Biallelic knockout of angptl3

Abstract

RNA molecules comprising a guide sequence portion consisting of 17-50 nucleotides and containing 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347, and compositions, methods, and uses thereof.

Description

BIALLELIC KNOCKOUT OF ANGPTL3

[0001] This application claims the benefit of U.S. Provisional Application No.63 / 492,808, filed March 29, 2023, U.S. Provisional Application No. 63 / 385,944, filed December 2, 2022, and U.S. Provisional Application No.63 / 368,926, filed July 20, 2022, the content of each of which is hereby incorporated by reference.

[0002] Throughout this application, various publications are referenced, including referenced in parenthesis. The disclosures of all publications mentioned in this application in their entireties are hereby incorporated by reference into this application in order to provide additional description of the art to which this invention pertains and of the features in the art which can be employed with this invention. REFERENCE TO SEQUENCE LISTING

[0003] This application incorporates-by-reference nucleotide sequences which are present in the file named “230720_91943-A-PCT_Sequence_Listing_AWG.xml”, which is 18,030,806 bytes in size, and which was created on July 20, 2023 in the IBM-PC machine format, having an operating system compatibility with MS-Windows, which is contained in the XML file filed July 20, 2023 as part of this application. BACKGROUND OF INVENTION

[0004] Treatment of several lipid metabolism disorders, including familial hypercholesterolemia (FH), hypertriglyceridemia, and hyperlipidemia, may benefit from targeted gene therapy. More specifically, familial hypercholesterolemia (FH) is a hereditary disease primarily due to mutations in the low-density lipoprotein receptor (LDLR) that lead to elevated cholesterol and premature development of cardiovascular disease. Hypertriglyceridemia is a lipid metabolism disorder that is characterized by high blood levels of triglycerides. It can cause atherosclerosis and other life- endangering disorders, even with normal cholesterol levels. Hyperlipidemia is another example of a lipid metabolism disorder that is characterized by elevated levels of any or all lipids and / or lipoproteins in the blood. A simple and specific gene therapy approach would improve treatment options for each of these disorders. Additionally, since high triglyceride levels suppress insulin release, such an approach may also be utilized to treat symptoms of type II diabetes.

[0005] Angiopoietin-like protein 3 (ANGPTL3) is a secretory protein with a role in lipid level regulation in plasma. Upon secretion, ANGPTL3 binds to lipoprotein lipase (LPL) and endothelial lipase (LIPG), thereby affecting hydrolysis of triglycerides and phospholipids. Thus, in healthy individuals ANGPTL3 serves as an inhibitor of lipoprotein-lipase.

[0006] ANGPTL3-deficiency due to loss-of-function mutations in the ANGPTL3 gene leads to a condition termed “familial combined hypobetalipoproteinemia” (FHBL2, OMIM # 605019), which is characterized by low concentration of all major lipoprotein classes in circulation. Indeed, families carrying loss of function mutations in ANGPTL3 were found to have low levels of LDL, VLDL and triglycerides. Accordingly, knockout of wildtype ANGPTL3 is a potential therapeutic target for treatment of combined hyperlipidemia, with a potential for reduction of plasma lipoprotein concentration following a reduction in ANGPTL3 expression.SUMMARY OF THE INVENTION

[0007] Disclosed are approaches for knocking out the ANGPTL3 gene to increase lipid metabolism, thereby treating disorders including hypertriglyceridemia, hyperlipidemia, and hypercholesterolemia. Accordingly, biallelic knockout of the ANGPTL3 gene in liver cells, for example, hepatocytes, as described herein may be utilized to treat, inhibit, prevent, and / or ameliorate any one of hypertriglyceridemia, hyperlipidemia, and hypercholesterolemia (e.g. familial hypercholesterolemia (FH)).

[0008] The present disclosure also provides a method for inactivating alleles of the angiopoietin- like 3 (ANGPTL3) gene in a cell, the method comprising introducing to the cell a composition comprising: a CRISPR nuclease, or a nucleotide molecule encoding the CRISPR nuclease; and an RNA molecule comprising a guide sequence portion having 17-50 nucleotides, or a DNA molecule encoding the RNA molecule, wherein a complex of the CRISPR nuclease and the RNA molecule affects a double strand break in the allele of the ANGPTL3 gene.

[0009] According to embodiments of the present invention, there is provided an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347.

[0010] According to some embodiments of the present invention, there is provided a composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0011] According to some embodiments of the present invention, there is provided a method for inactivating a ANGPTL3 allele in a cell, the method comprising delivering to the cell a composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0012] In some embodiments the cell is a liver cell. In some embodiments the cell is a hepatocyte. In some embodiments the cell is a stem cell. In some embodiments, the delivering to the cell isperformed in vivo, ex vivo, or in vitro. In some embodiments, the delivery to the cell is performed by in vivo delivery of a lentivirus, adeno-associated virus (AAV) or nanoparticle to the liver. In some embodiments, the method is performed ex vivo and the cell is provided / explanted from an individual patient. In some embodiments, the method further comprises the step of introducing the resulting cell, with the modified / knocked out ANGPTL3 allele, into the individual patient.

[0013] According to some embodiments of the present invention, there is provided a method for treating and / or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, the method comprising delivering to a cell of a subject having or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia a composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0014] According to some embodiments of the present invention, there is provided use of a composition comprising an RNA molecule comprising a guide sequence portion consisting of 17- 50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease for inactivating a ANGPTL3 allele in a cell, comprising delivering to the cell the composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0015] According to embodiments of the present invention, there is provided a medicament comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease for use in inactivating a ANGPTL3 allele in a cell, wherein the medicament is administered by delivering to the cell the composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0016] According to some embodiments of the present invention, there is provided use of a composition comprising an RNA molecule comprising a guide sequence portion consisting of 17- 50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease for treating, ameliorating, or preventinghypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, comprising delivering to a cell of a subject having or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia the composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0017] In some embodiments, the method is performed in vivo and the cell is a liver cell, for example, a hepatocyte.

[0018] In some embodiments, the composition is delivered to a cell in vivo by lipid nanoparticle delivery, lentivirus delivery, or AAV delivery.

[0019] According to some embodiments of the present invention, there is provided a medicament comprising the composition comprising an RNA molecule comprising a guide sequence portion having 17-50 contiguous nucleotides containing nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease for use in treating, ameliorating, or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, wherein the medicament is administered by delivering to a cell of a subject having or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia the composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0020] According to some embodiments of the present invention, there is provided a kit for inactivating a ANGPTL3 allele in a cell, comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347, a CRISPR nuclease, and / or a tracrRNA molecule; and instructions for delivering the RNA molecule; CRISPR nuclease, and / or the tracrRNA to the cell.

[0021] According to some embodiments of the present invention, there is provided a kit for treating hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia in a subject, comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347, a CRISPR nuclease, and / or a tracrRNA molecule; and instructions for delivering the RNA molecule;CRISPR nuclease, and / or the tracrRNA to a cell of a subject having or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figs. 1A-1B: Transfection-based guide screen in HeLa cells of guides targeting ANGPTL3 Exon 1, Exon 2, Exon 3, and Exon 4 with either OMNI-103 nuclease (Fig. 1A) or OMNI-159 nuclease (Fig.1B). Table A and Table B below provide details of guide sequences and nucleases utilized in the screen. Additional description of the OMNI-159 nuclease (SEQ ID NO: 20353) is provided in PCT International Application Publication No. WO 2023 / 019269 and additional description of the OMNI-103 nuclease (SEQ ID NO: 20354) is provided in PCT International Application Publication No. WO 2022 / 170199, the content of each of which are hereby incorporated by reference. Table A: OMNI CRISPR nucleases, PAM requirements, and sgRNA scaffold sequencesTable B: ANGPTL3-targeting guide sequence portions and CRISPR nucleases utilized

[0023] Figs. 2A-2D: sgRNAs targeting the first exon in the ANGPTL3 gene were screened for high on-target activity in Huh-7 cells using OMNI-103 CRISPR nuclease. A diagram showing the target sites of each of tested sgRNAs, which are listed in Table C below, is shown in Fig. 2A. Measurement of the percent (%) editing for each of the sgRNAs is shown in Fig. 2B. qRT-PCR measurement of ANGPTL3 mRNA levels in cells treated with each sgRNA is shown in Fig. 2C. ELISA measurement of ANGPTL3 secreted protein levels in cells treated with each sgRNA is shown in Fig.2D. Table C: ANGPTL3-targeting guide sequence portions of sgRNAs as shown in Figs.2A- 2D

[0024] Figs. 3A-3C: sgRNAs were used to target the mouse ANGPTL3 gene using OMNI-103 CRISPR nuclease in vivo. Details of each of tested sgRNAs are listed in Table D below. Measurement of the percent (%) editing for each of the sgRNAs is shown in Fig. 3A. qRT-PCR measurement of ANGPTL3 mRNA levels in mice treated with each sgRNA is shown in Fig.3B. ELISA measurement of ANGPTL3 secreted protein levels in mice treated with each sgRNA is shown in Fig.3C. Table D: Mouse ANGPTL3-targeting guide sequence portions of sgRNAs as shown in Figs.3A-3CDETAILED DESCRIPTION

[0025] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

[0026] It should be understood that the terms “a” and “an” as used above and elsewhere herein refer to “one or more” of the enumerated components. It will be clear to one of ordinary skill in the art that the use of the singular includes the plural unless specifically stated otherwise. Therefore, the terms “a,” “an” and “at least one” are used interchangeably in this application.

