Highly efficient transdermal recombinant humanized elastin, preparation method and application thereof
Patent Information
- Application Number
- CN202610474050.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-04-11
- Publication Date
- 2026-08-28
AI Technical Summary
[0006]为了解决现有技术中弹性蛋白难以经皮有效吸收以及皮肤弹性蛋白随着年龄增长减少导致皮肤老化等技术问题,本发明提供了一种高效透皮的重组人源化弹性蛋白及其制备方法和应用
[0015] The beneficial effects of this invention are as follows: The recombinant humanized elastin provided by this invention has good tissue compatibility and is suitable for clinical applications; it is obtained through recombinant expression, avoiding the risk of contamination by viruses, mycoplasma, and animal-derived pathogens, significantly reducing immunogenicity, and improving the biosafety and batch-to-batch consistency of the product; the elastin molecule provided by this invention simultaneously possesses a hydrophobic β-helical domain and a lysine-rich hydrophilic domain, effectively mimicking the structure and function of human elastin; the elastin provided by this invention can enter the cell through the cell membrane and reach the dermis through the stratum corneum, solving the problem of elasticity issues in existing technologies. It overcomes the problem of transdermal absorption of sex proteins; it has significant effects on promoting proliferation, adhesion, and migration of human skin fibroblasts (HFF-1) and exhibits good cell activity; it has excellent anti-wrinkle properties, good solubility, strong compatibility, and high thermal stability, making it suitable for use as an active ingredient in functional skincare product formulations; in D-galactose-induced skin aging animal models, it has good anti-aging and skin barrier repair effects; in zebrafish experiments, it has significant anti-wrinkle effects, inhibits the production of reactive oxygen species, and promotes tail fin regeneration; the constructed expression system is stable, has a high expression level, and is feasible for large-scale production.
Smart Images

Figure CN122647591A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of genetic engineering and biomaterials technology, specifically to a highly efficient transdermal recombinant humanized elastin, its preparation method, and its applications. Background Technology
[0002] Elastin is a crucial component of the extracellular matrix and plays a vital role in maintaining skin elasticity. With age, the amount of elastin in the skin gradually decreases, and its loss and degradation are significant factors contributing to decreased skin elasticity, wrinkle formation, and tissue laxity. More importantly, elastin gene expression declines significantly in adulthood, and once degraded, the body is almost unable to regenerate it. Therefore, exogenous elastin supplementation has become an important research direction in the fields of anti-aging and skin repair.
[0003] Currently, recombinant elastin has become a research hotspot in the fields of skin care and tissue engineering due to its excellent biocompatibility and activity. CN119371518A discloses a highly stable recombinant humanized elastin, which improves expression level and stability through codon optimization, and can promote HSF cell migration and increase the expression of related genes. CN120699132A describes a recombinant humanized elastin with a typical β-helical hydrophobic domain and a lysine-rich hydrophilic domain. This protein can significantly promote the proliferation, adhesion and migration of human skin fibroblasts, and has excellent antioxidant, anti-wrinkle and anti-aging activities.
[0004] Regarding the improvement of skin aging, CN120699133A discloses a recombinant humanized elastin based on the core functional sequence of human elastin. This protein synergistically improves endogenous aging characteristics such as decreased skin elasticity, collagen loss, and high oxidative stress by remodeling the extracellular matrix network structure. CN117683116B discloses a recombinant humanized elastin containing one or more elastin domains from the full-length amino acid sequence of human elastin. This protein has anti-aging, anti-wrinkle, and firming effects when applied in cosmetics. In addition, CN117551184B describes a recombinant elastin with better water solubility and lower immunogenicity, which can significantly promote the proliferation, adhesion, and migration of human skin keratinocytes and fibroblasts, and has a repair function for burned skin.
[0005] However, some problems still need to be solved in existing technologies. The high barrier function of the stratum corneum makes it difficult for proteins to be effectively absorbed transdermally, severely limiting their topical application in anti-aging and skin repair. Although novel transdermal delivery systems such as microneedles and ionic liquids have improved drug absorption to some extent, these technologies still have problems such as potential skin irritation, insufficient user compliance, strict storage conditions, complex preparation processes, and high costs, which limit their widespread application in daily skincare or large-scale industrial production. Therefore, developing a recombinant humanized elastin with highly efficient transdermal capabilities that can maintain good bioactivity and help the skin achieve effective absorption is of great significance for promoting the application of elastin in anti-aging and skin repair. Summary of the Invention
[0006] To address the technical problems of efficient transdermal absorption of elastin in existing technologies and the decline in skin elastin with age leading to skin aging, this invention provides a highly efficient transdermal recombinant humanized elastin, its preparation method, and its applications. The technical solution adopted by this invention to solve its technical problems is as follows: It provides a highly efficient transdermal recombinant humanized elastin, whose amino acid sequence includes the amino acid sequence shown in SEQ ID NO. 1, or an amino acid sequence shown in SEQ ID NO. 1 with one or more amino acids substituted, deleted, and / or added, and having the same function as the protein composed of the amino acid sequence shown in SEQ ID NO. 1.
[0007] Preferably, the present invention also provides a method for preparing the recombinant humanized elastin, comprising the following steps:
[0008] (1) Synthesize the gene sequence encoding the precursor elastin of the recombinant humanized elastin;
[0009] (2) The gene sequence is ligated to a vector, transformed into genetically engineered bacteria, and recombinant genetically engineered bacteria are constructed;
[0010] (3) The recombinant genetically engineered bacteria were expressed, the bacterial cells were collected, the supernatant was obtained by cleavage, and the elastin was obtained by purification;
[0011] Furthermore, the present invention also provides a gene encoding the precursor elastin of the recombinant humanized elastin, the gene sequence of which includes the gene sequence shown in SEQ ID NO. 3, or a gene sequence shown in SEQ ID NO. 3 with one or more nucleotides substituted, deleted and / or added, and expressing the same protein as the gene sequence shown in SEQ ID NO. 3.
[0012] Optionally, the recombinant vector is a pCold or pET vector, and the genetically engineered bacterium is Escherichia coli.
