Novel lyophilized formulation containing α-galactosidase a fusion protein

A stabilized lyophilized formulation of α-galactosidase A fusion protein, with a specific composition, addresses storage stability issues, ensuring high recovery rates and effective treatment of lysosomal storage diseases like Fabry disease.

HK40134724APending Publication Date: 2026-07-10KOREA GREEN CROSS CORP +1

Patent Information

Authority / Receiving Office
HK · HK
Patent Type
Applications
Current Assignee / Owner
KOREA GREEN CROSS CORP
Filing Date
2026-04-27
Publication Date
2026-07-10

AI Technical Summary

Technical Problem

Existing lyophilized formulations of α-galactosidase A fusion protein suffer from low storage stability and protein precipitation, limiting their effectiveness and concentration, especially in enzyme-replacement therapies for lysosomal storage diseases like Fabry disease.

Method used

A lyophilized formulation containing an α-galactosidase A fusion protein, linked to an immunoglobulin Fc region, is developed with a specific composition including a buffer, sugar or sugar alcohol, and optional amino acids and non-ionic surfactants, maintaining pH between 6.5 to 8.0, to stabilize the protein during lyophilization and reconstitution.

Benefits of technology

The formulation achieves high recovery rates and structural stability of the α-galactosidase A fusion protein, allowing for long-term storage and effective administration at higher concentrations, thereby enhancing therapeutic efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The invention relates to a lyophilized preparation containing alpha-galactosidase A fusion protein and a preparation method of the lyophilized preparation.
Need to check novelty before this filing date? Find Prior Art

Description

(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (43) International Publication Date 20 March 2025 (20.03.2025) llllllllllllllllllllllllllllllllllllllllllll (10) International Publication Number WO 2025 / 058333 Al WIPO I PCT (51) International Patent Classification: A61K9 / 19 (2006.01) A61K38 / 47 (2006.01) A61K 47 / 26 (2006.01) A61P3 / 00 (2006.01) A61K 47 / 18 (2006.01) A61P43 / 00 (2006.01) A61K47 / 22 (2006.01) (21) International Application Number: PCT / KR2024 / 013486 (22) International Filing Date: 06 September 2024 (06.09.2024) (25) Filing Eanguage: English (26) Publication Eanguage: English (30) Priority Data: 10-2023-0122402 14 September 2023 (14.09.2023) KR (71) Applicants: GREEN CROSS CORPORATION [KR / KR]; 107 Ihyeon-ro 30beon-gil, Giheung-gu, Yon- gin-si, Gyeonggi-do 16924 (KR). HANMIPHARM. CO., ETD. [KR / KR]; 214Muha-ro,Paltan-myeon,Hwaseong-si, Gyeonggi-do 18536 (KR). (72) Inventors: SON,Jong Moon; 107 Ihyeon-ro 30beon-gil, Giheung-gu, Yongin-si, Gyeonggi-do 16924 (KR). JI, In Ri; 107 Ihyeon-ro 30beon-gil, Giheung-gu, Yongin-si, Gyeonggi-do 16924 (KR). YOO, Miri; 107 Ihyeon-ro 30beon-gil, Giheung-gu, Yongin-si, Gyeonggi-do 16924 (KR). YES, Hye Jin; 107 Ihyeon-ro 30beon-gil, Gihe ung-gu, Yongin-si, Gyeonggi-do 16924 (KR). SON, Jae Woon; 107 Ihyeon-ro 30beon-gil, Giheung-gu, Yongin-si, Gyeonggi-do 16924 (KR). KIM, Sang Yun; 550 Dong- tangiheung-ro, Hwaseong-si, Gyeonggi-do 18469 (KR). KIM, Jin Young; 550 Dongtangiheung-ro, Hwaseong-si, Gyeonggi-do 18469 (KR). JANG, Doo Seo; 550 Dong- tangiheung-ro, Hwaseong-si, Gyeonggi-do 18469 (KR). HONG, Sung Hee; 550 Dongtangiheung-ro, Hwaseong-si, Gyeonggi-do 18469 (KR). (74) Agent: HANOU INTEEEECTUAE PROPERTY AND UAW; 6F, 135, Beobwon-ro, Songpagu, Seoul 05836 (KR). (81) Designated States (unless otherwise indicated, for every kind of national protection available)'. AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY,BZ, CA, CH, CL, CN, CO, CR, CU, CV, CZ, DE, DJ, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, JP, JM, IT, ISQ, KG, KH, KN, KP, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, MG, MK, MN, MU, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PA, PE, PG, PG, PT, PHRS, Q A, PL, SC, SD, SE, SG, SK, SL, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, WS, ZA, ZM, ZW. (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, CV, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SC, SD, SL, ST, SZ, TZ, UG, ZM, ZW), K AZ, KZY, BAM ( TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, ME, MK, MT, MT, SE, NL, NO, PL, SK, PT, RO), (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, KM, ML, MR, NE, SN, TD, TG). wo 20 25 / 0 58 33 3 A l IIII II II II II II II II II II II II II II II II II O (54) Title:NOVEL LYOPHILIZED FORMULATION CONTAINING α-GALACTOSIDASE A FUSION PROTEIN Composition #1 t #2 #3 #4 #5 #6 #7 #8 PH 6.5 6.5 6.5 6.5 6.8 6.8 6.8 6.8 PS 20(%) 0.017 0.017 0.017 0.017 0.017 0.017 0.017 0.017 L-Serine (%) 1.4 ’ 1.4 1.4 1.4 1.4 ' 1.4 1.4 1.4 Sugar Sucrose 1% Trehalose 1% Mannitol 1% ι N / A Sucrase 1% Trehalose 1% Mannitol 1% N / A ιΒ·ίΜ·ΗΜΜ||Μ Appearance (Cake) jjj||j||||· MW . (57) Abstract: The present invention relates to a lyophilized formulation containing an α-galactosidase A fusion protein and a prepa­ ration method therefor. [Continued on next page] WO 2025 / 058333 Al IIIIIIIIIIIIIIIIIIIIIIIIIIIIM Published: — with international search report (Art. 21(3)) — with sequence listing part of description (Rule 5.2(a)) 1 WO 2025 / 058333 PCT / KR2024 / 013486 Description Title of Invention: NOVEL LYOPHILIZED FORMULATION CONTAINING α-GALACTOSIDASE A FUSION PROTEIN Technical Field [1] The present invention relates to a lyophilized formulation containing a-galactosidase A fusionprotein, a preparation method therefor, and use thereof. [2] Background Art [3] Lysosomes are intracellular organelles involved in the degradation of proteins, various lipids such as glycolipids and cholesterol, and carbohydrates and the recycling of degraded products as primary constituents of new proteins, membrane components, and other molecules. Examples of diseases associated with the functions of lysosomes are lysosomal storage diseases (LSDs). [4] Lysosomal storage diseases (LSDs) are caused by defects in genes encoding enzymes of degrading glycolipid or polysaccharide waste products in cellular lysosomes, and the biological activity of lysosomal enzymes is significantly reduced or almost absent in cells and tissues of individuals with lysosomal storage diseases. Such a deficiency of degrading enzymes causes the accumulation of substances in large quantities without degradation, ultimately causing problems in cellular functions. [5] Fabry disease, known as one of the lysosomalstorage diseases, is a type of congenital metabolic disorder of glycolipids (glycosphingolipids) resulting from deficient or insufficient activity of alpha (a)-galactosidase A, which is a hydrolase present in lysosomes. Fabry disease, as a representative disease of α-galactosidase A deficiency, is an X chromosome-associated disease. Typical Fabry disease subjects generally have α-galactosidase A activity of less than 1% and show a wide range of symptoms including severe pain in the extremities (acroparesthesia), hypersensitivity to cold, corneal and lenticular changes, skin lesions (angiokeratoma), renal failure, cardiovascular disease, pulmonary failure, nervous system symptoms, and stroke. [6] Fabry disease causes a progressive accumulation of globotriaosylceramide (Gb3) in most of the tissues of the body. The accumulation of Gb3 is mainly found in vascular endothelia. Such progressive accumulation of Gb3 in vascular endothelia leads to ischemia and infarction in organs, such as thekidneys, heart, or brain. [7] [8] Enzyme-replacement therapy (ERT) is a representative method for treating lysosomal storage diseases, and a number of related studies have been conducted (Frances M. Platt et al., J Cell Biol. 2012 Nov 26; 199(5):723-34). Specifically, lysosomal storage 2 WO 2025 / 058333 PCT / KR2024 / 013486 diseases are caused by genetic defects in particular enzymes, and thus an enzyme­ replacement therapy for deficient enzymes is essential. Enzyme-replacement therapy is a standard therapy in lysosomal storage diseases and may exhibit an effect of alleviating existing symptoms or delaying the progress of the diseases by replacing the deficient enzymes. Therefore, studies have been conducted on various formulations including α-galactosidase A for preventing and treating α-galactosidase A deficiency. [9] However, the composition of a formulation for exhibiting stability significantly varies depending on the structure, physicochemical properties, dosage, etc., of an activeingredient (e.g., protein drug), and thus the development of a particular composition suitable for the active ingredient is essentially required, and the development of a formulation containing α-galactosidase A is insufficient. Particularly, a lyophilized formulation containing an α-galactosidase A fusion protein at a high concentration exhibits significantly low storage stability due to issues such as protein precipitation, and thus conventional lyophilized formulations contain an a- galactosidase A fusion protein at a concentration of 5 mg / mL or less. However, there is a need to develop a highly stable formulation containing an α-galactosidase A fusion protein at a high concentration to increase efficacy.

[10] Disclosure of Invention Technical Problem

[11] Moreover, developing lyophilized formulations that are suitable for long-term storage while maintaining the structure and activity of proteins is challenging due to issues such as the loss of structure or function of proteinsduring the lyophilization of protein medicines. Therefore, there is still a need to develop a lyophilized formulation capable of increasing the protein recovery rate while ensuring stability even for long­ term storage.

[12] Solution to Problem

[13] An aspect of the present invention is to provide a lyophilized formulation containing an α-galactosidase A fusion protein.

[14] Another aspect of the present invention is to provide a method for preparing the lyophilized formulation.

[15] Still another aspect of the present invention is to provide a method for reconstituting the lyophilized formulation. Advantageous Effects of Invention

[16] The lyophilized formulation according to the present invention can stably store an α-galactosidase A fusion protein for a long time and can administer to a patient 3 WO 2025 / 058333 PCT / KR2024 / 013486 an appropriate dosage of the fusion protein by increasing the recovery rate in the reconstitution.

[17] Brief Description of Drawings

[18] FIG. 1 comparesthe cake appearances of a lyophilized formulation immediately after dissolution and three days after dissolution according to pH conditions.

[19] FIG. 2 compares the recovery rates of the native form of the lyophilized formulation according to pH conditions.

[20] FIGS. 3 and 4 compare the appearances of lyophilized formulations containing a sugar or sugar alcohol.

[21] FIG. 5 compares the recovery rates of the native form of the lyophilized formulation at pH 6.5 according to the addition of sugar or sugar alcohol.

[22] FIG. 6 compares the recovery rate of the native form of the lyophilized formulation at pH 6.8 according to the addition of sugar or sugar alcohol.

[23] FIG. 7 compares the appearances of a lyophilized formulation according to concentration changes of a sugar (sucrose).

[24] FIG. 8 compares the recovery rates of the native form of a lyophilized formulation according to concentration changes of a sugar (sucrose).

[25] FIG. 9 examines the appearance of a lyophilizedformulation with an optimum composition under refrigeration for 12 months.

[26] FIG. 10 compares the recovery rate of the native form of a lyophilized formulation at 3, 6, and 12 months.

[27] Best Mode for Carrying out the Invention

[28] In accordance with one aspect of the present invention, there is provided a lyophilized formulation containing an α-galactosidase A fusion protein.

[29] In one embodiment, the lyophilized formulation may include a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein in which a-galactosidase A is linked to an immunoglobulin Fc region; a buffer; and a sugar or sugar alcohol.

[30] In another embodiment, the lyophilized formulation may include a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 1 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL.

[31] In the lyophilized formulation of any one of the previousembodiments, the lyophilized formulation may include a mixture obtained by lyophilizing an aqueous solution containing: the fusion protein at a concentration of 1 to 40 mg / mL; a buffer 4 WO 2025 / 058333 PCT / KR2024 / 013486 with a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; and an amino acid at a concentration of 1.0 to 3.0% (w / v).

[32] In the lyophilized formulation of any one of the previous embodiments, the lyophilized formulation may include a mixture obtained by lyophilizing an aqueous solution containing: the fusion protein at a concentration of 1 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; and a non-ionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[33] In the lyophilized formulation of any one of the previous embodiments, the lyophilized formulation may include a mixture obtained by lyophilizing an aqueous solution containing: the fusion protein at a concentration of 1 to40 mg / mL; a buffer with a pH of 6.5 to 8.0 containing 5 to 30 mM histidine; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.1% (w / v); and serine at a concentration of 1.0 to 3.0% (w / v).

[34] In the lyophilized formulation of any one of the previous embodiments, the sugar may be glucose, fructose, galactose, lactose, maltose, sucrose, trehalose, or a combination thereof.

[35] In the lyophilized formulation of any one of the previous embodiments, the sugar alcohol may be mannitol, sorbitol, or a combination thereof.

[36] In the lyophilized formulation of any one of the previous embodiments, the aqueous solution may further contain an amino acid at a concentration of 1.0 to 3.0% (w / v).

[37] In the lyophilized formulation of any one of the previous embodiments, the amino acid may be selected from the group consisting of serine, arginine, threonine, glutamine, glycine, alanine, and a combination thereof.

[38] In the lyophilizedformulation of any one of the previous embodiments, the aqueous solution may further contain a non-ionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[39] In the lyophilized formulation of any one of the previous embodiments, the non-ionic surfactant may be selected from the group consisting of poloxamer 188, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and a combination thereof.

[40] In the lyophilized formulation of any one of the previous embodiments, the buffer may contain histidine or a salt thereof, citric acid or a salt thereof, acetic acid or a salt thereof, phosphoric acid or a salt thereof, or a combination thereof.

[41] In the lyophilized formulation of any one of the previous embodiments, the buffer may contain 5 to 30 mM histidine.

[42] In the lyophilized formulation of any one of the previous embodiments, the lyophilized formulation may not further contain an isotonic agent.

[43] In the lyophilized formulation of any one of the previousembodiments, the isotonic agent may be sodium chloride. 5 WO 2025 / 058333 PCT / KR2024 / 013486

[44] In the lyophilized formulation of any one of the previous embodiments, the a- galactosidase A may include the amino acid sequence of SEQ ID NO: 1.

[45] In the lyophilized formulation of any one of the previous embodiments, the immunoglobulin Fc region may include the amino acid sequence of SEQ ID NO: 3.

[46] In the lyophilized formulation of any one of the previous embodiments, the a- galactosidase A fusion protein may include the amino acid sequence of SEQ ID NO: 4.

[47] In the lyophilized formulation of any one of the previous embodiments, the immunoglobulin Fc region may be derived from IgG4.

[48] In the lyophilized formulation of any one of the previous embodiments, the immunoglobulin Fc region may be aglycosylated.

[49] In the lyophilized formulation of any one of the previous embodiments, the fusion protein may have a structure in which two molecules of α-galactosidase A are linked tomonomers of an immunoglobulin Fc region in a dimeric form, respectively.

[50] In the lyophilized formulation of any one of the previous embodiments, the lyophilized formulation may be used to prevent or treat Fabry disease.

[51] In accordance with another aspect of the present invention, there is provided a method for preparing the lyophilized formulation.

[52] In an embodiment, the preparation method may include lyophilizing an aqueous solution containing: i) an α-galactosidase A fusion protein in which α-galactosidase A is linked to an immunoglobulin Fc region; ii) a buffer; and iii) a sugar or sugar alcohol.

[53] In another embodiment, the preparation method of any one of the previous embodiments may include further mixing an amino acid, a non-ionic surfactant, a preservative, or a combination thereof with the aqueous solution.

[54] In the preparation method of any one of the previous embodiments, the method may include lyophilizing 1 to 10 mL of an aqueous solution containing atleast one of a protein, a buffer, a sugar, a sugar alcohol, an amino acid, a non-ionic surfactant, a preservative, or a combination thereof.

[55] In accordance with another aspect of the present invention, there is provided a method for reconstituting the lyophilized formulation, the method including adding a reconstitution solution to the lyophilized formulation.

[56] In an embodiment, the reconstitution solution may be distilled water.

[57] In another embodiment, the reconstituted formulation may contain an a- galactosidase A fusion protein at a concentration of 10 to 100 mg / mL.

[58] Mode for the Invention

[59] Hereinafter, detailed contents for implementing the present invention will be described below. 6 WO 2025 / 058333 PCT / KR2024 / 013486

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67]

[68]

[69]

[70]

[71]

[72]

[73]

[74]

[75]

[76]

[77]

[78] Each description and embodiment disclosed in the present application may also be applied to other descriptions and embodiments. That is, all combinationsof various elements disclosed in the present application fall within the scope of the present disclosure. Furthermore, the scope of the present invention is not limited by the specific description below. Furthermore, a skilled in the art will recognize, or be able to ascertain, by using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Furthermore, these equivalents are intended to be included in the present invention. Throughout the description herein, not only the typical one-letter and three-letter codes for naturally occurring amino acids, but also three-letter codes generally allowed for other amino acids, such as 2-aminoisobutyric acid (Aib), N-methylglycine (Sar), and α-methyl-glutamic acid, are used. The amino acids mentioned herein are abbreviated according to the nomenclature rules of IUPAC-IUB as follows. alanine (Ala, A), arginine (Arg, R) asparagine (Asn, N), aspartic acid (Asp, D) cysteine (Cys, C),glutamic acid (Glu, E) glutamine (Gin, Q), glycine (Gly, G) histidine (His, H), isoleucine (He, I) leucine (Leu, L), lysine (Lys, K) methionine (Met, M), phenylalanine (Phe, F) proline (Pro, P), serine (Ser, S) threonine (Thr, T), tryptophan (Trp, W) tyrosine (Tyr, Y), valine (Vai, V) An aspect of the present invention provides a lyophilized formulation including a fusion protein in which α-galactosidase A is linked to an immunoglobulin Fc region. Specifically, the present invention relates to a lyophilized formulation including a mixture obtained by lyophilizing an aqueous solution containing: a pharmaceutically effective amount of a fusion protein in which α-galactosidase A and an immunoglobulin Fc region are linked to each other; a buffer; and a sugar or sugar alcohol. The aqueous solution may further contain an amino acid, a non-ionic surfactant, a preservative, or a combination thereof, but is not limited thereto. As used herein, the term "lyophilized formulation" refers to a drugformulated by lyophilization, as a form of a pharmaceutical product. Specifically, the a-galactosidase A fusion protein may be lyophilized together with a substance, such as an excipient, 7 WO 2025 / 058333 PCT / KR2024 / 013486 used to stabilize the fusion protein and thus is present in a solid state. A component contained in the lyophilized formulation, in addition to the α-galactosidase A fusion protein exhibiting pharmacological efficacy, may be interchangeably used with stabilizers. As used herein, the term "stabilizer" refers to a substance that stably maintains components of a formulation, such as an active ingredient, for a predetermined period of time.

[79]

[80] In the present invention, the lyophilized formulation is a concept that includes a lyophilized substance. The above lyophilized formulation is manufactured through a freeze-drying process in the form of a pre-lyophilized formulation containing a stabilizers for stabilizing the α-galactosidase A fusion protein and thea-galactosidase A fusion protein. In the present invention, the lyophilized formulation of the a- galactosidase A fusion protein may include a therapeutically effective amount of the α-galactosidase A fusion protein, and the therapeutically effective amount of the α-galactosidase A fusion protein may be contained in a single-use container or a multi-use container, but is not limited thereto. The lyophilized formulation of the present invention has a composition capable of stabilizing the α-galactosidase A fusion protein during the lyophilization process, and even while the lyophilized formulation is stored and then reconstituted, the stability of the formulation can be maintained and the formulation has a high recovery rate of the α-galactosidase A fusion protein. Furthermore, the lyophilized formulation of the present invention can maintain the stability even when the α-galactosidase A fusion protein is contained therein at a high concentration of 10 mg / mL to 40 mg / mL.

[81] Thelyophilized formulation that includes the α-galactosidase A fusion protein according to the present invention is stored in a container, and when needed, may be reconstituted for administration to an individual.

[82] As used herein, the term "reconstitution" refers to a process of liquefying (dissolving) the lyophilized substance in a solid state such that the α-galactosidase A fusion protein can be administered. Particularly, the concentration of the α-galactosidase A fusion protein included in the lyophilized formulation of the present invention may be 1 mg / mL to 150 mg / mL, 10 mg / mL to 120 mg / mL, or 10 mg / mL to 100 mg / mL upon reconstitution, but is not limited thereto. The concentration of the pre-formulation during a lyophilization process may be different from that after reconstitution.

[83]

[84] The lyophilized formulation of the present invention includes stabilizers capable of stabilizing the structure of the fusion protein so that the pharmacological efficacy of theα-galactosidase A fusion protein can be maintained for a long time even during long-term storage. Such a lyophilized formulation of the present invention includes a 8 WO 2025 / 058333 PCT / KR2024 / 013486 mixture obtained by lyophilizing an aqueous solution containing the α-galactosidase A fusion protein, a buffer, and a sugar or sugar alcohol.

[85]

[86] The α-galactosidase A fusion protein of the present invention is in a form in which α-galactosidase A is fused to an immunoglobulin Fc region. The a-galactosidase A fusion protein undergoes unfolding, in which the structure of the protein is deformed by various external factors (e.g., pH, temperature, osmosis, and presence or absence of stabilizers) during a lyophilization, reconstitution, or storage process, and thus causes a loss of enzymatic activity, resulting in a significant deterioration in the pharmacological efficacy of the formulation that includes a-galactosidase. Particularly, one of the two domains constituting α-galactosidaseA is first unfolded (to form soluble aggregates) and the other domain of α-galactosidase A and the immunoglobulin Fc region are sequentially unfolded, followed by the formation of higher-order aggregates and, finally, CH2 and CH3 domains of the immunoglobulin Fc region are unfolded (to form insoluble aggregates), resulting in precipitates visible to the naked eye. If the structure of the α-galactosidase A fusion protein is not maintained due to the stress occurring during the storage of the lyophilized formulation, resulting in soluble aggregates or higher-order aggregates, the risk of immunogenicity increases, causing safety problems with the formulation. Therefore, it is important to include a composition for preventing the unfolding of the α-galactosidase A fusion protein, in order to ensure the stability of the lyophilized formulation.

