Clostridium bacteria modified to simultaneously assimilate a plurality of sugars, and preparation and uses thereof

Abstract

The present invention relates to the genetic modification of bacteria in the genus Clostridium, typically solvent-producing bacteria in the genus Clostridium. The invention further relates to methods, tools and kits for deleting or modifying one or more coding sequences, or controlling the transcription of one or more coding sequences, the XylR and / or AraR transcriptional repressors, the genetically modified bacteria obtained and the uses thereof, in particular to simultaneously ferment at least one hexose and pentose, or the carbon-containing elements of a substrate comprising at least two carbon-containing elements chosen from among glucose, arabinose, xylose, mannose and galactose.

Description

[0001] CLOSTRIDIUM BACTERIA MODIFIED TO ASSIMILATE MULTIPLE SUGARS

[0002] SIMULTANEOUSLY, PREPARATION AND USES THEREOF

[0003] The present invention relates to the genetic modification of bacteria of the genus Clostridium, typically solvent-forming bacteria of the genus Clostridium. It further relates to methods, tools and kits for the elimination or modification of sequence(s) coding for, or controlling the transcription of sequence(s) coding for, the transcriptional repressors XylR and / or AraR, the genetically modified bacteria obtained and their uses, in particular for simultaneously fermenting at least one hexose and one pentose or the carbon elements of a substrate comprising at least two carbon elements chosen from glucose, arabinose, xylose, mannose and galactose.

[0004] TECHNOLOGICAL BACKGROUND

[0005] The genus Clostridium contains Gram-positive, strictly anaerobic, spore-forming bacteria belonging to the phylum Bacillota. Clostridia are an important group for the scientific community for several reasons. The first is that a number of serious diseases (e.g., tetanus, botulism) are caused by infections with pathogenic members of this family (John & Wood, 1986). The second is the potential use of so-called acidogenic or solventogenic strains in biotechnology. These non-pathogenic Clostridia naturally have the ability to transform a wide variety of sugars to produce chemical species of interest, particularly acetone, butanol, and ethanol (John & Wood, 1986) during a fermentation known as ABE. The bacterium Clostridium acetobutylicum is now considered a model representative of solventogenic Clostridia.

[0006] Solventogenic Clostridia are capable of assimilating a wide variety of carbon sources, which is an asset for ABE fermentation processes (Keis, Shaheen and Jones 2001). This versatility theoretically allows them to proliferate efficiently on a wide range of substrates, particularly on by-products from agro-industry (Qureshi et al. 2008; Ezeji, Qureshi and Blaschek 2007; Ezeji and Blaschek 2008; Qureshi et al. 2006). Thanks to the rise of industrial fermentation processes, and more recently green chemistry, the incorporation of plant biomass into industrial processes is becoming more widespread. However, a categorization of plant substrates has quickly become widespread throughout industry, contrasting two "generations" of industrial substrates, based on environmental and human considerations.

[0007] So-called first-generation (GI) substrates encompass all carbon sources derived from plant storage organs. GI substrates can be derived from corn, wheat, but also sugar cane or beetroot. Mostly composed of sucrose and starch, their fermentation on an industrial scale is now very efficient. However, the use of these substrates is controversial, since they require the use of arable land and commodities exploited by the agri-food industry.

[0008] In contrast to this paradigm, second-generation substrates ("2G") bring together all substrates derived from plant structural organs, or agro-industry co-products. In doing so, this approach helps reduce tensions between the energy and food sectors. Their use is, however, much less easy than GI substrates. The cause is the main carbon source of these substrates: lignocellulose, a complex and recalcitrant polymeric matrix. Its degradation into fermentable sugars requires more or less expensive pretreatments, which can generate microbial growth inhibitors.

[0009] Due to the complex nature of the different fractions from which they are derived, hemicellulose hydrolysates contain various carbon sources. These are predominantly xylose and glucose, accompanied by a mixture of minor sugars such as galactose, mannose, and arabinose. All of these sugars are fermentable by solvent-forming Clostridium species. For example, Clostridium cellulovorans DSM 743B is described by Wen et al. (2020) as a strain that can be manipulated to optimize the production of / / -butanol from lignocellulose, and WO 2013 / 159710 describes a modified C. beijerinckii bacterium with an increased capacity to consume xylose and / or arabinose. In practice, however, a biological process known as Catabolite Repression (CR) prevents the optimal and simultaneous utilization of all these carbon sources.In particular, catabolic repression prevents the efficient metabolism of xylose contained in lignocellulose hydrolysates. The bacterium C. acetobutylicum in particular is sensitive to this repression phenomenon (Qureshi et al. 2006; Grimmler et al. 2010). Hu et al. (2011) teach that inactivation of the xylR gene (CA_C2613) in the ATCC 824 strain of C. acetobutylicum leads to faster utilization of xylose, which, however, does not impact the total amount of fermented xylose. WO 2013 / 159710 advises the skilled person against inactivating xylR (CAC3673) in C. acetobutylicum.

[0010] SUMMARY OF THE INVENTION

[0011] The inventors describe, in the context of the present invention, bacteria of the genus Clostridium, typically solvent-forming bacteria, capable of consuming, simultaneously, different carbon sources, in particular different sugars. In particular, they describe, for the first time, a bacterium C. acetobutylicum capable of consuming, simultaneously, glucose and a pentose, preferentially glucose and arabinose.

[0012] The inventors describe in particular a genetically modified bacterium, belonging to the genus Clostridium, in particular a solventogenic bacterium, not expressing the transcriptional repressors XylR and / or AraR or expressing non-functional versions thereof. This genetically modified bacterium is a bacterium not expressing the products of the xylR and / or araR genes, in particular the products of the CA_C2613, CA_C3673 and / or CA_C1340 genes, or expressing non-functional versions of said products.

[0013] A particular bacterium described by the inventors in the present text does not express the transcriptional repressor XylR or expresses a non-functional version thereof. This genetically modified bacterium is a bacterium not expressing the products of the xylR genes, in particular the products of the CA_C2613 and / or CA_C3673 genes, or expressing non-functional versions of said products.

[0014] Another particular bacterium described by the inventors in the present text does not express the transcriptional repressor AraR or expresses a non-functional version thereof. This genetically modified bacterium is a bacterium not expressing the product of the araR gene, in particular the product of the CA_C1340 gene, or expressing a non-functional version of said product.

[0015] Another preferred genetically modified bacterium according to the invention is a bacterium not expressing the transcriptional repressors XylR and AraR or expressing non-functional versions thereof. This genetically modified bacterium is a bacterium not expressing the products of the xylR and araR genes, in particular the products of the CA_C2613, CA_C3673 and CA_C1340 genes, or expressing non-functional versions of said products.

[0016] Particularly preferred genetically modified bacteria according to the invention correspond to the strain identified in the present description as IFP 968 as registered on June 13, 2022 under deposit number LMG P-32703 with the BCCM-LMG collection (also identified in the present text as ACA_C1340 ACA_C2613 ACA_C3673 or araR AxylRl xylR2), and to the strain identified in the present description as IFP 967 as registered on June 13, 2022 under deposit number LMG P-32702 with the BCCM-LMG collection (also identified in the present text as ACA_C1340 or t iraR), usable for preparing a strain equivalent to the strain IFP 968. The invention also relates to any bacteria derived, cloned, mutant or genetically modified version thereof.

[0017] The inventors further describe a method for producing a recombinant bacterium as described in the present text, in particular a method comprising the deletion or inactivation of the xylR and / or araR genes so as to prevent or reduce the expression of functional XylR and / or AraR proteins, as well as the genetically modified bacteria capable of being obtained by this method, of which the bacteria IFP 967 and IFP 968 are examples.

[0018] They also describe the use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the product of the xylR or araR gene, or expresses a non-functional version of the xylR or araR gene, such as the strain IFP 967, to prepare a genetically modified bacterium according to the invention not expressing the products of the xylR and araR genes, or expressing non-functional versions thereof.

[0019] The inventors further describe the use of a bacterium according to the invention to produce a solvent, a sugar or a biosourced molecule, for example from i) a lignocellulosic biomass, ii) the product of a particular dedicated crop such as an energy crop, a perennial fodder crop, a herbaceous crop or a shrub crop, or iii) GI substrate(s) derived from one or more sugar, cereal or oil-producing plants, or iv) a mixture of such carbon sources. They also describe the use of the bacteria according to the invention to simultaneously ferment (or in other words, to "co-ferment") at least one hexose and one pentose, or the carbon elements of a substrate comprising at least two carbon elements chosen from glucose, arabinose, xylose, mannose and galactose.Such bacteria can be advantageously used to produce a solvent or a mixture of solvents, particularly on an industrial scale.

[0020] The invention also relates to a fermentation process involving the use of a genetically modified bacterium as described in the present text.

[0021] The inventors finally describe kits, in particular a kit for transforming and preferably genetically modifying a bacterium belonging to the genus Clostridium, and a kit for producing a solvent, a sugar or a biosourced molecule using a bacterium belonging to the genus Clostridium, said kit comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention and ii) a medium, in particular a rich culture medium, preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium, containing at least glucose and a pentose, preferably glucose and arabinose and / or xylose.

[0022] DETAILED DESCRIPTION OF THE INVENTION

[0023] Although used in industry for over a century, knowledge of bacteria belonging to the genus Clostridium, particularly solvent-forming bacteria, remains very limited. A major constraint encountered by manufacturers concerns their inability to simultaneously use several distinct carbon sources and therefore to efficiently metabolize different types of substrates, particularly different types of sugars.

[0024] Despite the difficulties, well known to those skilled in the art, encountered in genetically modifying bacteria belonging to the genus Clostridium, the inventors have succeeded, for the first time in the context of the present invention, in obtaining a C. acetobutylicum bacterium capable of simultaneously using, i.e., co-assimilating, co-metabolizing or co-fermenting (these terms being used interchangeably in the present text) several distinct sources of carbon, in particular derived from biomass, in particular plant biomass, for example lignocellulosic biomass.

[0025] A “raw biomass”, also called “native biomass”, preferred in the context of the invention is a plant biomass, in particular a lignocellulosic biomass. The latter essentially comprises three natural constituents (polymers) present in variable quantities depending on its origin: cellulose (approximately 35 to 50% by dry mass of the biomass), which is a polysaccharide essentially consisting of hexoses, hemicellulose (approximately 20 to 30% by dry mass of the biomass) which is a polysaccharide essentially consisting of pentoses, and lignin (approximately 15 to 25% by dry mass of the biomass) which is a polymer of complex structure and high molecular weight, composed of aromatic alcohols linked by ether bonds. These different molecules are responsible for the intrinsic properties of the plant wall and are organized into a complex tangle.Among these three basic polymers that integrate lignocellulosic biomass, cellulose and hemicellulose are those that allow the production of 2G sweet juices and 2G alcohol.