[0013] Preferably, purification is performed by affinity chromatography in step (3).
[0014] Furthermore, the recombinant humanized elastin can be used in skin care products, dressings, implants, artificial skin, artificial blood vessels, medical devices, biomaterials, and functional foods, especially in topical preparations for anti-wrinkle, anti-aging, or skin barrier repair.
[0015] The beneficial effects of this invention are as follows: The recombinant humanized elastin provided by this invention has good tissue compatibility and is suitable for clinical applications; it is obtained through recombinant expression, avoiding the risk of contamination by viruses, mycoplasma, and animal-derived pathogens, significantly reducing immunogenicity, and improving the biosafety and batch-to-batch consistency of the product; the elastin molecule provided by this invention simultaneously possesses a hydrophobic β-helical domain and a lysine-rich hydrophilic domain, effectively mimicking the structure and function of human elastin; the elastin provided by this invention can enter the cell through the cell membrane and reach the dermis through the stratum corneum, solving the problem of elasticity issues in existing technologies. It overcomes the problem of transdermal absorption of sex proteins; it has significant effects on promoting proliferation, adhesion, and migration of human skin fibroblasts (HFF-1) and exhibits good cell activity; it has excellent anti-wrinkle properties, good solubility, strong compatibility, and high thermal stability, making it suitable for use as an active ingredient in functional skincare product formulations; in D-galactose-induced skin aging animal models, it has good anti-aging and skin barrier repair effects; in zebrafish experiments, it has significant anti-wrinkle effects, inhibits the production of reactive oxygen species, and promotes tail fin regeneration; the constructed expression system is stable, has a high expression level, and is feasible for large-scale production. Attached Figure Description
[0016] Figure 1 This is an SDS-PAGE image of the recombinant humanized elastin with high transdermal efficiency of the present invention.
[0017] Figure 2 This is a diagram showing the reversible phase transition results of the recombinant humanized elastin of this invention.
[0018] Figure 3 This is a diagram showing the cell experiment results of the recombinant humanized elastin of the present invention.
[0019] Figure 4 This is a diagram showing the cellular uptake experiment results of the recombinant humanized elastin of this invention.
[0020] Figure 5 This is an in vitro permeation curve of the recombinant humanized elastin of the present invention.
[0021] Figure 6The in vivo transdermal permeability of the FITC-labeled recombinant humanized elastin of this invention at 2, 4, 8 and 12 h.
[0022] Figure 7 This is a diagram showing the characterization results of the Combo system for the recombinant humanized elastin of this invention;
[0023] Figure 8 This is a stained image of a skin tissue section used in the anti-aging characterization of recombinant humanized elastin according to the present invention.
[0024] Figure 9 The results are an evaluation of the oxidative stress environment in endogenous aging mice containing recombinant humanized elastin of this invention.
[0025] Figure 10 The results of RT-qPCR detection of related gene expression in endogenous aging mice containing recombinant humanized elastin of this invention are shown.
[0026] Figure 11 The figure shows the experimental results of zebrafish anti-wrinkle, reactive oxygen species scavenging, and tail fin repair using recombinant humanized elastin of this invention. Detailed Implementation
[0027] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0028] In the following specific embodiments, unless otherwise specified, the methods used are conventional methods and the reagents used are conventional reagents that can be obtained commercially.
[0029] Example 1: Preparation of highly efficient transdermal recombinant humanized elastin
[0030] The amino acid sequence of the highly efficient transdermal recombinant humanized elastin rTHE in this embodiment is shown in SEQ ID NO. 1. This protein is obtained by treating the precursor elastin with a protease, and the preparation process is as follows:
[0031] (1) The amino acid sequence of the precursor elastin of recombinant humanized elastin rTHE is shown in SEQ ID NO. 2, and the gene sequence is shown in SEQ ID NO. 3;
[0032] (2) Construct a precursor elastin expression strain; construct a plasmid incorporating the above nucleic acid, and confirm the successful synthesis of the plasmid by DNA sequencing; transform the plasmid into Escherichia coli BL21-DE3 strain to obtain a precursor elastin expression strain, and store the successfully transformed strain in glycerol at -80 ℃.
[0033] (3) Preparation and purification of recombinant humanized elastin
[0034] 200 μL of the pre-prepared seed culture was inoculated into 200 mL of LB broth containing the appropriate antibiotic and cultured overnight at 37 °C on a shaker to obtain proliferated cells. Subsequently, the above culture was transferred to 1 L of TB broth containing antibiotic at an inoculation rate of 3% (v / v) and further amplified in a shaker at 37 °C. When the optical density OD of the culture medium... 600 When the expression level reached 0.8–1.0, the culture temperature was lowered to 25 °C, and IPTG at a final concentration of 1 mM was added for induction. The induction was carried out overnight at this temperature. After induction, the bacterial culture was centrifuged at 3200 rpm for 30 min at 4 °C, the supernatant was discarded, and the bacterial cells were collected. The obtained bacterial cells were uniformly dispersed in lysis buffer (containing 20 mM sodium phosphate, 0.5 M sodium chloride, and 20 mM imidazole) at pH 7.4, and then the cells were thoroughly lysed using an ultrasonic homogenizer. The lysed suspension was centrifuged at low temperature to remove cell debris, the supernatant was collected, and affinity purification was performed using a Ni²⁺-NTA metal affinity chromatography column to obtain recombinant humanized elastin rTHE.
[0035] The obtained recombinant humanized elastin rTHE was analyzed by SDS-PAGE, and the results are as follows: Figure 1 As shown (lanes 1, 2, and 3 are all rTHE samples). The experimental results show that the rTHE obtained in this example forms a clear single protein band, indicating that the prepared recombinant humanized elastin has high purity and good homogeneity, meeting the requirements for subsequent applications.