[87] The present inventors established that the pH conditions of a formulation and the inclusion or exclusion of sugars (a sugar or sugar alcohol)are important in order to increase the recovery rate of a native form when a lyophilized formulation containing an α-galactosidase A fusion protein is reconstituted, and completed the present invention. The lyophilized formulation of the present invention can maintain the structure and activity of the fusion protein during long-term storage and achieves a high recovery rate, and thus is more effective in treating patients.

[88] A specific example of the lyophilized formulation according to the present invention may be a lyophilized formulation including a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein in which α-galactosidase A is linked to an immunoglobulin Fc region; a buffer; and a sugar or sugar alcohol, more specifically, a fusion protein at 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL.

[89] Another example may be a lyophilized formulation including a mixture obtained bylyophilizing an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; a sugar or sugar alcohol at a 9 WO 2025 / 058333 PCT / KR2024 / 013486 concentration of 1 to 20 mg / mL; and an amino acid at a concentration of 1.0 to 3.0% (w / v).

[90] Still another example may be a lyophilized formulation including a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; and a non-ionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[91] Still another example may be a lyophilized formulation including a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; an amino acid at a concentration of 1.0 to 3.0% (w / v); and anon-ionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[92] Still another example may be a lyophilized formulation including a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; mannitol, sucrose, or trehalose at a concentration of 1 to 20 mg / mL; serine at a concentration of 1.0 to 3.0% (w / v); and polysorbate 20 at a concentration of 0.001 to 0.1% (w / v).

[93] Still another example may be a lyophilized formulation including a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 15 to 35 mg / mL; histidine at a concentration of 5 to 30 mM; a sugar or sugar alcohol at a concentration of 2.5 to 10 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.05% (w / v); and serine at a concentration of 1.0 to 3.0% (w / v), but the lyophilized formulation of the present invention is not limited to the above examples.

[94]

[95] As used herein,the term "aqueous solution" refers to a substance capable of stably storing the α-galactosidase A fusion protein and maintaining the stability during lyophilization and reconstitution while containing the α-galactosidase A fusion protein. Particularly, the aqueous solution contains an excipient for stabilizing the α-galactosidase A fusion protein, thereby imparting stability to the a-galactosidase A fusion protein during lyophilization and enabling the preparation of a lyophilized formulation with storage stability. The stabilizers may include a buffer and sugars (a sugar or sugar alcohol). The stabilizers may further include, but are not limited to, an amino acid, a non-ionic surfactant, a preservative, an antioxidant, and the like. In proteins such as the α-galactosidase A fusion protein, storage stability is important not only for accurate dosage but also for inhibiting the potential production of an antigenic substance against the α-galactosidase A fusion protein. The aqueoussolution may be used interchangeably with "pre-formulation" in the present invention. The lyophilized formulation of the present invention comprises a lyophilized mixture of the aqueous 10 WO 2025 / 058333 PCT / KR2024 / 013486 solution comprising α-galactosidase A fusion protein and stabilizers (e.g., buffer, sugar, sugar alcohol, amino acid, etc.)

[96]

[97] The concentration of the α-galactosidase A fusion protein may be controlled by adjusting the volume of a reconstitution solution added to the lyophilized formulation, and therefore, the concentration of the α-galactosidase A fusion protein in the aqueous solution is not particularly limited, but the aqueous solution can stably lyophilize the α-galactosidase A fusion protein at a high concentration of about 10 mg / mL or more, specifically about 10 mg / mL to 40 mg / mL, and can also maintain the stability of the α-galactosidase A fusion protein in a reconstituted solution.

[98] For example, the aqueous solution of the present invention maycontain the a- galactosidase A fusion protein at a concentration of about 10 to 90 mg / mL, about 10 to 70 mg / mL, about 10 to 50 mg / mL, about 10 to 30 mg / mL, about 15 to 50 mg / mL, about 15 to 40 mg / mL, about 15 to 30 mg / mL, about 20 to 30 mg / mL, about 10 mg / mL, 20 mg / mL, 22 mg / mL, or 30 mg / mL, but is not limited thereto.

[99] As used herein, the term "about" refers to a range encompassing ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, ±0.01, and the like, and includes all of the values in the range equivalent or similar to those stated after this term, but is not limited thereto.

[100] It is generally known that increasing the protein concentration in a formulation may reduce stability and may cause the protein to precipitate. However, the aqueous solution containing stabilizers according to the present invention, even when containing the fusion protein at a high concentration, can maintain the structure of the fusion protein during lyophilization and reconstitution, suppress the occurrence ofprecipitation, and achieve a high recovery rate upon reconstitution. Therefore, the aqueous solution of the present invention may contain, as an active ingredient, the a- galactosidase A fusion protein at a high concentration, for example, at a concentration of about 10 mg / mL or more, about 15 mg / mL or more, or about 20 mg / mL or more.

[101]

[102] Buffer, as a component contained in the aqueous solution of the present invention, is a solution that serves to maintain the pH of the aqueous solution to avoid a rapid change in pH of the formulation during lyophilization or after reconstitution. The aqueous solution may be used as a solvent for the α-galactosidase A fusion protein and the stabilizers, and any aqueous solution may be used as the buffer of the present invention without limitation as long as the aqueous solution can maintain the pH level at which the α-galactosidase A fusion protein is stabilized.

[103] The pH value of the aqueous solution affects the structure of the fusionprotein, and the structure of the fusion protein may be stably maintained at a pH of 6.5 to 8.0. If the 11 WO 2025 / 058333 PCT / KR2024 / 013486 pH falls outside the appropriate range, α-galactosidase A is unfolded earlier than the immunoglobulin Fc region, resulting in impaired structural stability. Therefore, it is important to maintain the pH at an appropriate level to ensure structural stability of the α-galactosidase A fusion protein.

[104] Particularly, the present inventors identified that when a lyophilized formulation prepared from an aqueous solution with a pH of 6.5 or higher was dissolved, the appearance was transparent even when refrigerated, and the recovery rate of a native form was also high.

[105] Examples of the buffer may include phosphoric acid and its conjugate alkaline salts (e.g., a phosphate, such as sodium phosphate, potassium phosphate, or hydrogen or dihydrogen salts thereof), citric acid and its salts (e.g., sodium citrate), acetic acid and its salts (e.g.,sodium acetate), histidine and its salts, and mixtures of these as buffers, but are not limited thereto. For example, the buffer may be selected from the group consisting of a citrate buffer (e.g., sodium citrate buffer), an acetate buffer (e.g., sodium acetate buffer), a phosphate buffer (e.g., sodium phosphate buffer), a histidine buffer, and a combination thereof, and the buffer or buffering substances in the aqueous solution (citric acid and a salt thereof, acetic acid and a salt thereof, histidine and a salt thereof, phosphoric acid and a salt thereof, or a combination thereof) may be contained at a concentration sufficient to maintain the pH for structural stability of proteins.

[106] The pH of the aqueous solution may be about 6.5 to 8.0, for example, about pH 6.5 to 7.8, about pH 6.5 to 7.5, about pH 6.5 to 7.0, about pH 6.5 to 6.8, or a pH of about 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, or 7.5, but is not particularly limited thereto.

[107] To achieve the target pH,the buffer may include phosphoric acid, citric acid, acetic acid, histidine, or a salt thereof, or a mixture thereof at a concentration of about 5 mM to about 200 mM, about 5 mM to about 100 mM, about 5 mM to about 80 mM, about 5 mM to about 40 mM, about 8 mM to about 40 mM, about 5 mM to about 30 mM, about 5 mM to about 25 mM, about 5 mM to about 15 mM, about 5 mM to about 10 mM, or about 6.67 mM, but is not particularly limited thereto.

[108]

[109] In a specific embodiment, the buffer may include about 10 mM histidine, and have a pH of about 6.5 or higher, specifically, about pH 6.5 to 8.0, about pH 6.5 to 7.5, about pH 6.5 to 7.0, or about pH 6.5 to 6.8, but is not limited thereto.

[110]

[111] The sugars (a sugar or sugar alcohol) contained in the aqueous solution of the present invention play a crucial role in increasing the recovery rate of α-galactosidase A fusion protein when a lyophilized mixture is dissolved. The present inventors identified that the recovery rate of thenative α-galactosidase A fusion protein was high regardless 12 WO 2025 / 058333 PCT / KR2024 / 013486 of the type of sugar in formulations including sugars under all pH conditions. Therefore, the lyophilized formulation of the present invention, which achieves a high recovery rate of a native form by containing a sugar or sugar alcohol, can enhance the therapeutic effect by allowing the administration of the α-galactosidase A fusion protein at an appropriate dose.

[112] The sugar refers to a monosaccharide, a disaccharide, a polysaccharide, or an oligosaccharide and examples thereof may be mannose, glucose, fructose, galactose, fucose, lactose, maltose, sucrose, trehalose, raffinose, dextran, or a combination thereof. In a specific embodiment, the sugar may be glucose, fructose, galactose, lactose, maltose, sucrose, trehalose, or a combination thereof, but is not limited thereto. For example, the sugar may be sucrose or trehalose, but is not particularly limited thereto.

[113]

[114] Thesugar alcohol refers to a substance containing a plurality of hydroxyl groups, and includes a substance in which an aldehyde group and / or ketone group of a sugar is substituted with an alcohol group, and includes saccharides containing multiple hydroxyl groups. For example, the sugar alcohol may be mannitol, sorbitol, or a combination thereof, and specifically may be mannitol, but is not limited thereto.

[115] The aqueous solution according to the present invention may contain one type of sugar, that is, a sugar or sugar alcohol, or may contain a combination of several types of sugars, but is not limited thereto.

[116] The sugar alcohol, sugar, or a combination thereof may be present in the aqueous solution, at a concentration of about 1 to 30 mg / mL, about 1 to 25 mg / mL, about 2 to 20 mg / mL, about 2 to 15 mg / mL, about 2 to 10 mg / mL, about 2.5 to 5 mg / mL, or about 2.5 mg / mL, but is not particularly limited thereto.

[117]

[118] The aqueous solution of the present invention may furthercontain an amino acid. The amino acid may impart structural stability to the α-galactosidase A fusion protein. The amino acid contained in the lyophilized formulation of the present invention may be selected from serine, arginine, lysine, threonine, asparagine, glutamine, glycine, proline, alanine, valine, isoleucine, leucine, phenylalanine, or a combination thereof, and specifically, may be selected from the group consisting of serine, arginine, threonine, glutamine, glycine, alanine, and a combination thereof, but is not limited thereto. In a specific embodiment, the amino acid may be serine, but is not limited thereto.

[119] Relative to the total volume of the aqueous solution of the present invention, the amino acid may be present in the aqueous solution at an amount of about 1.0 to 5.0% (w / v), about 1.0 to 4.0% (w / v), about 1.0 to 3.0% (w / v), about 1.4 to 3.0% (w / v), about 13 WO 2025 / 058333 PCT / KR2024 / 013486 2.1 to 2.9% (w / v), about 1.4% (w / v), about 2.1% (w / v), about 2.5% (w / v),or about 2.9% (w / v), but is not particularly limited thereto.

[120]

[121] The aqueous solution according to the present invention may further contain a non-ionic surfactant. The non-ionic surfactant refers to a substance that lowers the surface tension of a protein solution to prevent the protein from being adsorbed to or aggregating on the hydrophobic surface after reconstitution.

[122] Specific examples of the non-ionic surfactant available in the present invention may include a polysorbate (e.g., polysorbate 20 (polyoxyethylene (20) sorbitan monolaurate), polysorbate 40 (polyoxyethylene (20) sorbitan monopalmitate), polysorbate 60 (polyoxyethylene (20) sorbitan mono stearate), polysorbate 80 (polyoxyethylene (20) sorbitan monooleate); wherein the number 20 following the polyoxyethylene indicates the total number of oxyethylene groups (-(CH2CH2O)-)), poloxamer (PEO-PPO-PEO copolymer; wherein PEO: poly (ethylene oxide) and PPO: poly (propylene oxide)), polyethylene-polypropyleneglycol, a polyoxyethylene compound (e.g., polyoxyethylene-stearate, polyoxyethylene alkyl ether (alkyl: Cl- C30), polyoxyethylene monoallyl ether, alkylphenyl polyoxyethylene copolymer (alkyl: C1-C30), etc.), and sodium dodecyl sulphate (SDS), and the like or an example thereof may be polysorbate or poloxamer, and these substances may be used alone or in a combination of one or more thereof.

[123] Specifically, the non-ionic surfactant may be poloxamer 188, polysorbate 20, polysorbate 40, polysorbate 60, or polysorbate 80, which may be used in combination, but is not particularly limited thereto.

[124] In the present invention, the non-ionic surfactant may be contained in the aqueous solution of the present invention, relative to the total volume of the aqueous solution, at a concentration of about 0.1% (w / v) or less, for example, about 0.001 to about 0.1% (w / v), about 0.001 to about 0.1% (w / v), about 0.01 to about 0.05% (w / v), about 0.001% (w / v), about 0.0255% (w / v), or about 0.05%(w / v), but is not particularly limited thereto.

[125]

[126] The aqueous solution according to the present invention may not further contain an isotonic agent, and the isotonic agent may be sodium chloride, but is not limited thereto. The aqueous solution of the lyophilized formulation according to the present invention does not contain an isotonic agent and thus allows the collapse temperature during lyophilization to be set higher, thereby reducing the time for a lyophilization process and lowering the osmotic pressure. The present inventors identified that no collapse occurred when the lyophilized formulation containing no isotonic agent according to the present invention was prepared. 14 WO 2025 / 058333 PCT / KR2024 / 013486

[127]

[128] The aqueous solution according to the present invention may further contain a preservative. The preservative is a substance that substantially mitigates the action of bacteria or fungi in the formulation and is a compound contained in the formulation tofacilitate the production of multi-dose preparations. Examples of potential preservatives may include octadecyldimethyl-benzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride (a mixture of alkylbenzyldimethylammonium chloride wherein an alkyl group is a long-chain compound), and benzethonium chloride. Other types of preservatives may include aromatic alcohols, such as phenol, butyl, or benzyl alcohol; alkyl parabens, such as methyl or propyl paraben; catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol, but are not limited thereto. The concentration of the preservative may be 0.001% (w / v) to 1.0% (w / v), but is not limited thereto.

[129]

[130] Meanwhile, the aqueous solution (pre-formulation) for preparing the lyophilized formulation of the present invention may further optionally contain other components or substances known in the art, in addition to the above described buffer, sugar alcohol, sugar, amino acid, non-ionic surfactant, and / or preservative, withinranges that do not impair the advantageous effects of the present invention, but is not limited thereto.

[131]

[132] A specific example of the aqueous solution (pre-formulation) for preparing the lyophilized formulation according to the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL, but is not limited thereto.

[133] Another specific example of the aqueous solution (pre-formulation) for preparing the lyophilized formulation according to the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; a non-ionic surfactant at a concentration of 0.001 to 0.1% (w / v); and an amino acid at a concentration of 1.0 to 3.0% (w / v), but is not limited thereto.

[134] Another specific exampleof the aqueous solution (pre-formulation) for preparing the lyophilized formulation according to the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0 containing 5 to 30 mM histidine; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.1% (w / v); and serine at a concentration of 1.0 to 3.0% (w / v), but is not limited thereto. 15 WO 2025 / 058333 PCT / KR2024 / 013486

[135] Another specific example of the aqueous solution (pre-formulation) for preparing the lyophilized formulation according to the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0 containing 5 to 30 rnM histidine; sucrose, trehalose, or mannitol at a concentration of 1 to 20 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.1% (w / v); and serine at a concentration of 1.0 to 3.0%(w / v), but is not limited thereto.

[136] Additionally, the aqueous solution for preparing the lyophilized formulation or the lyophilized formulation may further contain a pharmaceutically acceptable carrier, an excipient, and the like, and such a carrier or excipient may be non-naturally occurring.

[137]

[138] The lyophilized formulation according to the present invention may include a mixture obtained by lyophilizing 1 to 10 mL of an aqueous solution, and specifically, 5 to 10 mL or 4 to 6 mL of an aqueous solution, but is not limited thereto.

[139] The present inventors prepared 4 or 6 mL of an aqueous solution, followed by lyophilization and subsequent dissolution, and as a result, identified that the recovery rate of a native form was higher for a charging amount of 6 mL, with no significant difference between the two charging amounts.

[140]

[141] The aqueous solution for preparing the lyophilized formulation of the present invention may be frozen and dried under appropriatefreezing and drying conditions known in the art. The drying may be completed in a primary process or through several processes, such as secondary or higher processes.

[142]

[143] The lyophilized formulation of the present invention may be obtained by preparing a pre-formulation including the α-galactosidase A fusion protein at an appropriate concentration considering a desired dosage, lyophilizing the pre-formulation, and then again reconstituting the resultant product to be suitable for administration to a patient. The pre-formulation may be diluted to increase the volume, lyophilized, and then reconstituted with a smaller volume of reconstitution solution compared to the volume during reconstitution, but is not limited thereto. In the present invention, the lyophilized formulation may be a mixture obtained by lyophilizing an aqueous solution containing the α-galactosidase A fusion protein and stabilizers (e.g., a buffer, a sugar, a sugar alcohol, etc.), and further be a reconstitutedformulation obtained by reconstituting the lyophilized formulation using a reconstitution solution, but is not limited thereto.

[144]

[145] The lyophilized formulation according to the present invention can maintain the physical and / or chemical stability of the α-galactosidase A fusion protein while 16 WO 2025 / 058333 PCT / KR2024 / 013486 maintaining the activity thereof even during long-term storage, thereby ensuring excellent long-term stability. For example, the appearance, moisture content, and recovery rate of a native form can be maintained at appropriate levels even under long­ term refrigerated conditions (5 °C) or harsh conditions (40°C).

[146] Specifically, the lyophilized formulation according to the present invention can be stable for a period of time of 2 weeks or longer, 1 month or longer, 3 months or longer, 6 months or longer, 12 months or longer, 18 months or longer, or 24 months or longer even at a temperature of about -80°C to 50°C, for example, about 2°C to 8°C, about5°C, about 35°C, about 40°C, 35°C or higher, or about 40°C or higher, but is not limited thereto.

[147]

[148] The stability of the lyophilized formulation may be examined by a method known in the art, including pharmacopoeia specifications, and test items and criteria for assessing stability may be appropriately set by a person skilled in the art, and the examination is not limited to specific methods.

[149] For example, the lyophilized formulation according to the present invention remains transparent in terms of appearance as a cake or appearance after dissolution even during long-term storage, has a moisture content of less than 5%, less than 4%, less than 3%, less than 2%, or less than 1%, resulting in no deterioration in product quality, and shows a recovery rate of a native form of 85% or more, 90% or more, 95% or more, or 97% or more in SE-HPLC, but is not limited thereto.

[150]

[151] Hereinafter, the α-galactosidase A fusion protein as an active ingredient contained in thelyophilized formulation of the present invention will be described in more detail.

[152]

[153] The α-galactosidase A fusion protein contained in the lyophilized formulation of the present invention refers to a fusion protein in which α-galactosidase A is linked to an immunoglobulin Fc region, and the fusion protein may have a form in which two molecules of α-galactosidase A are linked to the immunoglobulin Fc region in a dimeric form via linkers. Specifically, two molecules of α-galactosidase A may be linked to respective monomers of the immunoglobulin Fc region in a dimeric form via linkers, respectively. The two molecules of α-galactosidase A may form a dimer through non-covalent bonds, but are not limited thereto. The fusion protein of the present invention has increased stability of α-galactosidase A due to the fusion of the immunoglobulin Fc region to the α-galactosidase A thereby exerting pharmacological efficacy for a long time in the body. The lyophilized formulation of thepresent invention does not lose the pharmacological efficacy despite long-term storage since a 17 WO 2025 / 058333 PCT / KR2024 / 013486 pre-formulation containing stabilizers in addition to the fusion protein is lyophilized to impart excellent stability to the fusion protein.

[154] Specifically, the fusion protein of the present invention may include the amino acid sequence of SEQ ID NO: 4, or may be encoded by the polynucleotide sequence of SEQ ID NO: 5, but is not limited thereto. The fusion protein of the present invention may be a dimer formed of two monomers including the amino acid sequence of SEQ ID NO: 4, but is not limited thereto. For the fusion protein of the present invention, the disclosure of WO 2019 / 125059 is incorporated as a reference.

[155]

[156] As used herein, the terms "fusion protein in which α-galactosidase A is linked to an immunoglobulin Fc region", "α-galactosidase A fusion protein", and "fusion protein" may be interchangeably used.

[157] The fusion protein of thepresent invention is expressed within a transformant in a form in which α-galactosidase A is linked to the immunoglobulin Fc region via a linker, so that α-galactosidase A forms a dimer via non-covalent bonds when the immunoglobulin Fc region forms the dimer.

[158]

[159] The α-galactosidase A (alpha-galactosidase A, α-Gal A, GLA) of the present invention is an enzyme that is present in lysosomes of the spleen, brain, liver, and the like and hydrolyzes α-galactosyl moieties at the ends of glycolipids and glycoproteins, and is a homodimeric glycoprotein. Particularly, α-galactosidase A is known to be involved in Fabry disease, which is a lysosomal storage disease. The a-galactosidase A has a dimeric structure consisting of two domains (TIM barrel domain and β-sheet containing immunoglobulin-like domain) (Journal of Biological Chemistry, Vol. 287, No. 34, 2012; and Lieberman et al. Biochemistry, Vol. 48, No. 22, 2009). The a- galactosidase A unfolds under a high pH environment, andtherefore a formulation containing α-galactosidase A is required to maintain an appropriate level of pH. Particularly, the active site is maintained in the state of soluble aggregates formed as one domain unfolds, but the activity is lost once insoluble aggregates are formed as unfolding further proceeds, and thus the lyophilized formulation is required to include stabilizers to exert the enzymatic activity by maintaining the soluble aggregate state. In the present invention, the α-galactosidase A may be in a native form or in a recombinant form and, specifically, may include the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.

[160] The α-galactosidase A includes fragments of a native form, or analogs thereof, without limitation, having mutations selected from the group consisting of substitution, addition, deletion, modification, and a combination thereof as long as the analogs have activity equivalent to that of the native form of the enzyme. 18 WO 2025 / 058333PCT / KR2024 / 013486

[161] The α-galactosidase A may include an amino acid sequence having at least 60%, 70%, or 80%, specifically at least 90%, more specifically, at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of SEQ ID NO: 1, and may be obtained from microorganisms by using recombination technology or be commercially available, but is not limited thereto.

