package one or more nucleic acid sequences encoding artificial miRNAs as described herein into AAV viral particles. The recombinant viral genome may include any elements used to establish miRNA expression, such as promoters, heteronucleotides, ITRs, ribosome-binding elements, terminators, enhancers, selection markers, introns, polyA signals, and / or origins of replication. In some embodiments, the rAAV vector comprises one or more of enhancers, splice donor / acceptor pairs, matrix attachment sites, or polyadenylation signals.

[0107] In some embodiments, an effective amount of rAAV particles containing a vector encoding an artificial miRNA is applied at or near the application site (e.g., the striatum and / or cortex) or further away from the application site to transduce cells (e.g., CNS cells, brain cells, neurons, and / or glial cells). In some embodiments, more than one of about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, or 100% of neurons are transduced. In some embodiments, about 5% to about 100%, about 10% to about 50%, about 10% to about 30%, about 25% to about 75%, about 25% to about 50%, or about 30% to about 50% of neurons are transduced. Methods for identifying neurons transduced by recombinant viral particles expressing miRNA are known in the art; for example, expression can be detected using immunohistochemistry, RNA detection (e.g., qPCR, RNA blotting, RNA-seq, in situ hybridization, etc.) or the use of co-expressed markers (such as enhanced green fluorescent protein).

[0108] In some respects, this disclosure provides viral particles containing a recombinant self-complementary genome (e.g., a self-complementary rAAV vector). AAV viral particles having a self-complementary vector genome and methods using a self-complementary AAV genome are described in the following literature: U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z. et al., (2003) Gene Ther [Gene Therapy] 10:2105-2111, each incorporated herein by reference in its entirety. rAAV containing a self-complementary genome will rapidly form a double-stranded DNA molecule using its partially complementary sequences (e.g., complementary coding and non-coding strands of a heterologous nucleic acid). In some embodiments, the vector comprises a first nucleic acid sequence encoding a heterologous nucleic acid and a second nucleic acid sequence encoding a complement of that nucleic acid, wherein the first nucleic acid sequence may form intra-strand base pairs with the second nucleic acid sequence along most or all of its length.

[0109] In some embodiments, a first heteronucleotide sequence encoding a miRNA and a second heteronucleotide sequence encoding a complement of that miRNA are linked by a mutated ITR (e.g., a right-hand ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-CACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCC GGGCGACCAAAGGTCGCCCACGCCCGGGCTTTGCCCGGGCG - 3' (SEQ ID NO: 49). The mutated ITR contains a deletion of the D region containing the terminal dissociation sequence. Therefore, during the replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, a recombinant viral genome comprising the following in 5' to 3' order will be packaged in the viral capsid: AAV ITR, a first heteronucleotide sequence containing the regulatory sequence, the mutated AAV ITR, a second heteronucleotide sequence oriented opposite to the first heteronucleotide, and a third AAV ITR. V. Viral particles and methods of generating viral particles

[0110] This disclosure provides, in particular, recombinant viral particles comprising nucleic acids encoding the artificial miRNA disclosed herein, and methods of using them to treat diseases or disorders in mammals, such as synucleinopathy. Virus particles

[0111] This disclosure provides viral particles comprising miRNA molecules as disclosed herein. In some embodiments, this disclosure provides viral particles for delivering miRNA molecules as disclosed herein. For example, this disclosure provides a method for delivering miRNA using recombinant viral particles to treat diseases or disorders in mammals; for example, rAAV particles containing miRNA for treating synucleinosis. In some embodiments, the recombinant viral particle is a recombinant AAV particle. In some embodiments, the viral particle is a recombinant AAV particle containing nucleic acid comprising a sequence of an artificial miRNA of this disclosure flanked by one or two ITRs. The nucleic acid is capsidated in the AAV particle. The AAV particle also contains a capsid protein. In some embodiments, the nucleic acid comprises one or more target coding sequences (e.g., nucleic acid of the miRNA of this disclosure) and control sequences (including transcription start and stop sequences) operably linked in the transcriptional direction, thereby forming an expression construct. The expression construct is flanked by at least one functional AAV ITR sequence at the 5' and 3' ends. “Functional AAV ITR sequence” means that the ITR sequence functions as intended for the rescue, replication, and packaging of AAV virions. See Davidson et al., PNAS, 2000, 97(7):3428-32; Passini et al., J. Virol, 2003, 77(12):7034-40; and Pechan et al., Gene Ther., 2009, 16:10-16, all of which are incorporated herein by reference in their full text. In order to practice some aspects of this disclosure, the recombinant vector contains at least all the AAV sequences necessary for capsidation and the physical structure for rAAV infection. The AAVITR used in the vectors of this disclosure does not need to have a wild-type nucleotide sequence (e.g., as described in Kotin, Hum. Gene Ther., 1994, 5:793-801) and can be altered by nucleotide insertion, deletion, or substitution, or the AAV ITR can be derived from any of several AAV serotypes. More than 40 AAV serotypes are currently known, and new serotypes and variants of existing serotypes continue to be identified. See Gao et al., PNAS, 2002, 99(18):11854-6; Gao et al., PNAS, 2003, 100(10):6081-6; and Bossis et al., J. Virol., 2003, 77(12):6799-810. Any use of AAV serotypes is considered to be within the scope of this disclosure.In some embodiments, the rAAV vector is a vector derived from an AAV serotype, including but not limited to AAV ITRs such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotypes. In some embodiments, the nucleic acid in the AAV contains the following ITRs: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serotypes. In some embodiments, the nucleic acid in the AAV further encodes a miRNA as described herein. In some embodiments, the rAAV particle comprises an AAV1, an AAV2HBKO capsid (e.g., as described in WO 2015168666), an AAV9 capsid, a PHP.B capsid, a PHP.eB capsid, or an Olig001 capsid.

[0112] For example, the nucleic acid in an AAV may contain at least one ITR of any AAV serotype considered herein, and may further encode a miRNA comprising a first strand and a second strand, wherein a) the first and second strands form a double helix; b) the first strand contains a guiding region; and c) the second strand contains a non-guiding region, wherein the non-guiding region contains a two-nucleotide deletion at bases 9 and 10 to create a protrusion in the guiding strand. In some embodiments, the vector may include a filler nucleic acid. In some embodiments, the filler nucleic acid may encode a green fluorescent protein. In some embodiments, the filler nucleic acid may be located between the promoter and the nucleic acid encoding the miRNA. In some embodiments, the filler nucleic acid is an A1AT filler nucleic acid.

[0113] Different AAV serotypes are used to optimize the transduction of specific target cells or to target specific cell types within specific target tissues (e.g., diseased tissues). rAAV particles may contain viral proteins and viral nucleic acids of the same or mixed serotypes. For example, in some embodiments, rAAV particles may contain an AAV1 capsid protein and at least one AAV2 ITR, or they may contain an AAV2 capsid protein and at least one AAV1 ITR. Any combination of AAV serotypes for generating rAAV particles is provided herein, as each combination is explicitly stated herein. In some embodiments, this disclosure provides rAAV particles containing an AAV1 capsid and a rAAV vector of this disclosure flanked by at least one AAV2 ITR (e.g., an expression construct containing nucleic acid encoding a miRNA of this disclosure). In some embodiments, this disclosure provides rAAV particles containing an AAV2 capsid. In some embodiments, the rAAV particle comprises an AAV1, an AAV2HBKO caption (e.g., as described in WO 2015168666), an AAV9 caption, a PHP.B caption, a PHP.eB caption, or an Olig001 caption.