[0036] Example 2 Characterization of the reversible phase transition properties of recombinant humanized elastin
[0037] Reversible phase transition is an important characteristic of elastin. To verify the phase transition behavior of the recombinant humanized elastin rTHE provided in this invention, the turbidity of the rTHE as a function of temperature was measured using a UV-Vis spectrophotometer equipped with a temperature control system to evaluate its reversible phase transition temperature (Tt). rTHE was dissolved in a buffer solution (20 mM sodium phosphate, pH 7.4) at concentrations ranging from 5 to 100 μM. Additionally, rTHE was dissolved in the same buffer solution containing different concentrations of NaCl, with a protein concentration of 100 μM and a sodium chloride concentration ranging from 0.25 to 1.5 M. The solutions were placed in quartz tubes and equilibrated at 15°C for 3 minutes as the initial temperature. The temperature was gradually increased by 4°C and equilibrated for 3 minutes each time. The measurement was terminated when the absorbance continued to increase and stabilized. The transition temperature was considered the temperature corresponding to the phase transition. The heated rTHE turbid solution was cooled at 4°C for 3 hours, shaken well, and then redispersed. Its reconstitution behavior was observed (no data available).
[0038] As shown in Figure 2, when the concentration of rTHE is 100 μM, the absorbance of its solution remains relatively stable within the temperature range of 20 ℃ to 30 ℃, and no obvious aggregation phenomenon is observed. When the temperature rises above 30 ℃, the solution begins to become turbid, and the absorbance increases rapidly, indicating that rTHE begins to undergo a phase transition. As the temperature continues to rise to 60 ℃, the absorbance reaches a plateau, with a maximum value of approximately 1.2. Different concentrations of rTHE solutions all exhibit similar temperature response curves. Figure 2 A).
[0039] Furthermore, using phase transition temperature (Tt) as the ordinate and the logarithm of rTHE concentration (lgC) as the modulus, rTHE ) construct a linear relationship model for the horizontal axis, such as Figure 2 As shown in Figure B, the phase transition temperature decreases with increasing protein concentration, exhibiting a strong linear correlation. Simultaneously, this study also investigated the effect of salt ion concentration in the solution on the phase transition behavior (Figures 2C and 2D). When the NaCl concentration increased from 0.1 M to 1.5 M, the phase transition temperature of rTHE showed a gradual decreasing trend, indicating that salt ions can significantly promote its phase transition process.
[0040] In summary, the results show that the recombinant humanized elastin rTHE prepared in this invention has typical reversible temperature-responsive phase transition characteristics, which conforms to the structure-function characteristics of natural elastin, and provides important physicochemical basis for its subsequent formulation development and application.
[0041] Example 3: Verification of the Cell Biological Function of Recombinant Humanized Elastin
[0042] (1) Cytotoxicity test
[0043] Add 100 μL of the solution to a 48-well plate at a density of 1 x 10⁻⁶. 5Human skin fibroblasts (HFF-1) cells per mL were incubated at 37 °C in 5% CO2 for 24 h. After 24 h, the culture medium in the wells was aspirated, and the recombinant humanized elastin rTHE prepared in Example 1 was diluted with DMEM medium to prepare solutions of 0, 5, 10, 50, 100, 500, and 1000 μg / mL, which were then added to 48-well plates. The control group was incubated with only DMEM medium. Incubation was continued at 37 °C in 5% CO2 for another 24 h. The toxicity of the designed recombinant humanized elastin to HFF-1 cells was detected using a CCK-8 assay.
[0044] like Figure 3 As shown in Figure B, the cell survival rate was over 100% after adding different concentrations of rTHE, indicating that the recombinant humanized elastin provided by this invention has no cytotoxicity and excellent biocompatibility.
[0045] (2) Cell proliferation experiment
[0046] HFF-1 cells were seeded at a density of 5 × 10³ cells / well in 24-well plates and cultured in DMEM medium containing 10% fetal bovine serum at 37 °C and 5% CO2 for 24 h. Six wells were then treated with DMEM medium containing 1.0 mg / mL of recombinant humanized elastin rTHE prepared in Example 1, serving as a blank control group. Cell proliferation was assessed using the CCK-8 assay after 1, 3, and 5 days of further culture at 37 °C and 5% CO2. The relative cell growth rates of the blank control group and the rTHE group were calculated at different time points based on the cell growth status of the blank control group on day 1 (set as 100% growth rate).
[0047] HFF-1 cells were fed at a rate of 1×10 5 Cells were seeded at a density of 1.0 mg / mL in a culture system containing 1.0 mg / mL of recombinant humanized elastin rTHE prepared in Example 1. After incubation at 37 °C for 1, 3, and 5 days, cell viability was assessed using a live / dead cell double staining kit.
[0048] like Figure 3 As shown in Figure C, the cell viability after treatment with 1 mg / mL rTHE was 107.7%, 178.7%, and 226.3% at days 1, 3, and 5, respectively. The results indicate that rTHE has good cell compatibility and can significantly promote cell proliferation. Figure 3As shown in Figure D, the results indicate that cells in all groups maintained good proliferative capacity from day 1 to day 5. Furthermore, compared to the control group, the rTHE group significantly promoted cell proliferation. Notably, the number of viable cells gradually increased with prolonged culture time, and the cell density in the rTHE group was significantly higher than that in the control group. These results demonstrate that rTHE possesses excellent cell activity and can significantly accelerate cell proliferation. In summary, these results indicate that the recombinant humanized elastin of this invention exhibits excellent cell proliferation-promoting activity.