[162] As used herein, the term "homology" refers to a degree of similarity with a wild­ type amino acid sequence or a wild-type nucleotide sequence, and the homology comparison may be conducted by observation with the naked eye or using a commercially available comparison program. The commercially available computer program may be used to calculate the homology between two or more sequences as a percentage (%). The homology (%) may be calculated between adjacent sequences. The terms "homology" and "identity" may often be used interchangeably.

[163] The information on thesequences of α-galactosidase A or derivatives thereof and nucleotide sequences encoding the same may be obtained from known databases, such as NCBI.

[164] The α-galactosidase A fusion protein of the present invention may be prepared by expression in the form, in which α-galactosidase A is linked to an immunoglobulin Fc region via a linker, within a transformant.

[165]

[166] The linker is a peptide linker, and the fusion protein of the present invention may be in the form in which α-galactosidase A is linked to the immunoglobulin Fc region via the peptide linker. One end of the linker may be linked to one chain of the immunoglobulin Fc region in a dimer form, but is not limited thereto.

[167]

[168] The peptide linker may contain one or more amino acids, for example, 1 to 1000 amino acids. The peptide linker may be any peptide linker known in the art, for example, including [GS]x linker, [GGGS]x linker, and [GGGGS]x linker, and the like, wherein x may be a natural number of 1 or greater(e.g., 1, 2, 3, 4, 5, or greater), but is not limited thereto. Specifically, the peptide linker of the present invention may be composed of 10 to 50 amino acids, more specifically, 20 to 40 amino acids, and may include the amino acid sequence of SEQ ID NO: 2.

[169]

[170] In an aspect of the present invention, the sites of the α-galactosidase A and the immunoglobulin Fc region, to which the peptide linker is linked, are not limited as long as the activity of α-galactosidase A is maintained, and α-galactosidase A is linked to the immunoglobulin Fc region. Specifically, the sites may be at a terminal of each of the α-galactosidase A and the immunoglobulin Fc region, more specifically, the 19 WO 2025 / 058333 PCT / KR2024 / 013486 C-terminus of the α-galactosidase A and the N-terminus of the immunoglobulin Fc region, but are not limited thereto.

[171] As used herein, the term "N-terminus" or "C-terminus" refers to the amino terminus and the carboxyl terminus of a protein, respectively. Examplesthereof may include the last amino acid residue of the N-terminus or the C-terminus but also amino acid residues near the N-terminus or the C-terminus, specifically, the first amino acid residue to the 10th amino acid residue from the last end.

[172] In the present invention, the peptide linkers may be linked to the monomers of the immunoglobulin Fc region in a dimeric form composed of monomeric immunoglobulin Fc regions, respectively, and each of the linkers respectively linked to the monomers of the immunoglobulin Fc region may be independently linked to one molecule of α-galactosidase A, respectively, but are not limited thereto.

[173]

[174] The immunoglobulin Fc region, one moiety constituting the enzyme fusion protein of the present invention, may be a dimer formed of immunoglobulin Fc region monomers.

[175] As used herein, the term "immunoglobulin Fc region" refers to a region including a heavy chain constant domain 2 (CH2) and / or a heavy chain constant domain 3 (CH3) excludingthe heavy chain and light chain variable domains of immunoglobulin. In an aspect of the present invention, such an immunoglobulin Fc region may include a modified hinge region, but is not limited thereto. Specifically, the immunoglobulin Fc region may have mutations selected from the group consisting of substitution, addition, deletion, modification, and any combination thereof in the native immunoglobulin Fc region, but is not limited thereto.

[176] The immunoglobulin Fc region is a substance used as a carrier in drug manufacturing. To stabilize proteins and prevent the elimination of proteins by the kidneys, research on fusion proteins using immunoglobulin Fc regions has recently been actively conducted. Immunoglobulins are major constituents of the blood, and there are five different types, IgG, IgM, IgA, IgD, and IgE. The most frequently used type for fusion protein studies is IgG, which is classified into four subtypes, IgGl to IgG4.

[177] The immunoglobulin Fc region may includea hinge region in the heavy chain constant domain, and the immunoglobulin Fc region monomers may constitute a dimer via the hinge region, but is not limited thereto. The immunoglobulin Fc region of the present invention may be an extended Fc region including a part of or the entirety of a heavy chain constant domain 1 (CHI) and / or a light chain constant domain 1 (CLI) excluding the heavy chain and the light chain variable domains of the immunoglobulin, as long as the immunoglobulin Fc region has substantially identical or enhanced effects compared with the native form. Additionally, the immunoglobulin Fc region 20 WO 2025 / 058333 PCT / KR2024 / 013486 of the present invention may be a region from which a considerably long amino acid sequence corresponding to CH2 and / or CH3 is eliminated.

[178] Specifically, the immunoglobulin Fc region of the present invention may include 1) a CHI domain, a CH2 domain, a CH3 domain, and a CH4 domain, 2) a CHI domain and a CH2 domain, 3) a CHI domain and aCH3 domain, 4) a CH2 domain and a CH3 domain, or 5) a combination of one or more domains selected from a CHI domain, a CH2 domain, a CH3 domain, and a CH4 domain and an immunoglobulin hinge region (or a part of the hinge region), but is not limited thereto. However, the immunoglobulin Fc region of the present invention is not limited thereto. More specifically, the immunoglobulin Fc region may include a hinge region, a CH2 domain, and a CH3 domain, but is not limited thereto.

[179]

[180] As used herein, the term "hinge sequence" refers to a site located on a heavy chain to form the dimer of the immunoglobulin Fc region via an inter-disulfide bond, and the immunoglobulin Fc region of the present invention may be in a form in which two molecules of immunoglobulin Fc chains form a dimer due to the presence of the hinge sequence.

[181] Specifically, the hinge region may be mutated to include only one cysteine (Cys) by a deletion of a part of the hinge region, or to include a proline (Pro)residue substituted for a serine (Ser) residue involved in chain exchange. More specifically, the hinge region may have a substitution of the serine residue at the 2nd position with a proline residue, but is not limited thereto. The immunoglobulin Fc region of the present invention may include the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

[182]

[183] The immunoglobulin Fc region of the present invention encompasses not only a native sequence obtained from papain digestion of an immunoglobulin, but also derivatives, substituents, and variants thereof, for example, sequences different from the native sequence and obtained by mutation of one or more amino acid residues by deletion, addition, non-conservative or conservative substitution, or a combination thereof. The derivatives, substituents, and variants are assumed to possess the ability to bind to FcRn.

[184] For example, the amino acid residues at positions 214 to 238, 297 to 299, 318 to 322, or 327 to 331 inIgG Fc, which are known to be important for linkage, may be used as sites suitable for mutation.

[185] In addition, various types of derivatives are possible by, for example, removing a site capable of forming a disulfide bond, deleting some amino acid residues at the N-terminus of native Fc, or adding a methionine residue at the N-terminus of 21 WO 2025 / 058333 PCT / KR2024 / 013486 native Fc. In addition, for removal of effector functions, complement-binding sites, for example, a Clq-binding site, may be removed, and an antibody dependent cell mediated cytotoxicity (ADCC) site may be removed. The techniques for preparing such sequence derivatives of the immunoglobulin Fc region are disclosed in WO 97 / 34631 and WO 96 / 32478, and the like.

[186] Amino acid exchanges in proteins and peptides that do not alter the entire activity of molecules are well known in the art (H. Neurath, R. L. Hill, The Proteins, Academic Press, New York, 1979). The exchanges that occur most commonly are exchangesbetween amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. In some cases, modifications may occur by phosphorylation, sulfation, acrylation, glycosylation, methylation, farnesylation, acetylation, amidation, or the like.

[187] The above described Fc derivatives exhibit a biological activity equivalent to that of the Fc region of the present invention, and may have an enhanced structural stability of the Fc region against heat, pH, and the like.

[188] Such an Fc region may be obtained from native forms isolated from living bodies of humans or animals, such as cows, goats, pigs, mice, rabbits, hamsters, rats, and guinea pigs, or may be recombinant forms or derivatives thereof obtained from transformant animal cells or microorganisms. Particularly, the Fc region may be obtained from a native form by isolating a whole immunoglobulin from a living human or animalbody and then treating the isolated immunoglobulin with protease. The isolated whole immunoglobulin is digested into Fab and Fc when treated with papain, and digested into pF'c and F(ab)2 when treated with pepsin. These fragments may be subjected to size exclusion chromatography or the like to separate Fc or pF'c therefrom. In a more specific embodiment, the immunoglobulin Fc region is a recombinant immunoglobulin Fc region where a human-derived Fc region is obtained from a microorganism.

[189] Alternatively, the immunoglobulin Fc region may be in the form of native glycans, increased glycans compared with the native form, or decreased glycans compared with the native form, or may be in a deglycosylated form. The increase, decrease, or removal of the immunoglobulin Fc glycans may be achieved by using conventional methods, such as a chemical method, an enzymatic method, and a genetic engineering method using a microorganism. Particularly, the immunoglobulin Fc region obtained by removalof glycans from Fc exhibits a significant deterioration in binding affinity for the complement clq and a reduction or loss in antibody-dependent cytotoxicity or complement-dependent cytotoxicity, and thus causes no unnecessary immune response in vivo. In this regard, a deglycosylated or aglycosylated immunoglobulin Fc region may be more suitable as a drug carrier for its own purpose. 22 WO 2025 / 058333 PCT / KR2024 / 013486

[190] As used herein, the term "deglycosylation" indicates an Fc region in which glycans are removed by an enzyme, and the term aglycosylation indicates a non-glycosylated Fc region produced in prokaryotes, more specifically E. coli.

[191]

[192] Meanwhile, the immunoglobulin Fc region of the present invention may originate from humans, or animals, such as cows, goats, pigs, mice, rabbits, hamsters, rats, and guinea pigs, and more specifically, the immunoglobulin Fc region originates from humans.

[193] In addition, the immunoglobulin Fc region may be an Fc region derivedfrom IgG, IgA, IgD, IgE, IgM, or a combination or hybrid thereof. In a more specific embodiment, the immunoglobulin Fc region is derived from IgG or IgM, which is most abundant in the human blood, and in a still more specific embodiment, the immunoglobulin Fc region is derived from IgG, which is known to increase the half-lives of ligand-binding proteins. In a still more specific embodiment, the immunoglobulin Fc region is an IgG4 Fc region, and in a still more specific embodiment, the immunoglobulin Fc region is an aglycosylated Fc region derived from human IgG4, but is not limited thereto. The immunoglobulin Fc region of the present invention may include the amino acid sequence of SEQ ID NO: 3, but is not limited thereto. More specifically, the immunoglobulin Fc region may include a monomer having the amino acid sequence of SEQ ID NO: 3, and the immunoglobulin Fc region may be a homodimer of monomers each having the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

[194]

[195] As used herein, the term "combination" refers to the formation of a linkage between a polypeptide encoding a single-chain immunoglobulin Fc region of the same origin and a single-chain polypeptide of a different origin when a dimer or a multimer is formed. That is, a dimer or multimer may be prepared from two or more fragments selected from the group consisting of IgG Fc, IgA Fc, IgM Fc, IgD Fc, and IgE Fc fragments.

[196]

[197] The immunoglobulin Fc region of the α-galactosidase A fusion protein may be in a dimeric form, specifically, and may have a structure in which two polypeptide chains are linked to each other via a disulfide bond. More specifically, the two chains may be linked via a nitrogen atom of one chain thereof, but are not limited thereto. The linkage via a nitrogen atom may be achieved by reductive amination of an ε-amino atom of lysine or the N-terminal amino group, but is not limited thereto. In one specific embodiment, the immunoglobulin Fc region mayachieve the linkage via a nitrogen atom of proline at the N-terminus thereof, but is not limited thereto. One Fc region of 23 WO 2025 / 058333 PCT / KR2024 / 013486 the dimeric form may be covalently linked to two molecules of α-galactosidase A via two linkers, but is not limited thereto.

[198]

[199] Unless otherwise stated herein, the disclosure of the α-galactosidase A or fusion protein according to the present invention in the detailed description or claims may be applied to not only the α-galactosidase A or fusion protein but also salts thereof (e.g., pharmaceutically acceptable salts) or solvate forms thereof. Thus, although only "a- galactosidase A" or "fusion protein" is described herein, the corresponding disclosure may also be applied to particular salts thereof, particular solvates thereof, and solvates of the particular salts. These salts may be, for example, in the form in which any pharmaceutically acceptable salt is used. The type of salts is not particularly limited. However,the salts are preferably in the form that is safe and effective for a subject, for example, a mammal, but is not particularly limited thereto.

[200] The term "pharmaceutically acceptable" refers to a substance that can be effectively used for a desired purpose without causing excessive toxicity, irritation, allergic responses, and the like within the scope of the medical and pharmaceutical decision.

[201] As used herein, the term "pharmaceutically acceptable salt" refers to a salt derived from pharmaceutically acceptable inorganic acids, organic acids, or bases. Examples of suitable salts may include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-p-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid, benzoic acid, malonic acid, naphthalene-2- sulfonic acid, benzene sulfonic acid, and the like. Salts derivedfrom suitable bases may include alkali metals such as sodium and potassium, alkali earth metals such as magnesium, ammonium, and the like.

[202] As used herein, the term "solvate" refers to a complex formed between the a- galactosidase A, fusion protein, or salt thereof according to the present invention and a solvent molecule.

[203]

[204] The fusion protein may be prepared or manufactured by any method known in the art, and specifically, the fusion protein may be obtained by culturing animal cells, into which an expression vector is inserted, and purifying the culture, or may be synthesized on the basis of the sequence thereof, but is not limited thereto.

[205]

[206] The lyophilized formulation of the present invention may be used to prevent, treat, and alleviate a disease, such as α-galactosidase A deficiency, which may be prevented, treated, or alleviated by administration of the α-galactosidase A fusion protein, but is not limited thereto. 24 WO 2025 / 058333 PCT / KR2024 / 013486

[207] The α-galactosidase A fusion protein of the present invention may be used as a drug for Enzyme Replacement Therapy (ERT). The Enzyme Replacement Therapy enables the prevention or treatment of a disease through the recovery of enzyme hypofunction by supplementing deficient or insufficient enzymes causing the disease.

[208] Specifically, the lyophilized formulation of the present invention may be used to prevent, treat, or alleviate α-galactosidase A deficiency. The α-galactosidase A deficiency is a lysosomal storage disease caused by deficiency of a-galactosidase A (α-Gal A), a lysosomal enzyme, and examples thereof include Fabry Disease, Angiokeratoma Diffuse, Angiokeratoma Corporis Diffusum, and Hereditary Dystopic Lipidosis.

[209] Fabry disease, one of the lysosomal storage diseases, is a recessively inherited disorder caused by X-chromosomal inactivation. Fabry disease is a congenital metabolic disorder of glyco sphingolipid caused by deficient or insufficient activity ofα-galactosidase A. It has been known that globotriaosylceramide (Gb3) is abnormally accumulated on the blood vessel wall and various parts of the body, such as skin, kidneys, heart, and nervous system, due to the abnormality of a- galactosidase A, significantly affecting the reduction of blood circulation and nutrient supply. Symptoms, such as hypersensitivity to cold, severe pain, acroparesthesia, angiokeratoma, corneal opacity, cardiac ischemia, myocardial infarction, and renal failure, occur, and eventually the kidneys fail to function properly, resulting in death.

[210] As used herein, the term "prevention" refers to any action that inhibits or delays the onset of a disease by administration of the fusion protein or a lyophilized formulation containing the fusion protein, and the term "treatment" refers to any action that alleviates, ameliorates, or beneficially changes the symptoms of a target disease by administration of the fusion protein or a lyophilized formulation containingthe fusion protein.

[211]

[212] In a specific embodiment of the present invention, the lyophilized formulation of the present invention may be used to prevent or treat Fabry disease, but is not limited thereto.

[213] In addition, the lyophilized formulation of the present invention may be administered via a subcutaneous route, but is not limited thereto. Specifically, the lyophilized formulation of the present invention in a lyophilized state may be reconstituted to be suitable for subcutaneous administration.

[214] As used herein, the term "administration" refers to the introduction of the reconstituted lyophilized formulation into a patient by any suitable method. The administration route of the lyophilized formulation is not particularly limited, but the lyophilized formulation may be administered by any general route as long as the a- 25 WO 2025 / 058333 PCT / KR2024 / 013486 galactosidase A fusion protein of the lyophilized formulation can reach a target in the living body, for example,intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, topical administration, intranasal administration, intrapulmonary administration, or rectal administration, but is not limited thereto.

[215]

[216] A preferred dosage of the fusion protein of the present invention may be about 0.0001 mg to 500 mg per 1 kg of the body weight of a patient per day, and the lyophilized formulation of the present invention may be formulated for appropriate dosage administration or reconstituted for appropriate dosage administration. However, with respect to the dosage of the fusion protein, the effective dose thereof is determined considering various factors, such as the patient's age, body weight, health condition, and sex, the severity of the disease, diet, and excretion rate, in addition to the route of administration and the frequency of treatment, and therefore, considering these, aperson skilled in the art can easily determine an effective dose that is appropriate for the particular use of the lyophilized formulation of the present invention.

[217]

[218] In accordance with still another aspect of the present invention, there is provided a method for preparing the lyophilized formulation.

[219] Specifically, the preparation method may include lyophilizing an aqueous solution containing an α-galactosidase A fusion protein, a buffer, and a sugar or sugar alcohol.

[220] The aqueous solution or lyophilized formulation may further contain at least one component selected from the group consisting of an amino acid, a non-ionic surfactant, and a preservative.

[221] The aqueous solution, lyophilized formulation, and constituting components thereof are as described above.

[222] The method may include lyophilizing 1 to 10 mL, specifically, 5 to 10 mL of an aqueous solution containing: an α-galactosidase A fusion protein in which a- galactosidase A is linked to animmunoglobulin Fc region; a buffer; and a sugar or sugar alcohol, but is not limited thereto.

[223]

[224] In accordance with still another aspect of the present invention, there is provided a method for reconstituting the lyophilized formulation, the method including adding a reconstitution solution to the lyophilized formulation.

[225] The aqueous solution, lyophilized formulation, and reconstitution are as described above. 26 WO 2025 / 058333 PCT / KR2024 / 013486

[226] As used herein, the term "reconstitution solution" refers to a solution that is added to a lyophilized formulation in a solid state to achieve reconstitution. Examples of the reconstitution solution may include distilled water (water), but are not particularly limited thereto.

[227] The reconstituted formulation may contain an α-galactosidase A fusion protein at a concentration suitable for administration to a subject, and specifically, may contain an α-galactosidase A fusion protein at a concentration of 10 to 100 mg / mL,10 to 90 mg / mL, 10 to 50 mg / mL, or 10 to 30 mg / mL, but is not limited thereto.

[228] The reconstituted formulation may be obtained by reconstituting the lyophilized formulation according to the present invention to be suitable for subcutaneous administration to a subject, but is not limited thereto.

[229]

[230] In accordance with still another aspect of the present invention, there is provided a lyophilized formulation for preventing or treating a disease.

[231] The lyophilized formulation is as described above.

[232] An example of the disease may be Fabry disease, but any disease for which the lyophilized formulation or the α-galactosidase A fusion protein included therein in the present invention can exhibit a preventive or therapeutic effect may be included without limitation.

[233]

[234] In accordance with still another aspect of the present invention, there is provided the use of the lyophilized formulation for preventing or treating a disease.

[235] The lyophilized formulationand disease are as described above.

[236]

[237] Hereinafter, the present invention will be described in detail with reference to examples and experimental examples. However, the following examples and experimental examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto.

[238]

[239] Example 1: Preparation of fusion protein of α-galactosidase A and immunoglobulin Fc region

[240]

[241] A fusion protein of α-galactosidase A and an immunoglobulin Fc region (hereinafter, referred to as α-galactosidase A fusion protein, SEQ ID NO: 4), in which native a- galactosidase A (SEQ ID NO: 1) and an immunoglobulin Fc region (SEQ ID NO: 3) were linked via a linker (SEQ ID NO: 2), was prepared.

[242] 27 WO 2025 / 058333 PCT / KR2024 / 013486

[243] Specifically, a polynucleotide (SEQ ID NO: 5) encoding the α-galactosidase A fusion protein was inserted into an XOGC vector as an expression vector, by using a restriction enzyme to construct a vectorexpressing the α-galactosidase A fusion protein.

[244]

[245] The DNA and protein sequences of the α-galactosidase A fusion protein are as shown in Table 1 below. In the protein sequence of Table 1 below, the underlined texts indicate a signal sequence, bold letters indicate amino acid substitutions, and italic letters indicate the linker. The α-galactosidase A fusion protein of the present invention is a dimer formed of two monomers each including the amino acid sequence of SEQ ID NO: 4.