[0027] For purposes of better understanding the present teachings and in no way limiting the scope of the teachings, unless otherwise indicated, all numbers expressing quantities, percentages or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0028] Unless otherwise stated, adjectives such as “substantially” and “about” modifying a condition or relationship characteristic of a feature or features of an embodiment of the invention, are understood to mean that the condition or characteristic is defined to within tolerances that are acceptable for operation of the embodiment for an application for which it is intended. Unless otherwise indicated, the word “or” in the specification and claims is considered to be the inclusive “or” rather than the exclusive or, and indicates at least one of, or any combination of items it conjoins.

[0029] In the description and claims of the present application, each of the verbs, “comprise,” “include” and “have” and conjugates thereof, are used to indicate that the object or objects of the verb are not necessarily a complete listing of components, elements or parts of the subject orsubjects of the verb. Other terms as used herein are meant to be defined by their well-known meanings in the art.

[0030] In some embodiments of the present invention, a DNA nuclease is utilized to affect a DNA break at a target site to induce cellular repair mechanisms, for example, but not limited to, non- homologous end-joining (NHEJ). During classical NHEJ, two ends of a double-strand break (DSB) site are ligated together in a fast but also inaccurate manner (i.e. frequently resulting in mutation of the DNA at the cleavage site in the form of small insertion or deletions).

[0031] As used herein, the term “modified cells” refers to cells in which a double strand break is affected by a complex of an RNA molecule and the CRISPR nuclease as a result of hybridization with the target sequence, i.e. on-target hybridization.

[0032] As used herein, the term “targeting sequence” or “targeting molecule” refers a nucleotide sequence or molecule comprising a nucleotide sequence that is capable of hybridizing to a specific target sequence, e.g., the targeting sequence has a nucleotide sequence which is at least partially complementary to the sequence being targeted along the length of the targeting sequence. The targeting sequence or targeting molecule may be part of an RNA molecule that can form a complex with a CRISPR nuclease, either alone or in combination with other RNA molecules, with the targeting sequence serving as the targeting portion of the CRISPR complex. When the molecule having the targeting sequence is present contemporaneously with the CRISPR molecule, the RNA molecule, alone or in combination with an additional one or more RNA molecules (e.g. a tracrRNA molecule), is capable of targeting the CRISPR nuclease to the specific target sequence. As non- limiting example, a guide sequence portion of a CRISPR RNA molecule or single-guide RNA molecule may serve as a targeting molecule. Each possibility represents a separate embodiment. A targeting sequence can be custom designed to target any desired sequence.

[0033] The term “targets” as used herein, refers to preferentially hybridizing a targeting sequence of a targeting molecule to a nucleic acid having a targeted nucleotide sequence. It is understood that the term “targets” encompasses variable hybridization efficiencies, such that there is preferential targeting of the nucleic acid having the targeted nucleotide sequence, but unintentional off-target hybridization in addition to on-target hybridization might also occur. It is understood that where an RNA molecule targets a sequence, a complex of the RNA molecule and a CRISPR nuclease molecule targets the sequence for nuclease activity.

[0034] The “guide sequence portion” of an RNA molecule refers to a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, e.g., the guide sequence portion has anucleotide sequence which is partially or fully complementary to the DNA sequence being targeted along the length of the guide sequence portion. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides in length, or approximately 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-39, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-22, 17-21, 18-25, 18-24, 18-23, 18-22, 18-21, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-22, 18-20, 20-21, 21-22, or 17-20 nucleotides in length. In some embodiments, the entire length of the guide sequence portion is fully complementary to the DNA sequence being targeted along the length of the guide sequence portion. The guide sequence portion may be part of an RNA molecule that can form a complex with a CRISPR nuclease with the guide sequence portion serving as the DNA targeting portion of the CRISPR complex. When the RNA molecule having the guide sequence portion is present contemporaneously with the CRISPR molecule, alone or in combination with an additional one or more RNA molecules (e.g. a tracrRNA molecule), the RNA molecule is capable of targeting the CRISPR nuclease to the specific target DNA sequence. Accordingly, a CRISPR complex can be formed by direct binding of the RNA molecule having the guide sequence portion to a CRISPR nuclease or by binding of the RNA molecule having the guide sequence portion and an additional one or more RNA molecules to the CRISPR nuclease. Each possibility represents a separate embodiment. A guide sequence portion can be custom designed to target any desired sequence. Accordingly, a molecule comprising a “guide sequence portion” is a type of targeting molecule. In some embodiments, the guide sequence portion comprises a sequence that is the same as, or differs by no more than 1, 2, 3, 4, or 5 nucleotides from, a guide sequence portion described herein, e.g., a guide sequence set forth in any of SEQ ID NOs: 1-20347. Each possibility represents a separate embodiment. In some of these embodiments, the guide sequence portion comprises a sequence that is the same as a sequence set forth in any of SEQ ID NOs: 1-20347. Throughout this application, the terms “guide molecule,” “RNA guide molecule,” “guide RNA molecule,” and “gRNA molecule" are synonymous with a molecule comprising a guide sequence portion.

[0035] The term “non-discriminatory” as used herein refers to a guide sequence portion of an RNA molecule that targets a specific DNA sequence that is common to all alleles of a gene.

[0036] In embodiments of the present invention, an RNA molecule comprises a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347.

[0037] The RNA molecule and or the guide sequence portion of the RNA molecule may contain modified nucleotides. Exemplary modifications to nucleotides / polynucleotides may be synthetic and encompass polynucleotides which contain nucleotides comprising bases other than the naturally occurring adenine, cytosine, thymine, uracil, or guanine bases. Modifications to polynucleotides include polynucleotides which contain synthetic, non-naturally occurring nucleosides e.g., locked nucleic acids. Modifications to polynucleotides may be utilized to increase or decrease stability of an RNA. An example of a modified polynucleotide is an mRNA containing 1-methyl pseudo- uridine. For examples of modified polynucleotides and their uses, see U.S. Patent 8,278,036, PCT International Publication No. WO / 2015 / 006747, and Weissman and Kariko (2015), each of which is hereby incorporated by reference.

[0038] As used herein, “contiguous nucleotides” set forth in a SEQ ID NO refers to nucleotides in a sequence of nucleotides in the order set forth in the SEQ ID NO without any intervening nucleotides.

[0039] In embodiments of the present invention, the guide sequence portion may be 50 nucleotides in length and contain 20-22 contiguous nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347. In embodiments of the present invention, the guide sequence portion may be less than 22 nucleotides in length. For example, in embodiments of the present invention the guide sequence portion may be 17, 18, 19, 20, or 21 nucleotides in length. In such embodiments the guide sequence portion may consist of 17, 18, 19, 20, or 21 nucleotides, respectively, in the sequence of 17-22 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-20347. For example, a guide sequence portion having 17 nucleotides in the sequence of 17 contiguous nucleotides set forth in SEQ ID NO: 20348 may consist of any one of the following nucleotide sequences (nucleotides excluded from the contiguous sequence are marked in strike-through):AAAAAAAUGUACUUGGUUCC (SEQ ID NO: 20348) 17 nucleotide guide sequence 1: AAAAAAAUGUACUUGGUUCC (SEQ ID NO: 20349) 17 nucleotide guide sequence 2: AAAAAAAUGUACUUGGUUCC (SEQ ID NO: 20350) 17 nucleotide guide sequence 3: AAAAAAAUGUACUUGGUUCC (SEQ ID NO: 20351) 17 nucleotide guide sequence 4: AAAAAAAUGUACUUGGUUCC (SEQ ID NO: 20352)

[0040] In embodiments of the present invention, the guide sequence portion may be greater than 20 nucleotides in length. For example, in embodiments of the present invention the guide sequence portion may be 21, 22, 23, 24 or 25 nucleotides in length. In such embodiments, the guide sequence portion may comprise 17-50 nucleotides containing a sequence of 20, 21, or 22 contiguous nucleotides set forth in any one of SEQ ID NOs: 1-20347 and additional nucleotides fully complimentary to a nucleotide or sequence of nucleotides adjacent to the 3’ end of the target sequence, 5’ end of the target sequence, or both.

[0041] In embodiments of the present invention a CRISPR nuclease and an RNA molecule comprising a guide sequence portion form a CRISPR complex that binds to a target DNA sequence to effect cleavage of the target DNA sequence. CRISPR nucleases, e.g. Cpf1, may form a CRISPR complex comprising a CRISPR nuclease and RNA molecule without a further tracrRNA molecule. Alternatively, CRISPR nucleases, e.g. Cas9, may form a CRISPR complex between the CRISPR nuclease, an RNA molecule, and a tracrRNA molecule. A guide sequence portion, which comprises a nucleotide sequence that is capable of hybridizing to a specific target DNA sequence, and a sequence portion that participates in CRIPSR nuclease binding, e.g. a tracrRNA sequence portion, can be located on the same RNA molecule. Alternatively, a guide sequence portion may be located on one RNA molecule and a sequence portion that participates in CRIPSR nuclease binding, e.g. a tracrRNA portion, may located on a separate RNA molecule. A single RNA molecule comprising a guide sequence portion (e.g. a DNA-targeting RNA sequence) and at least one CRISPR protein- binding RNA sequence portion (e.g. a tracrRNA sequence portion), can form a complex with a CRISPR nuclease and serve as the DNA-targeting molecule. In some embodiments, a first RNA molecule comprising a DNA-targeting RNA portion, which includes a guide sequence portion, and a second RNA molecule comprising a CRISPR protein-binding RNA sequence interact by base pairing to form an RNA complex that targets the CRISPR nuclease to a DNA target site or,alternatively, are fused together to form an RNA molecule that complexes with the CRISPR nuclease and targets the CRISPR nuclease to a DNA target site.