[0049] (3) Cell adhesion and spreading experiment
[0050] The recombinant humanized elastin rTHE prepared in Example 1 was diluted with PBS to a solution of 1.0 mg / mL. Heat denaturation with 1% BSA was used as a negative control. The prepared elastin rTHE solution was added to a 24-well plate and incubated at 4 °C for 24 h, after which the solution was aspirated. Human skin fibroblast HFF-1 cells were diluted with DMEM medium to a density of 1 x 10⁻⁶ cells / well. 5 HFF-1 cells were added to each well at a concentration of 10 cells / mL, and after 6 h, the cells were analyzed by fluorescence microscopy. Figure 3 B) Observation of HFF-1 cell adhesion and spreading characteristics. Fluorescence microscopy revealed the cell adhesion and spreading characteristics of HFF-1 cells on rTHE. HFF-1 cells were cultured in 24-well plates covered with heat-denatured BSA and rTHE, respectively. In the BSA group, HFF-1 cells remained round, indicating poor cell adhesion in BSA. Conversely, HFF-1 cells bound to the rTHE substrate exhibited a typical spindle-shaped morphology, indicating enhanced cell adhesion and spreading. Simultaneously, TRITC (tetramethylrhodamine isothiocyanate)-labeled phalloidin and DAPI fluorescent dye were used to label actin stress fibers and the nucleus in the cytoskeleton, respectively, for observation using confocal fluorescence microscopy. Figure 3 As shown in Figure E, fluorescence imaging results revealed that, compared to the control group, cells adhered in the rTHE group formed a highly developed actin cytoskeleton structure, while the cytoskeleton structure in the control group was relatively sparse. These results indicate that rTHE can significantly enhance the proliferation, adhesion, and spreading abilities of HFF-1 cells.
[0051] (4) Cell migration experiment
[0052] HFF-1 cells were loaded at 5 × 10 5Cells were seeded at a density of 1 cell / well in 6-well plates and cultured for 24 h until a monolayer confluence. A linear scratch was made vertically along a pre-marked line on the bottom of the plate using a 10 μL pipette tip, followed by gentle washing three times with PBS to remove detached cells. The experimental group was cultured in DMEM medium containing 1.0 mg / mL of recombinant humanized elastin rTHE prepared in Example 1, while the blank control group received only DMEM medium. The plates were incubated at 37 °C in a 5% CO2 humidified incubator. Images of the scratched areas were taken using an inverted microscope at 0 h and 24 h to analyze cell migration.
[0053] like Figure 3 As shown in Figure A, the scratches in the 0-hour blank group and the rTHE group were clear; after 24 hours of culture, most of the scratches in the rTHE group disappeared, and the cell migration rate was significantly higher than that in the blank group, indicating that the recombinant humanized elastin of the present invention has the ability to effectively promote the migration of HFF-1 cells.
[0054] The ability of rTHE to promote cell migration was evaluated using a scratch assay. Cell migration at the scratch site was observed 24 h after rTHE treatment. Cells treated with rTHE showed significantly improved migration after 24 h. The cell migration rate in the rTHE group was significantly higher than that in the Blank group, indicating that the recombinant humanized elastin of this invention has the ability to promote cell migration.
[0055] Example 4: Preparation of FITC-labeled recombinant humanized elastin
[0056] Steps (1)-(3) are the same as those in Example 1 for the preparation of recombinant humanized elastin (1)-(3);
[0057] (4) Dissolve 10 times excess FITC in 0.5 M sodium bicarbonate buffer at pH 9.0, mix with the protein solution, and add to a round-bottom flask. React at 0 °C for 24 hours. After the reaction, collect the solution and dialyze it with ultrapure water until the precipitate shows no fluorescence. Protect the sample from light during the operation. After dialysis, collect the sample and freeze-dry it to obtain the FITC-labeled target recombinant humanized elastin FITC-rTHE.
[0058] The recombinant human elastin rHE without transdermal sequence was labeled using the same method to obtain the FITC-labeled target recombinant human elastin FITC-rHE.
[0059] Example 5: Characterization of the properties of FITC-labeled recombinant humanized elastin
[0060] 1. Permeabilization experiment
[0061] 500 μL of HFF-1 cell suspension (2 × 10⁶ cells per well) 5Cells were seeded at a density of 1,000 μL in confocal microplates and incubated for 24 hours (37 °C, 5% CO2) to ensure complete adhesion. Then, 500 μL of 35 μM FITC-rTHE was added to each microplate. Incubation was continued at 37 °C for another 5 h. The ability of each sample to penetrate HFF-1 cells was observed using a laser confocal microscope. Cell nuclei were observed using 360 nm excitation (blue fluorescence), and cytoplasm was observed using 488 nm excitation (green fluorescence).
[0062] Cellular experiment results as follows Figure 4 As shown, obvious green fluorescence was observed in the cytoplasm of HFF-1 cells cultured in FITC-rTHE solution, while no obvious fluorescence was observed in the cytoplasm of HFF-1 cells cultured in FITC-rHE solution. This result indicates that the recombinant humanized elastin rTHE described in this application possesses excellent cell-penetrating ability.
[0063] 2. In vitro skin penetration test
[0064] Pig ear skin was collected, and subcutaneous blood vessels, fascia, and adipose tissue were removed with gauze or absorbent cotton balls. The skin was then repeatedly rinsed with physiological saline until the solution was clear and free of turbidity. The skin was trimmed to a suitable size and hydrated in physiological saline for 1 hour. The receiving chamber of the diffusion cell used physiological saline at pH 5.5 and was stirred at 500 rpm at 37 °C. The hydrated skin stratum corneum was placed face down in the supply chamber and fixed between the supply and receiving chambers of the vertical diffusion cell, ensuring complete contact between the skin and the solution in the receiving chamber without air bubbles. 0.1 mg / mL FITC-labeled rHE and rTHE solutions were added to the supply chamber. At 2, 4, 8, 12, and 24 h, 400 μL of the solution was collected from the receiving chamber, and an equal volume of physiological saline was added to maintain a constant volume of solution in the receiving chamber. The collected solutions were filtered through a filter membrane, and the transmitted concentration was determined using a fluorescence spectrometer based on a standard fluorescence intensity-concentration curve. The cumulative transmittance per unit area (Qn, mg / cm²) at time point n was calculated. 2 The calculation formula is as follows, where the volume of the receiving chamber is 25 mL.
[0065]
[0066] Q n : Cumulative transdermal absorption rate of the sample at time t; C n and C i : The concentration of the sample in the solution is received at time t and the i-th sampling; V i : Sampling volume; V: Volume of receiving chamber; r: Inner diameter of diffusion cell.
[0067] Results of in vitro skin penetration test as follows Figure 5As shown, the transdermal diffusion of rTHE showed a gradually increasing trend within 2-24 hours, while the transdermal diffusion of rHE did not increase significantly within the same period. At 24 hours, the cumulative diffusion of rTHE per unit area reached 0.080 mg / cm². 2 The results showed that the recombinant humanized elastin described in this application can penetrate the skin and exhibits excellent transdermal efficiency during 24 h of transdermal diffusion.