[0026] Non-limiting examples of lignocellulosic biomass include, for example, agricultural residues (including straw waste, corn cobs, sugarcane bagasse, etc.), but also forestry residues, sawmill residues (typically wood chips) or any other type of woody residue of forestry, industrial, urban or household origin. Cellulosic biomass may also be the product of a particular dedicated crop such as an energy crop, dedicated for example to the cultivation of annual plants (“whole plant” use, for example, wheat or corn).It may otherwise be, for example, a crop of perennial fodder plants (for example, fescue, cocksfoot or ryegrass), a crop of herbaceous plants (for example, miscanthus or "elephant grass" or switchgrass or "panic grass"), or a shrub crop (short or very short rotation coppice, for example, of willow, poplar, chestnut or eucalyptus).

[0027] Another biomass that can be used in the context of the invention may be a 1G substrate or a mixture of several IG substrates derived from sugar plants (such as, for example, sugar cane or sugar beet), cereal plants (such as, for example, corn or wheat) and / or oilseed plants (such as, for example, soybean, rapeseed, palm). In the context of the invention, the biomass may be used alone or a mixture, for example, of several different types of biomass. The amount of water contained in the raw biomass is between 1% and 70% of the total mass of raw biomass.

[0028] The inventors have thus advantageously succeeded in genetically modifying, in this sense, a solventogenic bacterium, the reference strain C. acetobutylicum. In particular, they have made it capable of fermenting two carbon elements of different natures, for example at least one hexose and one pentose, or the carbon elements of a substrate comprising at least two distinct carbon elements chosen from glucose, arabinose, xylose, mannose and galactose, preferably chosen from glucose, arabinose and xylose, even more preferably glucose and arabinose.

[0029] In C. acetobutylicum, genes related to xylose catabolism are organized in a regulon (Gu et al. 2010). The main operon involved in xylose assimilation is the CA_C2610- CA_C2612 locus, which contains the genes encoding the xylose isomerase XylA (CA_C2610) and the xylulokinase XylB (CA_C2612) (Gu et al. 2010). The genes encoding the permeases predicted to be involved in xylose import, AraEl (CA_C1339) and XylT (CA_C1345), are located at a second locus (CA_C1339- CA_C1349) also containing genes related to arabinose assimilation. A third operon (CA_C3451-CA_C3452) contains the genes encoding the proteins XynT and XynB, corresponding respectively to a hypothetical permease and a 1,4-PD-xylosidase.

[0030] With the exception of xylT, all of these genes have XylR-binding-site (XBS) operator sequences in their promoter or coding sequence (Gu et al. 2010). The presence of XBS places these genes under the control of a xylose repressor, named XylR, which is capable of preventing transcription in T in the absence of xylose in the medium.

[0031] The CA_C2613 gene is located upstream of the xylB gene within the main xylose assimilation operon. This organization is very similar to what is observed in species possessing a xylose repressor (Gu et al. 2010).

[0032] The CA_C3673 gene has an XBS at its promoter, suggesting autoregulation of its transcription. The product of this gene is also the repressor with the highest identity to XylR homologues from closely related solvent-forming Clostridia, such as C. beijerinckii NCIMB 8052.

[0033] Genes involved in arabinose uptake are mostly located within the CA_C1339-CA_C1349 locus. This locus includes genes encoding the putative arabinose transporters AraEl and XylT, the L-arabinose isomerases AraAl (CA_C1342) and AraA2 (CA_C1346), the ribulokinase AraK (CA_C1344), and the L-ribulose-5-phosphate 4-epimerase AraD (CA_C1341).

[0034] A second operon contains the genes CA_C1529 and CA_C1530 which encode the arabinofuranosidase Arb43 and the arabinoside transporter AraT.

[0035] All these genes, as well as the gene encoding the phosphoketolase Xfp, are placed under the control of the transcriptional repressor AraR (CA_C1340), active in the absence of arabinose (Zhang et al. 2012).

[0036] A recently highlighted feature of C. acetobutylicum is the phenotypic difference between growth on xylose and that on arabinose, although the metabolic pathways allowing the assimilation of these sugars have many common intermediates (Servinsky et al. 2010). Indeed, while the generation time on arabinose is 78 min, it reaches 287 min on xylose (Servinsky et al. 2012). While xylose permease and xylulokinase activities have been implicated, this difference can also be explained by the action of transcriptional regulatory factors.

[0037] Transcriptomic analysis of C. acetobutylicum ATCC 824 cultures in the presence of glucose, xylose, or arabinose reveals that the pentose phosphate pathway is induced similarly by xylose and arabinose (Servinsky et al. 2010). In contrast, the expression of the phosphoketolase Xfp shows a different expression pattern. Indeed, xfp is weakly induced by xylose (by a factor of 3 compared to glucose) but strongly induced by arabinose (by a factor of 185 compared to glucose) (Servinsky et al. 2012). The striking contrast in the induction of xfp gene expression in the absence of arabinose can be explained by the presence of an AraR-binding-site upstream of this gene. Thus, one of the most remarkable consequences during the transcriptomic analysis of a mutant whose araR gene has been inactivated is the improvement of the transcription of the xfp gene by a factor greater than 1000 (Zhang et al. 2012).This transcriptional regulation of phosphoketolase contributes to partially hindering the assimilation of xylose in the absence of arabinose.

[0038] Recent work further shows that in addition to being partially repressed in the absence of arabinose, xylose assimilation is reduced in the presence of arabinose. Indeed, cultures grown in the presence of xylose and arabinose show minimal xylose consumption, while the rate of arabinose assimilation does not differ from the rate observable on arabinose alone (Aristilde et al. 2014). An analysis of metabolic fluxes confirms the preferential assimilation of arabinose over cultured xylose on these two sugars (Aristilde et al. 2014). Servinsky et al. also showed that the preference of arabinose over xylose cannot be entirely explained by the growth rates inherent to these two carbohydrates. They thus highlighted the fact that arabinose would be capable of specifically inhibiting the expression of genes for the assimilation of other sugars, including those of xylose.

[0039] The inventors show for the first time that the joint inactivation of the genes encoding the AraR and XylR repressors makes it possible to obtain a strain with astonishing coassimilation capacities, since it is capable of simultaneously assimilating and / or metabolizing two distinct carbon sources such as arabinose and glucose, without lifting the catabolic repression on the assimilation of xylose.

[0040] An object described by the inventors thus relates to a genetically modified bacterium belonging to the genus Clostridium, in particular a species of Clostridium of industrial interest, in particular C. acetobutylicum, characterized in that it does not express the products of the xylR and / or araR genes, or expresses non-functional versions of these.

[0041] In the context of the present invention, the term "xylR gene" refers in particular to the sequence SEQ ID NO: 1 (CA_C2613) or the sequence SEQ ID NO: 2 (CA_C3673). The term "xylR gene" also refers to the variants of said sequences SEQ ID NO: 1 and SEQ ID NO: 2, in particular the variants having sequence homology with one of said sequences SEQ ID NO: 1 or SEQ ID NO: 2.

[0042] In the context of the present invention, the term "araR gene" refers in particular to the sequence SEQ ID NO: 3 (CA_C1340) or a variant of said sequence, in particular a variant exhibiting sequence homology with said sequence SEQ ID NO: 3.

[0043] A typical example of a variant according to the invention has a sequence homology with the sequence SEQ ID NO: 1, with SEQ ID NO: 2 or with the sequence SEQ ID NO: 3 of between 95% and 100%, and preferably between 96% and 100%. The sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and its variant are, for example, homologous to at least 95%, for example to at least 96%, to at least 97%, to at least 98%, or to at least 99%. According to a preferred embodiment, the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 and its variant have sequences homologous to at least 96%, at least 97%, or at least 98%.

[0044] The term "xylR gene" also refers to a sequence encoding a functional fragment or variant of the XylR protein, in particular a protein capable of / capable of repressing, reducing or preventing (or involved in the repression of), for example in the absence of xylose, the expression of an enzyme of the xylose assimilation pathway, for example capable of / capable of repressing, reducing or preventing, the transcription of at least one gene chosen from the gene encoding xylose isomerase "XylA" (encoded by the gene CA_C2610, SEQ ID NO: 4), the gene encoding xylulokinase "XylB" (encoded by the gene CA_C2612, SEQ ID NO: 5), a gene encoding a permease involved in the import of xylose such as for example the protein "AraEl" (encoded by the gene CA_C1339, SEQ ID NO: : 6), the protein “XylT” (encoded by the gene CA_C1345, SEQ ID NO: 7), or the protein “XynT” (encoded by the gene CA_C3451, SEQ ID NO: 8), and the gene encoding 1,4-PD-xylosidase “XynB” (encoded by the gene CA_C3452, SEQ ID NO: 9).

[0045] The term "xylR gene" also refers to a variant nucleotide sequence encoding a protein capable of binding in particular the promoter (SEQ ID NO: 10) of the "xylA" gene (CA_C2610, SEQ ID NO: 4), the promoter (SEQ ID NO: 11) of the "xylB" gene (CA_C2612, SEQ ID NO: 5) or an "XBS" (XylR-binding site) operator sequence chosen for example from SEQ ID NO: 12 and SEQ ID NO: 13. The protein encoded by the variant nucleotide sequence is preferably capable of recognizing an XBS (XylR-Binding site) sequence such as for example SEQ ID NO: 12 or SEQ ID NO: 13, and / or of repressing, reducing or preventing the expression of said genes.

[0046] In a particular embodiment, the term "xylR gene" also refers to a sequence coding a functional fragment or variant of the XylR protein, in particular a protein capable of / capable of repressing, reducing or preventing (or involved in the repression of), for example in the presence of xylose, the expression of an enzyme of the xylose assimilation pathway as described above.

[0047] The term "araR gene" also refers to a sequence encoding a functional fragment or variant of the AraR protein, in particular a protein capable of / capable of repressing, reducing or preventing (or involved in the repression of), for example in the absence of arabinose, the expression of an enzyme of the xylose assimilation pathway or the F arabinose assimilation pathway, in particular capable of partially preventing the assimilation of xylose or F arabinose.

[0048] The term "araR gene" also refers to a sequence capable of / repressing, reducing or preventing, for example in the absence of arabinose, the transcription of at least one gene chosen from a gene encoding a transporter, or presumed transporter, of F arabinose "XylA", such as "AraEl" (encoded by the gene CA_C1339, SEQ ID NO: 6) or "XylT" (encoded by the gene CA_C1345, SEQ ID NO: 7); a gene encoding an L-arabinose isomerase such as "AraAl" (encoded by the gene CA_C1342, SEQ ID NO: 14) or "AraA2" (encoded by the gene CA_C1346, SEQ ID NO: 15); the gene encoding ribulokinase “AraK” (encoded by gene CA_C1344, SEQ ID NO: 16); the gene encoding L-ribulose-5-phosphate 4-epimerase “AraD” (encoded by gene CA_C1341, SEQ ID NO: 17); the gene encoding F arabinofuranosidase “Arb43” (encoded by gene CA_C1529, SEQ ID NO: 18); the gene encoding the arabinoside transporter “AraT” (encoded by gene CA_C1530, SEQ ID NO: 19);and the xfp gene (CA_C1343, SEQ ID NO: 20) encoding a phosphoketolase.;

[0049] The term "araR gene" also refers to a variant nucleotide sequence encoding a protein capable of binding in particular the promoter of an "ara" gene such as "araEl", "araAl", "araA2", "araK" or "araD", for example a sequence chosen from SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or an "ABS" (AraR-binding site) operator sequence chosen for example from SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27. The protein encoded by the variant nucleotide sequence is preferably capable of recognizing an ABS (AraR-binding site) sequence such as for example SEQ ID NO: 25 or SEQ ID NO: 26, and / or of repressing, reducing or preventing the expression of one or more of said genes encoding an enzyme involved in the arabinose assimilation pathway.

