Functional saccharide converting enzymes and uses
Patent Information
- Application Number
- CN202610788381.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-06-03
- Publication Date
- 2026-09-11
AI Technical Summary
上述CE所催化的反应需要在高温下进行,但CE的热稳定性偏弱,导致乳果糖得率低;另外,副产物依匹乳糖超标,难于从乳果糖中分离,导致工艺成本高
[0027] This invention utilizes genetic engineering to mutate wild-type enzymes, improving their insufficient isomerization activity and stability at high temperatures. Three superior cellobiose epimerase mutants were screened, enhancing the half-life of the mutant enzymes at 70°C. Among them, the mutant CmCE/D226G/S180T...F93H/K151R/G349E CmCE/D226G/S180T F93H/N132W/A235P The half-lives at 70℃ were 216.8 min and 247.4 min, respectively, which were significantly better than those of the wild-type enzyme CmCE/D226G/S180T.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
(I) Technical Field
[0002] This invention relates to a functional sugar invertase and its application, and particularly to a cellobiose epimerase mutant, an immobilized enzyme, and its application in catalyzing the isomerization of lactose to prepare lactulose. (II) Background Technology
[0004] Lactulose is a reduced disaccharide composed of two groups, D-galactose and D-fructose, linked by a β-1,4 glycosidic bond. It is an isomer of lactose and can be used to treat chronic constipation and hepatic encephalopathy. It can also be used as a prebiotic to improve the distribution of gut microbiota in humans.
[0005] Currently, the industrial production of lactulose relies on chemical methods, but these methods suffer from low lactulose yield, numerous byproducts, difficulty in separating various disaccharide products, and environmental pollution. Therefore, developing an environmentally friendly and highly efficient biosynthetic method for lactulose is crucial for replacing traditional chemical synthesis. Currently, biosynthesis refers to the preparation of lactulose using enzymatic catalysis, involving enzymes such as β-galactosidase, β-glucosidase, and cellobiose epimerase. When using β-galactosidase or β-glucosidase, a high concentration of D-fructose needs to be added, and the reaction process is difficult to control, resulting in a relatively low lactulose yield. In contrast, cellobiose epimerase can directly catalyze the conversion of lactose to lactulose, with only ipilactose as a byproduct. This catalytic method has significant advantages for industrial applications.
[0006] Cellobiose 2-epimerase (EC 5.1.1.11, abbreviated as CE) belongs to the N-acetyl-D-glucosamine 2-epimerase (AGE) family. The most studied CEs for lactulose synthesis include those derived from thermophilic microorganisms. Caldicellulosiruptor saccharolyticus CE (CsCE), and derived from Dictyoglomus turgidum , Caldicellulosiruptor obsidiansis , Dictyoglomus thermophilum、Caldicellulosiruptor morganii Enzymatic catalysis (CE) of bacteria such as *Isobacterium* is used. The reactions catalyzed by CE require high temperatures, but the thermal stability of CE is relatively weak, resulting in low lactulose yield. Furthermore, the byproduct ipilactose exceeds the standard and is difficult to separate from lactulose, leading to high process costs. Therefore, the industrial production of lactulose through enzyme catalysis still faces challenges. (III) Summary of the Invention
[0008] The purpose of this invention is to provide a functional sugar invertase and its application in the catalytic isomerization of lactose to produce lactulose. The cellobiose epimerase mutant screened in this invention improves the catalytic efficiency and stability of CE, reduces the content of the byproduct ipilactose, and establishes an efficient conversion and separation extraction process for lactulose. It has good industrial application performance and is expected to realize the efficient and green manufacturing of lactulose.
[0009] The technical solution adopted in this invention is:
[0010] The present invention provides a functional sugar invertase, which is obtained by mutating one or more of the amino acids at positions 30, 44, 93, 132, 151, 235, 237, and 349 of the amino acid sequence of the wild-type cellobiose epimerase shown in SEQ ID NO.1.
[0011] Furthermore, the amino acid sequence of the functional glycoinvertase is shown in SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.7.
[0012] This invention provides a gene encoding the functional sugar invertase, a recombinant expression vector containing the gene, and a recombinant genetically engineered bacterium constructed from the recombinant expression vector. The recombinant expression vector uses pET28b as a base plasmid, and the recombinant genetically engineered bacterium uses... E. coli BL21(DE3) is the host bacterium.
[0013] This invention provides an immobilized functional sugar invertase, which is prepared by using wet bacterial cells obtained by fermentation culture of recombinant genetically engineered bacteria expressing the functional sugar invertase as the enzyme source, diatomaceous earth as the carrier, polyethyleneimine as the flocculant, and trimethylolphosphine (THP) as the cross-linking agent.