[0042] In embodiments of the present invention, an RNA molecule comprising a guide sequence portion may further comprise the sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of the guide portion of the RNA molecule and the trans-activating crRNA (tracrRNA). (See Jinek et al., 2012). In such an embodiment, the RNA molecule is a single- guide RNA (sgRNA) molecule. Embodiments of the present invention may also form CRISPR complexes utilizing a separate tracrRNA molecule and a separate RNA molecule comprising a guide sequence portion. In such embodiments the tracrRNA molecule may hybridize with the RNA molecule via basepairing and may be advantageous in certain applications of the invention described herein.

[0043] The term “tracr mate sequence” refers to a sequence sufficiently complementary to a tracrRNA molecule so as to hybridize to the tracrRNA via basepairing and promote the formation of a CRISPR complex. (See U.S. Patent No. 8,906,616). In embodiments of the present invention, the RNA molecule may further comprise a portion having a tracr mate sequence.

[0044] A "gene," for the purposes of the present disclosure, includes a DNA region encoding a gene product, as well as all DNA regions which regulate the production of the gene product, whether or not such regulatory sequences are adjacent to coding and / or transcribed sequences. Accordingly, a gene includes, but is not necessarily limited to, promoter sequences, terminators, translational regulatory sequences such as ribosome binding sites and internal ribosome entry sites, enhancers, silencers, insulators, boundary elements, replication origins, matrix attachment sites and locus control regions.

[0045] "Eukaryotic" cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells and human cells.

[0046] The term "nuclease" as used herein refers to an enzyme capable of cleaving the phosphodiester bonds between the nucleotide subunits of nucleic acid. A nuclease may be isolated or derived from a natural source. The natural source may be any living organism. Alternatively, a nuclease may be a modified or a synthetic protein which retains the phosphodiester bond cleaving activity. Gene modification can be achieved using a nuclease, for example a CRISPR nuclease.

[0047] According to embodiments of the present invention, there is provided an RNA molecule comprising a guide sequence portion (e.g. a targeting sequence) comprising a nucleotide sequence that is fully or partially complementary to a target sequence of the ANGPTL3 gene. In some embodiments, the guide sequence portion is fully or partially complementary to a target sequence located in or up to 30 nucleotides upstream or downstream to an exon of the ANGPTL3 gene. In some embodiments, the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides. In some embodiments the guide sequence portion is configured to target a CRISPR nuclease to a target sequence and provide a cleavage event, by a CRISPR nuclease complexed therewith, selected from a double-strand break and a single- strand break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of a ANGPTL3 target site. In some embodiments, the cleavage event enables non-sense mediated decay of the ANGPTL3 gene. In some embodiments, the RNA molecule is a guide RNA molecule such as a crRNA molecule or a single-guide RNA molecule.

[0048] In some embodiments, the target sequence of an allele of ANGPTL3 gene is altered (e.g., by introduction of an NHEJ-mediated indel (e.g., insertion or deletion), and results in reduction or elimination of expression of the gene product encoded by the allele of ANGPTL3 gene. In some embodiments, the reduction or elimination of expression is due to non-sense mediated mRNA decay such as due to immature stop codon. In some embodiments, the reduction or elimination of expression is due to expression of a truncated form of the ANGPTL3 gene product.

[0049] According to embodiments of the present invention, there is provided an RNA molecule comprising a guide sequence portion (e.g. a targeting sequence) comprising a nucleotide sequence that is fully or partially complementary to a target sequence located in or near the ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, or Exon 7 of the ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, or Exon 7 of the ANGPTL3 gene. Each possibility represents a separate embodiment. In some embodiments, the target sequence of ANGPTL3 gene is altered (e.g., by introduction of an NHEJ-mediated insertion or deletion), and results in reduction or elimination of expression of the gene product encoded by the ANGPTL3 gene. In some embodiments, the reduction or elimination of expression is due to non-sense mediated mRNA decay. In some embodiments, the guide sequence portion of the RNA molecule consists of16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides. In some embodiments the guide sequence portion is configured to target a CRISPR nuclease to a target sequence and provide a cleavage event, by a CRISPR nuclease complexed therewith, selected from a double-strand break and a single-strand break within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of a ANGPTL3 target site. In some embodiments, the cleavage event enables non-sense mediated decay of the ANGPTL3 gene. In some embodiments, the RNA molecule is a guide RNA molecule such as a crRNA molecule or a single-guide RNA molecule.

[0050] In some embodiments, the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of an exon of the ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of an exon of the ANGPTL3 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of an exon of the ANGPTL3 gene.

[0051] In some embodiments, the exon is Exon 1 and the guide sequence portion comprises 17- 22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 6333-9188.

[0052] In some embodiments, the exon is Exon 2 and the guide sequence portion comprises 17- 22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9189-9978.

[0053] In some embodiments, the exon is Exon 3 and the guide sequence portion comprises 17- 22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9979-10786.

[0054] In some embodiments, the exon is Exon 4 and the guide sequence portion comprises 17- 22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 10787-11633.

[0055] In some embodiments, the exon is Exon 5 and the guide sequence portion comprises 17- 22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 11634-12384.

[0056] In some embodiments, the exon is Exon 6 and the guide sequence portion comprises 17- 22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 12385-14057.

[0057] In some embodiments, the exon is Exon 7 and the guide sequence portion comprises a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 1-6332 and 14058-15412.

[0058] According to embodiments of the present invention, there is provided a method for inactivating at least one allele of the angiopoietin-like 3 (ANGPTL3) gene in a cell, the method comprising introducing to the cell a composition comprising: at least one CRISPR nuclease, or a nucleotide molecule encoding a CRISPR nuclease; and an RNA molecule comprising a guide sequence portion, or a DNA molecule encoding the RNA molecule, wherein a complex of the CRISPR nuclease and the RNA molecule affects a double strand break in at least one allele of the ANGPTL3 gene, wherein the guide sequence portion of the RNA molecule consists of 17-50 contiguous nucleotides.

[0059] In some embodiments, the RNA molecule comprising a guide sequence portion is a crRNA molecule or a sgRNA molecule. In some embodiments, the RNA molecule is a crRNA molecule and the composition further comprises a tracrRNA molecule which forms a complex with the crRNA molecule.

[0060] In some embodiments, the composition is introduced to a cell in a subject or to a cell in culture.

[0061] In some embodiments, the cell is a liver cell, preferably a hepatocyte. In some embodiments, the cell is a stem cell.

[0062] In some embodiments, the CRISPR nuclease and the RNA molecule are introduced to the cell at substantially the same time or at different times.

[0063] In some embodiments, alleles of the ANGPTL3 gene in the cell are subjected to an insertion or deletion mutation.

[0064] In some embodiments, the insertion or deletion mutation creates an early stop codon.

[0065] In some embodiments, the inactivating results in a truncated protein encoded by the inactivated allele.

[0066] In some embodiments, guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, or Exon 7 of the ANGPTL3 gene.

[0067] In some embodiments, the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of an exon of the ANGPTL3 gene, and a) the exon is Exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 6333-9188; b) the exon is Exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9189-9978; c) the exon is Exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9979-10786; d) the exon is Exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 10787-11633; e) the exon is Exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 11634-12384; f) the exon is Exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 12385-14057; org) the exon is Exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 1-6332 and 14058-15412.

[0068] In some embodiments, the guide sequence portion consists of 17-50 contiguous nucleotides and comprises 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347, or differs by no more than 3 nucleotides from a sequence set forth in any one of SEQ ID NOs: 1-20347.

[0069] According to embodiments of the present invention, there is provided a composition comprising an RNA molecule comprising a guide sequence portion which consists of 17-50 contiguous nucleotides and comprises 17-22 nucleotides in a sequence set forth in any one of SEQ ID NOs: 1-20347, or differs by no more than 3 nucleotides from a sequence set forth in any one of SEQ ID NOs: 1-20347.

[0070] In some embodiments, the guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, or Exon 7 of the ANGPTL3 gene.

[0071] In some embodiments, the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of an exon of the ANGPTL3 gene, and a) the exon is Exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 6333-9188; b) the exon is Exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9189-9978; c) the exon is Exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9979-10786; d) the exon is Exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 10787-11633;e) the exon is Exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 11634-12384; f) the exon is Exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 12385-14057; or g) the exon is Exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 1-6332 and 14058-15412.

[0072] In some embodiments, the composition further comprises a CRISPR nuclease.

[0073] In some embodiments, the composition further comprises a transactivating CRISPR RNA (tracrRNA) molecule.

[0074] In some embodiments, the CRISPR nuclease and RNA molecule form a complex, or the CRISPR nuclease, RNA molecule, and tracrRNA molecule form a complex.

[0075] According to embodiments of the present invention, there is provided a medicament comprising any one of the compositions described herein for use in inactivating a ANGPTL3 allele in a cell, wherein the medicament is administered by delivering to the composition to the cell.

[0076] According to embodiments of the present invention, there is provided use of any one of the compositions described herein for treating, ameliorating, or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, comprising delivering the composition to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

[0077] According to embodiments of the present invention, there is provided a medicament comprising any one of the compositions described herein for treating, ameliorating, or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, such that the medicament is administered by delivering the composition to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

[0078] According to embodiments of the present invention, there is provided a kit for inactivating a ANGPTL3 allele in a cell, comprising any one of the compositions described herein and instructions for delivering the composition to the cell.