[0050] In a particular embodiment, the term "araR gene" also refers to a sequence coding a functional fragment or variant of the AraR protein, in particular a protein capable of / capable of repressing, reducing or preventing (or involved in the repression of), for example in the presence of arabinose, the expression of an enzyme as described above of the xylose assimilation pathway or the arabinose assimilation pathway.

[0051] Where this text refers to a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the xylR and / or araR genes, or expresses non-functional versions thereof, the expression "non-functional version of the product of the gene" xylR, or araR, designates a protein, typically a protein identified in this text as "XylR" or "AraR", which is non-functional, i.e., incapable of carrying out the function of the protein encoded by the wild-type version of the gene in question.In the case of the xylR gene product, the non-functional version of said product designates a protein incapable of repressing, decreasing or preventing the expression of an enzyme of the xylose and / or arabinose assimilation pathway, for example incapable of repressing, decreasing or preventing the transcription of at least one gene chosen from the gene encoding xylose isomerase "XylA", the gene encoding xylulokinase "XylB", a gene encoding a permease involved in the import of xylose such as for example the protein "AraEl", the protein "XylT", or the protein "XynT", and the gene encoding 1,4-PD-xylosidase "XynB".

[0052] In the case of the araR gene product, the non-functional version of said product designates a protein incapable of repressing, decreasing or preventing the expression of an enzyme of the xylose assimilation pathway and / or the arabinose assimilation pathway, in particular capable of partially preventing the assimilation of xylose. This protein is for example incapable of repressing, decreasing or preventing the transcription of at least one gene chosen from a gene encoding a transporter, or presumed transporter, of arabinose “XylA”, such as “AraEl” or “XylT”; a gene encoding an L-arabinose isomerase such as “AraAl” or “AraA2”; the gene encoding ribulokinase “AraK”; the gene encoding L-ribulose-5-phosphate 4-epimerase “AraD”; the gene encoding arabinofuranosidase "Arb43"; the gene encoding the arabinoside transporter "AraT"; and the xfp gene encoding a phosphoketolase.

[0053] The term "bacteria of the genus Clostridium" refers in particular to Clostridium species of industrial interest, typically solvent-forming or acetogenic bacteria of the genus Clostridium. The term "bacteria of the genus Clostridium" includes wild bacteria as well as strains derived from them, genetically modified for the purpose of improving their performance.

[0054] By "Clostridium species of industrial interest" or "Clostridium bacteria of industrial interest" is meant species capable of producing, by fermentation, solvents such as ethanol, butanol, acetone or isopropanol and / or acids such as butyric acid or acetic acid, from sugars or oses, typically from sugars comprising 5 carbon atoms such as xylose, arabinose or fructose, from sugars comprising 6 carbon atoms such as glucose or mannose, from polysaccharides or polysaccharides such as cellulose or hemicellulose, and / or from any other source of carbon assimilable and usable by bacteria of the genus Clostridium (CO, CO2, and methanol for example).Examples of solvent-forming bacteria of interest are acetone-, butanol-, ethanol-, and / or isopropanol-producing bacteria of the genus Clostridium, such as strains identified in the literature as “ABE strain” [strains carrying out fermentations allowing the production of acetone, butanol, and ethanol], “IBE strain” [strains carrying out fermentations allowing the production of isopropanol (by reduction of acetone), butanol, and ethanol], and “AIBE strain” [strains carrying out fermentations allowing the production of acetone, isopropanol, butanol, and ethanol]. Solvent-forming bacteria of the genus Clostridium may be selected, for example, from, but not limited to, C. acetobutylicum, C. cellulolyticum, C. phytofermentans, C. beijerinckii, C. saccharobutylicum, C. saccharoperbutylacetonicum, C. sporogenes, C. butyricum, C. aurantibutyricum and C. tyrobutyricum, preferably from C. acetobutylicum, C. beijerinckii, C.butyricum, C. tyrobutyricum and C. cellulolyticum, and even more preferably among C. acetobutylicum and C. beijerinckii. A most preferred solvent-forming bacterium is C. acetobutylicum.

[0055] The acetogenic bacteria of interest are bacteria producing acids and / or solvents from CO2 and H2. Acetogenic bacteria of the genus Clostridium can be selected for example from C. aceticum, C. thermoaceticum, C. ljungdahlii, C. autoethanogenum, C. difficile, C. scatologenes and C. carboxidivorans.

[0056] In a particular embodiment, the bacterium of the genus Clostridium concerned is an “ABE strain”, preferably the bacterium C. acetobutylicum, for example the strain DSM 792 (also designated strain ATCC 824 or LMG 5710) of C. acetobutylicum.

[0057] In another particular embodiment, the bacterium of the genus Clostridium concerned is an "ABE strain", preferably the bacterium C. beijerinckii, for example the strain NCIMB 8052 of C. beijerinckii.

[0058] In another particular embodiment, the bacterium of the genus Clostridium concerned is an "IBE strain", preferably a subclade of C. beijerinckii selected from DSM 6423, LMG 7814, LMG 7815, NRRL B-593 and NCCB 27006. Thus, according to a preferred embodiment, the bacterium according to the invention belonging to the genus Clostridium is a Clostridium bacterium of industrial interest, in particular a solvent-forming bacterium, capable, in the wild state, of producing solvents and / or acids by fermentation from a carbon source, said carbon source being chosen for example from a sugar, CO, CO2, an alcohol, and an organic acid.In a particular preferred embodiment, the carbon source is a sugar, in particular a sugar comprising 5 carbon atoms such as xylose or arabinose, a sugar comprising 6 carbon atoms such as glucose, fructose or mannose, or a polysaccharide or polysaccharide such as cellulose or hemicellulose.

[0059] A particularly preferred bacterium according to the invention is a Clostridium bacterium capable of simultaneously fermenting at least one hexose and one pentose. A particularly preferred bacterium according to the invention is a Clostridium bacterium capable of simultaneously fermenting the carbon elements of a substrate comprising at least two carbon elements chosen from glucose, arabinose, xylose, mannose and galactose, preferably chosen from glucose, arabinose and xylose.

[0060] A person skilled in the art can thus easily verify whether or not said Clostridium bacterium is a bacterium according to the invention, by culturing said bacterium on a substrate comprising several carbon sources (for example according to the method taught by Grimmler et al., 2010): if the bacterium ferments / assimilates at least two different carbon sources simultaneously (versus consecutively, i.e., one after the other), it is a bacterium according to the invention. Thus, a wild Clostridium bacterium placed in the presence of a substrate comprising glucose, arabinose and xylose, first ferments the glucose, then the arabinose and then the xylose. On the contrary, a bacterium according to the invention is capable of fermenting / assimilating simultaneously (i.e. at the same time) at least two of the three sugars present in the substrate, namely in the example provided glucose and arabinose (xylose being assimilated in a second step).Another simple way to easily check whether the Clostridium bacterium is or is not a bacterium according to the invention is to measure the growth rate of the bacterium. The observation in this bacterium of a faster growth than an observable growth in a bacterium expressing a functional AraR protein, or a mixture of functional XylR and AraR proteins, on a medium comprising xylose as the sole carbon source, will be considered as an indication of obtaining the bacterium using a method according to the invention (comprising the deletion or inactivation of the xylR and araR genes so as to prevent or reduce the expression of functional XylR and AraR proteins).Concretely, the person skilled in the art considers that a wild Clostridium bacterium has a maximum growth rate of between approximately 0.10 and approximately 0.25; preferably approximately 0.15; on a medium comprising xylose as the sole carbon source (Servinsky et al., 2010). The inventors have observed that a bacterium modified according to the invention has a maximum growth rate of between approximately 0.45 and approximately 0.60; preferably greater than approximately 0.50, on such a medium. Another method for verifying whether or not the Clostridium bacterium is a bacterium according to the invention consists of sequencing the loci CA_C1340, CA_C2613 and CA_C3673 and verifying whether or not they have been modified compared to their wild version, with a view to preventing or reducing the expression of functional XylR and AraR proteins.

[0061] A particularly preferred bacterium belongs to the species C. acetobutylicum and, as explained above, does not express the products of the genes of sequences SEQ ID NO: 1 (CA_C2613) or a sequence homologous to at least 95%, for example to at least 96%, at least 97% or at least 98% thereof, of SEQ ID NO: 2 (CA_C3673) or a sequence homologous to at least 95%, for example to at least 96%, at least 97% or at least 98% thereof, and of SEQ ID NO: 3 (CA_C1340) or a sequence homologous to at least 95%, for example to at least 96%, at least 97% or at least 98% thereof, or expresses non-functional versions of said expression products.

[0062] This particularly preferred bacterium exhibits the technical abilities described above, i.e., it is capable of fermenting / assimilating at least two different carbon sources simultaneously, and it grows faster than a bacterium expressing a functional AraR protein, or a mixture of functional XylR and AraR proteins, on a medium comprising xylose as the sole carbon source.

[0063] Such a strain is characterized for the first time in the context of the present application.

[0064] This strain was registered on June 13, 2022, under the deposit number LMG P-32703 in the BCCM-LMG collection. In this strain, the xylR and araR genes have been (jointly) inactivated. The description also relates to any bacterial derivative, clone, mutant or genetically modified version thereof, typically lacking the xylR and araR genes, or in which said genes have also been inactivated.

[0065] Another subject of the invention relates to the use of a bacterium according to the invention for simultaneously fermenting two distinct sources of carbon, for example at least one hexose and one pentose, or the carbon elements of a substrate comprising at least two carbon elements chosen from glucose, arabinose, xylose, mannose and galactose. In a particular embodiment, the bacterium according to the invention is for example capable of simultaneously fermenting glucose and arabinose, glucose and xylose, glucose and mannose, glucose and galactose, arabinose and xylose, arabinose and mannose, arabinose and galactose, xylose and mannose, xylose and galactose or mannose and galactose.

[0066] In a particular preferred embodiment, the bacterium according to the invention is capable of fermenting a substrate comprising at least two sugars chosen from glucose, arabinose and xylose, for example glucose and arabinose, glucose and xylose, or arabinose and xylose.

[0067] The genetically modified bacterium according to the invention can be advantageously used to produce a solvent, for example a biofuel, or a mixture of solvents, for example a mixture of biofuels, in particular on an industrial scale. The invention also relates to a fermentation process, typically an industrial process, involving the use of a bacterium according to the invention.

[0068] Thanks to the present invention, the use of second generation ("2G") substrates, particularly lignocellulose, is now greatly facilitated. The present invention offers a welcome solution that will reduce tensions between the energy and food sectors.

[0069] A genetically modified bacterium according to the invention can also be advantageously used to produce a sugar or a bio-sourced molecule from a biomass, in particular a lignocellulosic biomass, or from a dedicated energy crop.