[0014] Furthermore, the immobilized functional glycoinvertase is prepared as follows: wet bacterial cells obtained by fermentation culture of recombinant genetically engineered bacteria expressing the functional glycoinvertase are suspended in a pH 7.5, 200 mM HEPES buffer solution; diatomaceous earth is added and stirred until homogeneous; then a 5% (v / v) polyethyleneimine aqueous solution is added, and the mixture is incubated at 25°C. o C. Flocculation was carried out at 100 r / min, followed by the addition of a 30% THP aqueous solution at 25°C. o C. The cross-linking reaction was carried out at 100 r / min for 2 h. The mixture was then filtered, and the filter cake was washed with distilled water and then extruded into long strips using an axial extruder. After being air-dried at room temperature, the strips were crushed into granules (preferably with a particle size of 0.5~2 mm) to obtain the immobilized functional sugar invertase.
[0015] Furthermore, the diatomaceous earth is Celite.® The diatomaceous earth is used in a ratio of 1:10-30 (preferably 1:20) to the wet bacterial cells; the volume of the polyethyleneimine aqueous solution is 0.1-0.5 mL / g (preferably 0.3 mL / g) based on the weight of the wet bacterial cells; the volume of the 30% THP aqueous solution is 0.01-0.1 mL / g (preferably 0.05 mL / g) based on the weight of the wet bacterial cells.
[0016] Furthermore, the 30% (v / v) trimethylolphosphine aqueous solution is prepared as follows: 15 g of tetramethylolphosphine chloride (80% concentration) is dissolved in 90 mL of deionized water, and 3.4 g of potassium hydroxide is dissolved in 10 mL of deionized water. The solution is then incubated at room temperature (25°C). o C. The two are slowly mixed at 100 r / min to prepare an aqueous solution of THP. The solution is prepared fresh for use. The molar ratio of tetrahydroxymethylphosphoric acid and potassium hydroxide is 1:0.995.
[0017] This invention provides an application of the aforementioned functional sugar invertase in catalyzing the isomerization of lactose to prepare lactulose.
[0018] Furthermore, the application uses wet cells obtained by inducing culture of recombinant genetically engineered bacteria containing a functional sugar invertase encoding gene, or pure enzyme solution extracted by ultrasonic disruption of wet cells, or immobilized enzyme prepared from wet cells as catalysts, lactose as substrate, and a buffer solution with pH 6-8 as reaction medium to form a reaction system. The reaction is carried out at 60-90℃ and 100-300 r / min (preferably 70℃ and 200 r / min) to obtain a reaction solution containing lactulose, and lactulose is then separated and extracted.
[0019] Furthermore, in the reaction system, the substrate concentration is 200-1000 g / L (preferably 400-800 g / L); when the catalyst is wet bacterial cells, the concentration is 100-150 g / L (preferably 100 g / L); when the catalyst is pure enzyme solution, the amount added is 0.1-1 mg / mL (preferably 0.3 mg / mL) based on protein content; and when the catalyst is immobilized enzyme, the amount added is 100-150 g / L (preferably 100 g / L).
[0020] Furthermore, to improve the product yield, boric acid or sodium aluminate is added to the reaction system in an amount 1-3 times the molar amount of the substrate, preferably 1.5 times the molar amount of boric acid and 2 times the molar amount of sodium aluminate.
[0021] Furthermore, the reaction medium is 200 mM HEPES buffer (pH 7.5).
[0022] Furthermore, the catalyst is prepared by the following method:
[0023] (1) Recombinant genetically engineered bacteria containing a functional sugar invertase encoding gene were inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured in a shaker at 37℃ and 150 r / min for 12 h to obtain seed culture; the seed culture was then diluted with 2% ( v / v The inoculum was injected into fresh LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured at 37°C and 150 r / min on a shaker. OD 600 When the concentration reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside (IPTG) to the culture medium to a final concentration of 0.1 mM, induce expression at 28℃ for 12 h, centrifuge at 4℃ and 8000 r / min for 10 min, discard the supernatant, and collect the wet cells;
[0024] (2) Take wet bacterial cells and resuspend them in 50 mM HEPES (pH 7.5) buffer. Sonicate them at 200 W for 20 min (working for 2 s, with a 3 s interval). Centrifuge the mixture at 8000 r / min for 10 min and collect the supernatant as the crude enzyme solution, which is used as the loading solution. The amount of buffer used is 20 mL / g based on the weight of wet bacterial cells.
[0025] (3) Enzyme purification was performed using a Ni-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC pre-packed column, 40 mm long × 12.6 mm inner diameter). The column was first equilibrated with 5 column volumes of equilibration buffer (20 mM phosphate buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0). 3-5 column volumes (preferably 4 column volumes) of loading buffer were loaded at a rate of 1 mL / min. Elution was then performed with 3-5 column volumes (preferably 5) of elution buffer (50 mM phosphate buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) at a rate of 1 mL / min. Based on the signal responses from the UV detector and conductivity detector, the eluent containing the target protein was collected and eluted in a dialysis bag with a molecular weight cutoff of 12-14 kDa using 50 mM HEPES buffer (pH 8.0). 7.5) Dialysis is performed to remove residual nickel ions from the residual enzyme solution. The choked liquid is collected to obtain pure enzyme solution.