[246]

[247] [Table 1] 28 WO 2025 / 058333 PCT / KR2024 / 013486 Sequence SEQ ID NO Protein MQLRNPELHL GCALALRFLA LVSWDIPGAR 4 ALDNGLARTP TMGWLHWERF MCNLDCQEEP DSCISEKLFM EMAELMVSEG WKOAGYEYLC IDDCWMAPQR DSEGRLQADP QRFPHGIRQL ANYVHSKGLK LGIYADVGNK TCAGFPGSFG YYDfDAQTFA DWGVDLLKFD GCYCDSLENL ADGYKHMSIA LNRTGRSIVY SCEWPLYMWP FQKPNYTEIR QYCNHWRNFA DIDDSWKSIK S1LDWTSFNQ ERMDVAGPG GWNDPDMLVI GNFGLSWNQQ VTQMALWAM AAPLFMSNDL RHISPQAKAL LQDKWIAiN QDPLGKQGYQ LRQGDNFEVW ERPLSGLAWA VAMINRQEIG GPRSYTIAVA SLGKGVACNPACFITQLLPV KRKLGFYEWT SRLRSHINPT GTVLLQLENT MQMSLKDLLG GGGSGGGGSG GGGSGGGGSG GGGSGGGGSP PCPAPEFLGG PSVFLFPPKP KDTLMISRTP EVTCVWQFiW YVDGVEVHNA KTKPREEQFQ STYRWSVLT VLHQDWLNGK EYKCKVSNKG LPSSIEKTIS KAKGQPREPQVYTLPPSQEE MTKNQVSLTC LVKGFYPSDI AVEWESNGQP ENNYKTTPPV LDSDGSFFLY SRLTVDKSRW QEGNVFSCSV MHEALHNHYTQKSLSLSLGK DNA ATGCAGCTGA GGAACCCAGA ACTACATCTG GGCTGCGCGC TTGCGCTTCG CTTCCTGGCC 5 CtcgtttCCT GGGACATCCC TGGGGCTAGA GCACTGGACA ATGGATTGGC AAGGACGCCT ACCATGGGCT GGCTGCACTG GGAGCGCTTC ATGTGCAACC TTGACTGCCA GGAACMGCCA GATTCCTGCA TCAGTGAGAA GCTCTTCATG GAGATGGCAG AGCTCATGGT CTCAGAAGGC TGGAAGGATG CAGGTTATGA GTACCTCTGC ATTGATGACT GTTGGATGGC TCCCCAAAGA GATTCAGAAG GCAGACTTCA GGCAGACCCT CAGCGCKTC CTCATGGGAT TCGCCAGCTA GCTAATTATG TTCACAGCAA AGGACTGAAG 29 WO 2025 / 058333 PCT / KR2024 / 013486 29 WO 2025 / 058333 PCT / KR2024 / 0 GGTTGTTACT GTGACAGTTT ggaaaatttg GCAGATGGTT ATAAGCACAT GTCCTTGGCCCTGAATAGGA CTGGCAGAAG CATTGTGTAC TCCTGTGAGT GGCCTCTTTA TATGTGGCCC TTTCAAAAGC CCAATTATAC AGAAATCCGA CAGTACTGCA ATCACTGGCG AAATTTTGCT GACATTGATG ATTCCTGGAA AAGTATAAAG AGTATCTTGG ACTGGACATC TTTTAACCAG GAGAGAATTG TTGATGTTGC TGGACCAGGG GGTTGGAATG ACCACAGATAT GTTAGGATT GGCAACTTTG GCCTCAGCTG GAATCAGCAA GTAACTCAGA TGGCCCTCTG GGCTATCATG GCTGCTCCTT TATTCATGTC TAATGACCTC CGACACATCA GCCCTCAAGC CAAAGCTCTC CTTCAGGATA AGGACGTAAT TGCCATCAAT CAGGACCCCT TGGGCAAGCA AGGGTACCAG CTTAGACAGG GAGACAACTT TGAAGTGTGG GAACGACCTC TCTCAGGCTT AGCCIGGGCT GTAGCTATGAAACCCGGCA GGAGATTGGT GGACCTCGCT CTTATACCAT CGCAGTTGCT TCCCTGGGTA AAGGAGTGGC CTGTAATCCT GCCTGCTTCA TCACACAGCT CCTCCCTGTG AAAAGGAAGC TAGGGTTCTA TGAATGGACT TCAAGGTTAA GAAGTCACAT AAATCCACA GGCACTGTTT TGCTTCAGCT AGAAAATACA ATGCAGATGT CATTAAAAGA CTTACTTGGC GGCGGAGGTT CAGGTGGTGG TGGCTCGGC GGTGGAGGGT CGGGGGGAGG CGGCTCTGGA GGAGGGGGCT CCGGTGGGGG AGGTAGCCCA CCATGCCCAG CACCTGAGTTCCTGGGGGGA CCATCAGTCT TCCTGTTCCC CCCAAAACCC AAGGACACCC TCATGATCTC CCGGACCCCT GAGGTCACATGCGTGGTGGT GGACGTGAGC CAGGAAGACC CTGAGGTCCA GTTCAACTGG TACGTGGACG GCGTGGAGGT GCATAATGCC AAGACAAAGC CGCGGGAGGA GCAGTTCCAA AGCACGTACC GTGTGGTCAG CGTCCTCACC GTCCTGCACC AGGACTGGCT GAATGGCAAG GAGTACAAGT GCAAGGTCTC CAACAAAGGC CTCCCATCCT CCATCGAGAA AACCATCTCC AAAGCCAAAG GGCAGCCCCG AGAACCACAG GTGTACACCC TGCCCCCATC CCAGGAGGAG ATGACCAAGA ACCAGGTCAG CCTGACCTGC CTGGTCAAAG GCTTCTATCC CAGCGACATC 30 WO 2025 / 058333 PCT / KR2024 / 013486

[249] GCCGTGGAGT GGGAGAGCAA TGGGCAGCCG GAGAACAACT ACAAGACCAC GCCTCCCGTG CTGGACTCCG ACGGCTCCTT CTTCCTCTAC AGCAGGCTAA CCGTGGACAA GAGCAGGTGG CAGGAGGGGA ACGTCTTCTC ATGCTCCGTG ATGCATGAGG CTCTGCACAA CCACTACACG CAGAAGAGCC TCTCCCTGTC TCTGGGTAAA TGA

[250]

[251] The constructed vector (pXOGC-alpha-galactosidase-Fc) expressing the a- galactosidase A fusion protein was transfected into a CHO-S cell line to prepare a cell line capable of mass producing the α-galactosidase A fusion protein.

[252]

[253] Specifically, CHO-S cells were suspension-cultured in a 1-L Erlenmeyer flask(Corning, cat. No. 431147) using a serum-free medium (FreeStyle CHO Expression Medium, Thermo Fisher, cat. No. 12651014). When the cells in the culture vessel reached 5X108, the cells were transformed using FreeStyle Max (Thermo Fisher, cat. No. 16447-100). That is, 10 mL of OptiPro SFM (Thermo Fisher, cat. No. 12309-019) was placed into each of two tubes. To one tube, 500 pg of DNA was added, and to the other tube, 500 μΕ of FreeStyle Max was added. Then, the two solutions were mixed and allowed to stand at room temperature for 10 minutes. Thereafter, the mixture was added to the cells, for which the medium had been pre-exchanged with fresh FreeStyle CHO expression medium (Thermo Fisher, cat. No. 12651014). The cells were cultured for about 96 hours under the conditions of 37°C, 5% CO2, and 125 rpm to prepare the α-galactosidase A fusion protein.

[254]

[255] In the α-galactosidase A fusion protein thus prepared, each of the two immunoglobulin Fc region monomers constituting the dimeris linked to one a- galactosidase A, thereby forming a structure in which the immunoglobulin Fc region in the dimeric form is fused to two molecules of α-galactosidase A.

[256]

[257] Example 2; Improvement in appearances of lyophilized formulation according to pH changes

[258]

[259] Example 2-1: Preparation of lyophilized formulations

[260]

[261] Several lyophilized formulations were prepared with various combinations of pH and contents of the nonionic surfactant and amino acid. The lyophilized formulations were evaluated for appearance, appearance after dissolution, and SE-HPLC analysis. 31 WO 2025 / 058333 PCT / KR2024 / 013486

[262]

[263] For the preparation of the lyophilized formulations, each solution for formulations having the compositions shown in Table 2 below was aliquoted into a glass vial (20 mL) with 4.0 mL, half-capped with a rubber stopper, and then loaded on a shelf of a freeze dryer (Lyostar 3, SP scientific). Subsequently, lyophilization was conducted under the conditionsshown in Table 3 below, and the prepared lyophilized formulation was capped with an aluminum cap after the completion of aluminum lyophilization.

[264]

[265] [Table 2] Fusion protein (Fc-GLA (mg / mL)) Buffer (L-Histidine (mM)) Amino acid (L-Serine Non-ionic surfactant (Polysorbate 20 (%, (w / v))) pH 1 30 10 2.1 0.001 6.0 2 30 10 2.1 0.001 7.0 3 30 10 2.1. 0.05 6.0 4 30 10 2.1 0.05 7.0 5-7 30 10 2.5 0.0255 6.5 8 30 10 2.9 0.001 6.0 9 30 10 2.9 0.001 7.0 10 30 10 2.9 0.05 6.0 11 30 10 2.9 0.05 7.0

[266]

[267] [Table 3] 32 WO 2025 / 058333 PCT / KR2024 / 013486 Loading Freezing Primary drying Secondary drying Temperature (°C) 5 -55 -25 25 Temperature change rate fC / min) 0 0.33 0.33 0.25 Holding time (min) 30 300 4500 1200 Pressure (mTorr) N / A N / A 60 50

[268]

[269] Example 2-2: Dissolution and appearance of lyophilized formulations

[270]

[271] Each lyophilized vial was allowed to stand at room temperature for 30 minutes to remove the moisture generated on the vial surface, and then the appearanceof a cake was examined.

[272] A 25G needle (1 inch or more) was fitted onto a 2 mL syringe, and 2 mL of distilled water was drawn out, and then injected into each vial containing the lyophilized product at a 90-degree angle. Since the vacuum was maintained inside the vial, the distilled water was automatically injected.

[273] Upon the completion of distilled water injection, the needle and syringe were separated to release the remaining vacuum inside the vial, and then the needle was removed. The vial was shaken 5 times and left to stand until the lyophilized cake dissolved.

[274] The appearance of the dissolved solution in the vial was examined, and then the vial was allowed to stand under refrigeration for 3 days, followed by subsequent appearance examination.

[275]

[276] Example 2-3: Size exclusion liquid chromatography (SE-HPLC)

[277]

[278] The lyophilized product dissolved in Example 2-2 was diluted using a mobile phase (IxPBS, Lonza) to a concentration of 1 mg / mL and thenfiltered using a 0.2-pm syringe filter. Thereafter, 200 pL of the filtered sample was injected into a vial insert and then prepared in a screw top vial.

[279] Subsequently, the mobile phase was connected to a pump, and then an assay column (TSKgel G3000SWXL, Tosoh) was mounted on Waters e2695 and Waters 2489 instruments (Waters) while the mobile phase flowed at a flow rate of 0.5 mL / min. 33 WO 2025 / 058333 PCT / KR2024 / 013486 The sample was equilibrated by flowing the mobile phase at a flow rate of 0.5 mL / min for 30 minutes or longer until detector signals were stabilized. When the temperature of an autosampler was lowered to 4°C, the sample was placed into the sampler, and 10 qL of the sample was injected. Thereafter, the mobile phase was allowed to flow for 35 minutes, and detection peaks were identified at 214 nm. Analysis was performed by Empower Pro software on a PC.

[280]

[281] Example 2-4: Comparison of appearances and recovery rates of native form of lyophilized formulationsaccording to pH changes

[282]

[283] First, as a result of comparing the cake appearance among the lyophilized formulations prepared in Example 2-2, the appearance was appropriate without serious collapse under all the conditions (FIG. 1).

[284] The appearance immediately after dissolution was transparent under all the conditions, but the appearance after 3 days of standing under refrigeration became more turbid as the pH decreased (FIG. 1). Specifically, the lyophilized formulations with a pH of 6.5 or higher showed a transparent appearance after dissolution.

[285]

[286] As a result of examining the recovery rate of the native form in the prepared lyophilized formulations by size exclusion chromatography, the recovery rate of the native form decreased as the pH was lowered (FIG. 2). Specifically, the lyophilized formulations with a pH of 6.5 or higher showed a high recovery rate of the native form. The native form indicates the α-galactosidase A fusion protein prepared in Example 1-1.

[287]

[288] The results of comparing the appearances and recovery rates of the native form of the lyophilized formulations according to pH changes are summarized in Table 4 below.

[289]

[290] [Table 4] 34 WO 2025 / 058333 PCT / KR2024 / 013486 # Cake appearance of lyophilized product Appearance immediately after dissolution Appearance after dissolution followed by storage for three days Recovery rate of native form (%) 1 Elegant Transparent Very turbid 96.5 2 Elegant Transparent Transparent 97.8 3 Elegant Transparent Turbid 95.3 4 Elegant Transparent Transparent 98.0 5-7 Elegant Transparent Transparent 96.1 8 Elegant Transparent Very turbid 92.4 9 Elegant Transparent Transparent 95.7 10 Elegant Transparent Slightly turbid 87.8 11 Elegant Transparent Transparent 90.5

[291]

[292] Example 3: Conditions for improving recovery rate of native form through pH, change in filling volume, and sugar screening

[293]

[294] Example 3-1: Preparation of lyophilized formulations

[295]

[296] After it wasconfirmed that the appearance after dissolution was improved for the formulations with a pH of 6.5 or higher in the above Example 2, for the purpose of increasing the recovery rate of the native form, various lyophilized formulations were prepared by adding a buffer, an amino acid, a nonionic surfactant, varying filling volume, and three types of sugars (sucrose, trehalose, mannitol) to the final raw solution, and then size exclusion chromatography analysis was performed.

[297]

[298] Each solution for formulations having the compositions shown in Table 5 below was aliquoted into a glass vial (20 mL) with 4 mL or 6 mL, half-capped with a rubber stopper, and then loaded on a shelf of a freeze dryer (Lyostar 3, SP scientific). Subsequently, lyophilization was conducted under the conditions shown in Table 6 below, and the prepared lyophilized formulation was capped with an aluminum cap after the completion of aluminum lyophilization.

[299]

[300] [Table 5] 35 WO 2025 / 058333PCT / KR2024 / 013486 # pH Buffer (L-Histidine (mM» Fusion protein (Fc-GLA (mg / rnLl Sugar Filling amount (ml) Amino acid (L-Serine («*)! Non-ionic surfactant (Polysorb ate 20 1 65 6.67 20 Sucrose 10 mg / mL 6 14 0017 2 6.67 Trehalose 10 mg / mL 3 p— 6.67 Mannitol 10 mg / mL 6.67 * 5 61 6.67 20 Sucrose 10 mg / mL 6 1.4 0.017 6 667 Trehalose 10 mg / mL 7 p 6.67 Mannitol 10 mg / mL * 10 65 10 30 Sucrose 15 mg / mL 4 2.1 0.025 12 10 Trehalose 15mqmL 14 10 Mannitol 15 mg / mL 16 10 • 18 61 10 30 Sucrose 15 mg / mL 4 2.1 0.025 20 10 Trehalose 15 mg / mL 22 10 Mannitol 15 mg / mL 10 -

[301] [Table 6] 36 WO 2025 / 058333 PCT / KR2024 / 013486 Loading Freezing Primary drying Secondary drying Temperature (°C) 5 -55 -25 25 Temperature change rate (°C / min) 0 0.33 0.33 0.25 Holding time (min) 30 300 4500 1200 Pressure (mTorr) N / A N / A 60 50

[302]

[303] Example 3-2: Dissolution and appearance of lyophilized formulations

[304]

[305] Each lyophilized vial prepared in Example 3-1 was allowed to stand at room temperature for 30 minutesto remove the moisture generated on the vial surface, and then the appearance of a cake was examined.

[306] A 25G needle (1 inch or more) was fitted onto a 2 mL syringe, and 2 mL of distilled water was drawn out, and then injected into each vial containing the lyophilized product at a 90-degree angle. Since the vacuum was maintained inside the vial, the distilled water was automatically injected.

[307] Upon the completion of distilled water injection, the needle and syringe were separated to release the remaining vacuum inside the vial, and then the needle was removed. The vial was shaken 5 times and left to stand until the lyophilized cake dissolved.

[308]

[309] Example 3-3: Size exclusion liquid chromatography (SE-HPLC)

[310]

[311] The lyophilized product dissolved in Example 3-2 was diluted using a mobile phase (IxPBS, Lonza) to a concentration of 1 mg / mL and then filtered using a 0.2-qm syringe filter. Thereafter, 200 qL of the filtered sample was injected into a vial insert andthen prepared in a screw top vial.

[312] Subsequently, the mobile phase was connected to a pump, and then an assay column (TSKgel G3000SWXL, Tosoh) was mounted on Waters e2695 and Waters 2489 instruments (Waters) while the mobile phase flowed at a flow rate of 0.5 mL / min. The sample was equilibrated by flowing the mobile phase at a flow rate of 0.5 mL / min for 30 minutes or longer until detector signals were stabilized. When the temperature of an autosampler was lowered to 4°C, the sample was placed into the sampler, and 10 37 WO 2025 / 058333 PCT / KR2024 / 013486 itL of the sample was injected. Thereafter, the mobile phase was allowed to flow for 35 minutes, and detection peaks were identified at 214 nm. Analysis was performed by Empower Pro software on a PC.

[313]

[314] Example 3-4: Conditions for improving recovery rate of native form according to pH, changes in filling volume, and sugar type

[315]

[316] First, as a result of comparing the cake appearance among the lyophilizedformulations prepared in Example 3-2, no serious collapse was observed under all the conditions (FIGS. 3 and 4).

[317]

[318] As a result of examining the recovery rate of the native form in the prepared lyophilized formulations by size exclusion chromatography, the proportion of the native form to the final raw solution was hardly decreased regardless of pH under the conditions containing three types of sugars, but the proportion of the native form to the final raw solution decreased under all the conditions not containing sugars (FIGS. 5 and 6).

[319] These results suggest that the lyophilized formulations containing the fusion protein of the present invention, which contain sugars, showed an excellent recovery rate of the native form regardless of the specific type of sugars.

[320]

[321] Additionally, as for the comparison of filling volume of the final raw material, the recovery rate of the native form was higher for a filling volume of 6 mL (FIGS. 5 and 6).

[322]

[323] Example 4:Optimum concentration of sucrose (white sugar) for improving recovery rate of native form

[324]

[325] Example 4-1: Preparation of lyophilized formulations

[326]

[327] After it was confirmed that the inclusion of a sugar at a pH of 6.8 showed an excellent recovery rate of the native form, various lyophilized formulations were prepared by adjusting the amount of sucrose (white sugar) as a representative example of saccharides, and then size exclusion chromatography analysis was performed.

[328]

[329] Each solution for formulations having the compositions shown in Table 7 below was aliquoted into a glass vial (20 mL) with 6 mL, half-capped with a rubber stopper, and then loaded on a shelf of a freeze dryer (Lyostar 3, SP scientific). Subsequently, 38 WO 2025 / 058333 PCT / KR2024 / 013486 lyophilization was conducted under the conditions shown in Table 7 below, and the prepared lyophilized formulation was capped with an aluminum cap after the completion of aluminum lyophilization.

[330]

[331] [Table 7] # pH Buffer (L-Histidine (mM)) Fusion protein (Fc-GLA (mg / mL)) White sugar (mg / mL) Total Filling amount (mL) Amino acid (L-Serine (%,(w / v))) Non-ionic | surfactant | (Polysorbate | 20(%,(w / v))) | 1 6.8 6.67 20 0 6 1.4 0.017 2 6.67 2.5 3 6.67 5 4 6.67 10

[332]

[333] [Table 8] Loading Freezing Primary drying Secondary drying Temperature (°C) 5 -55 -25 25 Temperature change rat (°C / min) 0 0.33 0.33 0.25 Holding time (min) 30 300 2500 1200 Pressure (mTorr) N / A N / A 60 50

[334]

[335] Example 4-2: Dissolution and appearance of lyophilized formulations

[336]

[337] Each lyophilized vial was allowed to stand at room temperature for 30 minutes to remove the moisture generated on the vial surface, and then the appearance of a cake was examined.

[338] A 25G needle (1 inch or more) was fitted onto a 2 mL syringe, and 2 mL of distilled water was drawn out, and then injected into each vial containing the lyophilized product at a 90-degree angle. Since the vacuum was maintained inside thevial, the distilled water was automatically injected. 39 WO 2025 / 058333 PCT / KR2024 / 013486

[339] Upon the completion of distilled water injection, the needle and syringe were separated to release the remaining vacuum inside the vial, and then the needle was removed. The vial was shaken 5 times and left to stand until the lyophilized cake dissolved.

[340]

[341] Example 4-3: Size exclusion liquid chromatography (SE-HPLC)

[342]

[343] The lyophilized product dissolved in Example 4-2 was diluted using a mobile phase (IxPBS, Lonza) to a concentration of 1 mg / mL and then filtered using a 0.2-μιη syringe filter. Thereafter, 200 μΕ of the filtered sample was injected into a vial insert and then prepared in a screw top vial.

[344] Subsequently, the mobile phase was connected to a pump, and then an assay column (TSKgel G3000SWXL, Tosoh) was mounted on Waters e2695 and Waters 2489 instruments (Waters) while the mobile phase flowed at a flow rate of 0.5 mL / min. The sample was equilibrated by flowingthe mobile phase at a flow rate of 0.5 mL / min for 30 minutes or longer until detector signals were stabilized. When the temperature of an autosampler was lowered to 4°C, the sample was placed into the sampler, and 10 μΕ of the sample was injected. Thereafter, the mobile phase was allowed to flow for 35 minutes, and detection peaks were identified at 214 nm. Analysis was performed by Empower Pro software on a PC.

[345]

[346] Example 4-4: Optimum concentration of white sugar for improving recovery rate of native form

[347]

[348] First, as a result of comparing the cake appearance among the lyophilized formulations prepared in Example 4-2, no serious collapse was observed under all the conditions (FIG. 7).

[349] As a result of examining the recovery rate of the native form in the prepared lyophilized formulations by size exclusion chromatography, the proportion of the native form to the final raw solution was least reduced under the condition that contains white sugar at a concentrationof 2.5 mg / mL (#2) (FIG. 8).

[350]

[351] Example 5: Long-term storage stability of optimum lyophilized formulation

[352]

[353] Example 5-1: Preparation of lyophilized formulation

[354]

[355] Considering the optimum recovery conditions of the native form derived through the previous examples, an optimum lyophilized formulation was prepared, and then 40 WO 2025 / 058333 PCT / KR2024 / 013486 subjected to size exclusion chromatography analysis at regular intervals while stored under refrigeration conditions (5±3°C).

[356]

[357] Specifically, a solution for a formulation having the composition shown in Table 9 below was aliquoted into a glass vial (20 mL) with 6 mL, half-capped with a rubber stopper, and then loaded on a shelf of a freeze dryer (Lyostar 3, SP scientific). Subsequently, lyophilization was conducted under the conditions shown in Table 10 below, and the prepared lyophilized formulation was capped with an aluminum cap after the completion of aluminum lyophilization.

[358]

[359] [Table 9] pH Buffer (L-Histidine (mM)) Fusion protein (Fc-GLA (mg / mL)) . . ., Non-iomcAmmo acid , , , White sugar „ ς . surfactant (mg / mL) %iw / L (Polysorbate ( / ο>™ 20(%,(w / v))) 1 6.8 6.67 22 25 14 °'017

[360]

[361] [Table 10] Loading Freezing Primary drying Secondary drying Temperature (°C) 5 -55 -25 25 Temperature change rate (’C / min) 0 0.33 0.33 0.25 Holding time (min) 30 300 2500 1200 Pressure (mTorr) N / A N / A 60 50

[362]

[363] Example 5-2: Dissolution and appearance of lyophilized formulations

[364]

[365] The lyophilized vial was allowed to stand at room temperature for 30 minutes to remove the moisture generated on the vial surface, and then the appearance of a cake was examined.

[366] A 25G needle (1 inch or more) was fitted onto a 2 mL syringe, and 2 mL of distilled water was drawn out, and then injected into each vial containing the lyophilized 41 WO 2025 / 058333 PCT / KR2024 / 013486 product at a 90-degree angle. Since the vacuum was maintained inside the vial, the distilled waterwas automatically injected.