[0079] According to embodiments of the present invention, there is provided a kit for treating or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia in a subject, comprising any one of the compositions described herein and instructions for delivering the composition to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

[0080] According to embodiments of the present invention, there is provided any one of the compositions described herein for use in ameliorating, or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

[0081] According to embodiments of the present invention, there is provided a method of treating hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia in a subject, the method comprising administering any one of the compositions described herein to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

[0082] According to embodiments of the present invention, there is provided a gene editing composition comprising an RNA molecule comprising a guide sequence portion consisting of 17- 50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347. In some embodiments, the RNA molecule further comprises a portion having a sequence which binds to a CRISPR nuclease. In some embodiments, the sequence which binds to a CRISPR nuclease is a tracrRNA sequence.

[0083] In some embodiments, the RNA molecule further comprises a portion having a tracr mate sequence.

[0084] In some embodiments, the RNA molecule may further comprise one or more linker portions.

[0085] According to embodiments of the present invention, an RNA molecule may be up to 1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, or 100 nucleotides in length. Each possibility represents a separate embodiment. In embodiments of the present invention, the RNA molecule may be 17 upto 300 nucleotides in length, 100 up to 300 nucleotides in length, 150 up to 300 nucleotides in length, 100 up to 500 nucleotides in length, 100 up to 400 nucleotides in length, 200 up to 300 nucleotides in length, 100 to 200 nucleotides in length, or 150 up to 250 nucleotides in length. Each possibility represents a separate embodiment.

[0086] According to some embodiments of the present invention, there is provided a method for inactivating ANGPTL3 expression in a cell, the method comprising delivering to the cell a composition comprising an RNA molecule comprising a guide sequence portion consisting of 17- 50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0087] According to some embodiments of the present invention, there is provided a method for preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, the method comprising delivering to a cell of a subject a composition comprising an RNA molecule comprising a guide sequence portion consisting of 17-50 contiguous nucleotides and comprising 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 and a CRISPR nuclease.

[0088] According to embodiments of the present invention, at least one CRISPR nuclease and at least one RNA molecule comprising a guide sequence portion are delivered to the subject and / or cells substantially at the same time or at different times.

[0089] In some embodiments, a tracrRNA molecule is delivered to the subject and / or cells substantially at the same time or at different times as the at least one CRISPR nuclease and the at least one RNA molecule comprising a guide sequence portion.

[0090] The compositions and methods of the present disclosure may be utilized for treating, preventing, ameliorating, or slowing progression of hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

[0091] Any one of, or combination of, the above-mentioned strategies for deactivating ANGPTL3 expression may be used in the context of the invention.

[0092] In embodiments of the present invention, an RNA molecule is used to direct a CRISPR nuclease to an exon or a splice site of a ANGPTL3 allele in order to create a double-stranded break (DSB), leading to insertion or deletion of one or more nucleotides by inducing an error-prone non- homologous end-joining (NHEJ) mechanism and thus formation of a frameshift mutation in theANGPTL3 allele. The frameshift mutation may result in, for example, inactivation or knockout of the ANGPTL3 allele by generation of an early stop codon in the ANGPTL3 allele and to generation of a truncated protein or to nonsense-mediated mRNA decay of the transcript of the allele. In further embodiments, one RNA molecule is used to direct a CRISPR nuclease to a promotor of a ANGPTL3 allele.

[0093] In some embodiments, the method is utilized for treating a subject at risk for hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia. In such embodiments, the method results in improvement, amelioration, or prevention of a disease phenotype by reducing or eliminating expression of ANGPTL3.

[0094] Embodiments of compositions described herein include at least one CRISPR nuclease, at least RNA molecule comprising a guide sequence portion, and a tracrRNA molecule, being effective in a subject or cells at the same time. The at least one CRISPR nuclease, at least RNA molecule comprising a guide sequence portion, and tracrRNA molecule may be delivered substantially at the same time or can be delivered at different times but have effect at the same time. For example, this includes delivering the CRISPR nuclease to the subject or cells before the RNA guide molecule and / or tracrRNA is substantially extant in the subject or cells.

[0095] In some embodiments, a human cell is modified by any one of the methods described herein. In some embodiments, the cell is a liver cell. In some embodiments the cell is a hepatocyte. In some embodiments the cell is a stem cell. ANGPTL3 Knockout Strategies

[0096] The present invention provides methods to knockout ANGPTL3 alleles in cells of a subject, preferably liver cells, e.g. hepatocytes, thereby preventing inhibition of lipid metabolism without causing harm to the subject. The provided methods to knockout ANGPTL3 alleles in a cell may be used to treat, prevent, or ameliorate any one of hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

[0097] ANGPTL3 knockout strategies include, but are not limited to biallelic knockout by targeting any one of, or a combination of, ANGPTL3 Exons 1-7, including within thirty nucleotides upstream and downstream of the exons in order to flank splice donor and acceptor sites. Frameshift mutations in these exons lead to non-functional, truncated ANGPTL3 proteins or non-sense mediated decay (NMD) of mutated ANGPTL3 transcripts. For example, an RNA molecule comprising a guide sequence portion that contains 17-24 nucleotides in a sequence present in anyone of SEQ ID NOs: 1-20347 may be used to target a CRISPR nuclease to a ANGPTL3 target site and induce a double-strand DNA break leading to non-functional, truncated ANGPTL3 proteins or non-sense mediated decay (NMD) of mutated ANGPTL3 transcripts. CRISPR nucleases and PAM recognition

[0098] In some embodiments, the sequence specific nuclease is selected from CRISPR nucleases, or is a functional variant thereof. In some embodiments, the sequence specific nuclease is an RNA- guided DNA nuclease. In such embodiments, the RNA sequence which guides the RNA-guided DNA nuclease (e.g., Cpf1) binds to and / or directs the RNA-guided DNA nuclease to all ANGPTL3 alleles in a cell. In some embodiments, the CRISPR complex does not further comprise a tracrRNA. In a non-limiting example, in which the RNA-guided DNA nuclease is a CRISPR protein, the at least one nucleotide which differs between the dominant ANGPTL3 allele and the functional allele may be within the PAM site and / or proximal to the PAM site within the region that the RNA molecule is designed to hybridize to. A skilled artisan will appreciate that RNA molecules can be engineered to bind to a target of choice in a genome by commonly known methods in the art. In some embodiments, the RNA-guided DNA nuclease is a portion of a fusion protein. In a non- limiting example, the RNA-guided DNA nuclease is linked to a second enzyme, e.g. a reverse transcriptase. In some embodiments, the RNA-guided DNA nuclease is a nickase that forms a single-strand DNA break.

[0099] The term “PAM” as used herein refers to a nucleotide sequence of a target DNA located in proximity to the targeted DNA sequence and recognized by the CRISPR nuclease complex. The PAM sequence may differ depending on the nuclease identity. In addition, there are CRISPR nucleases that can target almost all PAMs. In some embodiments of the present invention, a CRISPR system utilizes one or more RNA molecules having a guide sequence portion to direct a CRISPR nuclease to a target DNA site via Watson-Crick base-pairing between the guide sequence portion and the protospacer on the target DNA site, which is next to the protospacer adjacent motif (PAM), which is an additional requirement for target recognition. The CRISPR nuclease then mediates cleavage of the target DNA site to create a double-stranded break within the protospacer. In a non-limiting example, a type II CRISPR system utilizes a mature crRNA:tracrRNA complex that directs the CRISPR nuclease, e.g. Cas9 to the target DNA the target DNA via Watson-Crick base-pairing between the guide sequence portion of the crRNA and the protospacer on the target DNA next to the protospacer adjacent motif (PAM). A skilled artisan will appreciate that each of the engineered RNA molecule of the present invention is further designed such as to associate witha target genomic DNA sequence of interest next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence relevant for the type of CRISPR nuclease utilized, such as for a non- limiting example, NGG or NAG, wherein “N” is any nucleobase, for Streptococcus pyogenes Cas9 WT (SpCAS9); NNGRRT for Staphylococcus aureus (SaCas9); NNNVRYM for Jejuni Cas9 WT; NGAN or NGNG for SpCas9-VQR variant; NGCG for SpCas9-VRER variant; NGAG for SpCas9- EQR variant; NRRH for SpCas9-NRRH variant, wherein N is any nucleobase, R is A or G and H is A, C, or T; NRTH for SpCas9-NRTH variant, wherein N is any nucleobase, R is A or G and H is A, C, or T; NRCH for SpCas9-NRCH variant, wherein N is any nucleobase, R is A or G and H is A, C, or T; NG for SpG variant of SpCas9 wherein N is any nucleobase; NG or NA for SpCas9- NG variant of SpCas9 wherein N is any nucleobase; NR or NRN or NYN for SpRY variant of SpCas9, wherein N is any nucleobase, R is A or G and Y is C or T; NNG for Streptococcus canis Cas9 variant (ScCas9), wherein N is any nucleobase; NNNRRT for SaKKH-Cas9 variant of Staphylococcus aureus (SaCas9), wherein N is any nucleobase, and R is A or G; NNNNGATT for Neisseria meningitidis (NmCas9) , wherein N is any nucleobase; TTN for Alicyclobacillus acidiphilus Cas12b (AacCas12b) , wherein N is any nucleobase; or TTTV for Cpfl, wherein V is A, C or G. RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized.