[0070] In the context of the present invention, the term "bio-sourced molecule" means a molecule whose specificity is that the raw material used for its production must come from plant biomass, preferably lignocellulosic biomass, and not from resources of fossil origin such as oil, coal or natural gas.

[0071] Non-limiting examples of lignocellulosic biomass include, for example, agricultural residues (including straw waste, corn cobs, sugarcane bagasse, etc.), but also forestry residues, sawmill residues (typically wood chips) or any other type of woody residue.

[0072] Cellulosic biomass may also be the product of a particular dedicated crop such as an energy crop, dedicated for example to the cultivation of annual plants (use of "whole plant" for example wheat or corn). It may otherwise be for example a crop of perennial fodder plants (for example fescue, cocksfoot, ryegrass), a crop of herbaceous plants (for example miscanthus or "elephant grass", switchgrass or "panic grass"), or a shrub crop (short or very short rotation coppice for example willow, poplar, chestnut or eucalyptus).

[0073] Another biomass that can be used in the context of the invention may be a GI substrate derived from sugar plants (such as, for example, sugar cane or sugar beet), cereals (such as, for example, corn or wheat) and / or oilseeds (such as, for example, soybeans, rapeseed, or palm).

[0074] The invention further relates to a method for producing a recombinant bacterium according to the invention, comprising the deletion or inactivation of the xylR and araR genes so as to prevent or reduce the expression of functional XylR and AraR proteins.

[0075] The most successful known modification processes for obtaining genetically modified strains are based on homologous recombination events, which allow the genome to be modified in a precise and stable manner.

[0076] A particular production method according to the invention comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest.

[0077] For the purposes of the invention, the term "nucleic acid" means any natural, synthetic, semi-synthetic or recombinant DNA or RNA molecule, optionally chemically modified (i.e. comprising non-natural bases, modified nucleotides comprising, for example, a modified bond, modified bases and / or modified sugars), or optimized so that the codons of the transcripts synthesized from the coding sequences are the codons most frequently found in a bacterium of the genus Clostridium for use therein. In the case of the genus Clostridium, the optimized codons are typically codons rich in adenine ("A") and thymine ("T") bases.

[0078] In the peptide sequences described in this document, the amino acids are represented by their one-letter code according to the following nomenclature: C: cysteine; D: aspartic acid; E: glutamic acid; F: phenylalanine; G: glycine; H: histidine; I: isoleucine; K: lysine; L: leucine; M: methionine; N: asparagine; P: proline; Q: glutamine; R: arginine; S: serine; T: threonine; V: valine; W: tryptophan and Y: tyrosine.

[0079] In a particular embodiment described, the nucleic acid of interest comprises at least two complementary regions each of a target sequence, 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to said targeted DNA region / portion / sequence within the bacterial genome. These regions are capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically to a sequence as described above comprising at least 1 nucleotide, preferably at least 100 nucleotides, typically between 100 and 1000 nucleotides. The complementary regions of the target sequence present within the nucleic acid of interest can recognize, preferably target, the 5' and 3' flanking regions of the targeted sequence in a genetic modification tool known to those skilled in the art, typically any tool based on homologous recombination.

[0080] In a particular preferred embodiment, a portion of the nucleic acid of interest further recognizes (at least partially binds), and preferably targets, i.e. recognizes and allows the cleavage, in the genome of a Clostridium bacterium of interest, of at least one strand i) of a target sequence, ii) of a sequence controlling the transcription of a target sequence, or iii) of a sequence flanking a target sequence. The recognized sequence is also identified in the present text as a "target sequence" or "targeted sequence".

[0081] In this same preferred particular embodiment, the nucleic acid of interest comprises at least one complementary region of the target sequence which is 100% identical or at least 80% identical, preferably at least 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the targeted DNA region / portion / sequence within the bacterial genome and is capable of hybridizing to all or part of the complementary sequence of said region / portion / sequence, typically to a sequence comprising at least 5 nucleotides, preferably at least 5, 10, 14, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 15 and 30 nucleotides, preferably to a sequence comprising 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

[0082] The nucleic acid(s) of interest as described in the context of the present invention are capable of deleting said target sequence(s) from the genome of the bacterium or of modifying their expression, for example of modulating / regulating them, in particular of inhibiting them, preferably of modifying them in such a way as to render said bacterium incapable of expressing one or more proteins, in particular one or more functional proteins, from said sequence(s).

[0083] The “nucleic acids of interest”, typically expression cassettes or vectors, may be constructed by conventional techniques well known to those skilled in the art and may comprise one or more promoters, bacterial origins of replication (ORI sequences), termination sequences, selection genes, for example antibiotic resistance genes, and sequences (“flanked regions”) allowing the targeted insertion of the cassette or vector. ORI sequences of interest may for example be chosen from pIP404, pAMpi, ​​repH (origin of replication in C. acetobutylicum), ColEl or rep (origin of replication in E. coli), or any other origin of replication allowing the maintenance of the vector, typically the plasmid, within a bacterial cell belonging to the genus Clostridium.Termination sequences of interest may be chosen, for example, from those of the adc, thl genes, the bcs operon, or any other terminator, well known to those skilled in the art, allowing the termination of transcription within a bacterial cell belonging to the genus Clostridium. Selection genes (resistance genes) of interest may be chosen from ermB, catP, bla, tetA, tetM, and / or any other gene for resistance to ampicillin, erythromycin, chloramphenicol, thiamphenicol, spectinomycin, tetracycline, or any other antibiotic, well known to those skilled in the art, which can be used to select bacteria of the genus Clostridium.

[0084] The nucleic acid of interest may be a natural, synthetic or recombinantly produced RNA. This nucleic acid of interest may be prepared by any method known to those skilled in the art, such as, for example, chemical synthesis, in vivo transcription or amplification techniques. When the nucleic acid(s) of interest are introduced into the cell directly in the form of RNA molecules (mature or precursors), for example guide RNA (gRNA), these molecules may contain modified nucleotides or chemical modifications enabling them, for example, to increase their resistance to nucleases and thus increase their lifespan in the cell.They may in particular comprise at least one modified or non-natural nucleotide such as, for example, a nucleotide comprising a modified base, such as inosine, methyl-5-deoxy cytidine, dimethylamino-5-deoxyuridine, deoxyuridine, diamino-2,6-purine, bromo-5-deoxyuridine or any other modified base allowing hybridization.

[0085] The nucleic acids of interest used according to the invention can also be modified at the level of the internucleotide bond as are for example phosphorothioates, H-phosphonates or alkyl-phosphonates, or at the level of the skeleton as are for example alpha-oligonucleotides, 2'-O-alkyl riboses or PNA (Peptide Nucleic Acids) (Egholm et al., 1992).

[0086] In the context of the present description, a particular example of a nucleic acid of interest, used to transform and / or genetically modify a bacterium of interest, is a DNA fragment i) recognizing a coding sequence, ii) controlling the transcription of a coding sequence, or iii) flanking a coding sequence, the XylR repressor or the AraR repressor. In a preferred embodiment, the nucleic acid of interest is selected from the plasmid pGRNA-ACA_C1340 of sequence SEQ ID NO: 28, the plasmid pGRNA-ACA_C2613 of sequence SEQ ID NO:

[0087] 29 or the plasmid pGRNA-ACA_C3673 of sequence SEQ ID NO: 30.

[0088] A nucleic acid of particular interest described by the inventors is for example a vector, preferably a plasmid, for example the plasmid pGRNA-ACA_C1340 of sequence SEQ ID NO: 28, the plasmid pGRNA-ACA_C2613 of sequence SEQ ID NO: 29 or the plasmid pGRNA-ACA_C3673 of sequence SEQ ID NO: 30, described in the experimental part of the present description.

[0089] The or one of the recognized sequences (target sequence(s)) is preferably one of the sequences SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 corresponding to the xylR and araR genes respectively encoding an XylR protein and the AraR protein, or an amino acid sequence at least 70%, 75%, 80%, 85%, 90% or 95% identical to said protein, or a sequence comprising all or at least 95%, 96%, 97%, 98% or 99% of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In other words, the recognized sequence may be a sequence comprising at least 1 nucleotide, preferably at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35 or 40 nucleotides, typically between 1 and 40 nucleotides, preferably a sequence comprising 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides of the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

[0090] According to another particular example, the target sequence may also be a sequence controlling the transcription of a coding sequence as described above, typically a promoter sequence, for example the promoter sequence (SEQ ID NO: 10) of the “XylA” gene (CA_C2610, SEQ ID NO: 4), or that (SEQ ID NO: 11) of the “XylB” gene (CA_C2612, SEQ ID NO: 5). The nucleic acid of interest then recognizes, and is therefore typically capable of binding to, a sequence controlling the transcription of a coding sequence as described above.

[0091] According to another particular example, the target sequence may be a sequence flanking a coding sequence as described above, for example a sequence flanking the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a sequence at least 70% identical thereto. Such a flanking sequence typically comprises 1, 10 or 20 and 1000 nucleotides, for example between 1, 10 or 20 and 900, 800, 700, 600, 500, 400, 300 or 200 nucleotides, between 1, 10 or 20 and 100 nucleotides, between 1, 10 or 20 and 50 nucleotides, or between 1, 10 or 20 and 40 nucleotides, for example between 10 and 40 nucleotides, between 10 and

[0092] 30 nucleotides, between 10 and 20 nucleotides, between 20 and 30 nucleotides, between 15 and 40 nucleotides, between 15 and 30 nucleotides or between 15 and 20 nucleotides.

[0093] According to a particular aspect, the target sequence corresponds to the pair of sequences flanking such a coding sequence, each flanking sequence typically comprising at least 20 nucleotides, typically between 100 and 1000 nucleotides, preferably between 200 and 800 nucleotides.

[0094] Preferably, the method according to the invention for producing a recombinant bacterium comprises the transformation of the bacterial cell using at least one nucleic acid of interest, for example two or three nucleic acids of interest as described above, said nucleic acid(s) of interest being capable i) of recognizing (and capable of binding at least in part) a coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the XylR repressor, and ii) of recognizing (and capable of binding at least in part) a coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the AraR repressor.

[0095] As explained above, the coding sequence, controlling the transcription of a coding sequence, or flanking a coding sequence, the XylR repressor or the AraR repressor is also identified in this text as a "target sequence" or "targeted sequence".

[0096] The nucleic acid of interest as described in the context of the present invention is preferably capable of deleting said target sequence from the genome of the bacterium or of modifying its expression, for example of modulating / regulating it, in particular of inhibiting it, preferably of modifying it so as to render said bacterium incapable of expressing a protein (typically an AraR or XylR protein), in particular a functional protein, from said sequence. In a particularly preferred embodiment, the nucleic acid of interest is capable of modifying the bacterium so as to render it incapable of expressing one and / or the other of the AraR and XylR proteins.

[0097] The introduction into the bacteria of any nucleic acid of interest can be carried out by any method, direct or indirect, known to those skilled in the art, for example by transformation, conjugation, microinjection, transfection, electroporation, etc., preferably by electroporation (Mermelstein et al, 1993).