[0114] In some respects, this disclosure provides viral particles containing recombinant self-complementary genomes. AAV viral particles with self-complementary genomes and methods for using self-complementary AAV genomes are described in the following literature: U.S. Patent Nos. 6,596,535; 7,125,717; 7,465,583; 7,785,888; 7,790,154; 7,846,729; 8,093,054; and 8,361,457; and Wang Z. et al., (2003) Gene Ther [Gene Therapy] 10:2105-2111, each incorporated herein by reference in its entirety. rAAV containing self-complementary genomes will rapidly form double-stranded DNA molecules using its partially complementary sequences (e.g., complementary coding and non-coding strands of the transgene). In some embodiments, this disclosure provides an AAV viral particle comprising an AAV genome, wherein the rAAV genome comprises a first heteropolynucleotide sequence (e.g., the miRNA disclosed herein) and a second heteropolynucleotide sequence (e.g., the antisense strand of the miRNA disclosed herein), wherein the first heteropolynucleotide sequence may form intrastrand base pairs with the second polynucleotide sequence along most or all of its length. In some embodiments, the first and second heteropolynucleotide sequences are linked by a sequence that promotes intrastrand base pairing (e.g., a hairpin DNA structure). Hairpin structures are known in the art, for example, in miRNA or siRNA molecules. In some embodiments, the first and second heteropolynucleotide sequences are linked by a mutated ITR (e.g., a right-hand ITR). In some embodiments, the ITR comprises the polynucleotide sequence 5'-ttggccactccctctctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct-3' (SEQ ID NO: 50). The mutated ITR contains a deletion of the D region containing the terminal dissociation sequence. Therefore, during the replication of the AAV viral genome, the rep protein will not cleave the viral genome at the mutated ITR, and thus, the recombinant viral genome comprising the following in 5' to 3' order will be packaged in the viral capsid: AAVITR, a first heteropolynucleotide sequence containing the regulatory sequence, the mutated AAV ITR, a second heteropolynucleotide in the opposite orientation to the first heteropolynucleotide, and a third AAV ITR.In some embodiments, this disclosure provides an AAV viral particle comprising a recombinant viral genome comprising: a functional AAV2 ITR, a first polynucleotide sequence encoding the miRNA disclosed herein, a mutated AAV2 ITR comprising a deletion of the D region and lacking a functional terminal dissociation sequence, a second polynucleotide sequence comprising a complementary sequence of the first polynucleotide sequence encoding the miRNA disclosed herein, and the functional AAV2 ITR. Production of viral particles

[0115] rAAV particles can be generated using methods known in the art. See, for example, U.S. Patent Nos. 6,566,118; 6,989,264; and 6,995,006. In practicing this disclosure, host cells used for generating rAAV particles include mammalian cells, insect cells, plant cells, microorganisms, and yeast. The host cell can also be a packaging cell in which the AAV rep and cap genes are stably maintained; or a production cell in which the AAV vector genome is stably maintained. Exemplary packaging and production cells are derived from 293 cells, A549 cells, or HeLa cells. The AAV vector is purified and formulated using standard techniques known in the art.

[0116] Methods known in the art for producing rAAV vectors include, but are not limited to, transfection, stable cell line production, and infectious hybrid virus production systems, including adenovirus-AAV hybrids, herpesvirus-AAV hybrids (Conway, JE et al., (1997) J. Virology 71(11):8780-8789), and baculovirus-AAV hybrids. rAAV production cultures for producing rAAV viral particles require the following: 1) suitable host cells, including, in the case of baculovirus production systems, human cell lines such as HeLa, A549, or 293 cells, or insect cell lines such as SF-9; 2) suitable helper viral functions, provided by wild-type or mutant adenoviruses (e.g., temperature-sensitive adenoviruses), herpesviruses, baculoviruses, or plasmid constructs providing helper functions; 3) AAV rep and cap genes and gene products; 4) nucleic acids flanking at least one AAV ITR sequence (e.g., therapeutic nucleic acids); and 5) suitable culture media and culture medium components supporting rAAV production. In some embodiments, the AAV rep and cap gene products can be derived from any AAV serotype. Generally, but not necessarily, the AAV rep gene product has the same serotype as the ITR of the rAAV vector genome, provided that the rep gene product can function to replicate and package the rAAV genome. Suitable culture media known in the art can be used to generate rAAV vectors. These media include, but are not limited to, media produced by Hyclone Laboratories and JRH, including modified Eagle Medium (MEM), Durbeco Modified Eagle Medium (DMEM); custom formulations, such as those described in U.S. Patent No. 6,566,118; and Sf-900 II SFM medium as described in U.S. Patent No. 6,723,551, each of which is incorporated herein by reference in its entirety, particularly relating to custom culture medium formulations used in the generation of recombinant AAV vectors. In some embodiments, the AAV helper function is provided by adenovirus or HSV. In some embodiments, the AAV helper function is provided by baculovirus, and the host cell is an insect cell (e.g., Spodoptera frugiperda (Sf9) cells).

[0117] In some embodiments, rAAV particles can be generated via a triple transfection method, such as the exemplary triple transfection method provided below. In short, a plasmid containing the rep gene and capsid gene can be transfected (e.g., using the calcium phosphate method) together with a helper adenovirus plasmid into a cell line (e.g., HEK-293 cells), and the virus can be collected and optionally purified. Therefore, in some embodiments, rAAV particles are generated by triple transfecting a host cell with nucleic acid encoding the rAAV vector, nucleic acid encoding AAV rep and cap, and nucleic acid encoding AAV helper virus function, wherein transfecting the nucleic acid into the host cell produces host cells capable of producing rAAV particles.

[0118] In some embodiments, rAAV particles can be produced by a production cell line method, such as the exemplary production cell line method provided below (see also references in Martin et al., (2013) Human Gene Therapy Methods 24:253-269). Briefly, a cell line (e.g., HeLa cell line) can be stably transfected with a plasmid containing the rep gene, capsid gene, and promoter heterologous nucleic acid sequence. Cell lines can be screened to select a lead clone for rAAV production, which can then be amplified in a production bioreactor and infected with an adenovirus (e.g., wild-type adenovirus) as an assistant to initiate rAAV production. The virus can then be harvested, the adenovirus can be inactivated (e.g., by heating) and / or removed, and the rAAV particles can be purified. Thus, in some embodiments, rAAV particles are produced by a production cell line comprising one or more of the following: nucleic acids encoding an rAAV vector, nucleic acids encoding AAV rep and cap, and nucleic acids encoding AAV helper virus functions.