[0026] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:
[0027] This invention utilizes genetic engineering to mutate wild-type enzymes, improving their insufficient isomerization activity and stability at high temperatures. Three superior cellobiose epimerase mutants were screened, enhancing the half-life of the mutant enzymes at 70°C. Among them, the mutant CmCE / D226G / S180T...F93H / K151R / G349E CmCE / D226G / S180T F93H / N132W / A235P The half-lives at 70℃ were 216.8 min and 247.4 min, respectively, which were significantly better than those of the wild-type enzyme CmCE / D226G / S180T.
[0028] The mutant enzyme of this invention has a prolonged relative reaction time, which increases the enzyme's substrate affinity for lactose, the substrate used in the synthesis of lactulose. Using genetically engineered bacteria containing the mutant enzyme for biotransformation in a boric acid and sodium aluminate system improves conversion efficiency, significantly increases the yield of lactulose, and significantly reduces the yield of the byproduct ipilactose. The mutant CmCE / D226G / S180T is particularly effective in this process. F93H / N132W / A235P The conversion in the sodium aluminate system increased the product yield by 26.1% and decreased the by-product yield by 6.3%; the mutant CmCE / D226G / S180T F93H / K151R / G349E The conversion in the sodium aluminate system increased the product yield by 20.9% and reduced the by-product yield by 7.3%.
[0029] The synthesis of lactulose using cellobiose epimerase mutants of this invention has the advantages of being green and environmentally friendly, having low toxicity, few by-products, and high product yield. It overcomes the three wastes problems that are easily generated by chemical synthesis methods and has important industrial application prospects. (iv) Description of the attached drawings
[0031] Figure 1 This is a high-performance liquid chromatogram of a mixture of lactulose, lactose, and ipilactose standards.
[0032] Figure 2 Electrophoresis image of pure enzyme solution; Lane M: Marker; Lane 1: M2; Lane 2: M2 F93H Lane 3: M2 F93H / K151R / G349E Lane 4: M2 F93H / N132W / A235P .
[0033] Figure 3 For M2, M2 F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P The optimal temperature.
[0034] Figure 4 For M2, M2 F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235PP The half-life. (V) Detailed Implementation Methods
[0036] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0037] LB liquid medium consists of 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L sodium chloride, dissolved in water, at pH 7.0. LB solid medium is LB liquid medium with the addition of 15-20 g / L agar.
[0038] Example 1: Induction and activity detection of the initiation enzyme CmCE / D226G / S180T
[0039] 1. Induced expression of recombinant bacteria
[0040] The recombinant expression plasmid pET28b / CmCE / D226G / S180T, previously constructed in the laboratory (Chinese Journal of Biotechnology, DOI: 10.13345 / j.cjb.250384), was transformed into... E. coli BL21(DE3) competent cells were plated on LB agar plates containing 50 μg / mL kanamycin and incubated at 37°C for 12 h. Single colonies were randomly picked from the plates, and plasmids were extracted and identified by agarose gel electrophoresis and nucleotide sequencing. Colonies with correct sequencing results were preserved, ultimately yielding a wild-type strain containing pET28b / CmCE / D226G / S180T. E. coli BL21(DE3) / pET28b / CmCE / D226G / S180T, denoted as E. coli The amino acid and nucleotide sequences of BL21(DE3) / pET28b / M2.CmCE / D226G / S180T are shown in SEQ ID No. 1 and SEQ ID No. 2, respectively.
[0041] The above-mentioned wild-type strain was inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured at 37℃ and 150 r / min for 12 h to obtain seed culture; the seed culture was then diluted with 2% ( v / v The inoculum was injected into fresh LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured at 37°C and 150 r / min on a shaker. OD 600 When the concentration reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside (IPTG) to the culture medium to a final concentration of 0.1 mM, induce expression at 28℃ for 12 h, centrifuge at 4℃ and 8000 r / min for 10 min, discard the supernatant, collect the wet cells, and set aside for use.
[0042] 2. Detection of cellobiose epimerase activity
[0043] The final concentration of the 5 mL reaction system consisted of: 50 mM HEPES buffer (pH 7.5), 100 g / L lactose, and 50 g / L wet bacterial cells. Reaction conditions: The reaction was terminated by incubating on ice for 10 min at 70°C. Enzyme activity was defined as the amount of bacterial cells required per second to isomerize lactose to produce 1 μmol of lactulose at 70°C and pH 7.5, defined as one unit of enzyme activity (U).
[0044] HPLC detection conditions: Agilent 1260 HPLC system, Agilent autosampler, Shodex VG-50-4E column, Agilent differential detector, mobile phase 75% ( v / v Acetonitrile, 20% v / v A mixed solution of methanol and 5% ultrapure water was prepared. The column temperature was set at 40℃, and the flow rate was 1 mL / min. The external standard method was used to determine the yield of lactulose based on the retention time and peak area. The peak elution times of lactulose, ipilactose, and lactose were 8.4 min, 9.3 min, and 10.3 min, respectively. A mixed solution of lactulose, ipilactose, and lactose standards was prepared at a mass ratio of 1:0.5:1 and diluted with 1 mL of deionized water to achieve a total mass concentration of 5 g / L. The liquid chromatogram is shown below. Figure 1 .