[0098] Furthermore, these nucleic acids of interest (for example DNA fragments, RNA fragments, expression cassettes or expression vectors) can be integrated into the bacterial genome by techniques which are also well known to those skilled in the art.

[0099] In a particular embodiment, the method for transforming, and preferably genetically modifying, a bacterium as described in the present text, comprises a step of transforming the bacterium by introducing into said bacterium a nucleic acid of interest according to the invention as described above and involves a genetic modification tool, for example a genetic modification tool selected from a CRISPR tool, an insertional mutagenesis tool, for example based on the use of type II introns (for example the Targetron® tool or the ClosTron® tool) and an allelic exchange tool (for example the ACE® tool).

[0100] The method for transforming, and preferably further genetically modifying, a Clostridium bacterium may further comprise a step of obtaining, recovering, selecting or isolating the transformed bacterium, i.e. the bacterium exhibiting the desired recombination(s) / modification(s) / optimization(s).

[0101] In a particular embodiment, the method according to the invention is based on the use of (implements) the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology / genetic tool, in particular the CRISPR / Cas (CRISPR-associated protein) genetic tool. The present invention can be implemented using a conventional CRISPR / Cas genetic tool using a single plasmid comprising a nuclease, a gRNA and a repair template as described by Wang et al. (2015). The person skilled in the art can easily define the sequence and structure of the gRNAs according to the chromosomal region or the mobile genetic element to be targeted using well-known techniques (see for example the article by DiCarlo et al., 2013).The inventors have also developed and described a genetic tool for modifying bacteria, adapted to bacteria of the genus Clostridium, usable in the context of the present invention, based on the use of two plasmids (cf. WO2017 / 064439, Wasels et al., 2017).

[0102] In another embodiment, the method according to the invention is based on the use of insertional mutagenesis tools, for example the use of type II introns, and implements for example the ClosTron® technology / genetic tool or the Targetron® genetic tool.

[0103] Targetron® technology is based on the use of a reprogrammable group II intron (based on the Ll.ltrB intron of Lactococcus lactis), capable of rapidly integrating the bacterial genome at a desired locus (Chen et al., 2005, Wang et al., 2013), typically with the aim of inactivating a targeted gene. The mechanisms of recognition of the edited area as well as insertion into the genome by back-splicing are based on homology between the intron and said area on the one hand, and on the activity of a protein (ItrA) on the other hand. ClosTron® technology is based on a similar approach, supplemented by the addition of a selection marker in the intron sequence (Heap et al., 2007). This marker allows the integration of the intron into the genome to be selected, and therefore facilitates the production of the desired mutants. This genetic system also exploits type I introns.Indeed, the selection marker (called RAM for retrotransposition-activated marker) is interrupted by such a genetic element, which prevents its expression from the plasmid (a more precise description of the system: Zhong et al.). Splicing of this genetic element occurs before integration into the genome, which allows obtaining a chromosome with an active form of the resistance gene. An optimized version of the system includes FLP / FRT sites upstream and downstream of this gene, which allows the use of FRT recombinase to eliminate the resistance gene (Heap et al., 2010).

[0104] In another embodiment, the method according to the invention is based on the use of an allelic exchange tool, and for example implements the ACE® genetic technology / tool.

[0105] The ACE® technology is based on the use of an auxotrophic mutant (for uracil in C. acetobutylicum ATCC 824 by deletion of the pyrE gene, which also causes resistance to 5-fluoroorotic acid (A-5-FO); Heap et al., 2012). This system uses the allelic exchange mechanism, well known to those skilled in the art. Following transformation with a pseudo-suicide vector (with very low copies), the integration of the latter into the bacterial chromosome by a first allelic exchange event can be verified using the resistance gene initially present on the plasmid. The integration step can be carried out in two different ways, either within the pyrE locus or within another locus. In the case of integration at the pyrE locus, the pyrE gene is also placed on the plasmid, but without being expressed (no functional promoter).The second recombination restores a functional pyrE gene and can then be selected by auxotrophy (minimal medium, not containing uracil). Since the non-functional pyrE gene also has a selectable trait (sensitivity to A-5-FO), other integrations can then be envisaged on the same model, by successively alternating the state of pyrE between functional and non-functional. In the case of integration at another locus, a genomic area allowing expression of the counter-selection marker after recombination is targeted (typically, in an operon after another gene, preferably a highly expressed gene). This second recombination is then selected by auxotrophy (minimal medium not containing uracil).

[0106] In the described embodiments based on the use of type II introns, and for example implementing the ClosTron® technology / genetic tool or the Targetron® genetic tool, or based on the use of an allelic exchange tool, and for example implementing the ACE® technology / genetic tool, the targeted sequence is typically one of the sequences described in the present text.

[0107] The invention further relates to a kit for transforming and / or genetically modifying a bacterium of the genus Clostridium comprising at least one nucleic acid of interest as described in the present text (for example two nucleic acids of interest, typically a DNA fragment, each recognizing a target sequence) for transforming and preferably genetically modifying a bacterium of the genus Clostridium, and optionally one or more selection molecules.A particular kit comprises the essential elements for the operation of a CRISPR tool (typically at least one nucleic acid usable as gRNA, one nucleic acid usable as a repair template, at least one pair of primers, and an inducer allowing the expression of a Cas9 or MAD7 type nuclease), the essential elements for the operation of a tool based on the use of type II introns (typically at least one type II intron, at least one pair of primers and an inducer allowing the expression of a reverse transcriptase, for example type LtrA RT or Tel4c RT), or the essential elements for the operation of an allelic exchange tool (typically at least two nucleic acids usable as a homologous recombination template, and at least one pair of primers).

[0108] The kits according to the invention may further comprise one or more consumables such as a culture medium, at least one competent bacterium of the genus Clostridium (i.e. conditioned for transformation), or even an explanatory leaflet.

[0109] The invention typically relates to a kit for implementing a method of transformation and / or genetic modification described in the present text using a bacterium of the genus Clostridium.

[0110] The invention relates in particular to the genetically modified bacterium belonging to the genus Clostridium having the essential characteristic of not expressing the products of the xylR and araR genes, or of expressing non-functional versions thereof, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, and their uses. The application also describes the strain IFP 967, registered on June 13, 2022 under the deposit number LMG P- 32702 with the BCCM-LMG collection, in which the araR gene has been inactivated, as well as any bacteria derived, cloned, mutant or genetically modified version thereof, typically lacking the xylR and araR genes, or in which said genes have also been inactivated.

[0111] It relates in particular to the use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the product of the xylR or araR gene, or expresses a non-functional version of the xylR or araR gene, for example the strain IFP 967, registered on June 13, 2022 under the deposit number LMG P-32702 with the BCCM-LMG collection, to prepare a genetically modified bacterium according to the invention not expressing the products of the xylR and araR genes, or expressing non-functional versions thereof.

[0112] The invention further relates to a kit for producing a solvent, a sugar or a bio-sourced molecule using a bacterium belonging to the genus Clostridium, comprising i) a genetically modified bacterium belonging to the genus Clostridium according to the invention, for example IPF968, and ii) a medium, typically a preservation medium or a culture medium for said bacterium. The kit may further comprise an explanatory leaflet.

[0113] The medium for preserving or culturing the genetically modified bacterium (belonging to the genus Clostridium) according to the invention present in the kit is preferably supplemented with a carbon source composed of glucose and at least one pentose, preferably i) glucose and ii) arabinose and / or xylose. This medium preferably comprises between 0.1 and 250 g / L, more preferably between 1 and 100 g / L, of said carbon source (composed of glucose and at least one pentose).

[0114] The preservation or culture medium for the genetically modified bacteria is preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium.

[0115] The invention also relates to a particular kit for producing a solvent or a biofuel, or a mixture of solvents or biofuels, using a bacterium belonging to the genus Clostridium, said kit comprising i) a bacterium (belonging to the genus Clostridium) genetically modified according to the invention, characterized in that it does not express the products of the xylR and araR genes, or expresses non-functional versions thereof, and ii) a rich culture medium, preferably an RCM type culture medium, more preferably a GAPES type culture medium, even more preferably a CGM type culture medium, containing at least glucose and a pentose, preferably arabinose and / or xylose.

[0116] The invention further relates to the possible uses of the method or kit according to the invention for transforming and / or genetically modifying a bacterium of the genus Clostridium, typically a solvent-forming bacterium of the genus Clostridium, for example for generating improved variants of said bacterium. Finally, it relates to the possible uses of the method, the kit or a bacterium of the genus Clostridium transformed and preferably genetically modified according to the invention, in particular for enabling the production of solvents or biofuels, or mixtures thereof, typically on an industrial scale.

[0117] The following examples and figures are intended to illustrate the invention more fully without limiting its scope. In particular, these examples show the production and characterization of bacteria according to the invention, in which the inactivation of araR and / or xylR genes is carried out according to a particular preferred embodiment using a CRISPR-Cas9 tool. Said genes can be inactivated according to other particular embodiments, well known to those skilled in the art, based for example on gene inactivation by homologous recombination or by insertional mutagenesis, as explained above.

[0118] FIGURES

[0119] [Fig 1] Figure 1 represents the map of the plasmid pBANak

[0120] [Fig 2] Figure 2 represents the Map of the plasmid pGRNA_ACA_C1340

[0121] [Fig 3] Figure 3 represents the Map of the plasmid pGRNA_ACA_C2613

[0122] [Fig 4] Figure 4 represents the Map of the plasmid pGRNA_ACA_C3673

[0123] [Fig 5] Figure 5 shows the growth kinetics on 30 mM xylose CGM medium

[0124] [Fig 6 A] Figure 6 A represents the kinetics of consumption of a mixture of glucose, arabinose and xylose in the wild-type C. acetobutylicum DSM 792 strain, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose.

[0125] [Fig 6B] Figure 6B represents the consumption kinetics of a mixture of glucose, arabinose and xylose in the strain C. acetobutylicum DSM 792 ACA_C2613 ACA_C3673, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose

[0126] [Fig 6C] Figure 6C represents the consumption kinetics of a mixture of glucose, arabinose and xylose in the strain C. acetobutylicum DSM 792 ACA_C1340, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose.

[0127] [Fig 6D] Figure 6D represents the kinetics of consumption of a mixture of glucose, arabinose and xylose in the strain C. acetobutylicum DSM 792 ACA_C1340 ACA_C2613 ACA_C3673, on a CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose EXAMPLES

[0128] EXAMPLE No. 1: Strain C. ACA C2613 ACA C3673

[0129] Materials and methods

[0130] Growing conditions

[0131] C. acetobutylicum DSM 792 was grown in 2YTG medium (Tryptone 16 g L 1 , yeast extract 10 g L 1 , glucose 5 g L 1 , NaCl 4 g L 1 ) and CGM (KH2PO4, 0.75 g; K2HPO4, 0.75 g; MgSO4-7H2O, 0.40 g; MnSO4H2O, 0.01 g; FeSO4-7 H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; carbon source as specified). Escherichia coli NEB 10-beta was grown in LB medium (Tryptone 10 g L 1 , yeast extract 5 g L 1, NaCl 10 g L 1 ). Solid media were made by adding 15 g L 1 of agarose to liquid media. Erythromycin (at concentrations of 40 mg.L 1 in 2YTG medium), chloramphenicol (25 or 12.5 mg L 1 respectively in solid or liquid LB medium), thiamphenicol (15 mg L 1 in 2YTG medium) were used if necessary.