[0119] In some aspects, methods for generating any rAAV particles as disclosed herein are provided, the method comprising (a) culturing a host cell under conditions for generating rAAV particles, wherein the host cell contains (i) one or more AAV packaging genes, wherein each of the AAV packaging genes encodes an AAV replication and / or capsidation protein; (ii) an rAAV protovector containing a nucleic acid encoding a miRNA as disclosed herein, flanked by at least one AAV ITR; and (iii) an AAV helper function; and (b) recovering the rAAV particles generated by the host cell. In some embodiments, the at least one AAV ITR is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV, or mouse AAV capsid serum ITR, etc. In some embodiments, the capsidated protein is selected from the group consisting of: AAV1, AAV2, AAV3, AAV4, AAV5, AAV6 (e.g., wild-type AAV6 capsid or variant AAV6 capsid such as ShH10, as described in U.S. Pre-Publication Publication 2012 / 0164106), AAV7, AAV8, AAVrh8, AAVrh8R, AAV9 (e.g., wild-type AAV9 capsid, or modified AAV9 capsid as described in U.S. Pre-Publication Publication 2013 / 0323226), AAV10, AAVrh10, AAV11, AAV12, tyrosine capsid mutants, heparin-binding capsid mutants, AAV2R471A capsid, AAVAAV2 / 2-7m8 capsid, AAV... DJ costumes (e.g., AAV-DJ / 8 costume, AAV-DJ / 9 costume, or any other costume described in U.S. Pre-Grant Publication 2012 / 0066783), AAV2 N587A costume, AAV2 E548A costume, AAV2 N708A costume, AAV V708K costume, goat AAV costume, AAV1 / AAV2 chimeric costume, bovine AAV costume, mouse AAV costume, rAAV2 / HBoV1 costume, or AAV costumes as described in U.S. Patent No. 8,283,151 or International Publication No. WO / 2003 / 042397. In some embodiments, the AAV costume is the AAV2HBKO costume as described in WO 2015168666. In some embodiments, the AAV costume is the AAV9 costume. In some embodiments, the AAV costume is the PHP.B, PHP.eB, or Olig001 costume. In some embodiments, the mutant capsid protein retains the ability to form an AAV capsid.In some embodiments, the capsid protein is an AAV5 tyrosine mutant capsid protein. In another embodiment, the rAAV particle comprises a capsid protein from an AAV serotype derived from clade AF. In some embodiments, the rAAV particle comprises an AAV1 capsid and a recombinant genome containing an AAV2 ITR and nucleic acid encoding the miRNA disclosed herein. In yet another embodiment, the rAAV particle is purified. As used herein, the term "purified" includes a formulation of rAAV particles free from at least some other components that may also be present in the rAAV particle naturally present or where it was originally prepared. Thus, for example, purification techniques can be used to prepare isolated rAAV particles, enriching them from source mixtures such as culture lysates or production culture supernatants. Enrichment can be measured in a variety of ways, such as by the proportion of DNase-resistant particles (DRP) or genome copies (gc) present in solution or by infectivity, or it can be measured relative to a second potential interfering substance present in the source mixture, such as contaminants, including production culture contaminants or process contaminants, including helper viruses, culture medium components, etc.

[0120] Many methods for generating adenovirus vector particles are known in the art. For example, for internally disrupted adenovirus vectors, the adenovirus vector genome and the helper adenovirus genome can be transfected into a packaging cell line (e.g., the 293 cell line). In some embodiments, the helper adenovirus genome may contain recombination sites flanking its packaging signal, and both genomes can be transfected into a packaging cell line expressing recombinases (e.g., using the Cre / loxP system), such that the target adenovirus vector is packaged more efficiently than the helper adenovirus (see, for example, Alba, R. et al. (2005) Gene Ther. 12 Supplement 1:S18-27). Adenovirus vectors can be harvested and purified using standard methods, such as those described herein.

[0121] Many methods for generating lentiviral vector particles are known in the art. For example, for third-generation lentiviral vectors, a vector containing the target lentiviral genome with the gag and pol genes can be co-transfected with a vector containing the rev gene into a packaging cell line (e.g., the 293 cell line). The target lentiviral genome also contains a chimeric LTR that promotes transcription in the absence of Tat (see Dull, T. et al. (1998) J. Virol. [Journal of Virology] 72:8463-71). Lentiviral vectors can be harvested and purified using the methods described herein (e.g., Segura MM et al., (2013) Expert Opinion on Biology Ther. [Expert Opinion on Biology] 13(7):987-1011).

[0122] Many methods for generating HSV particles are known in the art. HSV vectors can be harvested and purified using standard methods, such as those described herein. For example, for replication-defective HSV vectors, the target HSV genome lacking all immediate early (IE) genes can be transfected into complementary cell lines that provide genes required for virus production, such as ICP4, ICP27, and ICP0 (see, for example, Samaniego, LA et al. (1998) J. Virol. [Journal of Virology] 72:3307-20). HSV vectors can be harvested and purified using methods described (e.g., Goins, WF et al., (2014) Herpes Simplex Virus Methods in Molecular Biology [Herpes Simplex Virus Methods in Molecular Biology] 1144:63-79).

[0123] This document also provides pharmaceutical compositions comprising recombinant viral particles and a pharmaceutically acceptable carrier, the recombinant viral particles containing a transgene encoding the miRNA disclosed herein. These pharmaceutical compositions are suitable for any of the administration methods described herein. Pharmaceutical compositions comprising recombinant viral particles encoding a nucleic acid encoding the miRNA disclosed herein can be introduced into the brain. For example, recombinant viral particles containing a nucleic acid encoding the miRNA disclosed herein can be administered intrastriatally. Any recombinant viral particles disclosed herein, including rAAV, adenovirus, lentivirus, and HSV particles, can be used.

[0124] In some embodiments, a pharmaceutical composition comprising recombinant viral particles and a pharmaceutically acceptable carrier is suitable for administration to humans, wherein the recombinant viral particles comprise a transgene encoding the miRNA disclosed herein. Such carriers are well known in the art (see, for example, Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). In some embodiments, a pharmaceutical composition comprising rAAV as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant lentiviral particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant adenovirus particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration). In some embodiments, a pharmaceutical composition comprising recombinant HSV particles as described herein and a pharmaceutically acceptable carrier is suitable for injection into the brain of a mammal (e.g., intrastriatal administration).

[0125] Pharmaceutically acceptable carriers of this type can be sterile liquids, such as water and oils, including those of petroleum, animal, plant, or synthetic origin, such as peanut oil, soybean oil, and mineral oil. Saline solutions, as well as aqueous solutions of dextran, polyethylene glycol (PEG), and glycerol, can also be used as liquid carriers, particularly for injectable solutions. Pharmaceutical compositions may further contain additional components such as preservatives, buffers, tonics, antioxidants and stabilizers, nonionic wetting or clarifying agents, thickeners, etc. The pharmaceutical compositions described herein can be packaged in single-unit doses or in multiple-dose formulations. These compositions are typically formulated as sterile and substantially isotonic solutions.

[0126] In some embodiments, SEQ ID NO: 1-14 (e.g., artificial miRNA sequences) can be configured to target human and / or non-human primate (cynomolgus macaque) SNCA mRNA, thereby avoiding known SNCA mutations and / or low-seed-mediated off-target potential. In some embodiments, SEQ ID NO: 1-14 can be expressed in two different human cell lines for SNCA mRNA and / or protein reduction. In some embodiments, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 8 can be expressed in a BAChSyn mouse model expressing human SNCA via an adeno-associated virus vector. In some embodiments, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 8 can reduce SNCA mRNA. In some embodiments, the reduction of SNCA mRNA by SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 8 can be confirmed by RT-dPCR.

[0127] In some aspects, this document provides an artificial miRNA comprising a first strand and a second strand, wherein (a) the first strand and the second strand form a double helix; (b) the first strand comprises a guiding region containing the nucleotide sequences of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14; and (c) the second strand may comprise a non-guiding region containing a nucleotide sequence that is partially complementary to the nucleotide sequence of the guiding region. In some embodiments, the guiding region comprises the sequence of SEQ ID NO: 4. In some embodiments, the guiding region comprises the sequence of SEQ ID NO: 5. In some embodiments, the guiding region comprises the sequence of SEQ ID NO: 7. In some embodiments, the guiding region comprises the sequence of SEQ ID NO: 8.