[0100] In some embodiments, an RNA-guided DNA nuclease e.g., a CRISPR nuclease, may be used to cause a DNA break, either double or single-stranded in nature, at a desired location in the genome of a cell. The most commonly used RNA-guided DNA nucleases are derived from CRISPR systems, however, other RNA-guided DNA nucleases are also contemplated for use in the genome editing compositions and methods described herein. For instance, see U.S. Publication No. 2015 / 0211023, incorporated herein by reference.

[0101] CRISPR systems that may be used in the practice of the invention vary greatly. CRISPR systems can be a type I, a type II, or a type III system. Non- limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, Casl0, Casl Od, CasF, CasG, CasH, Csyl , Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl , Csb2, Csb3,Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966.

[0102] In some embodiments, the RNA-guided DNA nuclease is a CRISPR nuclease derived from a type II CRISPR system (e.g., Cas9). The CRISPR nuclease may be derived from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Neisseria meningitidis, Treponema denticola, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difjicile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculumthermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, or any species which encodes a CRISPR nuclease with a known PAM sequence. CRISPR nucleases encoded by uncultured bacteria may also be used in the context of the invention. (See Burstein et al. Nature, 2017). Variants of CRIPSR proteins having known PAM sequences e.g., SpCas9 D1135E variant, SpCas9 VQR variant, SpCas9 EQR variant, or SpCas9 VRER variant may also be used in the context of the invention.

[0103] Thus, an RNA-guided DNA nuclease of a CRISPR system, such as a Cas9 protein or modified Cas9 or homolog or ortholog of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs and orthologs, may be used in the compositions of the present invention. Additional CRISPR nucleases may also be used, for example, the nucleases described in PCT International Application Publication Nos. WO2020 / 223514 and WO2020 / 223553, each of which are hereby incorporated by reference.

[0104] In certain embodiments, the CRIPSR nuclease may be a "functional derivative" of a naturally occurring Cas protein. A "functional derivative" of a native sequence polypeptide is a compound having a qualitative biological property in common with a native sequence polypeptide. "Functional derivatives" include, but are not limited to, fragments of a native sequence andderivatives of a native sequence polypeptide and its fragments, provided that they have a biological activity in common with a corresponding native sequence polypeptide. A biological activity contemplated herein is the ability of the functional derivative to hydrolyze a DNA substrate into fragments. The term "derivative" encompasses both amino acid sequence variants of polypeptide, covalent modifications, and fusions thereof. Suitable derivatives of a Cas polypeptide or a fragment thereof include but are not limited to mutants, fusions, covalent modifications of Cas protein or a fragment thereof. Cas protein, which includes Cas protein or a fragment thereof, as well as derivatives of Cas protein or a fragment thereof, may be obtainable from a cell or synthesized chemically or by a combination of these two procedures. The cell may be a cell that naturally produces Cas protein, or a cell that naturally produces Cas protein and is genetically engineered to produce the endogenous Cas protein at a higher expression level or to produce a Cas protein from an exogenously introduced nucleic acid, which nucleic acid encodes a Cas that is same or different from the endogenous Cas. In some cases, the cell does not naturally produce Cas protein and is genetically engineered to produce a Cas protein.

[0105] In some embodiments, the CRISPR nuclease is Cpf1. Cpf1 is a single RNA-guided endonuclease which utilizes a T-rich protospacer-adjacent motif. Cpf1 cleaves DNA via a staggered DNA double-stranded break. Two Cpf1 enzymes from Acidaminococcus and Lachnospiraceae have been shown to carry out efficient genome-editing activity in human cells. (See Zetsche et al., 2015).

[0106] Thus, an RNA-guided DNA nuclease of a Type II CRISPR System, such as a Cas9 protein or modified Cas9 or homologs, orthologues, or variants of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homologs, orthologues, or variants, may be used in the present invention.

[0107] In some embodiments, the guide molecule comprises one or more chemical modifications which imparts a new or improved property (e.g., improved stability from degradation, improved hybridization energetics, or improved binding properties with an RNA-guided DNA nuclease). Suitable chemical modifications include, but are not limited to: modified bases, modified sugar moieties, or modified inter-nucleoside linkages. Non-limiting examples of suitable chemical modifications include: 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2’-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2’-O-methylpseudouridine, "beta, D-galactosylqueuosine", 2’-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylpseudouridine, 1-methylguanosine, 1-methylinosine, "2,2-dimethylguanosine", 2-methyladenosine, 2- methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, “beta, D- mannosylqueuosine”, 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-methoxyuridine, 2-methylthio-N6-isopentenyladenosine, N-((9-beta-D-ribofuranosyl-2- methylthiopurine-6-yl)carbamoyl)threonine, N-((9-beta-D-ribofuranosylpurine-6-yl)N- methylcarbamoyl)threonine, uridine-5-oxyacetic acid-methylester, uridine-5-oxyacetic acid, wybutoxosine, queuosine, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5- methyluridine, N-((9-beta-D-ribofuranosylpurine-6-yl)-carbamoyl)threonine, 2’-O-methyl-5- methyluridine, 2’-O-methyluridine, wybutosine, "3-(3-amino-3-carboxy-propyl)uridine, (acp3)u", 2'-0-methyl (M), 3'-phosphorothioate (MS), 3'-thioPACE (MSP), pseudouridine, or 1-methyl pseudo-uridine. Each possibility represents a separate embodiment of the present invention.

[0108] In addition to targeting ANGPTL3 alleles by a RNA-guided CRISPR nuclease, other means of inhibiting ANGPTL3 expression in a target cell, preferably a liver cell such as a hepatocyte, include but are not limited to use of a gapmer, shRNA, siRNA, a customized TALEN, meganuclease, or zinc finger nuclease, a small molecule inhibitor, and any other method known in the art for reducing or eliminating expression of a gene in a target cell. See, for example, U.S. Patent Nos. 6,506,559; 7,560, 438; 8,420,391; 8,552,171; 7,056,704; 7,078,196; 8,362,231; 8,372,968; 9,045,754; and PCT International Publication Nos. WO / 2004 / 067736; WO / 2006 / 097853; WO / 2003 / 087341; WO / 2000 / 041566l; WO / 2003 / 080809; WO / 2010 / 079430; WO / 2010 / 079430; WO / 2011 / 072246; WO / 2018 / 057989; and WO / 2017 / 164230, the entire contents of each of which are incorporated herein by reference.

[0109] Advantageously, guide RNA molecules comprising at least one guide sequence portion presented herein provide improved ANGPTL3 knockout efficiency when complexed with a CRISPR nuclease in a cell relative to other guide RNA molecules. These specifically designed sequences may also be useful for identifying ANGPTL3 target sites for other nucleotide targeting- based gene-editing or gene-silencing methods, for example, siRNA, TALENs, meganucleases or zinc-finger nucleases. Delivery to cells

[0110] Any one of the compositions described herein may be delivered to a target cell by any suitable means. RNA molecule compositions of the present invention may be targeted to any cell which contains and / or expresses a ANGPTL3 allele, such as a mammalian liver cell (e.g. ahepatocyte). For example, in one embodiment the RNA molecule specifically targets ANGPTL3 alleles in a target cell and the target cell is a liver cell (e.g. a hepatocyte) or a stem cell. The delivery to the cell may be performed in vivo, ex vivo, or in vitro. The delivery may be in vivo delivery of a composition packaged in a lentivirus, adeno-associated virus (AAV), or nanoparticle to the liver of a subject. or a liver cell of the subject. The delivery may be ex vivo to a cell of the subject, for example, a liver cell, hepatocyte, or stem cell isolated from the subject. Further, the nucleic acid compositions described herein may be delivered to a cell as one or more of DNA molecules, RNA molecules, ribonucleoproteins (RNP), nucleic acid vectors, or any combination thereof.

[0111] In some embodiments, any one of the compositions described herein is delivered to a cell in-vivo. In some embodiments, the cell is a liver cell, such as a hepatocyte. In some embodiments, the composition is delivered to the liver of a subject. The composition may be delivered to the cell by any known in-vivo delivery method, including but not limited to, viral transduction, for example, using a lentivirus or adeno-associated virus (AAV), nanoparticle delivery, etc. Additional detailed delivery methods are described throughout this section.

[0112] In some embodiments, any one of the compositions described herein is delivered to a cell ex-vivo. In some embodiments, the cell is a liver cell, such as a hepatocyte. The composition may be delivered to the cell by any known ex-vivo delivery method, including but not limited to, nucleofection, electroporation, viral transduction, for example, using a lentivirus or adeno- associated virus (AAV), nanoparticle delivery, liposomes, etc. Additional detailed delivery methods are described throughout this section.

[0113] In some embodiments, the RNA molecule comprises a chemical modification. Non- limiting examples of suitable chemical modifications include 2'-0-methyl (M), 2'-0-methyl, 3'phosphorothioate (MS) or 2'-0-methyl, 3 'thioPACE (MSP), pseudouridine, and 1-methyl pseudo- uridine. Each possibility represents a separate embodiment of the present invention.

[0114] Any suitable viral vector system may be used to deliver nucleic acid compositions e.g., the RNA molecule compositions of the subject invention. Conventional viral and non-viral based gene transfer methods can be used to introduce nucleic acids and target tissues. In certain embodiments, nucleic acids are administered for in vivo or ex vivo gene therapy uses. Non-viral vector delivery systems include naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome or poloxamer. For a review of gene therapy procedures, see Anderson(1992); Nabel & Felgner (1993); Mitani & Caskey (1993); Dillon (1993); Miller (1992); Van Brunt (1988); Vigne (1995); Kremer & Perricaudet (1995); Haddada et al. (1995); and Yu et al. (1994).