[0132] Nucleic acids and plasmid vectors

[0133] The list of primers used for all constructions (name / DNA sequence) is detailed below:

[0134] C A_C2613_LH A_Fwd: AAAAA AG A ATTC ATTTGTCC ACTTAT ACC A ATTCCT (SEQ ID NO: 31)

[0135] CA_C2613_LHA_Rev: TCCTACTAGATACGGCGGAGTAAAATTAGT (SEQ ID NO: 32)

[0136] CA_C2613_RHA_Fwd: CTCCGCCGTATCTAGTAGGAATCTCCCACT (SEQ ID NO: 33)

[0137] CA_C2613_RHA_Rev : AAAAAAGTCGACAAAGAGAAAATAAGAGGATACAAAAG (SEQ ID NO : 34) gRNA_CA_C2613_Fwd : TCATGTTACACTTGGAACAGGCGT (SEQ ID NO : 35) gRNA_CAGCT26TCGAAACACRev : 36)

[0138] CA_C3673_LHA_Fwd : AAAAAAGGATCCAGAAAGACTTGTTACATCTCTAAGT (SEQ ID NO : 37)

[0139] CA_C3673_LHA_Rev : TGATATAGACTTAATGAACAAGATGTAATTTGAAATTAGT (SEQ ID NO : 38)

[0140] CA_C3673_RHA_Fwd : GTTCAATTAAGTCTATATCAAACATATCGCACCAACC (SEQ ID NO : 39)

[0141] CA_C3673_RHA_Rev: AAAAAAGTCGACATGATAATGGGAAATATATAGGAACTTT (SEQ ID NO: 40) gRNA_CA_C3673_Fwd: TCATGGAGTAGCAAGCTCTACAGG (SEQ ID NO: 41) gRNA_CA_C3673_Rev: AAACCCTGTAGAGCTTGCTACTCC (SEQ ID NO: 42) CA_C2613_verif_Fwd: TCGGC AGO AAAAACTCC AGT (SEQ ID NO: 43) CA_C2613_verif_Rev: GCAATTGCTGGCGGAATGAA (SEQ ID NO: 44) CA_C3673_verif Fwd: TACTTCATACATATCTAACGCACTCT (SEQ ID NO: 45) CA_C3673_verif Rev: AAATAACTTCTACTATGAGACAAGCA (SEQ ID NO: 46) The following plasmid vectors were constructed:

[0142] - Plasmid No. 1: pBANak (SEQ ID NO: 47)

[0143] It contains the pl5A origin of replication, as well as the ampR and kanR genes, which confer resistance to ampicillin and kanamycin, respectively. It also contains an expression cassette for the Bacillus subtilis phi 3T I methyltransferase, which is required for methylation of gene editing vectors prior to transformation into C. acetobutylicum.

[0144] - Plasmid No. 2: pGRNA_ACA_C2613 (SEQ ID NO: 29)

[0145] It contains all the elements of pGRNAhd with a substitution of F guide RNA allowing to target CA_C2613 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C2613_Fwd (SEQ ID NO: 35) and gRNA_CA_C2613_Rev (SEQ ID NO: 36) and integrated into the plasmid by the "golden gate assembly" technique, after digestion by BsaL II also contains an editing template allowing the inactivation of CA_C2613. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the pairs of primers CA_C2613_LHA_Fwd (SEQ ID NO: 31) / CA_C2613_LHA_Rev (SEQ ID NO: 32) and CA_C2613_RHA_Fwd (SEQ ID NO: 33) / CA_C2613_RHA_Rev (SEQ ID NO: 34) from C. acetobutylicum DSM 792 gDNA. The editing template was cloned between the BamHI and SalI restriction sites.

[0146] - Plasmid No. 3: pGRNA_ACA_C3673 (SEQ ID NO: 30)

[0147] It contains all the elements of pGRNAhd with a substitution of F guide RNA allowing to target CA_C3673 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C3673_Fwd (SEQ ID NO: 41) and gRNA_CA_C3673_Rev (SEQ ID NO: 42) and integrated into the plasmid by the golden gate assembly technique, after digestion by Bsal. It also contains an editing template allowing the inactivation of CA_C3673. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C3673_LHA_Fwd (SEQ ID NO: 37) / CA_C3673_LHA_Rev (SEQ ID NO: 38) and CA_C3673_RHA_Fwd (SEQ ID NO: 39) / CA_C3673_RHA_Rev (SEQ ID NO: 40) from C. acetobutylicum DSM 792 gDNA. The editing template was cloned between the BamHI and SalI restriction sites.

[0148] Transformation of C. acetobutylicum strains

[0149] Plasmids prepared in the NEB 10-beta strain were methylated by transformation into a NEB 10-beta strain also containing the pBANak plasmid. The extracted methylated plasmids will then be used to transform the C. acetobutylicum strain. The transformation is carried out according to the protocol described by Wasels et al. 2020.

[0150] Genetic editing of the CA_C2613 (SEQ ID NO: 1) and CA_C3673 (SEQ ID NO: 2) genes Inactivations of the CA_C2613 and CA_C3673 genes in the ACA_C2613-ACA_C3673 strains were carried out by genetic editing according to the protocol described by Wasels et al. 2020, using respectively the primer pairs CA_C2613_verif_Fwd (SEQ ID NO: 43) / CA_C2613_verif_Rev (SEQ ID NO: 44); CA_C3673_verif_Fwd (SEQ ID NO: 45) / CA_C3673_verif_Rev (SEQ ID NO: 46) during validation of the edition. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, may make it possible to obtain mutants with equivalent genotypes, i.e. no longer expressing the products of the CA_C2613 and CA_C3673 genes, or expressing a non-functional version of them.

[0151] Results

[0152] Growth kinetics and generation time determination

[0153] Growth monitoring of wild-type C. acetobutylicum DSM 792 and ACA_C2613 ACA_C3673 strains was carried out in quintuplicate on CGM medium containing 30 mM xylose (Figure 5).

[0154] The results reveal an improvement in generation time when growing on xylose as a carbon source. In addition, joint inactivation of the CA_C2613 and CA_C3673 genes results in a 33% improvement in generation time compared to the wild-type strain.

[0155] Monitoring consumption of a mixture of sugars

[0156] Sugar mixture consumption monitoring was carried out in technical triplicates with the wild-type C. acetobutylicum DSM 792 and ACA_C2613 ACA_C3673 strains, on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose (Figure 6).

[0157] The results indicate that joint inactivation of CA_C2613 and CA_C3673 does not present a significant phenotypic modification compared to the wild-type strain.

[0158] Example No. 2: strain IFP 967 (LMG P-32702), C. acetobutylicum ACA C1340

[0159] Materials and methods

[0160] Growing conditions

[0161] C. acetobutylicum DSM 792 was grown in 2YTG medium (Tryptone 16 g L 1 , yeast extract 10 g L 1 , glucose 5 g L 1 , NaCl 4 g L 1 ) and CGM (KH2PO4, 0.75 g; K2HPO4, 0.75 g; MgSO4-7H2O, 0.40 g; MnSO4H2O, 0.01 g; FeSO4-7 H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; carbon source as specified). Escherichia coli NEB 10-beta was grown in LB medium (Tryptone 10 g L 1 , yeast extract 5 g L 1 , NaCl 10 g L 1 ). Solid media were made by adding 15 g L 1of agarose to liquid media. Erythromycin (at concentrations of 40 mg.L 1 in 2YTG medium), chloramphenicol (25 or 12.5 mg L 1 respectively in solid or liquid LB medium), thiamphenicol (15 mg L 1 in 2YTG medium) were used if necessary.

[0162] Nucleic acids and plasmid vectors

[0163] The list of primers used for all constructions (name / DNA sequence) is detailed below:

[0164] CA_C1340_LHA_Fwd: AAAAAAGGATCCACCAGAAAAACCAACGCCTAGTA (SEQ ID NO: 48) CA_C1340_LHA_Rev: AGAAGTAGAAGAATTAAAATTGAAATAATTTATATTTAGTCCCTTGCC (SEQ ID NO: 49)

[0165] CA_C1340_RHA_Fwd: TTTCAATTTTAATTCTTCTACTTCTTCATATTTGTGCT (SEQ ID NO: 50) CA_C1340_RHA_Rev: AAAAAAGTCGACTAATTACTCATTACATACGTTATTTTTCAGT (SEQ ID NO: 51) gRNA_CA_C1340_Fwd: TCATTTTAAGGTCGATGATTCACA (SEQ ID NO: 52) gRNA_CA_C1340_Rev: AAACTGTGAATCATCGACCTTAAA (SEQ ID NO: 53) C A_C 1340_verif_Fwd: CCTACC A AT AGO ATCGCCC A AG A (SEQ ID NO: 54) CA_C 1340_verif_Rev: TTCTAGCATAAAATACTCCTCCCTA (SEQ ID NO: 55)

[0166] The following plasmid vectors were constructed:

[0167] - Plasmid No. 1: pBANak (SEQ ID NO: 47)

[0168] It contains the pl5A origin of replication, as well as the ampR and kanR genes, which confer resistance to ampicillin and kanamycin, respectively. It also contains an expression cassette for the Bacillus subtilis phi 3T I methyltransferase, which is required for methylation of gene editing vectors prior to transformation into C. acetobutylicum.

[0169] - Plasmid No. 4: pGRNA_ACA_C1340 (SEQ ID NO: 28)

[0170] It contains all the elements of pGRNAmd (Wasels et al. 2020) with a substitution of F guide RNA to target CA_C1340 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C1340_Fwd (SEQ ID NO: 52) and gRNA_CA_C1340_Rev (SEQ ID NO: 53) and integrated into the plasmid by the “golden gate assembly” technique, after digestion with Bsal. It also contains an editing template allowing the inactivation of CA_C1340. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C1340_LHA_Fwd (SEQ ID NO: 48) / CA_C1340_LHA_Rev (SEQ ID NO: 49) and CA_C1340_RHA_Fwd (SEQ ID NO: 50) / CA_C1340_RHA_Rev (SEQ ID NO: 51) from C. acetobutylicum DSM 792 gDNA. The editing template was cloned between the BamHI and SalI restriction sites. Transformation of C. acetobutylicum strains

[0171] Plasmids prepared in the NEB 10-beta strain were methylated by transformation into a NEB 10-beta strain also containing the pBANak plasmid. The extracted methylated plasmids will then be used to transform the C. acetobutylicum strain. The transformation is carried out according to the protocol described by Wasels et al. 2020.

[0172] Genetic editing of the CA_C1340 gene (SEQ ID NO: 3):

[0173] Inactivation of the CA_C1340 gene in ACA_C1340 strains was performed by gene editing according to the protocol described by Wasels et al. 2020, using the primer pairs CA_C1340_verif_Fwd (SEQ ID NO: 54) / CA_C1340_verif_Rev (SEQ ID NO: 55) respectively during editing validation. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, may make it possible to obtain mutants with equivalent genotypes, i.e. no longer expressing the CA_C1340 gene product or expressing a non-functional version of it.