[0128] In some embodiments, the guiding region may contain (a) the sequence of SEQ ID NO: 1 and the unguided region may contain the sequence of SEQ ID NO: 15; (b) the sequence of SEQ ID NO: 2 and the unguided region may contain the sequence of SEQ ID NO: 16; (c) the sequence of SEQ ID NO: 3 and the unguided region may contain the sequence of SEQ ID NO: 17; (d) the sequence of SEQ ID NO: 4 and the unguided region may contain the sequence of SEQ ID NO: 18; (e) the sequence of SEQ ID NO: 5 and the unguided region may contain the sequence of SEQ ID NO: 19; (f) the sequence of SEQ ID NO: 6 and the unguided region may contain the sequence of SEQ ID NO: 20; (g) the sequence of SEQ ID NO: 7 and the unguided region may contain the sequence of SEQ ID NO: 21; (h) the sequence of SEQ ID NO: 8 and the unguided region may contain the sequence of SEQ ID NO: 22; (i) SEQ ID NO: (j) the sequence of SEQ ID NO: 10, and the unguided region contains the sequence of SEQ ID NO: 24; (k) the sequence of SEQ ID NO: 11, and the unguided region contains the sequence of SEQ ID NO: 25; (l) the sequence of SEQ ID NO: 12, and the unguided region contains the sequence of SEQ ID NO: 26; (m) the sequence of SEQ ID NO: 13, and the unguided region contains the sequence of SEQ ID NO: 27; or (n) the sequence of SEQ ID NO: 14, and the unguided region contains the sequence of SEQ ID NO: 28.

[0129] In some embodiments, the guiding region may contain the sequence of SEQ ID NO: 4, and the unguided region may contain the sequence of SEQ ID NO: 18. In some embodiments, the guiding region may contain the sequence of SEQ ID NO: 5, and the unguided region may contain the sequence of SEQ ID NO: 19. In some embodiments, the guiding region may contain the sequence of SEQ ID NO: 7, and the unguided region may contain the sequence of SEQ ID NO: 21. In some embodiments, the guiding region may contain the sequence of SEQ ID NO: 8, and the unguided region may contain the sequence of SEQ ID NO: 22. In some embodiments, the artificial miRNA may target SNCA mRNA.

[0130] In some embodiments, an artificial miRNA can be configured to guide the binding of the coding sequence of SNCA mRNA to the region, thereby reducing the expression of the protein SNCA.

[0131] In some embodiments, the expression construct may contain a nucleic acid encoding an artificial miRNA as provided herein. In some embodiments, the nucleic acid encoding the miRNA is operatively linked to a promoter. In some embodiments, the nucleic acid encoding the artificial miRNA may be cloned into a miRNA scaffold, wherein transcription of the expression construct may form a stem-loop structure.

[0132] In some embodiments, the vector may contain an expression construct as provided herein. In some embodiments, the vector may be an rAAV vector.

[0133] In some embodiments, the viral particles may comprise a vector as provided herein, wherein the viral particles may comprise AAV particles containing a capsidized rAAV vector. In some embodiments, the viral particles may comprise a modified AAV9 capsid protein. In some embodiments, the modified AAV9 capsid protein may comprise SAN006. In some embodiments, the viral particles may comprise a modified AAV2 capsid protein. In some embodiments, the viral particles may comprise AAV2-HBKO. VI. Treatment Methods

[0134] Certain aspects of this disclosure relate to methods for treating synucleinopathy in individuals in need by reducing SNCA mRNA expression levels. In some embodiments, the invention provides a method for treating synucleinopathy by administering an effective amount of an expression cassette (e.g., an expression cassette delivered in rAAV particles) for expressing an artificial miRNA of the present disclosure. Examples of synucleinopathy include, but are not limited to, Parkinson's disease.

[0135] Expression cassettes for expressing artificial miRNAs (e.g., expression cassettes delivered in rAAV particles) can be administered via various routes. In some embodiments, the administration includes direct spinal injection and / or intracerebral administration. In some embodiments, the administration is performed at sites selected from: the brain, medulla oblongata, pons, cerebellum, intracranial cavity, pericerebral meninges, dura mater, arachnoid mater, pia mater, cerebrospinal fluid (CSF) in the pericerebral subarachnoid space, deep cerebellar nuclei, cerebral ventricular system, subarachnoid space, striatum, cortex, septum, thalamus, hypothalamus, and brain parenchyma. In some embodiments, the administration includes intraventricular injection into at least one lateral ventricle. In some embodiments, the administration includes intrathecal injection in the cervical, thoracic, and / or lumbar regions. In some embodiments, the administration includes intrastriatal injection. In some embodiments, the administration includes intrathalamic injection.

[0136] In some embodiments, administration to the central nervous system may include an intraparenchymal route. In some embodiments, an intraparenchymal route may include the thalamus, striatum, or hippocampus. In some embodiments, administration to the central nervous system may include an intracerebrospinal fluid (CSF) route. In some embodiments, an intracerebrospinal fluid (CSF) route may include within the ventricles, cerebellomedullary cistern, or intrathecal. In some embodiments, administration to the central nervous system may include a peripheral route. In some embodiments, a peripheral route may include an intravenous route. In some embodiments, administration to the central nervous system may include an experimental route. In some embodiments, an experimental route may include an intranasal route.

[0137] In some embodiments, the route of administration (ROA) may include an intracerebrospinal fluid (CSF) ROA. In some embodiments, an intracerebrospinal fluid (CSF) ROA may include an intraventricular (ICV), intracerebellomedullary cistern (ICM), or intrathecal (IT) ROA.

[0138] An effective amount of rAAV (in particle form in some embodiments) is administered according to the treatment goal. For example, where a low transduction percentage can achieve the desired therapeutic effect, the treatment goal is typically met or exceeded. In some cases, this transduction level can be achieved by transducing: only about 1% to 5% of target cells of the desired tissue type, at least about 20% of cells of the desired tissue type in some embodiments, at least about 50% in some embodiments, at least about 80% in some embodiments, at least about 95% in some embodiments, and at least about 99% of cells of the desired tissue type in some embodiments. The rAAV composition can be administered by one or more administrations, which may be administered during the same procedure or at intervals of days, weeks, months, or years. One or more of any of the administration routes described herein may be used. In some embodiments, multiple carriers may be used to treat humans.

[0139] In some embodiments of the foregoing aspects, rAAV is administered by direct injection into the spinal cord, intrathecal injection, or intracisional injection. In some embodiments, rAAV is administered to more than one location in the spinal cord or cerebellomedullary cistern. In some embodiments, rAAV is administered to more than one location in the spinal cord. In some embodiments, rAAV is administered to one or more of the lumbar, thoracic, and cervical subarachnoid spaces of the spinal cord. In some embodiments, rAAV is administered to the cerebellomedullary cistern.

[0140] In some embodiments, the present invention provides a method for treating a person suffering from synucleinosis by administering an effective amount of a pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA disclosed herein. In some embodiments, the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients.