[0045] Enzyme activity assay results showed E. coli The enzyme activity of wet bacterial cells of BL21(DE3) / pET28b / CmCE / D226G / S180T is 12.6 U / g.
[0046] Example 2: Construction of CmCE / D226G / S180T mutant library
[0047] Error-prone PCR was performed using plasmid pET28b / CmCE / D226G / S180T as a template to conduct enzyme directed evolution. The primers designed are as follows.
[0048] Forward primer: CATGAAGGAAAAGATCCTGAAATTC;
[0049] Reverse primer TTACACTCTTTTTATAATTTCTAAACACATCC.
[0050] Error-prone PCR systems include 10× Taq Buffer (Mg 2+ 5 μL of free MgCl2, 5 μL of 25 mM MgCl2, 7.8 μL of 4.5 mM MnCl2, 1 μL of dNTP Mix (10 mM each), 1 μL each of error-prone forward and reverse PCR primers, and 10 ng of plasmid template. Taq Add 0.5 μL of DNA Polymerase (5 U / μL) and bring the total volume to 50 μL with ultrapure water.
[0051] Error-prone PCR reaction conditions are: pre-denaturation at 95℃ for 3 min, (denaturation at 95℃ for 30 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min) for 30 cycles, and a final 72℃ for 5 min.
[0052] Take 5 μL of PCR product and add it to 100 μL of ice bath. E. coli In a suspension of BL21(DE3) competent cells, the cells were placed on ice for 30 min. The transformation product was then heat-shocked at 42°C for 90 s and rapidly cooled on ice for 2 min. 600 μL of sterile LB liquid medium was added to the tube, and the cells were incubated at 37°C and 200 r / min for 30 min. 100 μL of the above bacterial suspension was spread onto an LB solid medium plate containing 50 μg / mL kanamycin. After the bacterial suspension was completely absorbed by the medium, the cells were incubated upside down at 37°C for 12 h. The single colonies that grew were the positive transformants.
[0053] Example 3: High-throughput screening of positive transformants
[0054] 1. Culture and induction of enzyme production in transformants
[0055] Under aseptic conditions, 900 μL of LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance was added to each well of a 96-well plate, and positive transformants from Example 2 were inoculated using toothpicks. The 96-well plate was then incubated at 37°C and 200 r / min for 8 h; then 4% ( v / v The culture was inoculated into a new 900 μL LB liquid medium containing a final concentration of 50 μg / mL kanamycin resistance in a 96-well plate and cultured at 37°C and 200 r / min for 2 h. IPTG was added to each well to a final concentration of 0.1 mM, and the 96-well plate was placed at 28°C and 200 r / min to induce enzyme production for 12 h.
[0056] 2. Construction of the enzyme reaction system
[0057] Centrifuge the induced expression 96-well plate at 8000 r / min for 10 min to retain the bacterial cells. Resuspend the bacterial cells in 300 μL of 50mM HEPES (pH 7.5) buffer in each well and incubate at 80℃ for 20 min. Then add 200 μL of 25 g / L lactose aqueous solution and react at 80℃ for 10 min. Stop the reaction by incubating on ice for 10 min.
[0058] 3. Screening mutants using the tryptophan-cysteine hydrochloride colorimetric method
[0059] The tryptophan-cysteine hydrochloride colorimetric reagent was prepared as follows: Weigh / measure 1.25 g cysteine hydrochloride, 40 mg tryptophan, 30 mL ultrapure water, and 0.5 mL 1M HCl. Stir until completely dissolved, then dilute to 50 mL using a volumetric flask. Add 140 μL of 75% concentrated sulfuric acid and 10 μL of the tryptophan-cysteine hydrochloride colorimetric reagent to each well of the 96-well plate. Incubate at 46℃ for 30 min. Measure the colorimetric properties of the reaction solution using a spectrophotometer. A 518 Value. In a 96-well plate E. coli BL21(DE3) / pET28b / CmCE / D226G / S180T was used as a control, and the results were obtained through screening. A 518 Mutant strains with higher values than wild-type.
[0060] 4. High-throughput screening results
[0061] Passed in the first round A 518 One strain was selected from 480 recombinant bacteria that showed positive transformants. A 518 Absorbance value higher than E. coli The transformant was BL21(DE3) / pET28b / CmCE / D226G / S180T. Sequencing results showed that the transformant was CmCE / D226G / S180T / F93H, denoted as M2. F93H (The amino acid sequence and nucleotide sequence are shown in SEQ ID No. 3 and SEQ ID No. 4, respectively).