[0115] Methods of non-viral delivery of nucleic acids and / or proteins include electroporation, lipofection, microinjection, biolistics, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycation or lipid:nucleic acid conjugates, artificial virions, and agent-enhanced uptake of nucleic acids or can be delivered to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboiummeliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus and cassava vein mosaic virus). (See, e.g., Chung et al., 2006). Sonoporation using, e.g., the Sonitron 2000 system (Rich-Mar), can also be used for delivery of nucleic acids. Cationic-lipid mediated delivery of proteins and / or nucleic acids is also contemplated as an in vivo, ex vivo, or in vitro delivery method. (See Zuris et al. (2015); see also Coelho et al. (2013); Judge et al. (2006); and Basha et al. (2011)).

[0116] Non-viral vectors, such as transposon-based systems e.g. recombinant Sleeping Beauty transposon systems or recombinant PiggyBac transposon systems, may also be delivered to a target cell and utilized for transposition of a polynucleotide sequence of a molecule of the composition or a polynucleotide sequence encoding a molecule of the composition in the target cell.

[0117] Additional exemplary nucleic acid delivery systems include those provided by Amaxa.RTM. Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.) and Copernicus Therapeutics Inc., (see, e.g., U.S. Patent No. 6,008,336). Lipofection is described in e.g., U.S. Patent No.5,049,386, U.S. Patent No.4,946,787; and U.S. Patent No. 4,897,355, and lipofection reagents are sold commercially (e.g., Transfectam.TM., Lipofectin.TM. and Lipofectamine.TM. RNAiMAX). Cationic and neutral lipids that are suitable for efficient receptor-recognition lipofection of polynucleotides include those disclosed in PCT International Publication Nos. WO / 1991 / 017424 and WO / 1991 / 016024. Delivery can be to cells (ex vivo administration) or target tissues (in vivo administration).

[0118] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to one of skill in the art (see, e.g., Crystal, Science (1995); Blaese et al., (1995); Behr et al., (1994); Remy et al. (1994); Gao and Huang (1995); Ahmad and Allen (1992); U.S. Patent Nos.4,186,183; 4,217,344; 4,235,871; 4,261,975; 4,485,054; 4,501,728; 4,774,085; 4,837,028; and 4,946,787).

[0119] Additional methods of delivery include the use of packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are specifically delivered to target tissues using bispecific antibodies where one arm of the antibody has specificity for the target tissue and the other has specificity for the EDV. The antibody brings the EDVs to the target cell surface and then the EDV is brought into the cell by endocytosis. Once in the cell, the contents are released (See MacDiarmid et al., 2009).

[0120] Delivery vehicles include, but are not limited to, bacteria, preferably non-pathogenic, vehicles, nanoparticles, exosomes, microvesicles, gene gun delivery, for example, by attachment of a composition to a gold particle which is fired into a cell using via a “gene-gun”, viral vehicles, including but not limited to lentiviruses, AAV, and retroviruses), virus-like particles (VLPs). large VLPs (LVLPs), lentivirus-like particles, transposons, viral vectors, naked vectors, DNA, or RNA, among other delivery vehicles known in the art.

[0121] The delivery of a CRISPR nuclease and / or a polynucleotide encoding the CRIPSR nuclease, and optionally additional nucleotide molecules and / or additional proteins or peptides, may be performed by utilizing a single delivery vehicle or method or a combination of different delivery vehicles or methods. For example, a CRISPR nuclease may be delivered to a cell utilizing an LNP, and a crRNA molecule and tracrRNA molecule may be delivered to the cell utilizing AAV. Alternatively, a CRISPR nuclease may be delivered to a cell utilizing an AAV particle, and a crRNA molecule and tracrRNA molecule may be delivered to the cell utilizing a separate AAV particle, which may be advantageous due to size limitations.

[0122] The use of RNA or DNA viral based systems for viral mediated delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or they can be used to treat cells in vitro and the modified cells are administered to patients (ex vivo). Conventional viral based systems for the delivery of nucleic acids include, but are not limited to, retroviral, lentivirus, adenoviral, adeno-associated, vaccinia and herpes simplex virus vectors for gene transfer.

[0123] An RNA virus is may be utilized for delivery of the RNA compositions described herein. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues. Nucleic acid of the invention may be delivered by non-integrating lentivirus. Optionally, RNA delivery with Lentivirus is utilized. Optionally the lentivirus includes mRNA ofthe nuclease, RNA of the guide. Optionally the lentivirus includes mRNA of the nuclease, RNA of the guide and a donor template. Optionally, the lentivirus includes the nuclease protein, guide RNA. Optionally, the lentivirus includes the nuclease protein, guide RNA and / or a donor template for gene editing via, for example, homology directed repair. Optionally the lentivirus includes mRNA of the nuclease, DNA-targeting RNA, and the tracrRNA. Optionally the lentivirus includes mRNA of the nuclease, DNA-targeting RNA, and the tracrRNA, and a donor template. Optionally, the lentivirus includes the nuclease protein, DNA-targeting RNA, and the tracrRNA. Optionally, the lentivirus includes the nuclease protein, DNA-targeting RNA, and the tracrRNA, and a donor template for gene editing via, for example, homology directed repair.

[0124] As mentioned above, the compositions described herein may be delivered to a target cell using a non-integrating lentiviral particle method, e.g. a LentiFlash® system. Such a method may be used to deliver mRNA or other types of RNAs into the target cell, such that delivery of the RNAs to the target cell results in assembly of the compositions described herein inside of the target cell. See also PCT International Publication Nos. WO / 2013 / 014537, WO / 2014 / 016690, WO / 2016 / 185125, WO / 2017 / 194902, and WO / 2017 / 194903.

[0125] The tropism of a retrovirus can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that are able to transduce or infect non-dividing cells and typically produce high viral titers. Selection of a retroviral gene transfer system depends on the target tissue. Retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 kb of foreign sequence. The minimum cis-acting LTRs are sufficient for replication and packaging of the vectors, which are then used to integrate the therapeutic gene into the target cell to provide permanent transgene expression. Widely used retroviral vectors include those based upon murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), Simian Immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (See, e.g., Buchschacher et al. (1992); Johann et al. (1992); Sommerfelt et al. (1990); Wilson et al. (1989); Miller et al. (1991); PCT International Publication No. WO / 1994 / 026877A1).

[0126] At least six viral vector approaches are currently available for gene transfer in clinical trials, which utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent.

[0127] pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials (See Dunbar et al., 1995; Kohn et al., 1995; Malech et al., 1997). PA317 / pLASN was the first therapeutic vector used in a gene therapy trial (Blaese et al., 1995). Transduction efficiencies of 50% or greater have been observed for MFG-S packaged vectors. (Ellem et al., (1997); Dranoff et al., 1997).

[0128] Packaging cells are used to form virus particles that are capable of infecting a host cell. Such cells include 293 cells, which package adenovirus, AAV, and Psi-2 cells or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are usually generated by a producer cell line that packages a nucleic acid vector into a viral particle. The vectors typically contain the minimal viral sequences required for packaging and subsequent integration into a host (if applicable), other viral sequences being replaced by an expression cassette encoding the protein to be expressed. The missing viral functions are supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy typically only possess inverted terminal repeat (ITR) sequences from the AAV genome which are required for packaging and integration into the host genome. Viral DNA is packaged in a cell line, which contains a helper plasmid encoding the other AAV genes, namely rep and cap, but lacking ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus promotes replication of the AAV vector and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to a lack of ITR sequences. Contamination with adenovirus can be reduced by, e.g., heat treatment to which adenovirus is more sensitive than AAV. Additionally, AAV can be produced at clinical scale using baculovirus systems (see U.S. Patent No.7,479,554).

[0129] In many gene therapy applications, it is desirable that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type. Accordingly, a viral vector can be modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. For example, Han et al. (1995) reported that Moloney murine leukemia virus can be modified to express human heregulin fused to gp70, and the recombinant virus infects certain human breast cancer cells expressing human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs, in which the target cell expresses a receptor and the virus expresses a fusion protein comprising a ligand for the cell- surface receptor. For example, filamentous phage can be engineered to display antibody fragments (e.g., FAB or Fv) having specific binding affinity for virtually any chosen cellular receptor.Although the above description applies primarily to viral vectors, the same principles can be applied to nonviral vectors. Such vectors can be engineered to contain specific uptake sequences which favor uptake by specific target cells.

[0130] Gene therapy vectors can be delivered in vivo by administration to an individual patient, for example by systemic administration (e.g., intravitreal, intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application, as described below. Preferably, delivery of any one of the compositions disclosed herein is delivered in vivo to cells within the liver of a subject in order to knockout ANGPTL3 expression in cells of the liver (e.g. hepatocytes). The composition may be delivered to liver cells by several known means, including by use of virus vehicles (e.g. lentivirus, adeno-associated virus (AAV), etc.), nanoparticles, or delivery of naked RNA compositions. For example, the composition may be delivered in vivo to liver cells via lipid nanoparticle delivery, lentiviral delivery, or AAV delivery.

[0131] Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, tissue biopsy) or universal donor hematopoietic stem cells, followed by reimplantation of the cells into a patient, optionally after selection for cells which have incorporated the vector. A non-limiting exemplary ex vivo approach may involve removal of tissue (e.g., peripheral blood, bone marrow, and spleen) from a patient for culture, nucleic acid transfer to the cultured cells (e.g., hematopoietic stem cells), followed by grafting the cells to a target tissue (e.g., bone marrow, and spleen) of the patient. In some embodiments, the stem cell or hematopoietic stem cell may be further treated with a viability enhancer.