[0141] In some embodiments, these methods include administering an effective amount of a pharmaceutical composition to an individual in need of synucleinosis, the pharmaceutical composition comprising a recombinant viral vector encoding an artificial miRNA polypeptide disclosed herein. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 10 12 10 × 10 12 11 × 10 12 15 × 10 12 20 × 10 12 25 × 10 12 30 × 10 12 Or 50 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 12 Up to 6 × 10 12 6 × 10 12 Up to 7 × 10 12 7 × 10 12 Up to 8 × 10 12 8 × 10 12 Up to 9 × 10 12 9 × 10 12 Up to 10 × 10 12 10 × 10 12 Up to 11 × 10 12 11 × 10 12 Up to 15 × 10 12 15 × 10 12 Up to 20 × 10 12 20 × 10 12 Up to 25 × 10 12 25 × 10 12 Up to 30 × 10 12 30 × 10 12 Up to 50 × 10 12 Or 50 × 10 12 Up to 100 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 12 Up to 10 × 10 1210 × 10 12 Up to 25 × 10 12 Or 25 × 10 12 Up to 50 × 10 12 Any one of the following: genome copies / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 9 6 × 10 9 7 × 10 9 8 × 10 9 9 × 10 9 10 × 10 9 11 × 10 9 15 × 10 9 20 × 10 9 25 × 10 9 30 × 10 9 Or 50 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 9 Up to 6 × 10 9 6 × 10 9 Up to 7 × 10 9 7 × 10 9 Up to 8 × 10 9 8 × 10 9 Up to 9 × 10 9 9 × 10 9 Up to 10 × 10 9 10 × 10 9 Up to 11 × 10 9 11 × 10 9 Up to 15 × 10 9 15 × 10 9 Up to 20 × 10 9 20 × 10 9 Up to 25 × 10 9 25 × 10 9 Up to 30 × 10 9 30 × 10 9 Up to 50 × 10 9 Or 50 × 10 9 Up to 100 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is approximately 5 × 10⁻⁶. 9 Up to 10 × 10 910 × 10 9 Up to 15 × 10 9 15 × 10 9 Up to 25 × 10 9 Or 25 × 10 9 Up to 50 × 10 9 Any one of the following: transduction units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 6 × 10 10 7 × 10 10 8 × 10 10 9 × 10 10 10 × 10 10 11 × 10 10 15 × 10 10 20 × 10 10 25 × 10 10 30 × 10 10 40 × 10 10 Or 50 × 10 10 Any of the following: infection units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 Up to 6 × 10 10 6 × 10 10 Up to 7 × 10 10 7 × 10 10 Up to 8 × 10 10 8 × 10 10 Up to 9 × 10 10 9 × 10 10 Up to 10 × 10 10 10 × 10 10 Up to 11 × 10 10 11 × 10 10 Up to 15 × 10 10 15 × 10 10 Up to 20 × 10 10 20 × 10 10 Up to 25 × 10 10 25 × 10 10 Up to 30 × 10 10 30 × 10 10 Up to 40 × 10 10 40 × 10 10 Up to 50 × 10 10 Or 50 × 10 10Up to 100 × 10 10 Any of the following: infection units / mL. In some embodiments, the viral titer of the viral particles (e.g., rAAV particles) is at least about 5 × 10⁻⁶. 10 Up to 10 × 10 10 10 × 10 10 Up to 15 × 10 10 15 × 10 10 Up to 25 × 10 10 Or 25 × 10 10 Up to 50 × 10 10 Any of the infection units / mL. In some embodiments, the viral particles are rAAV particles.

[0142] In some embodiments, the dose of viral particles administered to an individual is at least about 1 × 10⁻⁶. 8 From approximately 6 × 10 13 Any one of the following: genome copies / kg body weight. In some embodiments, the dose of viral particles administered to an individual is approximately 1 × 10⁻⁶. 8 From approximately 6 × 10 13 Any one of the following: genome copies / kg body weight. In some embodiments, the dose of viral particles administered to an individual is approximately 1 × 10⁻⁶. 10 2 × 10 10 3 × 10 10 4 × 10 10 5 × 10 10 6 × 10 10 7 × 10 10 8 × 10 10 9 × 10 10 1 × 10 11 2 × 10 11 3 × 10 11 4 × 10 11 5 × 10 11 6 × 10 11 7 × 10 11 8 × 10 11 9 × 10 11 1 × 10 12 2 × 10 12 13 × 10 12 4 × 10 12 5 × 10 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 1012 Or 1 × 10 13 Any one of the following: genome copies / kg body weight.

[0143] In some embodiments, the total amount of viral particles administered to an individual is at least about 1 × 10⁻⁶. 9 From approximately 1 × 10 14 Any one of the genome copies. In some embodiments, the total amount of viral particles administered to an individual is approximately 1 × 10⁻⁶. 9 From approximately 1 × 10 14 Any one of the genome copies. In some embodiments, the total amount of viral particles administered to an individual is approximately 1 × 10⁻⁶. 11 2 × 10 11 3 × 10 11 4 × 10 11 5 × 10 11 6 × 10 11 7 × 10 11 8 × 10 11 9 × 10 11 1 × 10 12 2 × 10 12 3 × 10 12 4 × 10 12 5 × 10 12 6 × 10 12 7 × 10 12 8 × 10 12 9 × 10 12 1 × 10 13 2 × 10 13 13 × 10 13 4 × 10 13 5 × 10 13 6 × 10 13 7 × 10 13 8 × 10 13 9 × 10 13 Or 1 × 10 14 Any one of the genome copies.

[0144] In some respects, this article provides methods for treating or preventing synucleinopathy in patients in need. These methods include administering to a patient a composition comprising a miRNA containing a guide strand and a follower strand that binds to SNCA mRNA, wherein the guide strand contains the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, or SEQ ID NO: 14.

[0145] In some embodiments, synucleinopathy may include Parkinson's disease, multiple system atrophy, or Lewy body dementia. In some embodiments, synucleinopathy may be Parkinson's disease. In some embodiments, synucleinopathy may be multiple system atrophy. In some embodiments, synucleinopathy is Lewy body dementia.

[0146] In some embodiments, this document provides methods for reducing SNCA expression in patients with synucleinopathy, methods comprising administering to the patient a composition comprising a miRNA containing a guide strand and / or a follower strand capable of binding SNCA mRNA, wherein the guide strand comprises the nucleotide sequence of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14.

[0147] In some embodiments, this document provides a method for reducing exogenous human SNCA protein after treatment with an artificial miRNA. A plasmid expressing a specified artificial miRNA ID is co-transfected in triplicate with a target cDNA having a flanking UTR into HEK293T cells, as follows: Figure 1The images are depicted. Three days later, cells were lysed, and total α-synuclein levels were measured via a commercial enzyme-linked immunosorbent assay (ELISA, Abcam) according to the manufacturer's instructions. Values ​​were normalized relative to cells treated with control artificial miRNA. Fifteen sequences significantly reduced human α-synuclein. Values ​​represent mean + / - SEM. p < 0.01.

[0148] In some embodiments, this document provides a method for dose-dependent reduction of endogenous human SNCA following treatment with an artificial miRNA. To evaluate candidates based on their ability to reduce endogenous human SNCA, HeLa cells were transfected with a specified artificial miRNA. Plasmids were transfected into cells at three different dose levels using Lipofectamine 3000, with the DNA:lipid ratio kept constant by supplementing the transfection carrier DNA (Promega) as needed. Two days post-transfection, SNCA mRNA levels were quantified using digital PCR and normalized relative to housekeeping TBP mRNA and relative to control artificial miRNA sequences transfected at each corresponding dose level. Each artificial miRNA exhibited a dose-dependent reduction of the human SNCA target, such as… Figure 2 The values ​​depicted represent the mean + / - SEM, where individual data points are shown. , , p < 0.05, p < 0.01, p < 0.001.

[0149] In some embodiments, this document provides methods for reducing SNCA mRNA levels and / or decreasing SNCA proteins (e.g., SNCA peptides). The ratio of the guide chain to the follower chain and the results of chain processing in human cells are depicted in... Figures 3A-3B In some embodiments, the ratio of the guide strand to the lagging strand can be used as an indicator of whether the artificial miRNA binds to the intended target (via homology between the guide and target mRNAs). Figures 3A-3BThe results depicted show the isolation of total RNA (including small RNAs) from HeLa cells treated with triplicate of specified sequences, and the use of small RNA sequencing to measure the number of small RNAs matching the predicted guide or follower strand sequences. Each sequence tested exhibited excellent guide expression: follower expression with values ​​close to 100% (99.11, 99.72, 99.76, and 99.33 for 264, 265, 422, and 423, respectively). The values ​​on the graph represent the mean + / - SEM of three biological replicates, with individual data points shown.