[0062] Based on this, using pET28b / CmCE / D226G / S180T / F93H as a template, a second round of error-prone PCR and high-throughput screening was performed using the primers from Example 2. A 518 Two strains were selected from 768 recombinant bacteria that were positive transformants. A 518 Absorbance value higher than E. coli The transformant was BL21(DE3) / pET28b / CmCE / D226G / S180T / F93H. Sequencing results showed that the transformants were CmCE / D226G / S180T / F93 / K151R / G349E, denoted as M2. F93H / K151R / G349E (The amino acid sequence and nucleotide sequence are shown in SEQ ID No. 5 and SEQ ID No. 6, respectively) and CmCE / D226G / S180T / F93 / N132W / A235P, denoted as M2 F93H / N132W / A235P(The amino acid sequence and nucleotide sequence are shown in SEQ ID No. 7 and SEQ ID No. 8, respectively).
[0063] Will E. coli BL21(DE3) / pET28b / CmCE / D226G / S180T and transformants containing the above mutations were induced to produce enzymes according to the method in Example 1. The enzyme activity and residual activity were then measured, and lactulose was quantitatively detected by HPLC (Table 1). Compared with the control strain containing M2, M2... F93H M2 F93H / K151R / G349E M2 F93H / N132W / A235P The enzyme activity and thermostability of the mutant transformants were both improved, with M2 showing particularly enhanced activity. F93H / N132W / A235P The mutant with the greatest performance improvement.
[0064] Table 1 Comparison of enzyme activities between the starting enzyme and the mutant enzyme
[0065]
[0066] Example 4: Isolation and purification of starting enzyme and mutant enzyme
[0067] 1. Induction of recombinant bacterial expression and acquisition of crude enzyme solution
[0068] The method of Example 1 was used to treat M2 and M2 F93H M2 F93H / K151R / G349E M2 F93H / N132W / A235P Transformants were induced to express the enzyme, and wet cells were collected. 1 g of each wet cell was resuspended in 20 mL of 50 mM HEPES buffer (pH 7.5) and sonicated at 200 W for 20 min (2 s working, 3 s interval). The resulting mixture was centrifuged at 8000 r / min for 10 min, and the supernatant was collected as the crude enzyme solution, which was used as the loading solution.
[0069] 2. Affinity chromatography purification of recombinant enzymes
[0070] Enzyme purification was performed using a Nickel-NTA affinity chromatography column (Bio-Scale Mini Profinity IMAC pre-packed column, 40 mm long × 12.6 mm inner diameter). The column was first equilibrated with 5 column volumes of equilibration buffer (20 mM phosphate buffer, 300 mM NaCl, 20 mM imidazole, pH 8.0). 20 mL of sample (4 column volumes) was loaded at a rate of 1 mL / min. Elution was then performed with 5 column volumes of elution buffer (50 mM phosphate buffer, 300 mM NaCl, 500 mM imidazole, pH 8.0) at a rate of 1 mL / min. The eluent containing the target protein was collected based on the signal responses from the UV detector and conductivity detector. The purity of the eluent was determined by SDS-PAGE. Residual nickel ions in the residual enzyme solution were removed by dialysis in a dialysis bag with a molecular weight cutoff of 12-14 kDa using 50 mM HEPES buffer (pH 7.5). The cutoff solution was collected, and M2 and M2 were finally obtained. F93H M2 F93H / K151R / G349E M2 F93H / N132W / A235P Pure enzyme solution, gel electrophoresis image shown Figure 2 As shown, the protein concentrations were 3.0, 4.4, 4.3, and 5.6 mg / mL, respectively.
[0071] Example 5: Determination of Enzymatic Properties and Kinetic Parameters
[0072] 1. Optimal reaction temperature
[0073] The final concentration composition of the 5 mL reaction system is: 100 g / L lactose, 0.3 mg / mL pure enzyme solution (M2, M2) based on protein content. F93H M2 F93H / K151R / G349E M2 F93H / N132W / A235P A suitable amount of 50 mM HEPES buffer (pH 7.5) was added. The reaction system was incubated at 50-85℃ for 10 min, followed by ice bath cooling for 10 min. The lactulose content was detected using the HPLC method described in Example 1 to calculate the relative enzyme activity, thereby determining the optimal reaction temperature of the enzyme. Mutant enzyme M2 F93H M2 F93H / K151R / G349E M2 F93H / N132W / A235P The optimal reaction temperatures are 70℃, 70℃ and 80℃, respectively, M2 F93H / N132W / A235P It increased by 10°C compared to M2, see Figure 3 .
[0074] 2. Enzyme half-life determination
[0075] M2, M2 F93H M2 F93H / K151R / G349E M2F93H / N132W / A235P The pure enzyme solutions were incubated in a 70°C water bath for 180 min, and samples were taken every 15 min to determine the residual enzyme activity and calculate the enzyme half-life. Figure 4 The half-life of M2 at 70℃ is 157.4 min. F93H M2 F93H / K151R / G349E M2 F93H / N132W / A235P The half-lives at 70°C were increased to 166.7 min, 216.8 min, and 247.4 min, respectively.