[0068] 3. In vivo skin penetration test
[0069] Clean-grade female Kunming mice weighing 20±2 g were selected. Hair on the backs of the mice was removed using a clipper, followed by further hair removal with a depilatory cream, leaving the back epidermis completely bare. The hair-removed area was approximately 2×4 cm, and the area was stabilized for 24 h. 3 mL of FITC-labeled rTHE solution (1 mg / mL) was applied to the back skin of each mouse, and the mixture was incubated in the dark. At 2 h, 4 h, 8 h, and 12 h after sample application, three mice from each group were sacrificed, and the back skin was harvested and cryopreserved in the dark. The frozen tissue was embedded using embedding medium, and the embedded tissue was frozen sectioned and stained with DAPI to label cell nuclei. The skin penetration ability of each sample was observed using a laser confocal microscope. Skin tissue was observed using excitation at 488 nm (green fluorescence) and 364 nm (blue fluorescence).
[0070] Skin penetration test results as follows Figure 6 As shown, the fluorescence signal of the rTHE group was very obvious at all time points and penetrated deeper into the dermis over time. These results indicate that the recombinant humanized elastin rTHE described in this application has good skin penetration ability.
[0071] Example 6: Characterization of the skin aging repair properties of recombinant humanized elastin
[0072] In a controlled experimental environment (60% RH, 25±2 ℃), mice were housed under a 12-hour light / 12-hour dark circadian rhythm with free access to water and food. After 7 days of acclimatization, the hair on the backs of the mice was shaved using a razor, and depilatory cream was applied to further remove hair, exposing a skin area of approximately 3 cm × 3 cm. To ensure that the depilatory cream did not affect the integrity of the epidermis, the mice were left to stand for 24 hours after hair removal to stabilize their skin condition. Subsequently, the mice were randomly divided into five groups of 6 mice each. The blank group consisted of healthy mice that received a subcutaneous injection of 0.3 mL of physiological saline daily; the other four groups received a subcutaneous injection of D-galactose (D-gal, 1000 mg / kg, dissolved in physiological saline) daily for 8 consecutive weeks. The four groups were: Model group, Positive control group (PC, 5% Vitamin E emulsion), rTHE group (recombinant humanized elastin rTHE prepared in Example 1 dissolved in 1000 mg / L PBS), and rHE group (rHE dissolved in 1000 mg / L PBS). Topical treatment began on the first day of week 3 and continued for 6 weeks. The control and model groups received 1 mL of PBS daily throughout the experiment. All topical treatments (including the experimental treatment solution and Vitamin E emulsion) were evenly applied to the exposed back skin area and thoroughly spread until no visible residue remained, taking care not to damage the skin surface. At the designated experimental time points (weeks 2, 4, and 8), mice underwent back skin examination under anesthesia. Back hair was shaved before examination, and skin condition was assessed using the DermaLab Combo system. After assessment, mice were euthanized by cervical dislocation, and back skin tissue was immediately harvested for subsequent analysis. Skin tissue sections were stained with HE, Masson, and EVG, and skin aging and recovery were observed under a microscope.
[0073] (1) Evaluation of DermaLab Combo System
[0074] like Figure 7 As shown in Figure A, at week 2, all groups of mice except the control group exhibited signs of aging on their backs, including rough skin texture and wrinkles. At week 4, the model group showed a significant increase in wrinkles, indicating accelerated aging. The PC, rTHE, and rHE groups showed reduced wrinkles and smoother skin compared to the model group. At week 8, the model group mice showed even more pronounced wrinkles on their backs, while the positive control, rTHE, and rHE groups showed no obvious wrinkles and relatively smooth skin, essentially returning to a normal state. Furthermore, the rTHE group showed smoother skin than the positive control and rHE groups. This indicates that the recombinant humanized elastin of this invention helps restore skin appearance, reduce wrinkles, and thus repair aging skin.
[0075] Using Combo's ultrasound probe, the density and thickness of mouse skin were observed in vivo to visually assess the ability of elastin rTHE to promote the repair of aging skin. Results were as follows: Figure 7 As shown in Figure B. The results showed that at week 2, all groups except the blank group exhibited thinning of the epidermis and decreased dermal density. At week 4, the dermal density of the PC group, rTHE group, and rHE group began to increase, and the epidermis began to thicken, while the dermal density of the model group showed no significant change compared to week 2. At week 8, the epidermal thickness and dermal density of the PC group, rTHE group, and rHE group recovered to levels consistent with the blank group, with the rTHE group showing better results than the positive control group and the rHE group; all were higher than the model group. Combo's ultrasound probe can simultaneously detect the density of the mouse dorsal skin in vivo, evaluating the ability of recombinant humanized elastin rTHE to promote skin density recovery. Results are as follows... Figure 7 As shown in Figure C. The results showed that at week 2, the skin density of the model group, PC group, rTHE group, and rHE group was significantly lower than that of the control group, with no significant difference among the four groups. At week 4, the skin density of the PC group, rTHE group, and rHE group was significantly increased compared to the model group, with the rTHE group showing higher skin density than the rHE group. At week 8, the skin density of the PC group, rHE group, and rTHE group almost returned to normal skin levels, with the rTHE group showing better recovery than the PC group. This indicates that the recombinant humanized elastin of the present invention helps restore the epidermal thickness and dermal density of aging skin to normal levels.
[0076] Using Combo's TEWL probe, transepidermal water loss from the dorsal skin of mice was measured in vivo to assess the ability of recombinant humanized elastin rTHE to repair the skin barrier. Results are as follows: Figure 7 As shown in Figure D, at week 2, the TEWL values of the model group, PC group, rTHE group, and rHE group were all increased, significantly higher than those of the control group, indicating that the skin barrier function was damaged. At week 4, the TEWL values of the PC group, rTHE group, and rHE group decreased to below those of the model group but higher than those of the control group. The TEWL of the rTHE group was lower than that of the PC group. At week 8, the TEWL values of the PC group, rHE group, and rTHE group returned to normal skin levels. The experimental results demonstrate that the recombinant humanized elastin provided by this invention helps restore the skin barrier function of aging skin.