[0150] In some embodiments, this document provides methods including tandemly linked artificial miRNAs. In such embodiments, tandemly linked artificial miRNAs can improve the reduction of SNCA in human cells. Results of experiments including tandemly linked artificial miRNAs are depicted in... Figures 4A-4D In the process, plasmids expressing artificial miRNAs in specified forms (CBA-single, H1-single, 2X 7bp, 2X 130bp, 3X 7bp, and 3X 130bp) were transfected into HeLa cells. Figures 4A-4D Human SNCA (e.g., hSNCA) normalized relative to the corresponding control (e.g., Steward TBP) is shown on the y-axis, and each plasmid form is shown on the x-axis. Figure 4A The result for SEQ ID NO: 4 is shown. Figure 4B The results for SEQ ID NO: 5 are shown. Figure 4C The results for SEQ ID NO:7 are shown, and Figure 4D The results for SEQ ID NO: 8 are shown. SNCA mRNA levels were measured using RT-dPCR 2 days post-transfection.

[0151] Quantification was performed and normalized relative to housekeeping TBP mRNA and relative to cells treated with control plasmids in each corresponding form. Groups were compared with each other via one-way ANOVA, with repeated measures plotted. Figures 4A-4D The value represents the mean of four biological replicates plus or minus SEM. , , The values ​​are p < 0.01, p < 0.001, and p < 0.0001, respectively.

[0152] In some embodiments, this document provides a method for reducing human SNCA mRNA in vivo. Results showing the reduction of human SNCA mRNA in vivo are depicted in… Figure 5AIn this study, the AAV.SAN006 vector encoding the specified artificial miRNA was bilaterally injected into the striatum of two-month-old BAChSyn mice. Each artificial miRNA was tested as a single CBA-driven artificial miRNA and compared to a vector in which the same artificial miRNA was expressed as three tandem repeat sequences separated by a longer 130 bp linker ("-3X" suffix). Total RNA was isolated from striatal tissue at 6 weeks post-administration. Human SNCA mRNA levels were quantified using RT-dPCR, and the levels were normalized to the geometric mean relative to Hprt and Rpp30 housekeeping mRNA. Values ​​were plotted as fold changes relative to animals injected with the prepared buffer. Bars represent the standard error (SEM) of the mean plus or minus the mean. VII. Products and Reagent Kits

[0153] Kits or articles for use in the methods described herein are also provided. In each respect, the kits contain the compositions described herein in suitable packaging (e.g., recombinant viral particles of this disclosure, such as rAAV particles, containing nucleic acids encoding the miRNAs disclosed herein). Suitable packaging for the compositions described herein (such as striatal compositions) is known in the art and includes, for example, vials (e.g., sealed vials), containers, ampoules, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), etc. These articles may be further sterilized and / or sealed.

[0154] This disclosure also provides kits comprising the compositions described herein, and may further include one or more instructions regarding methods of using the compositions, as described herein. The kits described herein may further include other materials deemed commercially and user-appropriate, including additional buffers, diluents, filters, needles, syringes, and packaging inserts with instructions for performing any of the methods described herein. For example, in some embodiments, the kit comprises: a composition comprising a recombinant viral particle encoding a transgenic miRNA of the disclosed herein, the composition being used to deliver at least 1 × 10⁻⁶ 1 / 2 ... 9 Delivery of a genome copy to the brain of a mammal such as those described herein (e.g., via striatal administration) to a primate; a pharmaceutically acceptable carrier suitable for injection into the brain of a primate; and one or more of the following: a buffer, a diluent, a filter, a needle, a syringe, and a packaging insert having instructions for performing injection into the brain of a primate (e.g., via striatal administration). In some embodiments, the kit includes instructions for treating neurodegenerative synucleinopathy with the recombinant viral particles described herein. In some embodiments, the kit includes instructions for using the recombinant viral particles described herein according to any of the methods described herein. Example

[0155] This disclosure will be more fully understood by referring to the examples below. However, these examples should not be construed as limiting the scope of this disclosure. It should be understood that the examples and embodiments described herein are for illustrative purposes only, and various modifications or changes made based on these examples and embodiments will be conceived by those skilled in the art and should be included within the spirit and scope of this application and the appended claims. General Method plasmid and adeno-associated virus (AAV) production

[0156] Artificial microRNAs (artificial miRNAs) were expressed from a mouse miR155 scaffold under the control of the human cytomegalovirus enhancer / chicken β-actin (CBA) promoter. The guide sequence was designed to match regions homologous only to human and NHP SNCA. The control artificial miRNA encoded a non-targeted artificial miRNA sequence designed for minimal seed-mediated off-target gene repression. To generate a recombinant AAV vector encoding the artificial miRNA, the expression cassette was cloned into a plasmid containing an AAV2 inverted terminal repeat (ITR). To generate the AAV.SAN006 vector, HEK293 cells were transfected with three plasmids (containing ITR, AAVrep / cap, and Ad helper) in a 1:1:1 ratio using PEI (polyethyleneimine). The Ad helper plasmid (pHelper) was obtained from Xstrata Genetics / Agilent Technologies (Santa Clara, CA). AAV was purified using cesium chloride ultracentrifugation, and the virus was titrated against the polyA sequence using qPCR. Cell culture and transfection

[0157] HEK293T (ATCC) and HeLa (ATCC) cells were grown in complete DMEM at 37°C and 5% CO2 until 70%-80% confluence. Endotoxin-free plasmid DNA was diluted in Opti-MEM according to the manufacturer's instructions, compounded with Lipofectamine 3000 (Ingenie), and added to the cells. Cells were washed with PBS and lysed 2-3 days post-transfection for RNA or protein measurements (as shown). Total RNA isolation and mRNA quantification by RT-digital PCR (RTdPCR)

[0158] After chloroform addition and phase separation, total RNA, including small RNAs < 200 bp, was isolated from the aqueous phase using the RNeasy 96 QIAcube HT kit (QIAgen #74171) according to the manufacturer's instructions. RNA concentration and purity were assessed by measuring absorbance at A260 / A280 and A260 / A230 on a NanoDrop eight spectrophotometer (Thermo Scientific). RNA samples were diluted to isostatics and tested using the QIAcuity 8 system (QIAgen) and the QIAcuity One-Step Virus RT-PCR Kit (QIAgen 1123145) for multiplex quantification of human SNCA mRNA (TaqMan Hs01103383) and human TBP mRNA (IDT Hs.PT.58v.39859774) by RT-dPCR. SNCA mRNA values ​​were normalized relative to TBP housekeeping and analyzed relative to control levels. small RNA sequencing

[0159] Small RNA (< 200 bp) libraries were prepared and sequenced using the Illumina Truseq Small RNA Library Preparation Kit and sequencer. Raw data were filtered and aligned to a human reference genome (human B38 genome used in Qiagen Omicsoft studio) with miRbase.R22 gene annotations; reads were also aligned to a custom genome for each artificial miRNA hairpin box, which included a guide sequence, stem-loop sequence, and follower sequence plus flanking sequences. A custom Python script was used to output mature miRNA sequences and counts. α-synuclein ELISA

[0160] HEK293T cells were washed with PBS, lysed in assay buffer, and the total α-synuclein level was measured by ELISA using the Human α-synuclein SimpleStep Kit (Abogen, ab260052) according to the manufacturer's instructions. Values ​​were normalized relative to control cells transfected with artificial miRNA. Animal use and care

[0161] All procedures were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Jackson Labs and in accordance with the guidelines set forth in the NIH Guidelines for the Care and Use of Laboratory Animals. Adult C57BL / 6N-Tg(SNCA)129Mjff / J (“BAChSyn”) mice were maintained in a 12-hour light / dark cycle with food and water readily available. Each animal was identified with a unique ear tag and microchip. Stereotactic injection using AAV.SAN006-artificial miRNA vector