[0076] 3. Measurement of dynamic parameters
[0077] The final concentration composition of the 5 mL reaction system consisted of 0.3 mg / mL pure enzyme solution (based on protein content), an appropriate amount of 50 mM HEPES (pH 7.5) buffer, and 50-800 mM lactose. The reaction system was incubated at 70°C for 10 min, and then stopped by incubating on ice for 10 min. The amount of lactulose produced was determined by HPLC as described in Example 1, and M2 and M2 were obtained by fitting the data using Origin software. F93H M2 F93H / K151R / G349E M2 F93H / N132W / A235P The dynamic parameters of M2 are shown in Table 2. K m 73.8 mM k cat 640.5 min -1 , k cat / K m It is 8.8 min -1 ·mM -1 In comparison, M2 F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P of K m They decreased to 67.2 mM, 33.4 mM, and 31.6 mM, respectively. k cat Increased to 662.7 min respectively -1 1210.7 min -1 and 1231.7 min -1 , k cat / K m The min values were increased to 9.9 min. -1 ·mM -1 36.2 min -1 ·mM -1 and 39.03 min -1 ·mM-1 The results show that M2 F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P It has a better affinity for the substrate lactose and higher catalytic efficiency.
[0078] Table 2. Measurement of kinetic parameters
[0079]
[0080] Example 6: Biotransformation Synthesis of Lactulose
[0081] Prepared according to the method of Example 1 E. coli BL21 (DE3) / pET28b / M2, M2 F93H , E. coli BL21(DE3) / pET28b / M2 F93H / K151R / G349E and E. coli BL21 (DE3) / pET28b / M2 F93H / N132W / A235P Wet bacterial cells were used as a biocatalyst to bioconvert lactose into lactulose.
[0082] The final concentration of the 100 mL reaction system consisted of 400 g / L lactose, 100 g / L wet bacterial cells, and an appropriate amount of 200 mM HEPES buffer (pH 7.5). The reaction system was incubated at 70℃ and 200 r / min for 3 h. After filtering the reaction solution through a 0.22 μm membrane, the contents of lactose, lactulose, and epilactose in the filtrate were determined by HPLC as described in Example 1 (Table 3). E. coli BL21(DE3) / pET28b / M2 F93H , E. coli BL21 (DE3) / pET28b / M2 F93H / K151R / G349E and E. coli BL21 (DE3) / pET28b / M2 F93H / N132W / A235P The lactulose yields were 58.2%, 61.3%, and 64.5%, respectively, while the ipilactose yields were 9.8%, 7.8%, and 6.8%, respectively. In comparison, E. coli The lactulose yield of BL21(DE3) / pET28b / M2 was 54.8%, and the ipilactose yield was 10.2%. The transformation results indicate that the recombinant strain M2... F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P The conversion level of M2 was higher than that of M2.
[0083] Table 3 Biotransformation of starting enzymes and mutant enzymes
[0084]
[0085] Example 7: Bioconversion synthesis of lactulose under boric acid system
[0086] Prepared according to the method of Example 1 E. coli BL21 (DE3) / pET28b / M2, M2 F93H , E. coli BL21(DE3) / pET28b / M2 F93H / K151R / G349E and E. coli BL21 (DE3) / pET28b / M2 F93H / N132W / A235P Wet bacterial cells were used as a biocatalyst to bioconvert lactose into lactulose.
[0087] The final concentration composition of the 100 mL reaction system was: 400 g / L lactose, 100 g / L wet bacterial cells, 108 g / L boric acid (1.5 times the molar amount of lactose), and an appropriate amount of 200 mM HEPES buffer (pH 7.5). The reaction system was reacted at 70℃ and 200 r / min for 3 h. After adjusting the pH of the reaction solution to 1-2 with HCl, the solution was filtered through a 0.22 μm membrane, and the contents of lactose, lactulose, and epilactose in the filtrate were determined by HPLC as described in Example 1 (Table 4). (M2 content) F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P The lactulose yields of the recombinant strains were 88.6%, 95.3%, and 97.8%, respectively, and the ipilactose yields were 5.1%, 2.2%, and 1.0%, respectively. In contrast, the lactulose yield of the M2-containing recombinant strain was 81.4%, the ipilactose yield was 6.5%, and the residual lactose content was 12.1%. These results indicate that the recombinant strain M2... F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P The conversion level of M2 was higher than that of M2.
[0088] Table 4 Biotransformation under boric acid system
[0089]
[0090] Example 8: Bioconversion synthesis of lactulose in sodium aluminate system
[0091] Prepared according to the method of Example 1 E. coli BL21 (DE3) / pET28b / M2, M2 F93H , E. coli BL21(DE3) / pET28b / M2 F93H / K151R / G349E and E. coli BL21 (DE3) / pET28b / M2 F93H / N132W / A235P Wet bacterial cells were used as a biocatalyst to bioconvert lactose into lactulose.