[0174] Results

[0175] Growth kinetics and generation time determination

[0176] Growth monitoring of wild-type C. acetobutylicum DSM 792 and ACA_C1340 strains was carried out in quintuplicate on CGM medium containing 30 mM xylose (Figure 5).

[0177] The results reveal an improvement in generation time when growing on xylose as a carbon source. In addition, inactivation of the gene encoding the AraR repressor allows a +152% improvement in generation time compared to the wild-type strain.

[0178] Monitoring consumption of a mixture of sugars

[0179] Sugar mixture consumption monitoring was carried out in technical triplicates with the wild-type C. acetobutylicum DSM 792 and ACA_C1340 strains on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose (Figure 6).

[0180] The results indicate that inactivation of CA_C1340 allows for faster arabinose consumption kinetics in the presence of glucose than that observed in the wild-type strain. Tl

[0181] 3: IFP 968 strain ACA C1340-ACA C2613-

[0182] ACA C3673

[0183] Materials and methods

[0184] Growing conditions

[0185] C. acetobutylicum DSM 792 was grown in 2YTG medium (Tryptone 16 g L 1 , yeast extract 10 g L 1 , glucose 5 g L 1 , NaCl 4 g L 1 ) and CGM (KH2PO4, 0.75 g; K2HPO4, 0.75 g; MgSO4-7H2O, 0.40 g; MnSO4H2O, 0.01 g; FeSO4-7 H2O, 0.01 g; NaCl, 1.0 g; asparagine, 2.0 g; yeast extract, 5.0 g; (NH4)2SO4, 2.0 g; carbon source as specified). Escherichia coli NEB 10-beta was grown in LB medium (Tryptone 10 g L 1 , yeast extract 5 g L 1 , NaCl 10 g L 1 ). Solid media were made by adding 15 g L 1 of agarose to liquid media. Erythromycin (at concentrations of 40 mg.L 1 in 2YTG medium), chloramphenicol (25 or 12.5 mg L 1 respectively in solid or liquid LB medium), thiamphenicol (15 mg L 1 in 2YTG medium) were used if necessary.

[0186] <h2 style=";text-align:left;direction:ltr">Acids nucleiques and plasmid viruses<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0187] <h2 style=";text-align:left;direction:ltr"> The list of amorces ayant services in the constructions sense (nom / sequence d'ADN) is detailed this-dessous:<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0188] <h2 style=";text-align:left;direction:ltr"> CA_C1340_LHA_Fwd : AAAAAAGGATCCACCAGAAAAACCAACGCCTAGTA (SEQ ID NO : 48)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0189] <h2 style=";text-align:left;direction:ltr"> CA_C1340_LHA_Rev : AGAAGTAGAAGAATTAAAATTGAAATAATTTATATTTAGTCCCTTGCC (SEQ ID NO : 49)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0190] <h2 style=";text-align:left;direction:ltr"> CA_C1340_RHA_Fwd : TTTCAATTTTAATTCTTCTACTTCTTCATATTTGTGCT (SEQ ID NO : 50)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0191] <h2 style=";text-align:left;direction:ltr"> C A_C 1340_verif_Fwd : CCTACC A AT AGO ATCGCCC A AG A (SEQ ID NO : 54) CA_C 1340_verif_Rev : TTCTAGCATAAAATACTCCTCCCTA (SEQ ID NO : 55)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0192] <h2 style=";text-align:left;direction:ltr"> C A_C2613_LH A_Fwd : AAAAA AG A ATTC ATTTGTCC ACTTAT ACC A ATTCCT (SEQ ID NO : 31)<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0193] CA_C2613_LHA_Rev : TCCTACTAGATACGGCGGAGTAAAATTAGT (SEQ ID NO : 32)

[0194] CA_C2613_RHA_Fwd : CTCCGCCGTATCTAGTAGGAATCTCCCACT (SEQ ID NO : 33)

[0195] CA_C2613_RHA_Rev : AAAAAAGTCGACAAAGAGAAAATAAGAGGAATACAAAAG (SEQ ID NO : 34) gRNA_CA_C2613_Fwd : TCATGTTACACTTGGAACAGGCGT (SEQ ID NO : 35) gRNA_CA_C2613_Rev : AACACCAGTCAGTAGQTA IDGCT NO : 34) 36)

[0196] CA_C2613_verif_Fwd : TCGGC AGO AAAAACTCC AGT (SEQ ID NO : 42)

[0197] CA_C2613_verif_Rev : GCAATTGCTGGCGGAATGAA (SEQ ID NO : 43)

[0198] CA_C3673_LHA_Fwd : AAAAAAGGATCAGAAAGACTTGTTACATCTCTAAGT (SEQ ID NO : 37) CA_C3673_LHA_Rev : TGATATAGACTTAATGACAAGATGTAATTTGAATTAGT (SEQ ID NO : 38) CA_C363 GTTCAATTAAGTCTATATCAAACATATCGCACCAACC (SEQ ID NO : 39) CA_C3673_RHA_Rev : AAAAAAGTCGACATGATAATGGGAAATATAGGACTTT (SEQ ID NO : 40) gRNA_CA_C3673_FwCTAG : NOGSECT1QGAACGT gRNA_CA_C3673_Rev : AAACCCTGTAGAGCTTGCTACTCC (SEQ ID NO : 42) CA_C3673_verif Fwd : TACTTCATACATCTAACGCACTCT (SEQ ID NO : 44) CA_C3673_verif Rev : AASEGAQAACTTCTACTTA

[0199] The following plasmid vectors were constructed:

[0200] - Plasmid N°1 : pBANak (SEQ ID NO : 52)

[0201] It contains the pl5A origin of replication, as well as the ampR and kanR genes, which confer resistance to ampicillin and kanamycin, respectively. It also contains an expression cassette for the Bacillus subtilis phi 3T I methyltransferase, which is required for methylation of gene editing vectors prior to transformation into C. acetobutylicum.

[0202] - Plasmid No. 4: pGRNA_ACA_C1340 (SEQ ID NO: 28)

[0203] It contains all the elements of pGRNAhd (Wasels et al. 2020) with a substitution of the guide RNA allowing to target CA_C1340 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C1340_Fwd (SEQ ID NO: 52) and gRNA_CA_C1340_Rev (SEQ ID NO: 53) and integrated into the plasmid by the “golden gate assembly” technique, after digestion with Bsal. It also contains an editing template allowing the inactivation of CA_C1340. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C1340_LHA_Fwd (SEQ ID NO: 48) / CA_C1340_LHA_Rev (SEQ ID NO: 49) and CA_C1340_RHA_Fwd (SEQ ID NO: 50) / CA_C1340_RHA_Rev (SEQ ID NO: 51) from C. acetobutylicum DSM 792 gDNA. The editing template was cloned between the BamHI and SalI restriction sites.

[0204] - Plasmid No. 2: pGRNA_ACA_C2613 (SEQ ID NO: 29)

[0205] It contains all the elements of pGRNAhd with a substitution of the guide RNA allowing to target CA_C2613 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C2613_Fwd (SEQ ID NO: 35) and gRNA_CA_C2613_Rev (SEQ ID NO: 36) and integrated into the plasmid by the "golden gate assembly" technique, after digestion by Bsal. It also contains an editing template allowing the inactivation of CA_C2613. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C2613_LHA_Fwd (SEQ ID NO: 31) / CA_C2613_LHA_Rev (SEQ ID NO: 32) and CA_C2613_RHA_Fwd (SEQ ID NO: 33) / CA_C2613_RHA_Rev (SEQ ID NO: 34) from C. acetobutylicum DSM 792 gDNA. The editing template was cloned between the BamHI and SalI restriction sites. - Plasmid No. 3: pGRNA_ACA_C3673 (SEQ ID NO: 30)

[0206] It contains all the elements of pGRNAhd with a substitution of F guide RNA allowing to target CA_C3673 (Oligo-20-mer obtained by hybridization of the primers gRNA_CA_C3673_Fwd (SEQ ID NO: 41) and gRNA_CA_C3673_Rev (SEQ ID NO: 42) and integrated into the plasmid by the golden gate assembly technique, after digestion by Bsal. It also contains an editing template allowing the inactivation of CA_C3673. This editing template was constructed by cloning the LHA and RHA fragments obtained respectively by amplification with the primer pairs CA_C3673_LHA_Fwd (SEQ ID NO: 37) / CA_C3673_LHA_Rev (SEQ ID NO: 38) and CA_C3673_RHA_Fwd (SEQ ID NO: 39) / CA_C3673_RHA_Rev (SEQ ID NO: 40) from C. acetobutylicum DSM 792 gDNA. The editing template was cloned between the BamHI and SalI restriction sites.

[0207] Transformation of C. acetobutylicum strains

[0208] Plasmids prepared in the NEB 10-beta strain were methylated by transformation into a NEB 10-beta strain also containing the pBANak plasmid. The extracted methylated plasmids will then be used to transform the C. acetobutylicum strain. The transformation is carried out according to the protocol described by Wasels et al. 2020.

[0209] Genetic editing of the CA_C2613 (SEQ ID NO: 1), CA_C3673 (SEQ ID NO: 2) and / or CA_C1340 (SEQ ID NO: 3) genes:

[0210] The inactivation of the CA_C1340, CA_C2613 and CA_C3673 genes in the ACA_C1340-ACA_C2613-ACA_C3673 strain was carried out by genetic editing according to the protocol described by Wasels et al. 2020, using respectively the primer pairs CA_C1340_verif_Fwd (SEQ ID NO: 54) / CA_C1340_verif_Rev (SEQ ID NO: 55); CA_C2613_verif_Fwd (SEQ ID NO: 43) / CA_C2613_verif_Rev (SEQ ID NO: 44); CA_C3673_verif_Fwd (SEQ ID NO: 45) / CA_C3673_verif_Rev (SEQ ID NO: 46) during editing validation. The use of other genetic tools, such as those based on homologous recombination or the insertion of mobile genetic elements, may make it possible to obtain mutants with equivalent genotypes, i.e. no longer expressing the products of the CA_C1340, CA_C2613 and / or CA_C3673 genes, or expressing a non-functional version of them.

[0211] Results

[0212] Growth kinetics and generation time determination

[0213] Growth monitoring of wild-type C. acetobutylicum DSM 792 and ACA_C1340 ACA_C2613 strains

[0214] ACA_C3673 were grown in quintuplicate on CGM medium containing 30 mM xylose (Figure 5). The results reveal an improvement in generation time when grown on xylose as a carbon source. In addition, joint inactivation of the genes encoding the AraR and XylR repressors allows a +171% improvement in generation time compared to the wild-type strain.

[0215] Monitoring consumption of a mixture of sugars

[0216] Sugar mixture consumption monitoring was carried out in technical triplicates with the wild-type C. acetobutylicum DSM 792 and ACA_C1340 ACA_C2613 ACA_C3673 strains, on CGM medium containing 25 mM glucose, 25 mM arabinose and 70 mM xylose (Figure 6).