[0132] Ex vivo cell transfection for diagnostics, research, or for gene therapy (e.g., via re-infusion of the transfected cells into the host organism) is well known to those of skill in the art. In a preferred embodiment, cells are isolated from the subject organism, transfected with a nucleic acid composition, and re-infused back into the subject organism (e.g., patient). Various cell types suitable for ex vivo transfection are well known to those of skill in the art (See, e.g., Freshney, “Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications (6th edition, 2010) and the references cited therein for a discussion of how to isolate and culture cells from patients).

[0133] Vectors (e.g., retroviruses, liposomes, etc.) containing therapeutic nucleic acid compositions can also be administered directly to an organism for transduction of cells in vivo.Administration is by any of the routes normally used for introducing a molecule into ultimate contact with blood or tissue cells including, but not limited to, injection, infusion, topical application, and electroporation. Suitable methods of administering such nucleic acids are available and well known to those of skill in the art, and, although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route. According to some embodiments, the composition is delivered via IV injection.

[0134] Vectors suitable for introduction of transgenes into cells include non-integrating lentivirus vectors. See, e.g., U.S. Publication No.2009 / 0117617.

[0135] Pharmaceutically acceptable carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions available, as described below (See, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0136] The disclosed compositions and methods may also be used in the manufacture of a medicament for treating dominant genetic disorders in a patient. Examples of RNA guide sequence portions which specifically target alleles of ANGPTL3 gene

[0137] Although a large number of guide sequences can be designed to target the ANGPTL3 gene, the nucleotide sequences described in Table 1 and are identified by SEQ ID NOs: 1-20347 were specifically selected to effectively implement the methods set forth herein.

[0138] Table 1 shows guide sequences designed for use as described in the embodiments above to associate with ANGPTL3 alleles. Each engineered guide molecule is further designed such as to associate with a target genomic DNA sequence of interest that lies next to a protospacer adjacent motif (PAM), e.g., a PAM matching the sequence NGG or NAG, where “N” is any nucleobase. The guide sequences were designed to work in conjunction with one or more different CRISPR nucleases, including, but not limited to, e.g. SpCas9WT (PAM SEQ: NGG), SpCas9.VQR.1 (PAM SEQ: NGAN), SpCas9.VQR.2 (PAM SEQ: NGNG), SpCas9.EQR (PAM SEQ: NGAG), SpCas9.VRER (PAM SEQ: NGCG), SaCas9WT (PAM SEQ: NNGRRT), SpRY (PAM SEQ: NRN or NYN), NmCas9WT (PAM SEQ: NNNNGATT), Cpf1 (PAM SEQ: TTTV), JeCas9WT (PAM SEQ: NNNVRYM), OMNI-50 (PAM SEQ: NGG), OMNI-79 (PAM SEQ: NGG), OMNI-103 (PAM SEQ: NNRACT), OMNI-159 (NNNNCMAN), or OMNI-124 (PAM SEQ: NNGNRMNN).

[0139] Additional description of the OMNI-124 nuclease (SEQ ID NO: 20362) and the OMNI- 159 nuclease (SEQ ID NO: 20353) is provided in PCT International Application Publication No. WO 2023 / 019269 A2, the content of which is hereby incorporated by reference. Additional description of the OMNI-103 nuclease (SEQ ID NO: 20354) is provided in PCT International Application Publication Nos. WO 2022 / 170199 A2 and WO 2023 / 107946 A2, the content of each of which are hereby incorporated by reference. Additional description of the OMNI-50 nuclease (SEQ ID NO: 20360) is provided in U.S. Patent No. 11,666,641 B2 and PCT International Application Publication Nos. WO 2020 / 223514 A2, WO 2022 / 098693 A1, and WO 2023 / 019263 A1, the contents of each of which are hereby incorporated by reference. Additional description of the OMNI-79 nuclease (SEQ ID NO: 20361) is provided in U.S. Application Publication No. 2023 / 0122086 A1 and PCT International Application Publication Nos. WO 2021 / 248016 A2 and WO 2023 / 102407 A2, the contents of each of which are hereby incorporated by reference.

[0140] RNA molecules of the present invention are each designed to form complexes in conjunction with one or more different CRISPR nucleases and designed to target polynucleotide sequences of interest utilizing one or more different PAM sequences respective to the CRISPR nuclease utilized.Table 1: Guide sequence portions designed to associate with specific ANGPTL3 gene targetsThe indicated locations listed in column 1 of Table 1 are based on gnomAD v3 database and UCSC Genome Browser assembly ID: hg38, Sequencing / Assembly provider ID: Genome Reference Consortium Human GRCh38.p12 (GCA_000001405.27). Assembly date: Dec.2013 initial release; Dec.2017 patch release 12.

[0141] Examples are provided below to facilitate a more complete understanding of the invention. The following examples illustrate the exemplary modes of making and practicing the invention. However, the scope of the invention is not limited to specific embodiments disclosed in these Examples, which are for purposes of illustration only.EXPERIMENTAL DETAILS Example 1: ANGPTL3 Targeting Analysis

[0142] Guide sequence portions consisting of 17-50 contiguous nucleotides and containing 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347 are screened for high on target activity using a compatible CRISPR nuclease (e.g. OMNI-103 or OMNI- 159) in a human cell line (e.g. HeLa cells). On-target activity is determined by DNA capillary electrophoresis analysis. Example 2: ANGPTL3-targeting sgRNAs tested in liver cells

[0143] In order to reduce the expression of ANGPTL3 protein in liver cells, several single- guide RNAs (sgRNAs) were tested with OMNI-103 CRISPR nuclease expressed from mRNA in Huh-7 human hepatoma cells. Six (6) different sgRNAs targeting the first exon in the ANGPTL3 gene were screened for high on-target activity in Huh-7 cells (Table C and Fig. 2A). Briefly, 1µg of OMNI-103 and 124pmol of sgRNA were introduced into the cells by electroporation using Lonza 4D-nucleofector system. Cells were harvested 72 hours post- electroporation. Cell lysis and genomic DNA extraction were performed in Quick Extract (Lucigen), and endogenous genomic regions were amplified using specific primers to measure on-target activity by next-generation sequencing (NGS) (Fig.2B). In order to verify resulting changes in ANGPTL3 expression, ANGPTL3 mRNA levels were evaluated by qRT-PCR and ANGPTL3 secreted protein levels were evaluated by ELISA. For mRNA levels, total mRNA from edited and non-edited cells was extracted using a Maxwell RSC automated RNA purification kit (Promega). Total cDNA was synthesized from mRNA using a High-Capacity RNA to cDNA kit (Applied Biosystems). mRNA levels were measured by qRT-PCR using Sybr Green dye and HPRT mRNA levels as control (Fig. 2C). For measurement of secreted ANGPTL3 protein levels, 1x106Huh-7 cells were seeded and incubated in 500 µl of DMEM media for 24 hrs. Collected media samples were centrifuged for 10 minutes at 800g to sediment cells and debris and then analyzed for ANGPTL3 expression by a human ANGPTL3 ELISA kit (Abcam) (Fig.2D). All the tested sgRNAs showed over 90% genomic editing percentages and over 50% reduction of mRNA expression levels. Secretion of ANGPTL3 was below the sensitivity level for sgRNAs 29, 30, 32 and 36.Example 3: ANGPTL3-targeting sgRNAs tested in vivo