[0092] The final concentration composition of a 100 mL reaction system was: 800 g / L lactose, 100 g / L wet bacterial cells, 383 g / L sodium aluminate (twice the molar amount of lactose), and an appropriate amount of 200 mM HEPES buffer (pH 7.5). The reaction system was incubated at 70℃ and 200 r / min for 3 h. After adjusting the pH of the reaction solution to 1-2 with HCl, the solution was filtered through a 0.22 μm membrane, and the contents of lactose, lactulose, and epilactose were determined using the HPLC filtrate described in Example 1 (Table 5). (M2 content) F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P The lactulose yields of the recombinant strains were 90.1%, 96.2%, and 98.4%, and the ipilactose yields were 4.2%, 2.1%, and 1.6%, respectively. In contrast, the lactulose yield of the M2-containing recombinant strains was 85.3%, and the ipilactose yield was 5.9%. These results indicate that under high substrate concentration and sodium aluminate conversion conditions, the M2-containing recombinant strains... F93H M2 F93H / K151R / G349E and M2 F93H / N132W / A235P The transformation level of the recombinant bacteria was higher than that of M2.
[0093] Table 5. High lactose bioconversion in sodium aluminate system
[0094]
[0095] Example 9: Immobilization of M2 F93H / K151R / G349E and M2 F93H / N132W / A235P Recombinant cells
[0096] To prepare a 30% (v / v) trimethylolphosphine (THP) aqueous solution: Dissolve 15 g of tetramethylolphosphine chloride (80% concentration) in 90 mL of deionized water, and dissolve 3.4 g of potassium hydroxide in 10 mL of deionized water. Incubate at room temperature (25°C). o C. The two are slowly mixed at 100 r / min to prepare an aqueous solution of THP. The solution is prepared fresh for use. The molar ratio of tetrahydroxymethylphosphoric acid and potassium hydroxide is 1:0.995.
[0097] The recombinant M2 prepared in Example 1 F93H / K151R / G349E and M2 F93H / N132W / A235P 60 g of wet bacterial cells were suspended in 50 mL of pH 7.5 and 200 mM HEPES buffer, respectively, and 3 g of Celite was added. ® 545 diatomaceous earth, stir appropriately. Add 20 mL of 5% ( v / v Polyethyleneimine aqueous solution at 25 o C. Flocculation was carried out at 100 r / min, followed by the addition of 2.5 mL of 30% THP aqueous solution at 25°C. oC. Crosslinking reaction was carried out at 100 r / min for 2 h. The mixture was then filtered, the filter cake was washed with distilled water, and then extruded into long strips using an axial extruder. After air drying at room temperature, it was pulverized into granules (particle size 0.5~2 mm) to obtain a product containing M2. F93H / K151R / G349E and M2 F93H / N132W / A235P Immobilized cells.
[0098] Lactulose was prepared by biotransformation using immobilized cells as a biocatalyst and lactose as a substrate. The final composition of the catalytic system was: 800 g / L lactose, 100 g / L immobilized cells, 383 g / L sodium aluminate (twice the molar amount of lactose), and an appropriate amount of 200 mM HEPES buffer (pH 7.5). The reaction system was incubated at 70℃ and 200 r / min for 3 h. After adjusting the pH of the reaction solution to 1-2 with HCl, the solution was filtered through a 0.22 μm membrane, and the contents of lactose, lactulose, and epilactose were determined by HPLC using the filtrate described in Example 1. The collected immobilized cells were used for the next batch of biotransformation.
[0099] The results show that M2 F93H / K151R / G349E and M2 F93H / N132W / A235P Ten batches of immobilized cells were subjected to biotransformation, and the lactulose yield was above 94%, while the ipilactose yield and lactose residue were both below 3%.
[0100] Example 10: Isolation and purification of lactulose
[0101] Lactulose was separated and purified by removing aluminum ions using cation exchange resin. A strong acid styrene-based cation exchange resin of type 732 (purchased from Hangzhou Jigong Biotechnology) was selected. Pretreatment was performed first: soaking in 5% hydrochloric acid aqueous solution for 2 hours, followed by washing with deionized water until pH 6.0-7.0; then soaking in 5% sodium hydroxide aqueous solution for 2 hours, followed by washing with deionized water until pH 6.0-7.0; finally, rinsing with deionized water until no impurities were found.
[0102] M2 in Example 8 F93H / N132W / A235P The transformation broth of the recombinant bacteria was centrifuged at 8000 r / min for 20 min. The precipitate was collected, and 100 mL of deionized water was added and vortexed to mix. The pH was adjusted to 1-2 with HCl, and the mixture was magnetically stirred at room temperature for 30-60 min to dissociate the sodium aluminate-lactose complex. The dissociated solution was then centrifuged at 8000 r / min for 10 min to remove the precipitate, and the supernatant was reserved. The supernatant was then added to 10 g of activated 732 type strong acid styrene-based cation exchange resin in a 100 mL centrifuge tube and centrifuged for 30 minutes. oC. Shake at 200 r / min at a constant temperature for 60 min. After shaking, centrifuge at 8000 r / min at room temperature for 10 min and collect the supernatant. Then transfer it to a rotary evaporator (vacuum degree 0.08 MPa, water bath 60℃) for vacuum distillation until no liquid flows out, obtaining lactulose solid product. HPLC analysis showed that the lactulose recovery rate reached 95%.