[0162] Mice were anesthetized with isoflurane exposure and fixed in a stereotactic frame (Stoelting) under continuous isoflurane perfusion. The scalp was shaved and incised along the midline to locate the anterior fontanelle. A small borehole was drilled above the desired location within the brain. A Hamilton syringe was mounted onto the microcontrolled stereotactic frame (Stoelting), and the needle was slowly lowered to the appropriate depth. For striatal injection, 3E10 viral particles were injected into each hemisphere at coordinates AP+0.5, DV-3.1, and ML+ / -2.0. The virus was injected at a rate of 0.5 µL / min during each procedure. The needle was left in place for two minutes to prevent backflow of the vector through the needle diameter before being slowly removed from the brain. Mice were kept warm and continuously observed postoperatively until recovery. Four weeks post-injection, mice were euthanized by an overdose with >150 mg / kg sodium pentobarbital. After overdose, the mice were kept warm until their hearts were perfused with ice-cold PBS. Statistical analysis

[0163] Statistical analysis was performed using Prism software (version 9, Graphpad) with one-way ANOVA (and multiple comparisons where applicable). Example 1: Artificial miRNA sequences reduce the expression of α-synuclein in human cells.

[0164] Seventeen candidate artificial miRNA (mRNA) sequences were selected based on the following criteria: 1) their low off-target potential calculated using an algorithm to select sequences with seeds having a lower predicted off-target frequency (Boudreau et al., 2013); 2) avoidance of known pathogenic SNCA mutations and high-frequency single nucleotide polymorphisms (SNPs); and 3) homology between human and non-human primate SNCAs to promote translatability. The sequences shown in Table 1 were each embedded in a mouse miR155 scaffold for expression as artificial miRNAs and cloned into expression plasmids driven by a constitutive polymerase II promoter.

[0165] First, sequences were screened in HEK293T cells via a co-transfection-based assay. An expression plasmid containing human SNCA cDNA was designed with a sufficient SNCA 3' UTR sequence (NM_000345.3) to cover the binding sites of all artificial miRNAs selected. This experimental design, due to the co-transfection of the target with the artificial miRNA, enabled the detection of activity even from low-potency artificial miRNAs.

[0166] Three copies of a plasmid expressing the specified artificial miRNA ID were co-transfected into HEK293T cells with target cDNA containing flanking UTRs. HEK293T cells were lysed after 3 days. Total α-synuclein was quantified using a commercial enzyme-linked immunosorbent assay (ELISA, Abogen), according to the manufacturer's instructions. Values ​​were normalized relative to cells treated with control artificial miRNA. Values ​​represent mean + / - SEM. p < 0.01. Compared with cells transfected with control artificial miRNA sequences, fifteen sequences significantly reduced human α-synuclein, such as... Figure 1 As shown.

[0167] The ability of a subset of candidate sequences to reduce endogenous α-synuclein levels in a dose-dependent manner was then evaluated. HeLa cells were transfected with plasmids encoding each artificial miRNA at different levels. Specifically, plasmids were transfected into cells at three different dose levels using Lipofectamine 3000, with the DNA:lipid ratio kept constant by supplementing the transfection carrier DNA (Promega) as needed. Cells were lysed 2 days post-transfection, and total RNA was quantified by reverse transcription digital polymerase chain reaction (RT-dPCR) to evaluate SNCA mRNA reduction. SNCA mRNA levels were normalized relative to housekeeping TBP mRNA and relative to control artificial miRNA sequences transfected at each corresponding dose level. Each sequence showed a dose-dependent reduction in endogenous human SNCA mRNA, such as... Figure 2 As shown. The values ​​represent the mean + / - SEM, with individual data points shown. , , p < 0.05, p < 0.01, p < 0.001. Example 2: Artificial miRNA sequences exhibit excellent strand bias and accurate 5' processing in human cells.

[0168] Each artificial miRNA was expressed as a precursor miRNA hairpin loop, which was machined by an endogenous RNAi (RNAi) machine to generate a mature 21-nucleotide double-stranded structure. The antisense guide strand of this double-stranded structure was preferentially loaded into the RNA-induced silencing complex (RISC) to mediate the degradation of the target mRNA, while the lagging strand was excluded and degraded in the cytosol. Appropriate 5' cleavage of the artificial miRNA guide sequence defines the seed sequence and is crucial for mid-target transcriptional silencing. Small RNA sequencing was used to evaluate in vivo guide and lagging strand processing based on known metrics that contribute to the mid-target and off-target activities of the artificial miRNAs. HeLa cells were transfected with plasmids encoding each artificial miRNA at different levels (50 ng, 100 ng, 150 ng). Cells were lysed 2 days post-transfection, and total RNA was isolated. Small RNA libraries were prepared and sequenced to quantify guide and lagging strand expression levels and strand cleavage fidelity. Four artificial miRNA sequences (SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 8) were selected for further characterization. The ratio of the guide strand to the lair strand can be used as an indicator of whether the artificial miRNA binds to the intended target (via homology between the guide and target mRNAs). Therefore, the guide strand containing the antisense seed sequence targeting SNCA was highly enriched compared to its corresponding lair strand, accounting for an average of over 99% of the total expressed artificial miRNA sequences, such as... Figure 3A As shown. Total RNA (including small RNAs) was isolated from HeLa cells treated in triplicate with specified sequences. Small RNA sequencing was used to measure the number of small RNAs matching the predicted guide or follower strand sequences. For each artificial miRNA, the accuracy of 5' processing of the guide strand exceeded 99%. Specifically, each sequence tested exhibited excellent guide: follower expression with values ​​close to 100% (99.11, 99.72, 99.76, and 99.33 for SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 8, respectively). Figure 3B The figures depict the mean + / - SEM values ​​from three biological replicates, with individual data points. These results demonstrate that the strand bias of these artificial miRNAs is highly accurate, and that the 5' cut of the artificial miRNA sequence preserves the seed sequence designed to target SNCAs. Example 3: Tandem-linked artificial miRNAs improve the reduction of target SNCA mRNA.

[0169] While each artificial miRNA significantly reduces SNCA targets when expressed as a single hairpin, it is possible to promote expression and target reduction by expressing artificial miRNAs as a tandem series, all driven by a single promoter (Fowler, 2016). A series of modified artificial miRNA expression plasmids with a CBA promoter were designed, which drives the expression of one to three copies (1X, 2X, 3X) of the artificial miRNA. The effect of hairpin linker length was evaluated by selecting short 7-base-pair (bp) linker nucleotide sequences or longer sequences (referred to as "130") with a 134 bp linker (first) and a 124 bp linker (second), resulting in four variants (2 x 7 bp, 2 x 130 bp, 3 x 7 bp, and 3 x 130 bp) for each single "parent" artificial miRNA. The effects of these linked artificial miRNA plasmids on the hairpin linker length were also evaluated compared to single artificial miRNAs expressed from a strong H1 polymerase III-based promoter. Plasmids expressing artificial miRNAs in specified forms (CBA-single, H1-single, 2 x 7 bp, 2 x 130 bp, 3 x 7 bp, and 3 x 130 bp) were transfected into HeLa cells. Total RNA was isolated after 2 days for quantification of SNCA target mRNA knockdown using RT-dPCR. Knockdown was assessed relative to the corresponding control artificial miRNA plasmid expressed in the same form. SNCA RNA levels were compared to housekeeping TBP. mRNA was normalized and cells were treated with each corresponding form of control plasmid. Regardless of the parental artificial miRNA sequence, SNCA knockdown generated by the 3 x 130 bp linked form was significantly greater than that of a single artificial miRNA expressed from the CBA or H1 promoters. Figures 4A-4D As shown. Groups were compared with each other via one-way ANOVA with repeated measures. The values ​​represent the mean + / - SEM of the four biological replicates. , , The values ​​are p < 0.01, p < 0.001, and p < 0.0001, respectively. Example 4: Reduction of human SNCA mRNA in vivo