[367] Upon the completion of distilled water injection, the needle and syringe were separated to release the remaining vacuum inside the vial, and then the needle was removed. The vial was shaken 5 times and left to stand until the lyophilized cake dissolved.

[368]

[369] Example 5-3: Moisture content

[370]

[371] Three lyophilized vials for each condition were placed in a moisture content analysis room controlled to maintain a humidity of 40% or less, for at least one hour. Three sets of 885 KF Thermoprep vials and caps to be used as a control group (Blank) were prepared.

[372] The lyophilized cake in each of the vials was crushed as finely as possible using a spatula, transferred to a zero-calibrated 885 KF Thermoprep vial, weighed, and capped. The control vials were capped without separate weighing. Thereafter, the prepared vials were placed in the auto-sampler in the order of the control group followed by the sample group.

[373] The 831 KF CoulometerRemote Controller was programmed to measure each control vial three times and each test sample three times. The total number of samples to be analyzed was entered into the 885 Compact Oven, and then analysis was performed.

[374]

[375] Example 5-4: Size exclusion liquid chromatography (SE-HPLC)

[376]

[377] The lyophilized product dissolved in Example 5-2 was diluted using a mobile phase (IxPBS, Lonza) to a concentration of 1 mg / mL and then filtered using a 0.2-qm syringe filter. Thereafter, 200 qL of the filtered sample was injected into a vial insert and then prepared in a screw top vial.

[378] Subsequently, the mobile phase was connected to a pump, and then an assay column (TSKgel G3000SWXL, Tosoh) was mounted on Waters e2695 and Waters 2489 instruments (Waters) while the mobile phase flowed at a flow rate of 0.5 mL / min. The sample was equilibrated by flowing the mobile phase at a flow rate of 0.5 mL / min for 30 minutes or longer until detector signals were stabilized. When thetemperature of an autosampler was lowered to 4°C, the sample was placed into the sampler, and 10 qL of the sample was injected. Thereafter, the mobile phase was allowed to flow for 35 minutes, and detection peaks were identified at 214 nm. Analysis was performed by Empower Pro software on a PC. 42 WO 2025 / 058333 PCT / KR2024 / 013486

[379]

[380] Example 5-5: Long-term storage stability of optimum lyophilized formulation

[381]

[382] As a result of analyzing the appearance and moisture content of the lyophilized formulation prepared in Example 5-1, the appearance of the cake or the appearance after dissolution was maintained as transparent even after 12 months under refrigeration (5±3°C) conditions, and the moisture content was also maintained at 1.0% even after 6 months (FIG. 9).

[383] The prepared lyophilized formulation was stored under refrigeration (5±3°C), and after 3, 6, and 12 months, the recovery rate of the native form was examined by size exclusion chromatography. As a result, theproportion of the native form was maintained with little reduction even after 12 months compared with 0 months (FIG. 10).

[384]

[385] While the present invention has been described with reference to the particular illustrative embodiments, a person skilled in the art to which the present invention pertains can understand that the present invention may be embodied in other specific forms without departing from the technical spirit or essential characteristics thereof. Therefore, the exemplary embodiments described above should be construed as being exemplified and not limiting the present disclosure. The scope of the invention should be construed that the meaning and scope of the appended claims rather than the detailed description and all changes or variations derived from the equivalent concepts fall within the scope of the present invention. 43 WO 2025 / 058333 PCT / KR2024 / 013486 Claims [Claim 1] A lyophilized formulation comprising a fusion protein in which α-galactosidase A is linkedto an immunoglobulin Fc region, the lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution containing: the fusion protein at a concentration of 10 to 40 mg / mL; a buffer with a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL. [Claim 2] The lyophilized formulation of claim 1, wherein the sugar is glucose, fructose, galactose, lactose, maltose, sucrose, trehalose, or a combination thereof. [Claim 3] The lyophilized formulation of claim 1, wherein the sugar alcohol is mannitol, sorbitol, or a combination thereof. [Claim 4] The lyophilized formulation of claim 1, wherein the aqueous solution further contains an amino acid at a concentration of 1.0 to 3.0% (w / v). [Claim 5] The lyophilized formulation of claim 4, wherein the amino acid is selected from the group consisting of serine, arginine, threonine, glutamine, glycine, alanine, and a combination thereof. [Claim 6] The lyophilized formulation of claim 1, wherein theaqueous solution further contains a non-ionic surfactant at a concentration of 0.001 to 0.1% (w / v). [Claim 7] The lyophilized formulation of claim 6, wherein the non-ionic surfactant is selected from the group consisting of poloxamer 188, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and a combination thereof. [Claim 8] The lyophilized formulation of claim 1, wherein the buffer contains histidine or a salt thereof, citric acid or a salt thereof, acetic acid or a salt thereof, phosphoric acid or a salt thereof, or a combination thereof. [Claim 9] The lyophilized formulation of claim 1, wherein the buffer contains 5 to 30 mM histidine. [Claim 10] The lyophilized formulation of claim 1, wherein the lyophilized formulation comprises a mixture obtained by lyophilizing 1 to 10 mL of an aqueous solution. [Claim 11] The lyophilized formulation of claim 1, wherein the aqueous solution does not further contain an isotonic agent. 44 WO 2025 / 058333 PCT / KR2024 / 013486 [Claim 12]The lyophilized formulation of claim 1, wherein the a- galactosidase A includes the amino acid sequence of SEQ ID NO: 1 [Claim 13] 1. The lyophilized formulation of claim 1, wherein the fusion protein includes the amino acid sequence of SEQ ID NO: 4. [Claim 14] The lyophilized formulation of claim 1, wherein the fusion protein has a structure in which two molecules of α-galactosidase A are linked to monomers of an immunoglobulin Fc region in a dimeric form, respectively. [Claim 15] The lyophilized formulation of claim 1, wherein the lyophilized formulation comprises a mixture obtained by lyophilizing an aqueous solution containing: the fusion protein at a concentration of 15 to 35 mg / mL; histidine at a concentration of 5 to 30 mM; the sugar or sugar alcohol at a concentration of 2.5 to 10 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.05% (w / v); and serine at a concentration of 1.0 to 3.0% (w / v). [Claim 16] The lyophilized formulation of claim 1, wherein the lyophilizedformulation is used to prevent or treat Fabry disease. [Claim 17] A method for preparing the lyophilized formulation of any one of claims 1 to 16, the method comprising lyophilizing an aqueous solution containing i) an α-galactosidase A fusion protein in which α-galactosidase A is linked to an immunoglobulin Fc region, ii) a buffer, and iii) a sugar or sugar alcohol. [Claim 18] The method of claim 17, wherein the method comprises lyophilizing 1 to 10 mL of an aqueous solution containing i) an α-galactosidase A fusion protein in which α-galactosidase A is linked to an immunoglobulin Fc region, ii) a buffer, and iii) a sugar or sugar alcohol. [Claim 19] A method for reconstituting the lyophilized formulation of any one of claims 1 to 18, the method comprising adding a reconstitution solution to the lyophilized formulation of any one of claims 1 to 18. [Claim 20] The method of claim 19, wherein the reconstitution solution is distilled water. [Claim 21] The method of claim 19, wherein theformulation reconstituted by the method contains the α-galactosidase A fusion protein at a concentration of 10 to 100 mg / mL. 1 / 5 WO 2025 / 058333 PCT / KR2024 / 013486 [Fig. 1] L-Serine (%) | Composition #1 #3 #8 #10 #7 #2 PH 6.0 6.0 6.0 6.0 6.5 7.0 PS 20(%) 0.001 0.05 0.001 I 0.05 0.0255 0.001 2.1 2.1 2.9 2.9 2.5 2.1 Appearance i (cake) . I z i । Z.I j Z.y | Z y । । ζ ι i LUUULU Appearance Γ (after dissolution I followed by || refrigeration for 3 4 Appearance (immediately after dissolution) Ji '■ -4 96.5 95.3 92.4 87.8 96.1 97.8 [Fig. 2] 2 / 5 WO 2025 / 058333 PCT / KR2024 / 013486 [Fig. 3] Composition #1 #2 #3 #4 #5 #6 #7 #8 pH 6.5 6.5 6.5 6.5 6.8 6.8 6.8 6.8 PS 20(%) 0.017 0.017 0.017 0.017 0.017 0.017 0.017 0.017 L-Serine (%) 1.4 1.4 1.4 1.4 1.4 1.4 1.4 1.4 Sugar Sucrose 1% Trehalose 1% Mannitol 1% N / A Sucrose 1% Trehalose 1% Mannitol 1% N / A I Fig. 4] Composition #10 #12 #14 #16 #18 #20 #22 #24 ί PS 20(%) 0.025 0.025 0.025 0.025 0.025 0.025 0.025 0.025 L-Serine (%), 2.1 2.1 2.1 2.1 2.1 2.1 2.12.1 Sugar Sucrose 1.5% Trehalose 1.5% Mannitol 1.5% N / A Sucrose 1.5% Trehalose 1.5% Mannitol 1.5% N / A 3 / 5 WO 2025 / 058333 PCT / KR2024 / 013486 [Fig. 5] SE-HPLC (pH 6.5 condition) After dissolution 6 mL Filling 4 mL Filling Final raw solution [Fig. 6] 4 / 5 WO 2025 / 058333 PCT / KR2024 / 013486 [Fig. 7] Composition #1 #2 #3 #4 PH 6.8 6.8 6.8 6.8 PS 20 (%) ί 0.017 0.017 0.017 0.017 L-Serine (%) 1.4 1.4 1.4 1.4 Sucrose (%) 0 0.25 0.5 1.0 [Fig. 8] SE-HPLC fU 100 99 98 97 96 Final raw solution After dissolution E > o 95 0 mg / mL 2.5 mg / mL 5 mg / mL 10 mg / mL Sucrose concentration 5 / 5 WO 2025 / 058333 PCT / KR2024 / 013486 [Fig. 9] [Fig. 10] Test item Storage temperature 0 Months ] 6 Months 12 Months Appearance (Cake) ι··1βΟ·ι··ιι|Ι··Ι·Μ 1 n $:..- Si ■ 1 U M B· ■II· ■Illi·» ■■■ 5±3°C ι·^Β^·ι . -ΜΜΜΜΜ- Appearance (after dissolution) GC 1 1 34 A ior. i' 2W±U2.i: ■ Lst ion st «ri’· : ί s । ■ m · : i ■μΜ|Ι|» Moisture.... content (%) * 0.7 1 1.0 I N / A SE-HPLC (5°Q 100.0 sP o'*' E 90.0 o > 80.0M—» 05 ~z. O' 70-° ω 860.0 50.0 0 3 6 12 Duration of storage (M) INTERNATIONAL SEARCH REPORT International application No. PCT / KR2024 / 013486 A. CLASSIFICATION OF SUBJECT MATTER A61K 9 / 19(2006.01)i; A61K 47 / 26(2006.01)1; A61K 47 / 18(2006.01)1; A61K 47 / 22(2006.01)1; A61K 38 / 47(2006.01)1; A61P 3 / 00(2006.01)1; A61P 43 / 00(2006.01)1 According to International Patent Classification (IPC) or to both national classification and IPC B. FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) A61K 9 / 19(2006.01); A61J 1 / 05(2006.01); A61K 38 / 00(2006.01); A61K 38 / 43(2006.01); A61K 38 / 47(2006.01); A61K 47 / 18(2006.01); A61K 47 / 22(2006.01); C07K 16 / 28(2006.01); C07K 19 / 00(2006.01); C12N 15 / 62(2006.01); C12N 9 / 40(2006.01); C12N 9 / 96(2006.01) Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched Korean utility models and applications for utility models Japanese utility models and applications for utilitymodels Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) eKOMPASS(KIPO internal) & Keywords: fusion protein, lyophillized formulation, α-galactosidase A, immunoglobulin Fc region C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No. Y WO 2022-202947 Al (JCR PHARMACEUTICALS CO., LTD. et al.) 29 September 2022 (2022-09-29) claims 1-20, 25; paragraphs

[0085] ,

[0094] 1-18 Y WO 2015-009052 Al (ILDONG PHARM CO., LTD.) 22 January 2015 (2015-01-22) claims 1, 10, 11 1-18 Y US 2014-0127227 Al (BYEONG SEON CHANG) 08 May 2014 (2014-05-08) claims 1, 17, 18, 20; table 5 4,5,15 Y US 2021-0009984 Al (HANMI PHARM. CO., LTD.) 14 January 2021 (2021-01-14) abstract; claims 1-23 1-18 Y WO 2022-103221 Al (HANMI PHARM. CO., LTD. et al.) 19 May 2022 (2022-05-19) abstract; claims 1-18 1-18 | V | Further documents are listed in thecontinuation of Box C. | V | See patent family annex. * Special categories of cited documents: “T” later document published after the international filing date or priority “A” document defining the general state of the art which is not considered date and not in conflict with the application but cited to understand the to be of particular relevance principle or theory underlying the invention “D” document cited by the applicant in the international application “X” document of particular relevance; the claimed invention cannot be “E” earlier application or patent but published on or after the international considered novel or cannot be considered to involve an inventive step filing date when the document is taken alone “L” document which may throw doubts on priority claim(s) or which is “Y” document of particular relevance; the claimed invention cannot be cited to establish the publication date of another citation or other considered to involve an inventive step when the document isspecial reason (as specified) combined with one or more other such documents, such combination “O” document referring to an oral disclosure, use, exhibition or other being obvious to a person skilled in the art means document member of the same patent family “P” document published prior to the international filing date but later than the priority date claimed Date of the actual completion of the international search 18 December 2024 Date of mailing of the international search report 19 December 2024 Name and mailing address of the ISA / KR Korean Intellectual Property Office 189 Cheongsa-ro, Seo-gu, Daejeon 35208, Republic of Korea Facsimile No. +82-42-481-8578 Authorized officer HEO, Joo Hyung Telephone No. +82-42-481-5373 Form PCT / ISA / 210 (second sheet) (July 2022) INTERNATIONAL SEARCH REPORT International application No. PCT / KR2024 / 013486 C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant toclaim No. PX KR 10-2023-0134823 A (GREEN CROSS CORPORATION et al.) 22 September 2023 (2023-09-22) claims 1-22 1-18 Form PCT / ISA / 210 (second sheet) (July 2022) INTERNATIONAL SEARCH REPORT International application No. PCT / KR2024 / 013486 Box No. I Nucleotide and / or amino acid sequence(s) (Continuation of item l.c of the first sheet) 1. With regard to any nucleotide and / or amino acid sequence disclosed in the international application, the international search was carried out on the basis of a sequence listing: a. / forming part of the international application as filed. b. furnished subsequent to the international filing date for the purposes of international search (Rule 13ter.l(a)), | | accompanied by a statement to the effect that the sequence listing does not go beyond the disclosure in the international application as filed. 2. | | With regard to any nucleotide and / or amino acid sequence disclosed in the international application, this report has been established to the extent that ameaningful search could be carried out without a WIPO Standard ST.26 compliant sequence listing. 3. Additional comments: Form PCT / ISA / 210 (continuation of first sheet) (July 2022) Box No. II Observations where certain claims were found unsearchable (Continuation of item 2 of first sheet) INTERNATIONAL SEARCH REPORT International application No. PCT / KR2024 / 013486 This international search report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons: 1. | | Claims Nos.: because they relate to subject matter not required to be searched by this Authority, namely: 2. [7] Claims Nos.: 20,21 because they relate to parts of the international application that do not comply with the prescribed requirements to such an extent that no meaningful international search can be carried out, specifically:Claims 20, 21 are regarded to be unclear because they refer to claims which do not comply with PCT Rule6.4(a) 3. | Z | Claims Nos.: 19 because they aredependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). Form PCT / ISA / 210 (continuation of first sheet) (July 2022) INTERNATIONAL SEARCH REPORT Information on patent family members International application No. PCT / KR2024 / 013486 Patent document cited in search report Publication date (day / month / year) Patent family member(s) Publication date (day / month / year) WO 2022-202947 Al 29 September 2022 AU 2022-245592 Al 19 October 2023 AU 2022-245592 A9 26 October 2023 BR 112023019201 A2 17 October 2023 CA 3214463 Al 29 September 2022 CN 116997352 A 03 November 2023 EP 4311555 Al 31 January 2024 JP 2022-151814 A 07 October 2022 KR 10-2023-0160848 A 24 November 2023 MX 2023011087 A 02 October 2023 US 2024-0165258 Al 23 May 2024 WO 2015-009052 Al 22 January 2015 None US 2014-0127227 Al 08 May 2014 AU 2012-328524 Al 22 May 2014 AU 2012-328524 B2 18 May 2017 AU 2017-213510 Al 31 August 2017 AU 2017-213510 B2 01 August 2019 BR 112014010186 A2 02 May 2017CA 2853823 To 02 May 2013 CA 2853823 C 20 December 2016 CA 2951856 To 02 May 2013 CN 104023748 A 03 September 2014 CN 104023748 B 2028 March 2018 1657 CN A 09 November 2018 EP 2771033 Al 03 September 2014 EP 3578203 Al 11 December 2019 KR 10-1759694 Bl 19 July 2017 KR 10-2014-0097247 A 06 KR 2014 August 10-2017-0084369 A 19 July 2017 MX 2014005106 A 22 September 2014 MX 352823 B 04 December 2017 US 2016-0271253 Al 22 September 2016 US 2013 March- 20135 Al 2019 US 9364542 B2 14 June 2016 WO 2013-063510 Al 02 May 2013 US 2021-0009984 Al 14 January 2021 AR 113430 Al 29 April 2020 AU- 3 July 2831 2020 BR 112020012346 A2 24 November 2020 CA 3086474 Al 27 June 2019 CN 111511910 A 07 August 2020 EA 202091239 Al 09 September 2020 EP 6 1726 Al September 2020 IL 275248 A 30 July 2020 JP 2021-507705 A 25 February 2021 JP 7403455 B2 22 December 2023 KR 10-2019-0076909 A 02 July 2019 KR-1015-2023 13 October 2023 KR 10-2588611 Bl 16 October 2023 KR 10-2712547 Bl 04October 2024 MX 2020006635 A 10 December 2020 NZ 765453 A 22 March 2024 PH 12020550927 Al 10 May 2021 Form PCT / ISA / 210 (patent family annex) (July 2022) INTERNATIONAL SEARCH REPORT Information on patent family members International application No. PCT / KR2024 / 013486 Patent document cited in search report Publication date (day / month / year) Patent family member(s) Publication date (day / month / year) SG 11202005510 A 29 July 2020 TW 201934753 A 01 September 2019 wo 2019-125059 Al 27 June 2019 WO 2022-103221 Al 19 May 2022 AU 2021-378707 Al 01 June 2023 AU 2021-378707 A9 11 July 2024 CA 3196258 Al 19 May 2022 CN 116419760 A 11 July 2023 CO 2023006437 A2 09 June 2023 EP 4245311 Al 20 September 2023 IL 302858 A 01 July 2023 JP 2023-549323 A 24 November 2023 KR 10-2022-0065719 A 20 May 2022 MX 2023005580 A 29 May 2023 US 2023-0405093 Al 21 December 2023 ZA 202304534 B 30 October 2024 KR 10-2023-0134823 A 22 September 2023 AR 128795 Al 12 June 2024 AU 2023-233398 Al 01 August 2024 CO 2024013582 A221 October 2024 IL 314901 A 01 October 2024 MX 2024011196 A 18 September 2024 TW 202400222 A 01 January 2024 wo 2023-177159 Al 21 September 2023 Form PCT / ISA / 210 (patent family annex) (July 2022) (19) State Intellectual Property Office (12) Invention Patent Application (10) Application Publication Number (43) Application Publication Date (21) Application Number 202480057808.5 (22) Application Date 2024.09.06 (30) Priority Data 10-2023-0122402 2023.09.14 KR (85) PCT International Application Entering National Phase Date 2026.03.10 (86) Application data for PCT international application: PCT / KR2024 / 013486 2024.09.06 (87) Publication data for PCT international application: WO2025 / 058333 EN 2025.03.20 (71) Applicant: Green Cross Co., Ltd. Address: South Korea Applicant: Hanmi Pharmaceutical Co., Ltd. (72) Inventors: Son Jong-moon, N.R., Yoo Mi-ri, Lee Hye-jin, Son Jae-yoon, Kim Sang-yoon, Kim Jin-young, D.S., Jang Hong-sung-hee (74) Patent Agency: Beijing Zhongzi Law Firm, 11247 Patent Attorney: Zhang Shuo (51) Int.Cl. A61K 9 / 19 (2006.01) A61K 47 / 26 (2006.01) A61K 47 / 18 (2006.01) A61K 47 / 22 (2006.01) A61K 38 / 47(2006.01) A61P 3 / 00(2006.01) A61P 43 / 00(2006.01) (54) Invention Title: Novel Lyophilized Formulation Containing α-Galactosidase A Fusion Protein (57) Abstract: This invention relates to lyophilized formulations containing α-galactosidase A fusion protein and methods for preparing the same. Claims (2 pages), Description (25 pages), Sequence Listing (electronic publication), Drawings (5 pages), CN 121793950 A 2026.04.03 CN 1 21 79 39 50 A 1. A lyophilized formulation comprising a fusion protein wherein α-galactosidase A is linked to the Fc region of an immunoglobulin, said lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution, said aqueous solution containing: the fusion protein at a concentration of 10 to 40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL.2. The lyophilized formulation of claim 1, wherein the sugar is glucose, fructose, galactose, lactose, maltose, sucrose, trehalose, or a combination thereof. 3. The lyophilized formulation of claim 1, wherein the sugar alcohol is mannitol, sorbitol, or a combination thereof. 4. The lyophilized formulation of claim 1, wherein the aqueous solution further contains 1.0 to 3.0% (w / v) of an amino acid. 5. The lyophilized formulation of claim 4, wherein the amino acid is selected from serine, arginine, threonine, glutamine, glycine, alanine, or a combination thereof. 6. The lyophilized formulation of claim 1, wherein the aqueous solution further contains 0.001 to 0.1% (w / v) of a nonionic surfactant. 7. The lyophilized formulation of claim 6, wherein the nonionic surfactant is selected from poloxamer 188, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, or a combination thereof. 8. The lyophilized formulation of claim 1, wherein the buffer contains histidine or a salt thereof, citrate or a salt thereof, acetic acid or a salt thereof, phosphate or a salt thereof, or a combination thereof. 9. The lyophilized formulation of claim 1, wherein the buffer contains 5-30 mM histidine. 10. The lyophilized formulation of claim 1, wherein the lyophilized formulation comprises a mixture obtained by lyophilizing 1 to 10 mL of an aqueous solution. 11. The lyophilized formulation of claim 1, wherein the aqueous solution does not further contain an isotonic agent. 12. The lyophilized formulation of claim 1, wherein the α-galactosidase A comprises the amino acid sequence of SEQ ID NO: 1. 13. The lyophilized formulation of claim 1, wherein the fusion protein comprises the amino acid sequence of SEQ ID NO: 4. 14. The lyophilized formulation of claim 1, wherein the fusion protein has a structure in which two α-galactosidase A molecules are respectively linked to monomers of the Fc region of immunoglobulin in a dimer form. 15. The lyophilized formulation of claim 1, wherein the lyophilized formulation comprises a mixture obtained by lyophilizing an aqueous solution, the aqueous solution containing: the fusion protein at a concentration of 15-35 mg / mL; histidine at a concentration of 5-30 mM; a sugar or sugar alcohol at a concentration of 2.5-10 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.05% (w / v); and serine at a concentration of 1.0-3.0% (w / v). 16. The lyophilized formulation of claim 1, wherein the lyophilized formulation is used for the prevention or treatment of Fabry disease. 17. A method for preparing the lyophilized formulation of any one of claims 1 to 16, the method comprising lyophilizing an aqueous solution containing i) an α-galactosidase A fusion protein linked to the Fc region of immunoglobulin.ii) protein, and iii) buffer, and sugar or sugar alcohol. Claims 1 / 2 page 2 CN 121793950 A 18. The method of claim 17, wherein the method comprises lyophilizing 1 to 10 mL of an aqueous solution containing i) an α-galactosidase A fusion protein wherein α-galactosidase A is linked to the Fc region of immunoglobulin, ii) buffer, and iii) sugar or sugar alcohol. 19. A method for reconstructing a lyophilized formulation according to any one of claims 1 to 18, the method comprising adding a reconstructed solution to the lyophilized formulation according to any one of claims 1 to 18. 20. The method of claim 19, wherein the reconstructed solution is distilled water. 21. The method of claim 19, wherein the formulation reconstructed by the method contains 10 to 100 mg / mL of the α-galactosidase A fusion protein. Claims 2 / 2 Page 3 CN 121793950 A Novel Lyophilized Formulation Containing α-Galactosidase A Fusion Protein Technical Field

[0001] This invention relates to a lyophilized formulation containing α-galactosidase A fusion protein, its preparation method, and its use. Background Art

[0002] Lysosomes are intracellular organelles that participate as major components of new proteins, membrane components, and other molecules in the degradation of proteins, various lipids such as glycolipids and cholesterol, and carbohydrates, as well as the recycling of degradation products. An example of a disease associated with lysosomal function is lysosomal storage disease (LSDs).