[0217] The results indicate that simultaneous coassimilation of arabinose and glucose is made possible by the joint inactivation of CA_C1340 and the CA_C2613 and CA_C3673 genes.

[0218] Catabolite repression preventing the coassimilation of xylose in the presence of the other two sugars is, however, maintained. This unexpected result indicates that the synergy between the joint inactivation of the genes encoding the AraR and XylR repressors allows the lifting of catabolite repression weighing on arabinose, while maintaining it for xylose.

[0219] Conclusions

[0220] During this work, the inventors were able to demonstrate the benefit of jointly inactivating the genes encoding the AraR and XylR repressors in the C. acetobutylicum DSM 792 strain, thus describing that the combination of these genetic modifications allows the production of a C. acetobutylicum strain performing glucose / arabinose coassimilation and exhibiting accelerated growth on xylose alone. Inactivation of the araR gene alone does not allow co-assimilation of arabinose and glucose, which is only obtained when the copies of the genes encoding the XylR repressor are also inactivated. In addition, inactivation of both copies of the gene encoding XylR is not sufficient to significantly reduce the generation time of the microorganism when it grows on a medium containing xylose as the sole carbon source. Inactivation of the gene encoding AraR is necessary.

[0221] This result is important since this strain naturally suffers from an inability to simultaneously assimilate pentoses and hexoses such as glucose, arabinose and xylose, drastically impacting performance during fermentation on substrates composed of a mixture of these sugars, such as industrial substrates for sugar production processes from biomass. REFERENCES

[0222] - Aristilde, Ludmilla; Lewis, Ian A.; Park, Junyoung O.; Rabinowitz, Joshua D. (2014) Hierarchy in Pentose Sugar Metabolism in Clostridium acetobutylicum. In: Applied and environmental microbiology, vol. 81, n°4, p. 1452-1462. DOI: 10.1128 / aem.03199-14.

[0223] - Ezeji, Thaddeus; Blaschek, Hans P. (2008) Fermentation of dried distillers' grains and soluble (DDGS) hydrolysates to solvents and value-added solvent products byogenic clostridia. In: Bioresource Technology, vol. 99, no. 12, p. 5232-5242. DOI: 10.1016 / j.biortech.2007.09.032.

[0224] - Ezeji, Thaddeus; Qureshi, Nasib; Blaschek, Hans P. (2007) Butanol production from agricultural residues. Impact of degradation products on Clostridium beijerinckii growth and butanol fermentation. In : Biotechnology and bioengineering, vol. 97, n° 6, p. 1460-1469. DOI: 10.1002 / bit.21373.

[0225] - Grimmler, Christina; Held, Claudia; Liebl, Wolfgang; Ehrenreich, Armin (2010) Transcriptional analysis of catabolite repression in Clostridium acetobutylicum growing on mixtures of D-glucose and D- xylose. In : Journal of biotechnology, vol. 150, n° 3, p. 315-323. DOI: 10.1016 / j.jbiotec.2010.09.938.

[0226] - Gu, Yang; Ding, Yi; Ren, Cong; Sun, Zhe; Rodionov, Dmitry A.; Zhang, Weiwen et al. (2010) Reconstruction of xylose utilization pathway and régulons in Firmicutes. In : BMC genomics, vol. 11, p. 255. DOI: 10.1186 / 1471-2164-11-255.

[0227] - Hu, Shiyuan; Zheng, Huajun; Gu, Yang; Zhao, Jingbo; Zhang, Weiwen; Yang, Yunliu et al. (2011) Comparative genomic and transcriptomic analysis revealed genetic characteristics related to solvent formation and xylose utilization in Clostridium acetobutylicum EA 2018. In : BMC genomics, vol. 12, n° 1. DOI: 10.1186 / 1471-2164-12-93.

[0228] - Keis, S.; Shaheen, R.; Jones, D. T. (2001) Emended descriptions of Clostridium acetobutylicum and Clostridium beijerinckii, and descriptions of Clostridium saccharoperbutylacetonicum sp. nov. and Clostridium saccharobutylicum sp. nov. In : INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY, vol. 51, n° 6, p. 2095-2103. DOI: 10.1099 / 00207713-51-6-2095.

[0229] - Qureshi, N.; Li, X.-L.; Hughes, S.; Saha, B. C.; Cotta, M. A. (2006) Butanol Production from Corn Fiber Xylan Using Clostridium acetobutylicum. In : Biotechnology Progress, vol. 22, n° 3, p. 673-680. DOI: 10.1021 / bp050360w.

[0230] - Qureshi, Nasib; Ezeji, Thaddeus C.; Ebener, Jennifer; Dien, Bruce S.; Cotta, Michael A.; Blaschek, Hans P. (2008) Butanol production by Clostridium beijerinckii. Part I. Use of acid and enzyme hydrolyzed corn fiber. In : Bioresource Technology, vol. 99, n° 13, p. 5915-5922. DOI: 10.1016 / j.biortech.2007.09.087.

[0231] - Servinsky, M. D. Arabinose-Induced Catabolite Repression as a Mechanism for Pentose Hierarchy Control in Clostridium acetobutylicum ATCC 824.

[0232] - Servinsky, M. D.; Germane, K. L.; Liu, S.; Kiel, J. T.; Clark, A. M.; Shankar, J.; Sund, C. J. (2012) Arabinose is metabolized via a phosphoketolase pathway in Clostridium acetobutylicum ATCC 824. In : Journal of industrial microbiology & biotechnology, vol. 39, n° 12, p. 1859-1867. DOI: 10.1007 / s 10295-012- 1186-x.

[0233] - Servinsky, Matthew D.; Kiel, James T.; Dupuy, Nicole F.; Sund, Christian J. (2010) Transcriptional analysis of differential carbohydrate utilization by Clostridium acetobutylicum. In : Microbiology (Reading, England), vol. 156, n° Pt 11, p. 3478-3491. DOI: 10.1099 / mic.0.037085-0.

[0234] - Wasels, François; Chartier, Gwladys; Hocq, Rémi; Lopes Ferreira, Nicolas; Julia Pettinari, M. (2020) A CRISPR / Anti-CRISPR Genome Editing Approach Underlines the Synergy of Butanol Dehydrogenases in Clostridium acetobutylicum DSM 792. In : Applied and environmental microbiology, vol. 86, n° 13, p. 4823. DOI: 10.1128 / AEM.00408-20.

[0235] - Zhiqiang Wen, Rodrigo Ledesma- Amaro, MinruiLLu, Mingjie Jin, and Sgheng Yang (2020) Metabolic Engineering of Clostridium cellulovorans to improve butanol production by consolidated bioprocessing. ACS Synth. Biol., 9, 304-315.

[0236] - Xiao, Han; Li, Zhilin; Jiang, Yu; Yang, Yunliu; Jiang, Weihong; Gu, Yang; Yang, Sheng (2012) Metabolic engineering of D-xylose pathway in Clostridium beijerinckii to optimize solvent production from xylose mother liquid. In : Metabolic engineering, vol. 14, n° 5, p. 569-578. DOI: 10.1016 / j.ymben.2012.05.003.

[0237] - Zhang, Lei; Leyn, Semen A.; Gu, Yang; Jiang, Weihong; Rodionov, Dmitry A.; Yang, Chen (2012) Ribulokinase and transcriptional regulation of arabinose metabolism in Clostridium acetobutylicum. In : Journal of bacteriology, vol. 194, n° 5, p. 1055-1064. DOI: 10.1128 / JB.06241-11.

Claims

CLAIMS 1. A genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the products of the xylR and araR genes, or expresses non-functional versions of them.

2. Bacterium according to claim 1, characterized in that the bacterium is a solvent-forming bacterium, preferably C. acetobutylicum.

3. Bacterium according to claim 1 or 2, characterized i) in that the bacterium belongs to the species C. acetobutylicum and does not express the products of the genes of sequences SEQ ID NO: 1 (CA_C2613) or a sequence homologous to at least 95% thereof, of SEQ ID NO: 2 (CA_C3673) or a sequence homologous to at least 95% thereof, and of SEQ ID NO: 3 (CA_C1340) or a sequence homologous to at least 95% thereof, or ii) expresses non-functional versions of said expression products.

4. Bacteria according to any one of claims 1 to 3, characterized in that it is capable of simultaneously fermenting at least one hexose and one pentose.

5. Bacteria according to any one of claims 1 to 3, characterized in that it is capable of simultaneously fermenting the carbon elements of a substrate comprising at least two carbon elements chosen from glucose, arabinose, xylose, mannose and galactose, preferably chosen from glucose, arabinose and xylose.

6. Bacterium according to any one of claims 1 to 3, characterized in that it grows faster than a bacterium expressing a functional AraR protein, or a mixture of functional XylR and AraR proteins, on a medium comprising xylose as the sole carbon source.

7. Bacteria according to any one of claims 1 to 6, characterized in that the bacterium is the IFP 968 strain registered on June 13, 2022 under the deposit number LMG P-32703 with the BCCM-LMG collection.

8. Use of a bacterium according to any one of claims 1 to 6 for simultaneously fermenting at least one hexose and one pentose or the carbon elements of a substrate comprising at least two carbon elements chosen from glucose, arabinose, xylose, mannose and galactose.

9. Use according to claim 8, characterized in that the substrate comprises at least two sugars chosen from glucose, arabinose and xylose.

10. Use according to claim 8 or 9, for producing a solvent, for example a biofuel, or a mixture of solvents, for example a mixture of biofuels.

11. Use of a bacterium according to one of claims 1 to 6 for producing a sugar or a bio-sourced molecule from i) a lignocellulosic biomass, ii) the product of a particular dedicated crop such as an energy crop, a perennial fodder plant crop, a herbaceous crop, a shrub crop, or iii) GI substrate(s) from one or more sugar, cereal or oil-producing plants, or iv) a mixture of such carbon sources.

12. A fermentation process involving the use of a bacterium as described in any one of claims 1 to 7.

13. A method of producing a recombinant bacterium according to any one of claims 1 to 7 comprising the deletion or inactivation of the xylR and araR genes so as to prevent or reduce the expression of functional XylR and AraR proteins.

14. Genetically modified bacterium belonging to the genus Clostridium capable of being obtained by the method according to claim 13, characterized in that said bacterium is a bacterium as described in one of claims 1 to 6.

15. Use of a genetically modified bacterium belonging to the genus Clostridium, characterized in that it does not express the product of the xylR or araR gene, or expresses a non-functional version of the product of the xylR or araR gene, for preparing a genetically modified bacterium according to one of claims 1 to 6 not expressing the products of the xylR and araR genes, or expressing non-functional versions thereof.

16. Use according to claim 15, characterized in that the genetically modified bacterium not expressing the product of the xylR or araR gene, or expressing a non-functional version of the product of the xylR or araR gene, is the strain IFP 967 registered on June 13, 2022 under the deposit number LMG P- 32702 with the BCCM-LMG collection.

17. Kit for producing a solvent, a sugar or a biosourced molecule using a bacterium belonging to the genus Clostridium characterized in that it does not express the products of the xylR and araR genes, or expresses non-functional versions thereof, comprising a genetically modified bacterium belonging to the genus Clostridium according to claim 1 and a medium for preserving said bacterium.

Images