[0077] Using Combo's moisture probe, the water content of the skin on the back of mice was measured in vivo to assess the ability of recombinant humanized elastin rTHE to promote the restoration of skin hydration. The results are as follows: Figure 7As shown in Figure E. The results showed that at week 2, the skin hydration levels of the model group, PC group, rTHE group, and rHE group all decreased, with no significant differences among the four groups, and all significantly lower than the control group. At week 4, the skin hydration levels of the PC group, rHE group, and rTHE group all increased, and all three were significantly higher than the model group. At week 8, the skin hydration levels of the PC group, rTHE group, and rHE group basically returned to normal skin levels, with the rTHE group having a higher skin hydration level than the PC group. The experiment demonstrates that the recombinant humanized elastin provided by this invention can restore the hydration level of aging skin.
[0078] In summary, the recombinant humanized elastin of the present invention helps restore the epidermal thickness and dermal density of aging skin to normal levels, restores the skin barrier of aging skin, and restores the skin moisture content to normal levels, thereby repairing aging skin.
[0079] (2) Staining of tissue sections
[0080] HE staining was used to investigate the ability of recombinant humanized elastin rTHE to promote the repair of aging skin at the tissue level. Figure 8 As shown in A and 8B, the dorsal skin of the control group mice was healthy during the experiment, with a thick and continuous epidermis, orderly arrangement of epidermal layers, and continuous and dense fiber arrangement in the dermis. At week 2, except for the control group, the epidermis of the mice in all other groups thinned, while the model group and PC group showed slight peeling. At week 4, the epidermis of the model group still showed a trend of thinning, while the epidermis of the PC group, rTHE group, and rHE group gradually thickened. Peeling in the PC group essentially disappeared, and the epidermis thickness in the rTHE group was higher than that in the PC group. At week 8, the epidermal thickness of the rTHE group and rHE group returned to a level not significantly different from the control group, both being higher than that of the PC group. The epidermis of the model group showed no significant improvement compared to week 4.
[0081] Masson staining was used to investigate the ability of recombinant humanized elastin rTHE to promote the repair and regeneration of collagen fibers in aging skin. Figure 8As shown in C and 8D, the dorsal skin of the control group mice was healthy during the experiment, with continuous and dense collagen fibers in the dermis without obvious breakage. At week 2, except for the control group, the collagen fiber content in the dermis of the dorsal skin of all groups of mice was significantly lower than that of the control group, showing signs of breakage and fragmentation, and overall disordered fiber arrangement. At week 4, the dermal collagen fiber content in the PC, rTHE, and rHE groups increased, with the rHE and rTHE groups recovering faster than the PC group. New collagen fibers began to form at the breakage sites, and the fiber arrangement began to become more orderly, although a small number of collagen fibers remained disordered. At week 8, the dermal collagen fiber arrangement in the PC, rTHE, and rHE groups basically returned to normal, with orderly fiber arrangement. The collagen fiber content in the rTHE and rHE groups recovered to a level not significantly different from the control group, with the rTHE group having a higher content than the PC group; while the model group still showed disordered fiber arrangement and breakage.
[0082] The ability of recombinant humanized elastin rTHE to promote the regeneration of elastic fibers in aging skin was studied using EVG staining. Figure 8 As shown in Figures E and 8F, the dorsal skin of the control group mice was healthy during the experiment, with densely packed and evenly distributed elastic fibers. At week 2, except for the control group, the elastic fibers in the dermis of the dorsal skin of all other groups decreased, became scattered, and their content was significantly lower than that of the control group. At week 4, the elastic fibers in the model group mice continued to decrease, while new elastic fibers began to appear in the PC, rTHE, and rHE groups. The recovery of elastic fiber content in the PC, rTHE, and rHE groups was faster than that in the PC group. At week 8, the PC, rTHE, and rHE groups had more and more uniform elastic fibers than the model group. The dermal elastic fiber content in the rTHE and rHE groups recovered to a level not significantly different from the control group, and the elastic fiber content in the rTHE and rHE groups was higher than that in the PC group.
[0083] In summary, the recombinant humanized elastin of the present invention helps increase the thickness of the epidermis of aging skin and promotes the regeneration of collagen and elastin fibers, thereby achieving the effect of anti-skin aging.
[0084] Example 7 Characterization of the antioxidant stress performance of recombinant humanized elastin
[0085] The activities of antioxidant enzymes superoxide dismutase (SOD) and catalase (CAT), total glutathione (GSH) content, and malondialdehyde (MDA) levels were detected using a colorimetric assay kit. Skin tissue was weighed and added to the extraction buffer at a ratio of 0.1 g / mL, homogenized under ice bath conditions, and then analyzed at 1.2 × 10⁻⁶. 4 Centrifuge at × g for 10 min (4 ℃), and collect the supernatant for detection. Finally, the contents of SOD, MDA, CAT and GSH are determined by microplate reader.
[0086] MDA, SOD, GSH, and CAT are key intracellular antioxidants that play a crucial role in combating oxidative stress. MDA is an important indicator of lipid peroxidation, and its content in the skin increases significantly with aging. Skin aging leads to an increase in reactive oxygen species, including superoxide ions, hydrogen peroxide, and hydroxyl radicals, thereby disrupting the skin's oxidation / antioxidant balance.
[0087] like Figure 9 As shown, the expression of SOD, CAT, and GSH in the model group was significantly reduced, while the expression of MDA was significantly increased. In the rTHE group, the MDA content was significantly reduced, while the activities of SOD, GSH, and CAT were increased. There was no significant difference from the blank group, indicating that the recombinant humanized elastin of the present invention can alleviate skin oxidative stress and delay aging by reducing the conversion of superoxide anions to hydrogen peroxide and inhibiting the production of hydrogen peroxide and lipid peroxides.