[0003] Lysosomal storage disease (LSDs) is caused by defects in genes encoding enzymes that degrade glycolipids or polysaccharide waste in cellular lysosomes, and the biological activity of lysosomal enzymes is significantly reduced or almost absent in the cells and tissues of individuals with lysosomal storage disease. This defect in degrading enzymes leads to the accumulation of substances without degradation, ultimately resulting in problems with cellular function.

[0004] Fabry disease, known as a lysosomal storage disorder, is a congenital glycolipid (glycosphingolipid) metabolic disorder caused by a deficiency or insufficiency of the activity of alpha(α)-galactosidase A (a hydrolytic enzyme present in lysosomes). Fabry disease, as a representative disease of alpha-galactosidase A deficiency, is an X-chromosome-related disorder. Typical Fabry disease patients usually have less than 1% alpha-galactosidase A activity and exhibit a wide range of symptoms, including severe pain in the extremities (acromial paresthesia), cold hypersensitivity, corneal and lens changes, skin lesions (angiokeratoma), kidney failure, cardiovascular disease, lung failure, neurological symptoms, and stroke.

[0005] Fabry disease leads to the progressive accumulation of globular triacylsphingolipid (Gb3) in most tissues of the body. Gb3 accumulation is primarily found in the vascular endothelium. This progressive accumulation of Gb3 in the vascular endothelium leads to organ damage such as the kidneys, heart, or…Ischemia and infarction in the brain.

[0006] Enzyme replacement therapy (ERT) is a representative method for treating lysosomal storage diseases, and many related studies have been conducted (France M, Platt et al., J Cell Biol, 26 November 2012; 199(5): 723-34). Specifically, lysosomal storage diseases are caused by genetic defects of specific enzymes, so enzyme replacement therapy for enzyme deficiency is necessary. Enzyme replacement therapy is the standard treatment for lysosomal storage diseases and can show the effect of alleviating existing symptoms or delaying disease progression by replacing the deficient enzyme. Therefore, various preparations containing α-galactosidase A for the prevention and treatment of α-galactosidase A deficiency have been studied.

[0007] However, the composition of stable preparations varies significantly depending on the structure, physicochemical properties, dosage, etc. of the active ingredient (e.g., protein drugs), so it is essential to develop specific compositions suitable for the active ingredient, and the development of preparations containing α-galactosidase A is insufficient. In particular, due to problems such as protein precipitation, lyophilized formulations containing high concentrations of α-galactosidase A fusion protein exhibit significantly low storage stability, and therefore conventional lyophilized formulations contain 5 mg / mL or lower concentrations of α-galactosidase A fusion protein. However, there is a need to develop highly stable formulations containing high concentrations of α-galactosidase A fusion protein to increase efficacy.

[0008] Invention Disclosure

[0009] Technical Problem

[0010] Moreover, due to problems such as loss of protein structure or function during the lyophilization of protein drugs, developing lyophilized formulations suitable for long-term storage while maintaining the structure and activity of proteins is challenging. Therefore, there is still a need to develop a lyophilized formulation that can improve protein recovery while ensuring stability, even long-term storage stability.

[0011] Solution to the Problem

[0012] One aspect of the present invention is to provide a lyophilized formulation containing α-galactosidase A fusion protein.

[0013] Another aspect of the present invention is to provide a method for preparing a lyophilized formulation.

[0014] Another aspect of the present invention is to provide a method for reconstructing a lyophilized formulation.

[0015] Beneficial Effects of the Invention

[0016] The lyophilized formulation of the present invention allows for the stable storage of α-galactosidase A fusion protein for a long period of time, and allows for the administration of appropriate doses of the fusion protein to patients by increasing the recovery rate during reconstruction.

[0017] Brief Description of the Drawings

[0018] Figure 1 compares the appearance of the lyophilized formulation immediately after dissolution and three days after dissolution, according to pH conditions.

[0019] Figure 2 compares the recovery rate of the natural form of the lyophilized formulation according to pH conditions.

[0020] Figures 3 and 4 compare the appearance of the lyophilized formulation containing sugar or sugar alcohol.

[0021] Figure 5 compares the recovery rate of the natural form of the lyophilized formulation at pH 6.5 according to the addition of sugar or sugar alcohol.

[0022] Figure 6 compares the recovery rate of the natural form of the lyophilized formulation at pH 6.8 according to the addition of sugar or sugar alcohol.

[0023] Figure 7 compares the appearance of the lyophilized formulation according to the change in sugar (sucrose) concentration.

[0024] Figure 8 compares the recovery rate of the natural form of the lyophilized formulation according to the change in sugar (sucrose) concentration.

[0025] Figure 9 examines the appearance of the lyophilized formulation with the optimal composition after 12 months of refrigeration.

[0026] Figure 10 compares the recovery rate of the natural form of the lyophilized formulation at 3, 6, and 12 months.

[0027] Best Mode for Carrying Out the Invention

[0028] According to one aspect of the invention, a lyophilized formulation containing an α-galactosidase A fusion protein is provided.

[0029] In one embodiment, the lyophilized formulation may comprise a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein wherein α-galactosidase A is linked to the Fc region of immunoglobulin; a buffer solution; and a sugar or sugar alcohol.

[0030] In another embodiment, the lyophilized formulation may comprise a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 1-40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1-20 mg / mL.

[0031] In any of the preceding embodiments, the lyophilized formulation may comprise a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 1-40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1-20 mg / mL; and amino acids at a concentration of 1.0-3.0% (w / v).

[0032] In any of the foregoing embodiments, the lyophilized formulation may include a mixture obtained by lyophilizing an aqueous solution, the aqueous solution containing: a fusion protein at a concentration of 1-40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1-20 mg / mL; and a nonionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[0033] In any of the foregoing embodiments, the lyophilized formulation may include a mixture obtained by lyophilizing an aqueous solution, the aqueous solution containing: a fusion protein at a concentration of 1-40 mg / mL; a buffer solution at a pH of 6.5 to 8.0 containing 5-30 mM histidine; a sugar or sugar alcohol at a concentration of 1-20 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.1% (w / v); and serine at a concentration of 1.0 to 3.0% (w / v).

[0034] In the freeze-dried formulation of any of the foregoing embodiments, the sugar may be glucose, fructose, galactose, lactose, maltose, sucrose, trehalose, or a combination thereof.Page 2 / 25 of the document CN 121793950 A

[0035] In any of the aforementioned lyophilized formulations, the sugar alcohol may be mannitol, sorbitol, or a combination thereof.

[0036] In any of the aforementioned lyophilized formulations, the aqueous solution may further contain amino acids at a concentration of 1.0 to 3.0% (w / v).

[0037] In any of the aforementioned lyophilized formulations, the amino acids may be selected from serine, arginine, threonine, glutamine, glycine, alanine, and combinations thereof.

[0038] In any of the aforementioned lyophilized formulations, the aqueous solution may further contain a nonionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[0039] In any of the aforementioned lyophilized formulations, the nonionic surfactant may be selected from poloxamer 188, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof.

[0040] In any of the lyophilized formulations of the foregoing embodiments, the buffer may contain histidine or a salt thereof, citric acid or a salt thereof, acetic acid or a salt thereof, phosphate or a salt thereof, or a combination thereof.

[0041] In any of the lyophilized formulations of the foregoing embodiments, the buffer may contain 5 to 30 mM histidine.

[0042] In any of the lyophilized formulations of the foregoing embodiments, the lyophilized formulation may not further contain an isotonic agent.

[0043] In any of the lyophilized formulations of the foregoing embodiments, the isotonic agent may be sodium chloride.

[0044] In any of the lyophilized formulations of the foregoing embodiments, α-galactosidase A may include the amino acid sequence of SEQ ID NO: 1.

[0045] In any of the lyophilized formulations of the foregoing embodiments, the immunoglobulin Fc region may include the amino acid sequence of SEQ ID NO: 3.

[0046] In any of the lyophilized formulations of the foregoing embodiments, the α-galactosidase A fusion protein may include the amino acid sequence of SEQ ID NO: 4.

[0047] In any of the lyophilized formulations of the foregoing embodiments, the immunoglobulin Fc region may be derived from IgG4.

[0048] In any of the lyophilized formulations of the foregoing embodiments, the immunoglobulin Fc region may be non-glycosylated.

[0049] In any of the lyophilized formulations of the foregoing embodiments, the fusion protein may have a structure in which two α-galactosidase A molecules are respectively linked to monomers of the immunoglobulin Fc region in a dimer form.

[0050] In any of the lyophilized formulations of the foregoing embodiments, the lyophilized formulation may be used for the prevention or treatment of Fabry disease.

[0051] According to another aspect of the invention, a method for preparing a lyophilized formulation is provided.

[0052] In one embodiment, the preparation method may include lyophilizing an aqueous solution comprising: i) wherein α-galactosidase...ii) an α-galactosidase A fusion protein linked to the Fc region of immunoglobulin; and iii) a sugar or sugar alcohol.

[0053] In another embodiment, the preparation method of any of the foregoing embodiments may further mix an amino acid, a nonionic surfactant, a preservative, or a combination thereof with an aqueous solution.

[0054] In the preparation method of any of the foregoing embodiments, the method may include lyophilizing 1 to 10 mL of an aqueous solution containing at least one of a protein, a buffer (or buffering agent), a sugar, a sugar alcohol, an amino acid, a nonionic surfactant, a preservative, or a combination thereof.

[0055] According to another aspect of the invention, a method for reconstructing a lyophilized formulation is provided, the method comprising adding a reconstructed solution to the lyophilized formulation.

[0056] In one embodiment, the reconstructed solution may be distilled water.

[0057] In another embodiment, the reconstructed formulation may contain an α-galactosidase A fusion protein at a concentration of 10-100 mg / mL.

[0058] Invention Specification 3 / 25 pages 6 CN 121793950 A

[0059] The following describes the details for carrying out the invention.

[0060] The various descriptions and embodiments disclosed in this application can also be applied to other descriptions and embodiments. In other words, all combinations of the various elements disclosed in this application fall within the scope of this disclosure. Furthermore, the scope of the invention is not limited by the following specific description.

[0061] Furthermore, those skilled in the art will recognize or be able to determine various equivalents of the specific embodiments of the invention described herein using only conventional experiments. Furthermore, these equivalents are intended to be included in the invention.

[0062] Throughout this specification, not only are the typical single-letter and three-letter codes for naturally occurring amino acids used, but also three-letter codes that are generally permitted for other amino acids, such as 2-aminoisobutyric acid (Aib), N-methylglycine (Sar), and α-methylglutamic acid. The amino acids described herein are abbreviated according to the IUPAC-IUB naming rules as follows.

[0063] Alanine (Ala, A), Arginine (Arg, R)

[0064] Asparagine (Asn, N), Aspartic acid (Asp, D)

[0065] Cysteine ​​(Cys, C), Glutamic acid (Glu, E)

[0066] Glutamine (Gln, Q), Glycine (Gly, G)

[0067] Histidine (His, H), Isoleucine (Ile, I)

[0068] Leucine (Leu, L), Lysine (Lys, K)

[0069] Methionine (Met, M), Phenylalanine (Phe, F)

[0070] Proline (Pro, P), Serine (Ser, S)

[0071] Threonine (Thr, T), Tryptophan (Trp, W)

[0072] Tyrosine (Tyr, Y), Valine (Val, V)

[0073] One aspect of the invention provides a lyophilized formulation comprising a fusion protein in which α-galactosidase A is linked to the Fc region of an immunoglobulin.

[0074] Specifically, the invention relates to a lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution containing: a pharmaceutically effective amount of the fusion protein, wherein α-galactosidase A and the Fc region of an immunoglobulin are linked to each other; a buffer solution; and a sugar or sugar alcohol. The aqueous solution may further contain amino acids, nonionic surfactants, preservatives, or combinations thereof, but is not limited thereto.

[0075] As used herein, the term "lyophilized formulation" refers to a pharmaceutical product formulated by lyophilization. Specifically, the α-galactosidase A fusion protein may be lyophilized together with substances used to stabilize the fusion protein, such as excipients, and thus exist in a solid state. Components contained in the lyophilized formulation, other than the α-galactosidase A fusion protein exhibiting pharmacological efficacy, may be interchanged with stabilizers. As used herein, the term "stabilizer" refers to a substance that stably maintains the components of a formulation, such as the active ingredient, for a predetermined period of time.

[0076] In this invention, a lyophilized formulation is a concept that includes lyophilized substances. The aforementioned lyophilized formulation is prepared by a freeze-drying method in the form of a pre-lyophilized formulation, which contains a stabilizer for stabilizing the α-galactosidase A fusion protein and the α-galactosidase A fusion protein. In this invention, the lyophilized formulation of the α-galactosidase A fusion protein may include a therapeutically effective amount of the α-galactosidase A fusion protein, which may be contained in a single-use container or a multiple-use container, but is not limited thereto. The lyophilized formulation of this invention has a composition capable of stabilizing the α-galactosidase A fusion protein during the freeze-drying process, and the stability of the formulation can be maintained even when the lyophilized formulation is stored and then reconstituted, and the formulation has a high α-galactosidase A fusion protein recovery rate. Furthermore, even when the α-galactosidase A fusion protein is contained therein at a high concentration of 10 mg / mL to 40 mg / mL, the lyophilized formulation of the present invention maintains stability. Specification 4 / 25 pages 7 CN 121793950 A

[0077] The lyophilized formulation of the present invention comprising the α-galactosidase A fusion protein is stored in a container and can be reconstituted for individual application when needed.

[0078] As used herein, the term “reconstituted” refers to the process of liquefying (dissolving) a solid lyophilized material to make the α-galactosidase A fusion protein applicable. In particular, the concentration of the α-galactosidase A fusion protein contained in the lyophilized formulation of the present invention can be reconstituted to be from 1 mg / mL to 150 mg / mL, from 10 mg / mL to 120 mg / mL, or from 10 mg / mL to 100 mg / mL, but…This is not limited to this. The concentration of the pre-formulation during the lyophilization process may differ from the concentration after reconstructing.

[0079] The lyophilized formulation of the present invention includes a stabilizer capable of stabilizing the structure of the fusion protein so that the pharmacological efficacy of the α-galactosidase A fusion protein can be maintained for a long time, even during long-term storage. Such a lyophilized formulation of the present invention comprises a mixture obtained by lyophilizing an aqueous solution containing the α-galactosidase A fusion protein, a buffer solution, and a sugar or sugar alcohol.

[0080] The α-galactosidase A fusion protein of the present invention is a form in which α-galactosidase A is fused to the Fc region of an immunoglobulin. The α-galactosidase A fusion protein undergoes unfolding, wherein during lyophilization, reconstructing, or storage, the structure of the protein is deformed due to various external factors (e.g., pH, temperature, osmosis, and the presence or absence of a stabilizer), resulting in a loss of enzyme activity and a significant deterioration in the pharmacological efficacy of formulations containing α-galactosidase. Specifically, one of the two domains constituting α-galactosidase A unfolds first (to form soluble aggregates), the other domain of α-galactosidase A and the immunoglobulin Fc region unfold sequentially, subsequently forming higher-order aggregates, and finally the CH2 and CH3 domains of the immunoglobulin Fc region unfold (to form insoluble aggregates), resulting in visible precipitation. If the structure of the α-galactosidase A fusion protein is not maintained due to stress generated during the storage of the lyophilized formulation, resulting in soluble aggregates or higher-order aggregates, the risk of immunogenicity increases, causing safety issues with the formulation. Therefore, to ensure the stability of the lyophilized formulation, it is important to include components to prevent the unfolding of the α-galactosidase A fusion protein.

[0081] The inventors determined that when a lyophilized formulation containing the α-galactosidase A fusion protein is reconstructed, the pH conditions of the formulation and the inclusion or exclusion of sugars (sugars or sugar alcohols) are important in order to improve the recovery rate of the natural form, thus completing the present invention. The lyophilized formulation of the present invention can maintain the structure and activity of the fusion protein during long-term storage and achieves a high recovery rate, thus being more effective in treating patients.

[0082] Specific examples of the lyophilized formulation of the present invention may be lyophilized formulations comprising a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein wherein α-galactosidase A is linked to the Fc region of immunoglobulin; a buffer; and a sugar or sugar alcohol; more specifically, 10-40 mg / mL of the fusion protein; a buffer at a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1-20 mg / mL.

[0083] Another example may be a lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 10-40 mg / mL; a buffer at a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1-20 mg / mL; and amino acids at a concentration of 1.0-3.0% (w / v).

[0084] Another example may be a lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution, the aqueous solution containing: a fusion protein at a concentration of 10-40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1-20 mg / mL; and a nonionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[0085] Another example may be a lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution, the aqueous solution containing: a fusion protein at a concentration of 10-40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1-20 mg / mL; an amino acid at a concentration of 1.0 to 3.0% (w / v); and a nonionic surfactant at a concentration of 0.001 to 0.1% (w / v).

[0086] Another example may be a lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 10-40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; mannitol, sucrose, or trehalose at a concentration of 1-20 mg / mL; serine at a concentration of 1.0 to 3.0% (w / v); and polysorbate ester 20 at a concentration of 0.001 to 0.1% (w / v).

[0087] Another example may be a lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution containing: a fusion protein at a concentration of 15-35 mg / mL; histidine at a concentration of 5-30 mM; a sugar or sugar alcohol at a concentration of 2.5-10 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.05% (w / v); and serine at a concentration of 1.0-3.0% (w / v), but the lyophilized formulation of the present invention is not limited to the above embodiments.

[0088] As used herein, the term "aqueous solution" refers to a substance capable of stably storing α-galactosidase A fusion protein and maintaining stability during lyophilization and reconstitution while containing α-galactosidase A fusion protein. In particular, the aqueous solution contains excipients for stabilizing the α-galactosidase A fusion protein, thereby imparting stability to the α-galactosidase A fusion protein during lyophilization and enabling the preparation of lyophilized formulations with storage stability. Stabilizers may include buffers and sugars (sugars or sugar alcohols). Stabilizers may further include, but are not limited to, amino acids, nonionic surfactants, preservatives, and antioxidants. In proteins such as α-galactosidase A fusion proteins, storage stability is important not only for accurate dosage but also for inhibiting potential antigenic substances that produce anti-α-galactosidase A fusion proteins. In this invention, aqueous solutions can be used interchangeably with "prepared formulations." The lyophilized formulations of this invention comprise α-galactosidase A fusion protein and stabilizers (e.g., amino acids, nonionic surfactants, preservatives, antioxidants, etc.).A lyophilized mixture of aqueous solutions of buffers, sugars, sugar alcohols, amino acids, etc.

[0089] The concentration of α-galactosidase A fusion protein can be controlled by adjusting the volume of the reconstituted solution added to the lyophilized formulation. Therefore, the concentration of α-galactosidase A fusion protein in the aqueous solution is not particularly limited. Instead, the aqueous solution can stably lyophilize α-galactosidase A fusion protein at a high concentration of about 10 mg / mL or higher, specifically about 10 mg / mL to 40 mg / mL, and can also maintain the stability of α-galactosidase A fusion protein in the reconstituted solution.

[0090] For example, the aqueous solution of the present invention may contain, but is not limited to, an α-galactosidase A fusion protein at concentrations of about 10 to 90 mg / mL, about 10 to 70 mg / mL, about 10 to 50 mg / mL, about 10 to 30 mg / mL, about 15 to 50 mg / mL, about 15 to 40 mg / mL, about 15 to 30 mg / mL, about 20 to 30 mg / mL, about 10 mg / mL, 20 mg / mL, 22 mg / mL, or 30 mg / mL.

[0091] As used herein, the term “about” means a range encompassing ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, ±0.01, etc., and includes, but is not limited to, all values ​​within those equivalent or similar ranges stated after the term.