[0170] The ability of candidate artificial miRNAs to reduce human SNCA in vivo was evaluated. An AAV vector (capsid SAN006) was generated to express a single artificial miRNA hairpin or 3X 130bp linker variant. For in vivo studies, transgenic mice expressing the complete human SNCA gene, including the UTR, were used, enabling evaluation of the guide sequence of the 3'UTR targeting the SNCA mRNA. The AAV.SAN006 vector was administered directly to the striatum of two-month-old BAChSyn mice at 3E10 VG per hemisphere (e.g., bilateral injection into the striatum). Each artificial miRNA was tested as a single CBA-driven artificial miRNA and compared to a vector in which the same artificial miRNA was expressed as three tandem repeat sequences separated by a longer 130bp linker ("-3X" suffix). Total striatal RNA and genomic DNA were isolated to evaluate target reduction and compared to control animals injected with a prepared buffer. Total RNA was isolated from striatal tissue at 6 weeks post-administration. Human SNCA mRNA levels were quantified using RT-dPCR and normalized to the geometric mean of Hprt and Rpp30 housekeeping mRNA. Except for SEQ ID NO: 5, each sequence presented evidence of effective SNCA mRNA reduction in single and / or 3X form, such as... Figure 5A The values ​​are plotted as folds of change relative to animals injected with the prepared buffer. Bars represent the mean + / - SEM. Figure 5B The x-axis shows that for SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, and SEQ ID NO: 8, the 3 x 130 bp strand variants exhibited increased expression levels of amiRNA relative to a single miRNA hairpin. The increased expression levels of the strand variants ranged from 2-fold to 10-fold relative to a single miRNA hairpin. Other sequence lists Target peptide amino acid sequence KGGGFHG (SEQ ID NO: 60) Target peptide-amino acid sequence with flanks as linkers AAAKGGGFHGAS (SEQ ID NO: 61) SAN0006 capsid amino acid sequence (complete structural protein) .

Claims

1. An artificial miRNA comprising a first strand and a second strand, wherein... (a) The first chain and the second chain form a double chain; (b) The first strand contains a guide region containing the following nucleotide sequences: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14; and (c) The second strand contains a non-guided region containing a nucleotide sequence that is partially complementary to the nucleotide sequence of the guided region.

2. The artificial miRNA of claim 1, wherein the guidance region comprises the sequence of SEQ ID NO:

4.

3. The artificial miRNA of claim 1, wherein the guidance region comprises the sequence of SEQ ID NO:

5.

4. The artificial miRNA of claim 1, wherein the guidance region comprises the sequence of SEQ ID NO:

7.

5. The artificial miRNA of claim 1, wherein the guidance region comprises the sequence of SEQ ID NO:

8.

6. The artificial miRNA of claim 1, wherein the guide region comprises (a) The sequence of SEQ ID NO: 1, and the non-guided region contains the sequence of SEQ ID NO: 15; (b) The sequence of SEQ ID NO: 2, and the non-guided region contains the sequence of SEQ ID NO: 16; (c) The sequence of SEQ ID NO: 3, and the non-guided region contains the sequence of SEQ ID NO: 17; (d) The sequence of SEQ ID NO: 4, and the non-guided region contains the sequence of SEQ ID NO: 18; (e) The sequence of SEQ ID NO: 5, and the non-guided region contains the sequence of SEQ ID NO: 19; (f) The sequence of SEQ ID NO: 6, and the non-guided region contains the sequence of SEQ ID NO: 20; (g) The sequence of SEQ ID NO: 7, and the non-guided region contains the sequence of SEQ ID NO: 21; (h) The sequence of SEQ ID NO: 8, and the non-guided region contains the sequence of SEQ ID NO: 22; (i) The sequence of SEQ ID NO: 9, and the non-guided region contains the sequence of SEQ ID NO: 23; (j) The sequence of SEQ ID NO: 10, and the non-guided region contains the sequence of SEQ ID NO: 24; (k) The sequence of SEQ ID NO: 11, and the non-guided region contains the sequence of SEQ ID NO: 25; (l) The sequence of SEQ ID NO: 12, and the non-guided region contains the sequence of SEQ ID NO: 26; (m) The sequence of SEQ ID NO: 13, and the non-guided region contains the sequence of SEQ ID NO: 27; or (n) The sequence of SEQ ID NO: 14, and the non-guided region contains the sequence of SEQ ID NO:

28.

7. The artificial miRNA of claim 6, wherein the guiding region comprises the sequence of SEQ ID NO: 4, and the non-guiding region comprises the sequence of SEQ ID NO:

18.

8. The artificial miRNA of claim 6, wherein the guiding region comprises the sequence of SEQ ID NO: 5, and the non-guiding region comprises the sequence of SEQ ID NO:

19.

9. The artificial miRNA of claim 6, wherein the guiding region comprises the sequence of SEQ ID NO: 7, and the non-guiding region comprises the sequence of SEQ ID NO:

21.

10. The artificial miRNA of claim 6, wherein the guiding region comprises the sequence of SEQ ID NO: 8, and the non-guiding region comprises the sequence of SEQ ID NO:

22.

11. The artificial miRNA according to any one of claims 1-10, wherein the artificial miRNA targets SNCA mRNA.

12. The artificial miRNA of claim 11, wherein the binding of the guidance region to the coding sequence of the SNCA mRNA reduces the expression of the protein SNCA.

13. An expression construct comprising a nucleic acid encoding an artificial miRNA as described in any one of claims 1-12.

14. The expression construct of claim 13, wherein the nucleic acid encoding the miRNA is operatively linked to a promoter.

15. The expression construct of claim 13 or claim 14, wherein the nucleic acid encoding the artificial miRNA is cloned into a miRNA scaffold, wherein the transcription of the expression construct forms a stem-loop structure.

16. A vector comprising the expression construct as described in any one of claims 13-15.

17. The carrier of claim 16, wherein the carrier is an rAAV carrier.

18. A viral particle comprising the vector as described in claim 16, wherein the viral particle is an AAV particle capsidating the rAAV vector.

19. The viral particle of claim 18, wherein the viral particle comprises a modified AAV9 capsid protein.

20. A method of treating or preventing synucleinopathy in a patient in need, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding SNCA mRNA, wherein the guide strand comprises the nucleotide sequence of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO:

14.

21. The method of claim 20, wherein the synucleinosis is Parkinson's disease.

22. The method of claim 20, wherein the synucleinosis is multiple system atrophy.

23. The method of claim 20, wherein the synucleinosis is Lewy body dementia.

24. A method for reducing SNCA expression in a patient with synucleinopathy, the method comprising administering to the patient a composition comprising a miRNA comprising a guide strand and a follower strand for binding SNCA mRNA, wherein the guide strand comprises the nucleotide sequence of: SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13 or SEQ ID NO: 14.

Citation Information

Patent Citations

  • Container for packaging the finished product

    RU239243U1

  • Methods for generating high titer helper-free preparations of released recombinant AAV vectors

    US6566118B1

  • Metabolically activated recombinant viral vectors and methods for the preparation and use

    US6596535B1

  • Production of adeno-associated virus in insect cells

    US6723551B2

  • Methods for generating high titer helper-free preparations of released recombinant AAV vectors

    US6989264B2