[0088] Example 8 Characterization of the cytoplasmic matrix remodeling performance of recombinant humanized elastin
[0089] To detect the differential expression of extracellular matrix remodeling-related genes in mice after treatment, the expression levels of 12 genes, including Elastin, Col I, Col III, Fibrillin-1, LOX, MMP-2, MMP-12, IGFBP3, IGFBP5, TNFα, IL-1β, and IL-6, were analyzed using RT-qPCR. Total RNA was extracted from tissues using an RNA isolation kit, and the concentration and purity of the RNA samples were determined using a NanoDrop spectrophotometer. The extracted RNA was reverse transcribed to obtain cDNA templates for RT-qPCR amplification, and gene expression levels were then detected using TB Green Premix Ex Taq II. The primer sequences used for RT-qPCR are shown in Table 1. β-actin was used as an internal control gene for normalization, and the expression levels were analyzed using 2... - Δ Δ CT The relative expression level of genes was calculated using a method. Each sample was analyzed three times.
[0090] Table 1: Primer sequences used for RT-qPCR
[0091] Gene Forward primer (5′-3′) Reverse primer (5′-3′) β-actin CCC ATC TAT GAG GGT TAC GC TTT AAT GTC ACG CAC GAT TTC ELN TAAAGCAGCTAAATACGGTG AGGAAGCTCATTTTCTCTTC IGFBP3 AATCATCATCAAGAAAGGGC GAACTTCAGGTGATTCAGTG IGFBP5 AAGTCAAGATCGAGAGAGAC TGGGTCAGCTTCTTTCTG Fibrillin-1 GGTGAATGTACAAACACAGTCAGCA TGTCTGCCGCATAGGTGTCAT COL I GAGAACCAGCAGAGCCA GAACAAGGTGACAGAGGCATA COL III GTGCTACTGTGAGCTGCTTCTTC TCTACATTGGACTGCTGTGCC LOX TGAAGAACCAAGGGACATCGG ATAGGAACAGAGCACAGCTTGTTGA IL-1β GCCACCTTTTGACAGTGATGAG TGATGTGCTGCTGCGAGATT TNF α CCCTCACACTCACAAACCAC ACAAGGTACAACCCATCGGC IL-6 GGAGTCACAGAGAGAGTGGC CGCACTAGGTTTGCCGAGTA MMP-2 GACCGCTTGGCTTCAAATCA CCGCATGGTCTCGATGGTAT MMP-12 ACACCTGACATGAACCGTGAG TGGCCAAGACCTAAGGAATG
[0092] Aging leads to ECM degradation, particularly a decrease in collagen and elastin content. LOX and fibrillin-1 promote the cross-linking of elastin to form mature elastic fibers. Upregulation of MMP-2 and MMP-12 can degrade elastic fibers. IGFBP3 can induce apoptosis, and IGFBP5 can induce cellular senescence. TNF-α, IL-6, and IL-1β are pro-inflammatory cytokines that participate in normal inflammatory and immune responses. The results of RT-qPCR detection of related gene expression are shown below. Figure 10 The figure shows that the Col I, Col III, LOX, and Fibrillin-1 genes were significantly upregulated in the rTHE group, demonstrating their role in promoting elastin fiber synthesis and thus contributing to skin elasticity recovery. The inactive expression of MMP-2 and MMP-12 genes indicates that they inhibit age-related degradation of elastic fibers. The decrease in cytokines such as IGFBP3, IGFBP5, TNF α, IL-1β, and IL-6 suggests that rTHE can reduce skin inflammation and delay cellular senescence. Furthermore, the upregulation of Elastin, Col I, and Col III genes in the rTHE group corresponds to the increased volume fraction of elastic fibers and collagen in tissue staining. These results indicate that the recombinant humanized elastin-based rTHE provided in this invention helps promote ECM remodeling.
[0093] Example 9: Zebrafish Experiment with Recombinant Humanized Elastin
[0094] (1) Anti-wrinkle test
[0095] Healthy, wild-type AB strain zebrafish aged 3 days were randomly assigned to 6-well plates, 15 fish per well, and divided into 4 groups: blank group, positive control group (PC, 0.5 mg / mL tea polyphenol treatment), model group (water treatment), and recombinant humanized elastin rTHE group (1 mg / mL). At the start of the experiment, the standard dilution water in the well plates was quickly removed to avoid harming the juvenile fish. Then, 5 mL of test solution was added to each well, and the fish were incubated for 2 hours. During the incubation period, the experimental groups received three light irradiations, each lasting 15 minutes, with a 30-minute interval, and a total irradiation dose of 2.0–2.5 J / cm². 2 After irradiation, the zebrafish were incubated at 28.5 ± 1 °C for another 22 h. The control group received no treatment.
[0096] Images of zebrafish tail fins were captured using a visible light microscope, and the tail fin area (in pixels) was automatically measured and calculated using ImageJ software. The anti-wrinkle inhibition rate of the test substance in the tail fin was calculated using the following formula:
[0097]
[0098] in,
[0099] Q: The inhibition rate of caudal fin contraction in the zebrafish test group compared with the model control group; A1: The average caudal fin area (pixels) of the treatment group; A2: The average caudal fin area (pixels) of the model group; A3: The average caudal fin area (pixels) of the normal control group.
[0100] The anti-wrinkle efficacy of recombinant humanized elastin rTHE was evaluated using a zebrafish caudal fin structure UV-induced interference model. Figure 11 As shown in Figures A and 11B, after ultraviolet irradiation, the fin area of the model group was significantly reduced compared with the control group (P < 0.001), confirming the successful establishment of the model. After ultraviolet irradiation, the zebrafish caudal fins showed significant shrinkage and deformation. After 22 hours of recovery, both the positive control group and the rTHE group showed good recovery. These findings indicate that the recombinant humanized elastin rTHE provided by this invention effectively exhibits anti-wrinkle properties and significantly reduces the shrinkage and deformation of the zebrafish caudal fins.