[0092] It is generally known that increasing the protein concentration in a formulation can reduce stability and can cause protein precipitation. However, aqueous solutions containing the stabilizer of the present invention, even when containing high concentrations of the fusion protein, can maintain the structure of the fusion protein during lyophilization and reconstitution, inhibit precipitation, and achieve high recovery rates during reconstitution. Therefore, the aqueous solutions of the present invention can contain high concentrations of α-galactosidase A fusion protein as the active ingredient, for example, at concentrations of about 10 mg / mL or higher, about 15 mg / mL or higher, or about 20 mg / mL or higher.

[0093] The buffer solution contained in the aqueous solution of the present invention is a solution used to maintain the pH of the aqueous solution to avoid rapid pH changes in the formulation during lyophilization or after reconstitution. This aqueous solution can be used as a solvent for the α-galactosidase A fusion protein and the stabilizer, and any aqueous solution can be used as the buffer solution of the present invention without limitation, as long as the aqueous solution can maintain a stable pH level for the α-galactosidase A fusion protein.

[0094] The pH of the aqueous solution affects the structure of the fusion protein, and the structure of the fusion protein can be stably maintained at pH values ​​between 6.5 and 8.0. If the pH falls outside the appropriate range, α-galactosidase A unfolds earlier than the Fc region of immunoglobulin, leading to impaired structural stability. Therefore, it is important to maintain the pH at an appropriate level to ensure the structural stability of the α-galactosidase A fusion protein.

[0095] In particular, the inventors have determined that when lyophilized formulations prepared from aqueous solutions with a pH of 6.5 or higher are dissolved, they are transparent in appearance, even when refrigerated, and the recovery rate of the natural form is also high. Specification 6 / 25 pages 9 CN 121793950 A

[0096] Examples of buffers / reagents may include, but are not limited to, phosphate and its conjugate basic salts (e.g., phosphates such as sodium phosphate, potassium phosphate, or hydrogen phosphate or dihydrogen phosphate), citric acid and its salts (e.g., sodium citrate), acetic acid and its salts (e.g., sodium acetate), histidine and its salts, and mixtures thereof as buffers / reagents. For example, the buffer may be selected from citrate buffers (e.g., sodium citrate buffer), acetate buffers (e.g., sodium acetate buffer), phosphate buffers (e.g., sodium phosphate buffer), histidine buffers, and combinations thereof, and the buffer or buffering substance in the aqueous solution (citric acid and its salts, acetic acid and its salts, histidine and its salts, phosphate and its salts, or combinations thereof) may be included at a concentration sufficient to maintain pH for the structural stability of the protein.

[0097] The pH of the aqueous solution may be from about 6.5 to 8.0, for example, from about pH 6.5 to 7.8, about pH 6.5 to 7.5, about pH 6.5 to 7.0, about pH 6.5 to 6.8, or about pH 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4 or 7.5, but is not particularly limited thereto.

[0098] To achieve the target pH, the buffer may include, but is not particularly limited to, concentrations of phosphate, citric acid, acetic acid, histidine, or salts thereof, or mixtures thereof, at concentrations of about 5 mM to about 200 mM, about 5 mM to about 100 mM, about 5 mM to about 80 mM, about 5 mM to about 40 mM, about 8 mM to about 40 mM, about 5 mM to about 30 mM, about 5 mM to about 25 mM, about 5 mM to about 15 mM, about 5 mM to about 10 mM, or about 6.67 mM.

[0099] In one specific embodiment, the buffer may contain about 10 mM of histidine and have a pH of about 6.5 or higher, specifically about pH 6.5 to 8.0, about pH 6.5 to 7.5, about pH 6.5 to 7.0, or about pH 6.5 to 6.8.

[0100] When dissolving the lyophilized mixture, the sugars (sugars or sugar alcohols) contained in the aqueous solution of the present invention play a key role in improving the recovery rate of the α-galactosidase A fusion protein. The inventors have determined that the recovery rate of the natural α-galactosidase A fusion protein is high under all pH conditions, regardless of the type of sugar in the formulation containing sugar. Therefore, the lyophilized formulation of the present invention, which achieves a high recovery rate in its natural form by containing sugars or sugar alcohols, can enhance therapeutic effects by allowing the administration of the α-galactosidase A fusion protein at appropriate doses.

[0101] Sugar refers to monosaccharides, disaccharides, polysaccharides, or oligosaccharides, examples of which may be mannose, glucose, fructose, galactose, fucose, lactose, maltose, sucrose, trehalose, raffinose, dextran, or combinations thereof. In one specific embodiment, sugar may be glucose, fructose, galactose, lactose, maltose, sucrose, trehalose, or combinations thereof, but is not limited thereto. For example, sugar may be sucrose or trehalose, but is not particularly limited thereto.

[0102] Sugar alcohol refers to a substance containing multiple hydroxyl groups, including substances in which the aldehyde and / or ketone groups of sugar are replaced by alcohol groups, including sugars containing multiple hydroxyl groups. For example, sugar alcohol may be mannitol, sorbitol, or combinations thereof, and specifically may be mannitol, but is not limited thereto.

[0103] The aqueous solution of the present invention may contain one type of sugar, i.e., sugar or sugar alcohol, or may contain a combination of several types of sugar, but is not limited thereto.

[0104] Sugar alcohols, sugars, or combinations thereof may be present in aqueous solutions at concentrations of about 1 to 30 mg / mL, about 1 to 25 mg / mL, about 2 to 20 mg / mL, about 2 to 15 mg / mL, about 2 to 10 mg / mL, about 2.5 to 5 mg / mL, or about 2.5 mg / mL, but are not limited thereto.

[0105] The aqueous solutions of the present invention may also contain amino acids. Amino acids can confer protein structural stability to α-galactosidase A fusion. The amino acids contained in the lyophilized formulations of the present invention may be selected from serine, arginine, lysine, threonine, asparagine, glutamine, glycine, proline, alanine, valine, isoleucine, leucine, phenylalanine, or combinations thereof, specifically selected from serine, arginine, threonine, glutamine, glycine, alanine, and combinations thereof, but are not limited thereto. In one specific embodiment, the amino acid may be serine, but is not limited thereto.

[0106] The amino acids may be present in the aqueous solution in amounts of about 1.0 to 5.0% (w / v), about 1.0 to 4.0% (w / v), about 1.0 to 3.0% (w / v), about 1.4 to 3.0% (w / v), about 2.1 to 2.9% (w / v), about 1.4% (w / v), about 2.1% (w / v), about 2.5% (w / v), or about 2.9% (w / v), relative to the total volume of the aqueous solution of the present invention, but are not particularly limited thereto.

[0107] The aqueous solution of the present invention may also contain a nonionic surfactant. A nonionic surfactant is a substance that reduces the surface tension of a protein solution to prevent the protein from adsorbing or aggregating on a hydrophobic surface after reconstruction.

[0108] Specific examples of nonionic surfactants that can be used in this invention may include polysorbates (e.g., polysorbate 20 (polyoxyethylene (20) dehydrated sorbitol monolaurate), polysorbate 40 (polyoxyethylene (20) dehydrated sorbitol monolaurate)).Polysorbate (PP), polysorbate 60 (polyoxyethylene (20) dehydrated sorbitan monostearate), polysorbate 80 (polyoxyethylene (20) dehydrated sorbitan monooleate); wherein the number 20 after polyoxyethylene indicates the total number of oxyethylene groups (-(CH2CH2O)-), poloxamer (PEO-PPO-PEO copolymer; wherein PEO: poly(ethylene oxide) and PPO: poly(propylene oxide)), polyethylene glycol-polypropylene glycol, polyoxyethylene compounds (e.g., polyoxyethylene-stearate, polyoxyethylene alkyl ether (alkyl: C1-C30), polyoxyethylene monoallyl ether, alkylphenyl polyoxyethylene copolymer (alkyl: C1-C30) etc.) and sodium dodecyl sulfate (SDS), etc., or examples thereof may be polysorbate or poloxamer, which may be used alone or in combination of one or more of them.

[0109] In particular, the nonionic surfactant may be poloxamer 188, polysorbate 20, polysorbate 40, polysorbate 60, or polysorbate 80, which may be used in combination, but are not particularly limited thereto.

[0110] In this invention, the nonionic surfactant may be included in the aqueous solution of the invention at a concentration of about 0.1% (w / v) or lower relative to the total volume of the aqueous solution, for example, about 0.001 to about 0.1% (w / v), about 0.001 to about 0.1% (w / v), about 0.01 to about 0.05% (w / v), about 0.001% (w / v), about 0.0255% (w / v), or about 0.05% (w / v), but is not particularly limited thereto.

[0111] The aqueous solution of the invention may not further contain an isotonic agent, which may be sodium chloride, but is not limited thereto. The aqueous solution of the lyophilized formulation of the present invention is free of isotonic agents, thus allowing for a higher collapse temperature to be set during lyophilization, thereby reducing the lyophilization process time and lowering the osmotic pressure. The inventors have determined that no collapse occurs when preparing the lyophilized formulation of the present invention, which is free of isotonic agents.

[0112] The aqueous solution of the present invention may further contain a preservative. A preservative is a substance that substantially reduces the action of bacteria or fungi in a formulation and is a compound contained in the formulation to facilitate the production of multi-dose formulations. Examples of potential preservatives may include octadecyl dimethyl benzyl ammonium chloride, hexamethyl diammonium chloride, benzalkonium chloride (wherein the alkyl group is a mixture of alkyl benzyl dimethyl ammonium chloride, which is a long-chain compound), and benzyl chloride. Other types of preservatives may include aromatic phenols, such as phenol, butanol, or benzyl alcohol; alkyl parabens, such as methylparaben or propylparaben; catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol, but are not limited thereto. The concentration of the preservative can be from 0.001% (w / v) to 1.0% (w / v), but is not limited thereto.

[0113] Meanwhile, without impairing the advantageous effects of the present invention, in addition to the above-mentioned buffer solutions, sugar alcohols, sugars, amino acids,In addition to nonionic surfactants and / or preservatives, the aqueous solution (pre-formulation) used to prepare the lyophilized formulation of the present invention may optionally further contain other components or substances known in the art, but is not limited thereto.

[0114] Specific examples of the aqueous solution (pre-formulation) used to prepare the lyophilized formulation of the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; and a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL, but is not limited thereto.

[0115] Another specific example of the aqueous solution (pre-formulation) used to prepare the lyophilized formulation of the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer solution at a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; a nonionic surfactant at a concentration of 0.001 to 0.1% (w / v); and amino acids at a concentration of 1.0 to 3.0% (w / v) of the amino acid specified in the specification (page 8 / 25, 11 CN 121793950 A), but is not limited thereto.

[0116] Another specific example of an aqueous solution (pre-formulation) used to prepare the lyophilized formulation of the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer solution containing 5 to 30 mM histidine at a pH of 6.5 to 8.0; a sugar or sugar alcohol at a concentration of 1 to 20 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.1% (w / v); and serine at a concentration of 1.0 to 3.0% (w / v), but not limited thereto.

[0117] Another specific example of an aqueous solution (pre-formulation) used to prepare the lyophilized formulation of the present invention may be an aqueous solution containing: a fusion protein at a concentration of 10 to 40 mg / mL; a buffer solution containing 5 to 30 mM histidine at a pH of 6.5 to 8.0; sucrose, trehalose, or mannitol at a concentration of 1 to 20 mg / mL; polysorbate 20 at a concentration of 0.001 to 0.1% (w / v); and serine at a concentration of 1.0 to 3.0% (w / v), but not limited thereto.

[0118] In addition, the aqueous solution or lyophilized formulation used to prepare the lyophilized formulation may further contain pharmaceutically acceptable carriers, excipients, etc., which may be non-naturally occurring.

[0119] The lyophilized formulation of the present invention may include, but is not limited thereto, a mixture obtained by lyophilizing 1 to 10 mL of the aqueous solution, specifically 5 to 10 mL or 4 to 6 mL of the aqueous solution.

[0120] The inventors prepared 4 or 6 mL aqueous solutions, then lyophilized them, followed by dissolution. The results showed that a 6 mL filler volume resulted in a higher recovery rate of the natural form, with no significant difference between the two filler volumes.

[0121] The aqueous solutions used to prepare the lyophilized formulations of the present invention can be prepared under suitable freeze-drying and drying conditions known in the art.Freezing and drying. Drying can be completed in a primary process or through multiple processes, such as secondary or higher-level processes.

[0122] The lyophilized formulation of the present invention can be obtained by preparing a pre-formulation comprising an appropriate concentration of α-galactosidase A fusion protein taking into account the expected dose, a freeze-dried formulation, and then reconstructing the resulting product to suitability for administration to a patient. The pre-formulation can be diluted to increase volume, lyophilized, and then reconstructed with a reconstructing solution of a smaller volume compared to the volume during reconstructing, but is not limited thereto. In the present invention, the lyophilized formulation can be a mixture obtained by lyophilizing an aqueous solution containing α-galactosidase A fusion protein and a stabilizer (e.g., a buffer, sugar, sugar alcohol, etc.), and further, a reconstructed formulation obtained by reconstructing the lyophilized formulation using a reconstructing solution, but is not limited thereto.

[0123] The lyophilized formulation of the present invention maintains the physical and / or chemical stability of the α-galactosidase A fusion protein even during long-term storage, while maintaining its activity, thereby ensuring excellent long-term stability. For example, even under long-term refrigeration conditions (5°C) or harsh conditions (40°C), the appearance, moisture content, and recovery rate of the natural form can be maintained at appropriate levels.

[0124] Specifically, the lyophilized formulations according to the invention can be stable for periods of 2 weeks or longer, 1 month or longer, 3 months or longer, 6 months or longer, 12 months or longer, 18 months or longer, or 24 months or longer, even at temperatures from about -80°C to 50°C, for example, from about 2°C to 8°C, about 5°C, about 35°C, about 40°C, 35°C or higher, or about 40°C or higher, but are not limited thereto.

[0125] The stability of the lyophilized formulations can be checked by methods known in the art, including pharmacopoeia instructions, and the test items and standards used to evaluate stability can be appropriately set by those skilled in the art, and the check is not limited to a specific method.

[0126] For example, the lyophilized formulation of the present invention remains transparent in terms of cake appearance or appearance after dissolution even during long-term storage, and has a moisture content of less than 5%, less than 4%, less than 3%, less than 2% or less than 1%, so that the product quality does not deteriorate, and shows a natural form recovery rate of 85% or higher, 90% or higher, 95% or higher, or 97% or higher in SE-HPLC, but is not limited thereto. Specification 9 / 25 pages 12 CN 121793950 A

[0127] The α-galactosidase A fusion protein contained in the lyophilized formulation of the present invention as an active ingredient is described in more detail below.

[0128] The α-galactosidase A fusion protein contained in the lyophilized formulation of the present invention refers to a fusion protein in which α-galactosidase A is linked to the Fc region of immunoglobulin, and the fusion protein may have two α-galactosidase A molecules linked by...The linker is connected to the Fc region of an immunoglobulin in a dimer form. Specifically, two α-galactosidase A molecules can be respectively linked to their respective monomers in the Fc region of the immunoglobulin in a dimer form via a linker. The two α-galactosidase A molecules can form a dimer through non-covalent bonds, but are not limited thereto. The fusion protein of the present invention has increased α-galactosidase A stability due to the fusion of the immunoglobulin Fc region with α-galactosidase A, thereby exerting pharmacological efficacy in vivo for a long time. The lyophilized formulation of the present invention does not lose its pharmacological efficacy even after long-term storage because the pre-formulation containing stabilizers in addition to the fusion protein is lyophilized to impart excellent stability to the fusion protein.

[0129] Specifically, the fusion protein of the present invention may include the amino acid sequence of SEQ ID NO: 4, or may be encoded by the polynucleotide sequence of SEQ ID NO: 5, but is not limited thereto. The fusion protein of the present invention may be a dimer formed by two monomers including the amino acid sequence of SEQ ID NO: 4, but is not limited thereto. The disclosure of WO 2019 / 125059 is incorporated herein by reference for the fusion protein of the present invention.

[0130] As used herein, the terms "fusion protein in which α-galactosidase A is linked to the Fc region of immunoglobulin", "α-galactosidase A fusion protein", and "fusion protein" are used interchangeably.

[0131] The fusion protein of the present invention is expressed in a transformant in a form in which α-galactosidase A is linked to the Fc region of immunoglobulin via a linker, so that α-galactosidase A forms a dimer via a non-covalent bond when the Fc region of immunoglobulin forms a dimer.

[0132] The α-galactosidase A (α-galactosidase A, α-Gal A, GLA) of the present invention is an enzyme present in lysosomes of the spleen, brain, liver, etc., and hydrolyzes the α-galactosyl moiety at the ends of glycolipids and glycoproteins; it is a homodimeric glycoprotein. In particular, α-galactosidase A is known to be involved in Fabry disease (a lysosomal storage disease). α-Galactosidase A has a dimer structure consisting of two domains (a TIM barrel domain and an immunoglobulin-like domain containing a β-sheet) (Journal of Biological Chemistry, Vol. 287, No. 34, 2012; and Lieberman et al., Biochemistry, Vol. 48, No. 22, 2009). α-Galactosidase A unfolds at high pH, ​​therefore formulations containing α-Galactosidase A require maintaining an appropriate pH level. Specifically, the active site remains in a soluble aggregate state formed upon unfolding of one domain; however, activity is lost once insoluble aggregates form as unfolding progresses. Therefore, lyophilized formulations need to contain stabilizers to maintain enzyme activity by preserving the soluble aggregate state. In this invention, α-Galactosidase A...Lactosidase A may be in a native form or a recombinant form, and specifically, may include, but is not limited to, the amino acid sequence of SEQ ID NO: 1.

[0133] α-galactosidase A includes fragments of its native form or analogs thereof, not limited to those having mutations selected from substitution, addition, deletion, modification, and combinations thereof, provided that the analog has activity equivalent to that of the native form of the enzyme.

[0134] α-galactosidase A may include an amino acid sequence having at least 60%, 70%, or 80%, specifically at least 90%, more specifically at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequence of SEQ ID NO: 1, which may be obtained from microorganisms or commercially available using recombinant technology, but is not limited thereto.

[0135] The term “homology” as used herein refers to the degree of similarity to a wild-type amino acid sequence or wild-type nucleotide sequence, and homology comparisons may be performed by visual inspection or using commercially available comparison procedures. Commercially available computer programs can be used to calculate the homology between two or more sequences, expressed as a percentage (%). Homology (%) between adjacent sequences can be calculated. The terms “homology” and “identity” are often used interchangeably. Specification 10 / 25 pages 13 CN 121793950 A

[0136] Information on the sequence of α-galactosidase A or its derivatives and the nucleotide sequence encoding them is available from known databases such as NCBI.

[0137] The α-galactosidase A fusion protein of the present invention can be prepared by expression in a transformant in a form in which α-galactosidase A is linked to the Fc region of an immunoglobulin via a linker.

[0138] The linker is a peptide linker, and the fusion protein of the present invention can be in a form in which α-galactosidase A is linked to the Fc region of an immunoglobulin via a peptide linker. One end of the linker can be attached to a chain of the Fc region of an immunoglobulin in dimer form, but is not limited thereto.

[0139] The peptide linker can contain one or more amino acids, for example, 1 to 1000 amino acids. The peptide linker can be any peptide linker known in the art, including, for example, [GS]x linkers, [GGGS]x linkers, and [GGGGS]x linkers, etc., where x can be a natural number of 1 or greater (e.g., 1, 2, 3, 4, 5 or greater), but is not limited thereto. Specifically, the peptide linker of the present invention can consist of 10 to 50 amino acids, more specifically 20 to 40 amino acids, and may include the amino acid sequence of SEQ ID NO: 2.

[0140] In one aspect of the present invention, the sites where α-galactosidase A and the immunoglobulin Fc region are linked to the peptide linker are not limited, as long as the activity of α-galactosidase A is maintained, and α-galactosidase A is linked to the immunoglobulin Fc region. SpecificallyThe site may be at the respective ends of α-galactosidase A and the immunoglobulin Fc region, more specifically, at the C-terminus of α-galactosidase A and the N-terminus of the immunoglobulin Fc region, but is not limited thereto.

[0141] As used herein, the terms “N-terminus” or “C-terminus” refer to the amino-terminus and carboxyl-terminus of a protein, respectively. Examples may include the last amino acid residue at the N-terminus or C-terminus, but also include amino acid residues near the N-terminus or C-terminus, particularly the first to tenth amino acid residues from the last end.

[0142] In this invention, peptide linkers may be respectively linked to monomers of the immunoglobulin Fc region in the form of a dimer composed of monomeric immunoglobulin Fc regions, and each linker respectively linked to a monomer of the immunoglobulin Fc region may be independently linked to an α-galactosidase A molecule, but is not limited thereto.

[0143] The immunoglobulin Fc region, which constitutes a part of the enzyme fusion protein of this invention, may be a dimer formed from immunoglobulin Fc region monomers.

[0144] As used herein, the term "immunoglobulin Fc region" refers to a region comprising the heavy chain constant domain 2 (CH2) and / or heavy chain constant domain 3 (CH3) of an immunoglobulin, excluding the heavy chain and light chain variable domains. In one aspect of the invention, the immunoglobulin Fc region may include, but is not limited to, a modified hinge region. Specifically, the immunoglobulin Fc region may have mutations selected from substitution, addition, deletion, modification, and any combination thereof in the native immunoglobulin Fc region, but is not limited to these.

[0145] The immunoglobulin Fc region is a substance used as a carrier in pharmaceutical manufacturing. Recently, research has been actively conducted on fusion proteins using the immunoglobulin Fc region to stabilize proteins and prevent renal clearance of proteins. Immunoglobulins are the main components of blood and there are five different types: IgG, IgM, IgA, IgD, and IgE. The most commonly used type in fusion protein research is IgG, which is divided into four subtypes, IgG1 to IgG4.

[0146] The immunoglobulin Fc region may include a hinge region within the heavy chain constant domain, and immunoglobulin Fc region monomers may form dimers via the hinge region, but are not limited thereto. The immunoglobulin Fc region of the present invention may be an extended Fc region comprising part or all of the heavy chain constant domain 1 (CH1) and / or light chain constant domain 1 (CL1) of the immunoglobulin, excluding the heavy chain and light chain variable domains, as long as the immunoglobulin Fc region has substantially the same or enhanced effects compared to the native form. In addition, the immunoglobulin Fc region of the present invention may be a region from which a considerably long amino acid sequence corresponding to CH2 and / or CH3 is removed.