Claims
1. A functional sugar invertase, characterized in that, The functional sugar invertase is obtained by mutating one or more of the amino acids at positions 30, 44, 93, 132, 151, 235, 237, and 349 of the wild-type cellobiose epimerase shown in SEQ ID NO.
1.
2. The functional sugar invertase as described in claim 1, characterized in that, The amino acid sequence of the functional glycoinvertase is shown in SEQ ID NO.3, SEQ ID NO.5 or SEQ ID NO.
7.
3. A recombinant genetically engineered bacterium containing the encoding gene of the functional sugar invertase as described in claim 1.
4. An immobilized functional invertase, characterized in that, The immobilized functional sugar invertase is prepared by using wet bacterial cells obtained through fermentation culture of recombinant genetically engineered bacteria expressing the functional sugar invertase as the enzyme source, diatomaceous earth as the carrier, polyethyleneimine as the flocculant, and trimethylolphosphatidylcholine as the cross-linking agent.
5. The immobilized functional glycoinvertase as described in claim 4, characterized in that, The immobilized functional glycoinvertase was prepared as follows: The wet bacterial cells obtained by fermentation culture of the recombinant genetically engineered bacteria expressing the functional glycoinvertase were suspended in a pH 7.5, 200 mM HEPES buffer solution, diatomaceous earth was added, and the mixture was stirred until homogeneous; then, a 5% (v / v) polyethyleneimine aqueous solution was added, and the mixture was incubated at 25°C. o C. Flocculation was carried out at 100 r / min, followed by the addition of a 30% (v / v) trimethylolphosphatide aqueous solution, and the mixture was kept at 25°C. o C. The cross-linking reaction was carried out at 100 r / min for 2 h. The mixture was then filtered, and the filter cake was washed with distilled water and extruded into long strips using an axial extruder. After being air-dried at room temperature, the strips were crushed into granules to obtain the immobilized functional sugar invertase.
6. The application of the functional sugar invertase of claim 1 in the catalytic isomerization of lactose to prepare lactulose.
7. The application as described in claim 6, characterized in that, The application uses wet cells obtained by inducing culture of recombinant genetically engineered bacteria containing a functional sugar invertase encoding gene, or pure enzyme solution extracted by ultrasonic disruption of wet cells, or immobilized enzyme prepared from wet cells as catalysts, lactose as substrate, and a buffer solution with pH 6-8 as reaction medium to form a reaction system. The reaction is carried out at 60-90℃ and 100-300r / min to obtain a reaction solution containing lactulose, and lactulose is then separated and extracted.
8. The application as described in claim 7, characterized in that, In the reaction system, the substrate concentration is 200-1000 g / L; when the catalyst is wet bacterial cells, the concentration is 50-150 g / L; when the catalyst is pure enzyme solution, the amount added is 0.1-1 mg / mL based on protein content; and when the catalyst is immobilized enzyme, the amount added is 100-150 g / L.
9. The application as described in claim 7, characterized in that, Add boric acid or sodium aluminate to the reaction system in an amount that is 1-3 times the molar amount of the substrate.
10. The application as described in claim 7, characterized in that, The catalyst is prepared according to the following method: (1) Recombinant genetically engineered bacteria containing a functional sugar invertase encoding gene were inoculated into LB liquid medium containing a final concentration of 50 μg / mL kanamycin and cultured in a shaker at 37℃ and 150 r / min for 12 h to obtain seed culture; The seed culture was inoculated at a volume concentration of 2% into fresh LB liquid medium containing a final concentration of 50 μg / mL kanamycin, and cultured at 37°C and 150 r / min on a shaker. OD 600 When the concentration reaches 0.6-0.8, add isopropyl-β-D-thiogalactoside to the culture medium to a final concentration of 0.1 mM, induce expression at 28℃ for 12 h, centrifuge at 4℃ and 8000 r / min for 10 min, discard the supernatant, and collect the wet cells. (2) Take wet bacterial cells and resuspend them in pH 7.5, 50 mM HEPES buffer. Sonicate them at 200 W for 20 min, working for 2 s and then at 3 s intervals. Centrifuge the mixture at 8000 r / min for 10 min and collect the supernatant as crude enzyme solution, which is used as the loading solution. (3) The enzyme was purified using a Ni-NTA affinity chromatography column. The column was first equilibrated with 5 column volumes of equilibration buffer. 3-5 column volumes of sample were loaded at a rate of 1 mL / min. Elution was then performed with 3-5 column volumes of elution buffer at a rate of 1 mL / min. Based on the signal responses of the UV detector and conductivity detector, the eluent containing the target protein was collected. The eluent was dialyzed in a dialysis bag with a molecular weight cutoff of 12-14 KDa using pH 7.5 and 50 mM HEPES buffer to remove residual nickel ions from the enzyme solution. The cutoff solution was collected to obtain the pure enzyme solution. The equilibration buffer consisted of 20 mM phosphate buffer, 300 mM NaCl, 20 mM imidazole, and pH 8.
0. The elution buffer consisted of 50 mM phosphate buffer, 300 mM NaCl, 500 mM imidazole, and pH 8.0.