[0101] (2) Experiment on scavenging reactive oxygen species
[0102] The levels of reactive oxygen species (ROS) in juvenile zebrafish were detected using the cell-permeability fluorescent probe H2DCFDA. Three-day-old zebrafish juveniles were placed in 6-well plates, 10 fish per well. The zebrafish were divided into four groups: a control group, a model group, a positive control group (PC, 0.5 mg / mL dipotassium glycyrrhizate), and a recombinant humanized elastin rTHE group (1 mg / mL). The control group received no treatment. The rTHE group juveniles were treated with 4 mL of 1 mg / mL recombinant humanized elastin rTHE solution for 1 h. The model group received only CuSO4 treatment, and the positive control group received 0.5 mg / mL dipotassium glycyrrhizate treatment. After treatment, all groups were exposed to 30 µM CuSO4 for 20 min to induce oxidative stress.
[0103] like Figure 11 As shown in C and 11D, the fluorescence intensity of zebrafish in the model group was significantly increased compared with the control group (P < 0.001), confirming the successful establishment of the model. Both the PC and rTHE groups showed good recovery, with the caudal fin of the rTHE group recovering to a level with no significant difference from the control group. These findings indicate that the recombinant humanized elastin of this invention can effectively alleviate CuSO4-induced reactive oxygen species generation.
[0104] (3) Zebrafish tail fin regeneration experiment
[0105] Three-day-old zebrafish juveniles were divided into 6-well plates. The zebrafish were further divided into a control group, a model group, a positive control group (RRP extract of Rehmannia glutinosa), and an rTHE group, with one well per group and 15 zebrafish per well. The control group received no treatment, while the experimental groups underwent 100-200 μm caudal fin amputation under magnification. Zebrafish with uniform caudal fin damage were randomly assigned to 6-well plates. Each well was supplemented with rTHE solution and RRP extract (0.1 mg / mL). −1 To achieve a final volume of 5 mL per well, the experimental groups were incubated in the dark at 28.5 ± 1°C for 48 h. Ten zebrafish were randomly selected from each group, and images were captured using a visible light microscope. Caudal fin images were taken at 0, 24, 48, 72, and 96 hours after amputation. Figure 11 E). ImageJ software was used to process the images, outline the zebrafish's tail fin, automatically calculate the tail fin area, and record the corresponding experimental data. Figure 11 F).
[0106] In the control group, the caudal fin area expanded to approximately 1.5 times its 24-hour size 96 hours (hpa) after amputation. At 24 hpa, caudal fin tissue regeneration began in all amputated zebrafish. In the model group, the amputated caudal fin regained its shape within 96 hpa, but its size remained significantly smaller. The caudal fin area recovery rate in the PC and rTHE groups was significantly higher than that in the model group, and by 96 hpa, it had recovered to a level indistinguishable from the control group. Notably, at 72 hpa, the caudal fin area in the rTHE group was significantly larger than that in the PC group, indicating a faster caudal fin repair rate. These results demonstrate that rTHE effectively promotes tissue wound repair.
[0107] In summary, the highly efficient transdermal recombinant humanized elastin provided by this invention possesses a typical β-helical hydrophobic domain and a lysine-rich hydrophilic domain, exhibiting excellent biocompatibility and biomimetic functional characteristics, and achieving the function of penetrating cell membranes and the skin barrier. The elastin exhibits significant proliferative, adhesion-promoting, and migration-promoting activities against human skin fibroblasts (HFF-1). In a D-galactose-induced skin aging mouse model, the elastin significantly increased skin thickness and dermal density, increased stratum corneum water content, reduced transepidermal water loss rate (TEWL), and restored skin elasticity. In zebrafish anti-wrinkle and reactive oxygen species (ROS) inhibition experiments, the elastin effectively reduced UV-induced tail fin contraction and inhibited ROS production, while simultaneously promoting the repair of injured tail fins.
Claims
1. A highly efficient transdermal recombinant humanized elastin, characterized in that, The recombinant humanized elastin amino acid sequence is as shown in SEQ ID NO.1, or a variant sequence thereof in which one or more amino acids are substituted, deleted and / or added but still retain the same transdermal and bioactive functions as SEQ ID NO.
1.
2. The recombinant humanized elastin according to claim 1 is obtained by protease cleavage of precursor elastin and has cell penetration and transdermal capabilities, wherein the amino acid sequence of the precursor elastin is shown in SEQ ID NO.
2.
3. The highly efficient transdermal recombinant humanized elastin according to claim 2, characterized in that, The proteases include one or more of thrombin, pepsin, trypsin, or bromelain.
4. A gene encoding a precursor elastin of the recombinant humanized elastin of claim 1 or 2, wherein the nucleotide sequence is the sequence shown in SEQ ID NO.3, or an equivalent sequence thereof in which one or more nucleotides are substituted, deleted and / or added but still express the protein of claim 1 or 2.
5. A recombinant vector comprising the gene of claim 4, wherein the recombinant vector is a pCold or pET vector.
6. A recombinant genetically engineered bacterium carrying the recombinant vector of claim 5, wherein the genetically engineered bacterium is Escherichia coli.
7. A method for preparing the recombinant humanized elastin of claim 1 or 2, comprising: (1) Synthesize the gene as described in claim 4; (2) The gene is ligated to a vector and transformed into the genetically engineered bacteria of claim 6 to obtain an expression strain; (3) Cultivate the expression strain, induce expression, lyse the bacterial cells and purify to obtain the protein.
8. The method of claim 7, wherein the characteristic is that Purification is performed by affinity chromatography in step (3).
9. The use of the recombinant humanized elastin according to claim 1 or 2 in the preparation of skin care products, dressings, implants, artificial skin, artificial blood vessels, medical devices, biomaterials or functional foods.
10. The use according to claim 9, wherein the skin care product is a topical preparation for anti-wrinkle, anti-aging, or skin barrier repair.
Citation Information
Patent Citations
Recombinant human elastin and its preparation method and application
CN117683116B
High-stability recombinant humanized elastin, genetically engineered bacterium for expressing protein and application of high-stability recombinant humanized elastin
CN119371518A
Recombinant humanized elastin with high biological activity as well as preparation method and application of recombinant humanized elastin
CN120699132A