[0144] In order to reduce the expression of ANGPTL3 protein in vivo in C57Bl6 mice, LNPs containing either a “sgRNA1m” or “sgRNA2m” guide molecule and an OMNI-103-encoding mRNA molecule were intravenously injected into a tail vein of a C57Bl6 mouse at a concentration of either 2.5 mg / kg or 5 mg / kg (Table D). Blood serum was collected from mice on Day 0 (day of injection) and 14 days later. For evaluation of on-target editing, whole livers were collected and separated into single cell suspension using a Liver Perfusion kit and GentleMACS instrument (Miltenyi Biotec). Genomic DNA extraction was performed using a Maxwell RSC Cell kit (Promega) and endogenous genomic regions were amplified using specific primers to measure on-target activity by next-generation sequencing (NGS) (Fig.3A). In order to verify resulting changes in ANGPTL3 expression, we evaluated ANGPTL3 mRNA levels by qRT-PCR and ANGPTL3 secreted protein levels by ELISA. For the evaluation of mRNA levels, total mRNA was extracted using Maxwell RSC automated RNA purification kit (Promega). Total cDNA was synthesized from mRNA using a High-Capacity RNA to cDNA kit (Applied Biosystems). LDLR mRNA levels were measured by qRT-PCR using Sybr Green dye and measuring HPRT mRNA levels as a control (Fig. 3B). For measurement of secreted ANGPTL3 protein levels, serum samples collected from mice before and 14-days after the treatment were analyzed for ANGPTL3 expression using a mouse ANGPTL3 ELISA kit (Abcam) (Fig. 3C). Both tested sgRNAs showed over 50% genomic editing percentages and over 80% reduction of mRNA expression levels in all the mice. Secretion of ANGPTL3 was reduced by over 80% in the sgRNA2m and over 95% in the sgRNA1m tested groups.REFERENCES 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817-20. 2. Anderson (1992) “Human gene therapy”, Science 256:808-13. 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther.19(12):2186-200. 4. Behr (1994) Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382-89. 5. Blaese (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291-97. 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475-80. 7. Buchschacher and Panganiban (1992) “Human immunodeficiency virus vectors for inducible expression of foreign genes”, J. Virol.66:2731-39. 8. Burstein et al. (2017) “New CRISPR-Cas systems from uncultivated microbes”, Nature 542:237-41. 9. Chang and Wilson (1987) “Modification of DNA ends can decrease end-joining relative to homologous recombination in mammalian cells”, Proc. Natl. Acad. Sci. USA 84:4959-4963. 10. Chung et al. (2006) “Agrobacterium is not alone: gene transfer to plants by viruses and other bacteria”, Trends Plant Sci.11(1):1-4. 11. Coelho et al. (2013) “Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N. Engl. J. Med.369, 819-829. 12. Collias and Beisel (2021) “CRISPR technologies and the search for the PAM-free nuclease”, Nature Communications 12, 555.13. Crystal (1995) “Transfer of genes to humans: early lessons and obstacles to success”, Science 270(5235):404-10. 14. Dillon (1993) “Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167-173. 15. Dranoff et al. (1997) “A phase I study of vaccination with autologous, irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”, Hum. Gene Ther.8(1):111-23. 16. Dunbar et al. (1995) “Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”, Blood 85:3048-57. 17. Ellem et al. (1997) “A case report: immune responses and clinical course of the first human use of ganulocyte / macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”, Cancer Immunol Immunother 44:10-20. 18. Gao and Huang (1995) “Cationic liposome-mediated gene transfer” Gene Ther. 2(10):710-22. 19. Haddada et al. (1995) “Gene Therapy Using Adenovirus Vectors”, in: The Molecular Repertoire of Adenoviruses III: Biology and Pathogenesis, ed. Doerfler and Böhm, pp. 297-306. 20. Han et al. (1995) “Ligand-directed retro-viral targeting of human breast cancer cells”, Proc Natl Acad Sci U.S.A.92(21):9747-51. 21. Hu et al. (2018) “Evolved Cas9 variants with broad PAM compatibility and high DNA specificity”, Nature 556(7699):57-63. 22. Jinek et al. (2012) “A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337(6096):816-21. 23. Johan et al. (1992) “GLVR1, a receptor for gibbon ape leukemia virus, is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”, J Virol 66(3):1635-40.24. Judge et al. (2006) “Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”, Mol Ther.13(3):494-505. 25. Kohn et al. (1995) “Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”, Nature Medicine 1:1017-23. 26. Kremer and Perricaudet (1995) “Adenovirus and adeno-associated virus mediated gene transfer”, Br. Med. Bull.51(1):31-44. 27. Macdiarmid et al. (2009) “Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”, Nat Biotehcnol.27(7):643-51. 28. Malech et al. (1997) “Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”, PNAS 94(22):12133-38. 29. Miller et al. (1991) “Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”, J Virol.65(5):2220-24. 30. Miller (1992) “Human gene therapy comes of age”, Nature 357:455-60. 31. Mitani and Caskey (1993) “Delivering therapeutic genes – matching approach and application”, Trends in Biotechnology 11(5):162-66. 32. Nabel and Felgner (1993) “Direct gene transfer for immunotherapy and immunization”, Trends in Biotechnology 11(5):211-15. 33. Nishimasu et al. (2018) “Engineered CRISPR-Cas9 nuclease with expanded targeting space”, Science 361(6408):1259-1262. 34. Remy et al. (1994) “Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”, Bioconjugate Chem.5(6):647-54. 35. Sentmanat et al. (2018) “A Survey of Validation Strategies for CRISPR-Cas9 Editing”, Scientific Reports 8:888, doi:10.1038 / s41598-018-19441-8. 36. Sommerfelt et al. (1990) “Localization of the receptor gene for type D simian retroviruses on human chromosome 19”, J. Virol.64(12):6214-20.37. Van Brunt (1988) “Molecular framing: transgenic animals as bioactors” Biotechnology 6:1149-54. 38. Vigne et al. (1995) “Third-generation adenovectors for gene therapy”, Restorative Neurology and Neuroscience 8(1,2): 35-36. 39. Walton et al. (2020) “Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants”, Science 368(6488):290-296. 40. Weissman and Kariko (2015) “mRNA:Fulfilling the promise of gene therapy”, Molecular Therapy (9):1416-7. 41. Wilson et al. (1989) “Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”, J. Virol.63:2374-78. 42. Yu et al. (1994) “Progress towards gene therapy for HIV infection”, Gene Ther. 1(1):13-26. 43. Zetsche et al. (2015) “Cpf1 is a single RNA-guided endonuclease of a class 2 CRIPSR- Cas system” Cell 163(3):759-71. 44. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol.33(1):73-80.

Claims

CLAIMS 1. A method for inactivating at least one allele of the angiopoietin-like protein 3 (ANGPTL3) gene in a cell, the method comprising introducing to the cell a composition comprising: at least one CRISPR nuclease, or a nucleotide molecule encoding a CRISPR nuclease; and an RNA molecule comprising a guide sequence portion, or a DNA molecule encoding the RNA molecule, wherein a complex of the CRISPR nuclease and the RNA molecule affects a double strand break in at least one allele of the ANGPTL3 gene, wherein the guide sequence portion of the RNA molecule consists of 17-50 contiguous nucleotides.

2. The method of claim 1, wherein the composition is introduced to a cell in a subject or to a cell in culture.

3. The method of any one of claims 1-2, wherein the cell is a liver cell, preferably a hepatocyte, or a stem cell.

4. The method of any one of claims 1-3, wherein the CRISPR nuclease and the RNA molecule are introduced to the cell at substantially the same time or at different times.

5. The method of any one of claims 1-4, wherein alleles of the ANGPTL3 gene in the cell are subjected to an insertion or deletion mutation.

6. The method of claim 5, wherein the insertion or deletion mutation creates an early stop codon.

7. The method of any one of claims 1-6, wherein the inactivating results in a truncated protein encoded by the inactivated allele.

8. The method of any one of claims 1-7, wherein guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, or Exon 7 of the ANGPTL3 gene.

9. The method of any one of claims 1-8, wherein the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of an exon of the ANGPTL3 gene, and a) the exon is Exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 6333-9188; b) the exon is Exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9189-9978; c) the exon is Exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9979-10786; d) the exon is Exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 10787-11633; e) the exon is Exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 11634-12384; f) the exon is Exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 12385-14057; or g) the exon is Exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 1-6332 and 14058-15412.

10. The method of any one of claims 1-7, wherein the guide sequence portion consists of 17-50 contiguous nucleotides and comprises 17-22 nucleotides in the sequence set forth in any one of SEQ ID NOs: 1-20347, or differs by no more than 3 nucleotides from a sequence set forth in any one of SEQ ID NOs: 1-20347.

11. A composition comprising an RNA molecule comprising a guide sequence portion which consists of 17-50 contiguous nucleotides and comprises 17-22 nucleotides in asequence set forth in any one of SEQ ID NOs: 1-20347, or differs by no more than 3 nucleotides from a sequence set forth in any one of SEQ ID NOs: 1-20347.

12. The composition of claim 11, wherein the guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of Exon 1, Exon 2, Exon 3, Exon 4, Exon 5, Exon 6, or Exon 7 of the ANGPTL3 gene.

13. The composition of claim 11 or 12, wherein the guide sequence portion is complementary to a target sequence located from 30 base pairs upstream to 30 base pairs downstream of an exon of the ANGPTL3 gene, and a) the exon is Exon 1, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 6333-9188; b) the exon is Exon 2, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9189-9978; c) the exon is Exon 3, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 9979-10786; d) the exon is Exon 4, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 10787-11633; e) the exon is Exon 5, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 11634-12384; f) the exon is Exon 6, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 12385-14057; or g) the exon is Exon 7, and the guide sequence portion comprises 17-22 nucleotides in a sequence that is the same as or differs by no more than 3 nucleotides from a sequence set forth in any of SEQ ID NOs: 1-6332 and 14058-15412.

14. The composition of any one of claims 11-13, further comprising a CRISPR nuclease.

15. The composition of any one of claims 11-14, further comprising a transactivating CRISPR RNA (tracrRNA) molecule.

16. The composition of any one of claims 11-15, wherein the CRISPR nuclease and RNA molecule form a complex, or the CRISPR nuclease, RNA molecule, and tracrRNA molecule form a complex.

17. A medicament comprising the composition of any one of claims 11-16 for use in inactivating a ANGPTL3 allele in a cell, wherein the medicament is administered by delivering to the cell the composition of any one of claims 11-16.

18. Use of the composition of any one of claims 11-16 for treating, ameliorating, or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, comprising delivering the composition of any one of claims 11-16 to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

19. A medicament comprising the composition of any one of claims 11-16 for use in treating, ameliorating, or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia, wherein the medicament is administered by delivering the composition of any one of claims 11-16 to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

20. A kit for inactivating a ANGPTL3 allele in a cell, comprising the composition of any one of claims 11-16 and instructions for delivering the composition to the cell.

21. A kit for treating or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia in a subject, comprising the composition of any one of claims 11- 16 and instructions for delivering the composition to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

22. The composition of any one of claims 1-16 for use in treating, ameliorating, or preventing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

23. A method of treating hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia in a subject, the method comprising administering the composition of any one of claims 11-16 to a subject experiencing or at risk of experiencing hypertriglyceridemia, hyperlipidemia, or hypercholesterolemia.

24. A composition, method, process, kit, modified cell, or use as characterized by one or more elements disclosed herein.

Images