[0147] Specifically, the immunoglobulin Fc region of the present invention may include 1) CH1 domain, CH2 domain, CH3 domain (details omitted).Page 11 / 25 14 CN 121793950 A and CH4 domain, 2) CH1 domain and CH2 domain, 3) CH1 domain and CH3 domain, 4) CH2 domain and CH3 domain, or 5) a combination of one or more domains selected from the CH1 domain, CH2 domain, CH3 domain and CH4 domain with the immunoglobulin hinge region (or a portion of the hinge region), but not limited thereto. However, the immunoglobulin Fc region of the present invention is not limited thereto. More specifically, the immunoglobulin Fc region may include the hinge region, the CH2 domain and the CH3 domain, but is not limited thereto.

[0148] As used herein, the term "hinge sequence" refers to a site on the heavy chain that forms an immunoglobulin Fc region dimer by interchain disulfide bonds, and the immunoglobulin Fc region of the present invention may be in the form of two immunoglobulin Fc chain molecules forming a dimer due to the presence of the hinge sequence.

[0149] Specifically, the hinge region can be mutated to include only one cysteine ​​(Cys) residue by deleting a portion of the hinge region, or to replace the serine (Ser) residue involved in the chain exchange with a proline (Pro) residue. More specifically, the hinge region may have a serine residue at position 2 replaced by a proline residue, but is not limited thereto. The immunoglobulin Fc region of the present invention may include, but is not limited to, the amino acid sequence of SEQ ID NO: 3.

[0150] The immunoglobulin Fc region of the present invention includes not only the native sequence obtained from papain digestion of immunoglobulin, but also its derivatives, substitutes, and variants, such as sequences different from the native sequence and obtained by mutation of one or more amino acid residues through deletion, addition, non-conservative or conserved substitution, or a combination thereof. The derivatives, substitutes, and variants are configured to have the ability to bind FcRn.

[0151] For example, amino acid residues at positions 214 to 238, 297 to 299, 318 to 322, or 327 to 331 in the IgG Fc (known to be important for linkage) can be used as suitable sites for mutation.

[0152] In addition, various types of derivatives can be obtained, for example, by removing sites capable of forming disulfide bonds, deleting some amino acid residues at the N-terminus of the native Fc, or adding methionine residues at the N-terminus of the native Fc. Furthermore, in order to remove effector functions, complement binding sites, such as C1q binding sites, can be removed, and antibody-dependent cell-mediated cytotoxicity (ADCC) sites can be removed. Techniques for preparing such sequence derivatives of the immunoglobulin Fc region are disclosed in WO 97 / 34631 and WO 96 / 32478, etc.

[0153] Amino acid alterations in proteins and peptides without changing the overall activity of the molecule are well known in the art (H. Neurath, RL Hill, The Proteins, Academic Press,New York, 1979). The most common exchanges are between amino acid residues Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. In some cases, modifications can occur via phosphorylation, sulfation, acrylate, glycosylation, methylation, farnesylation, acetylation, amidation, etc.

[0154] The above-mentioned Fc derivatives exhibit bioactivity equivalent to the Fc region of the present invention and can have enhanced Fc region structural stability against heat, pH, etc.

[0155] Such Fc regions can be obtained from natural forms isolated from living humans or animals (such as cattle, goats, pigs, mice, rabbits, hamsters, rats, and guinea pigs), or can be recombinant forms or derivatives thereof obtained from transformed animal cells or microorganisms. In particular, Fc regions can be obtained from natural forms by isolating intact immunoglobulins from living humans or animals and then treating the isolated immunoglobulins with proteases. When treated with papain, the isolated intact immunoglobulins are digested into Fab and Fc, and when treated with pepsin, they are digested into pF'c and F(ab)2. These fragments can be subjected to size exclusion chromatography, etc., to isolate Fc or pF'c therefrom. In a more specific embodiment, the immunoglobulin Fc region is a recombinant immunoglobulin Fc region, wherein the human Fc region is obtained from microorganisms.

[0156] Alternatively, the immunoglobulin Fc region may be in the form of a natural glycan, a glycan with increased glycan content compared to the natural form, or a glycan with decreased glycan content compared to the natural form (see page 12 / 25 of CN 121793950 A), or it may be in a deglycosylated form. The increase, decrease, or removal of immunoglobulin Fc glycans can be achieved using conventional methods, such as chemical methods, enzymatic methods, and genetic engineering methods using microorganisms. In particular, immunoglobulin Fc regions obtained by removing glycans from Fc exhibit a significantly reduced affinity for complement c1q binding and reduced or lost antibody-dependent or complement-dependent cytotoxicity, thus not inducing unwanted immune responses in vivo. In this respect, deglycosylated or aglycosylated immunoglobulin Fc regions may be more suitable as drug carriers for their own purposes.

[0157] As used herein, the term “deglycosylation” refers to an Fc region in which the glycan is removed by an enzyme, and the term aglycosylation refers to a non-glycosylated Fc region produced in prokaryotes, more specifically in Escherichia coli.

[0158] Meanwhile, the immunoglobulin Fc region of the present invention can be derived from humans or animals, such as cattle, goats, pigs, mice, rabbits, hamsters, rats, and guinea pigs, and more specifically, the immunoglobulin Fc region is derived from humans.

[0159] Furthermore, the immunoglobulin Fc region can be derived from the Fc region of IgG, IgA, IgD, IgE, IgM, or combinations or hybrids thereof. In a more specific embodiment, the immunoglobulin Fc region is derived from the most abundant IgG or IgM in human blood, and in another more specific embodiment, the immunoglobulin Fc region is derived from IgG known to increase the half-life of ligand-binding proteins. In yet another more specific embodiment, the immunoglobulin Fc region is the IgG4 Fc region, and in yet another more specific embodiment, the immunoglobulin Fc region is a glycosylated Fc region derived from human IgG4, but is not limited thereto. The immunoglobulin Fc region of the present invention can include, but is not limited to, the amino acid sequence of SEQ ID NO: 3. More specifically, the immunoglobulin Fc region may include monomers having the amino acid sequence of SEQ ID NO: 3, and the immunoglobulin Fc region may be a homodimer of monomers each having the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.

[0160] As used herein, the term "combination" refers to the formation of a link between a polypeptide encoding a single-chain immunoglobulin Fc region of the same origin and single-chain polypeptides of different origins when forming a dimer or multimer. That is, the dimer or multimer may be prepared from two or more fragments selected from IgG Fc, IgA Fc, IgM Fc, IgD Fc and IgE Fc fragments.

[0161] Specifically, the immunoglobulin Fc region of the α-galactosidase A fusion protein may be in dimer form and may have a structure in which two polypeptide chains are linked to each other by disulfide bonds. More specifically, the two chains may be linked via the nitrogen atom of one of the chains, but is not limited thereto. Linkage via nitrogen atoms can be achieved through reductive amination of the ε-amino atom of lysine or the N-terminal amino group, but is not limited thereto. In one specific embodiment, the immunoglobulin Fc region can be linked via the nitrogen atom of its N-terminal proline, but is not limited thereto. One Fc region in dimer form can be covalently linked to two α-galactosidase A molecules via two linkers, but is not limited thereto.

[0162] Unless otherwise stated herein, the disclosure of α-galactosidase A or fusion protein according to the invention in the detailed description or claims applies not only to α-galactosidase A or fusion protein, but also to its salts (e.g., pharmaceutically acceptable salts) or its solvate forms. Thus, although only “α-galactosidase A” or “fusion protein” is described herein, the corresponding disclosure also applies to its specific salts, its specific solvates, and solvates of specific salts. These salts canThis can be, for example, the use of any pharmaceutically acceptable salt. There are no particular limitations on the type of salt. However, the salt is preferably in a form that is safe and effective for the subject, such as a mammal, but is not particularly limited thereto.

[0163] The term "pharmaceutically acceptable" means a substance that, within the scope of medical and pharmaceutical determinations, is effective for the intended purpose without causing excessive toxicity, irritation, allergic reactions, etc.

[0164] As used herein, the term "pharmaceutically acceptable salt" refers to a salt derived from a pharmaceutically acceptable inorganic acid, organic acid, or base. Examples of suitable salts may include hydrochloric acid, bromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, p-toluenesulfonic acid, tartaric acid, acetic acid, citric acid, mesylic acid, formic acid, benzoic acid, acetic acid, dicitonic acid, naphthalene-2-sulfonic acid, benzenesulfonic acid, etc. Salts derived from suitable bases may include alkali metals such as sodium and potassium, alkaline earth metals such as magnesium and ammonium, etc.

[0165] The term "solvate" as used herein refers to a complex formed between the α-galactosidase A, fusion protein, or its salts of the present invention and solvent molecules.

[0166] The fusion protein may be prepared or produced by any method known in the art. Specifically, the fusion protein may be obtained by culturing animal cells in which an expression vector has been inserted and purifying the culture, or may be synthesized based on its sequence, but is not limited thereto.

[0167] The lyophilized formulation of the present invention may be used to prevent, treat, and alleviate diseases such as α-galactosidase A deficiency, which may be prevented, treated, or alleviated by administration of the α-galactosidase A fusion protein, but is not limited thereto.

[0168] The α-galactosidase A fusion protein of the present invention may be used as a medicament for enzyme replacement therapy (ERT). Enzyme replacement therapy can prevent or treat diseases by supplementing the deficiency or insufficiency of the enzyme causing the disease, through the restoration of enzyme function decline.

[0169] Specifically, the lyophilized formulation of the present invention can be used to prevent, treat, or alleviate α-galactosidase A deficiency. α-galactosidase A deficiency is a lysosomal storage disorder caused by a deficiency of the lysosomal enzyme α-galactosidase A (α-Gal A), examples of which include Fabry disease, diffuse angiokeratoma, diffuse somatic angiokeratoma, and hereditary dystopic lipidosis.

[0170] Fabry disease is one of the lysosomal storage disorders, a recessive genetic disease caused by X-chromosome inactivation. Fabry disease is a congenital metabolic disorder of glycosphingolipids caused by a deficiency or insufficiency of α-galactosidase A activity. It is known that due to α-galactosidase A deficiency...Abnormalities in lactosidase A lead to the abnormal accumulation of globosaphosphosphingosine (Gb3) in the blood vessel walls and various parts of the body, such as the skin, kidneys, heart, and nervous system, significantly affecting blood circulation and reducing nutrient supply. Symptoms such as hypersensitivity to cold, severe pain, acromegaly, angiokeratoma, corneal opacity, myocardial ischemia, myocardial infarction, and renal failure occur, ultimately leading to death due to the inability of the kidneys to function properly.

[0171] As used herein, the term “prevention” means any action that inhibits or delays the onset of the disease by administering the fusion protein or a lyophilized formulation containing the fusion protein, and the term “treatment” means any action that alleviates, improves, or beneficially alters the symptoms of a target disease by administering the fusion protein or a lyophilized formulation containing the fusion protein.

[0172] In one specific embodiment of the invention, the lyophilized formulation of the invention can be used for the prevention or treatment of Fabry disease, but is not limited thereto.

[0173] Additionally, the lyophilized formulation of the invention can be administered subcutaneously, but is not limited thereto. Specifically, the lyophilized formulations of the present invention in their lyophilized state can be reconstituted for subcutaneous administration.

[0174] As used herein, the term "administration" means introducing the reconstituted lyophilized formulation into a patient by any suitable method. There are no particular limitations on the route of administration of the lyophilized formulation, but it can be administered via any general route as long as the α-galactosidase A fusion protein of the lyophilized formulation can reach the target in vivo, for example, intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, local administration, intranasal administration, intrapulmonary administration, or rectal administration, but not limited thereto.

[0175] The preferred dose of the fusion protein of the present invention can be from about 0.0001 mg to 500 mg per kg of patient body weight per day, and the lyophilized formulations of the present invention can be formulated for appropriate dose administration or reconstituted for appropriate dose administration. However, the dosage of the fusion protein, in addition to the route of administration and treatment frequency, also takes into account various factors, such as the patient's age, weight, health status and sex, disease severity, diet and excretion rate, to determine its effective dosage. Therefore, taking into account these factors, those skilled in the art can readily determine the effective dosage suitable for the specific use of the lyophilized formulation of the present invention.

[0176] According to another aspect of the present invention, a method for preparing a lyophilized formulation is provided.

[0177] Specifically, the preparation method may include lyophilizing an aqueous solution containing α-galactosidase A fusion protein, a buffer solution and a sugar or sugar alcohol.

[0178] The aqueous solution or lyophilized formulation may further contain at least one component selected from amino acids, nonionic surfactants and preservatives.

[0179] Aqueous solutions, lyophilized formulations, and their constituent components are as described above.

[0180] The method may include lyophilizing 1 to 10 mL, specifically 5 to 10 mL, of an aqueous solution containing: an α-galactosidase A fusion protein, wherein the α-galactosidase A is linked to the Fc region of an immunoglobulin; a buffer solution; and a sugar or sugar alcohol, but is not limited thereto.

[0181] According to another aspect of the invention, a method for reconstructing a lyophilized formulation is provided, the method comprising adding a reconstructing solution to the lyophilized formulation.

[0182] Aqueous solutions, lyophilized formulations, and reconstructing are as described above.

[0183] As used herein, the term “reconstructing solution” refers to a solution added to a solid lyophilized formulation to achieve reconstructing. Examples of reconstructing solutions may include distilled water (water), but are not particularly limited thereto.

[0184] The reconstituted formulation may contain an α-galactosidase A fusion protein at a concentration suitable for individual administration, specifically, it may contain α-galactosidase A fusion protein at concentrations of 10 to 100 mg / mL, 10 to 90 mg / mL, 10 to 50 mg / mL, or 10 to 30 mg / mL, but is not limited thereto.

[0185] The reconstituted formulation can be obtained by reconstituted the lyophilized formulation of the present invention for subcutaneous administration to an individual, but is not limited thereto.

[0186] According to another aspect of the present invention, a lyophilized formulation for the prevention or treatment of a disease is provided.

[0187] The lyophilized formulation is as described above.

[0188] An example of a disease may be Fabry disease, but may be non-limitingly included in any disease in which the lyophilized formulation of the present invention or the α-galactosidase A fusion protein contained therein can present a preventive or therapeutic effect.

[0189] According to another aspect of the present invention, the use of the lyophilized formulation for the prevention or treatment of a disease is provided.

[0190] The lyophilized formulation and the disease are as described above.

[0191] The present invention will be described in detail below through examples and experimental examples. However, the following examples and experimental examples are only for illustrating the present invention, and the scope of the present invention is not limited thereto.

[0192] Example 1: Preparation of fusion protein of α-galactosidase A and immunoglobulin Fc region

[0193] A fusion protein of α-galactosidase A and immunoglobulin Fc region (hereinafter referred to as α-galactosidase A fusion protein, SEQ ID NO: 4) was prepared, wherein natural α-galactosidase A (SEQ ID NO: 1) and immunoglobulin Fc region (SEQ ID NO: 3) are linked by a linker (SEQ ID NO: 2).

[0194] Specifically, a vector for expressing α-galactosidase A fusion protein was constructed by inserting a polynucleotide (SEQ ID NO: 5) encoding the α-galactosidase A fusion protein into an XOGC vector as an expression vector using a restriction enzyme.

[0195] The DNA and protein sequences of the α-galactosidase A fusion protein are shown in Table 1 below. In the protein sequences in Table 1, underlined text indicates signal sequences, bold letters indicate amino acid substitutions, and italic letters indicate linkers. The α-galactosidase A fusion protein of the present invention is a dimer formed by two monomers, each monomer including the amino acid sequence of SEQ ID NO: 4. Specification 15 / 25 pages 18 CN 121793950 A

[0196] Specification 16 / 25 pages 19 CN 121793950 A

[0197]

[0198]

[0199] The constructed vector expressing the α-galactosidase A fusion protein (pX0GC-α-galactosidase-Fc) was transfected into the CHO-S cell line on page 17 / 25 of the specification 20 CN 121793950 A to prepare a cell line capable of producing α-galactosidase A fusion protein in large quantities.

[0200] Specifically, CHO-S cells were cultured in suspension in a 1L Erlenmeyer flask (Corning, catalog number 431147) using serum-free medium (FreeStyle CHO expression medium, Thermo Fisher, catalog number 12651014). When the cell count reached 5 × 10⁸, the cells were transformed with FreeStyle Max (Thermo Fisher, catalog number 16447-100). That is, 10 mL of OptiPro SFM (Thermo Fisher, catalog number 12309) was added to each of two tubes. 500 μg of DNA was added to one tube, and 500 μL of FreeStyle Max was added to the other tube. The two solutions were then mixed and allowed to stand at room temperature for 10 minutes. The mixture was then added to the cells, wherein the medium had been previously replaced with fresh FreeStyle CHO expression medium (Thermo Fisher, catalog number 12651014). Cells were cultured at 37°C, 5% CO2, and 125 rpm for approximately 96 hours to prepare α-galactosidase A fusion protein.

[0201] In the α-galactosidase A fusion protein prepared in this way, each of the two immunoglobulin Fc region monomers constituting the dimer is linked to one α-galactosidase A, thereby forming a structure in which the dimer form of the immunoglobulin Fc region is fused with two α-galactosidase A molecules.

[0202] Example 2: Improvement of the appearance of lyophilized formulations according to pH changes

[0203] Example 2-1: Preparation of lyophilized formulations

[0204] Various lyophilized formulations were prepared using various combinations of pH, nonionic surfactants, and amino acid content. The appearance of the lyophilized formulations, their appearance after dissolution, and SE-HPLC analysis were evaluated.

[0205] For the preparation of lyophilized formulations, solutions of the formulations having the compositions shown in Table 2 below were aliquoted into 4.0 mL glass vials (20 mL), partially sealed with rubber stoppers, and then placed on the rack of a freeze dryer (Lyostar 3, SP Scientific). Subsequently, lyophilization was performed under the conditions shown in Table 3 below, and after aluminum lyophilization, the prepared lyophilized formulation was sealed with an aluminum cap.

[0206] Specification 18 / 25 pages 21 CN 121793950 A

[0207]

[0208] Example 2-2: Dissolution and Appearance of Lyophilized Formulations

[0209] Each lyophilized vial was allowed to stand at room temperature for 30 minutes to remove moisture generated on the surface of the vial, and then the appearance of the filter cake was examined.

[0210] A 25G needle (1 inch or larger) was attached to a 2 mL syringe, 2 mL of distilled water was drawn, and then injected at a 90-degree angle into each vial containing the lyophilized product. The distilled water was automatically injected due to the vacuum maintained inside the vial.

[0211] After distilled water injection, the needle and syringe were separated to release the remaining vacuum in the vial, and then the needle was removed. The vial was shaken 5 times and allowed to stand until the lyophilized cake dissolved.

[0212] The appearance of the dissolved solution in the vial was checked, and then the vial was allowed to stand under refrigeration for 3 days, followed by an appearance inspection.

[0213] Examples 2-3: Size Exclusion Liquid Chromatography (SE-HPLC)

[0214] The lyophilized product dissolved in Example 2-2 was diluted to a concentration of 1 mg / mL with the mobile phase (1xPBS, Lonza) and then filtered through a 0.2 μm injection filter. Subsequently, 200 μL of the filtered sample was injected into the vial insert and then prepared in a screw-cap vial.

[0215] Subsequently, the mobile phase was connected to the pump, and the analytical column (TSKgel G3000SWXL, Tosoh) was installed on a Waters e2695 and Waters 2489 Instruments (Waters), with the mobile phase flowing at a flow rate of 0.5 mL / min. The sample was equilibrated by allowing the mobile phase to flow at a flow rate of 0.5 mL / min for 30 minutes or longer until the detector signal stabilized. When the temperature of the autosampler dropped to 4°C, the sample was placed in the sampler, and 10 μL of sample was injected. Then, the mobile phase was allowed to flow for 35 minutes, and the detection peak was identified at 214 nm. The analysis was performed on a PC using Empower Pro software.

[0216] Examples 2-4: Comparison of Appearance and Natural Form Recovery of Lyophilized Formulations Based on pH Changes

[0217] First, the comparison results of the cake appearance of the lyophilized formulations prepared in Example 2-2 showed that the appearance was suitable under all conditions, with no serious collapse (Figure 1).

[0218] The immediate appearance after dissolution is transparent under all conditions, but the appearance changes after 3 days of refrigeration.The appearance became more turbid as the pH decreased (Figure 1). Specifically, lyophilized formulations with pH 6.5 or higher showed a clear appearance after dissolution.

[0219] Results of size exclusion chromatography analysis of the recovery rate of the natural form in the prepared lyophilized formulations showed that the recovery rate of the natural form decreased as the pH decreased (Figure 2). Specifically, lyophilized formulations with pH 6.5 or higher showed a high recovery rate of the natural form. The natural form refers to the α-galactosidase A fusion protein prepared in Examples 1-1.

[0220] The comparison results of the appearance of the lyophilized formulations and the recovery rate of the natural form according to pH changes are summarized in Table 4 below. Instructions for Use, Pages 19 / 25, 22, CN 121793950 A

[0221]

[0222] Example 3: Conditions for improving the recovery rate of natural forms by changing pH, filling volume, and sugar screening

[0223] Example 3-1: Preparation of lyophilized formulations

[0224] After confirming that the appearance of the formulation with pH 6.5 or higher in Example 2 above was improved after dissolution, various lyophilized formulations were prepared by adding buffer / liquid, amino acids, nonionic surfactants, changing the filling volume, and three sugars (sucrose, trehalose, and mannitol) to the final stock solution in order to improve the recovery rate of natural forms, and then size exclusion chromatography was performed.

[0225] The solutions of the formulations having the compositions shown in Table 5 below were aliquoted into 4 mL or 6 mL glass vials (20 mL), partially sealed with rubber stoppers, and then loaded onto the rack of a freeze dryer (Lyostar 3, SP Scientific). Subsequently, lyophilization was performed under the conditions shown in Table 6 below. After the aluminum lyophilization was completed, the prepared lyophilized formulation was sealed with an aluminum cap. Instructions for Use 20 / 25 pages 23 CN 121793950 A

[0226]

[0227]

[0228] Example 3-2: Dissolution and Appearance of the Lyophilized Formulation

[0229] The lyophilized vials prepared in Example 3-1 were each left to stand at room temperature for 30 minutes to remove moisture from the surface of the vials, and then the appearance of the vials was checked.

[0230] A 25G needle (1 inch or larger) was attached to a 2 mL syringe, 2 mL of distilled water was drawn, and then injected at a 90-degree angle into each vial containing the lyophilized product. The distilled water was automatically injected as a vacuum was maintained inside the vial.

[0231] After the distilled water injection was completed, the needle and syringe were separated to release the remaining vacuum inside the vial, and then the needle was removed. Instructions for Use 21 / 25 pages 24 CN 121793950 A Shake the vial 5 times and let it stand until the lyophilized cake dissolves.

[0232] Example 3-3: Size exclusion liquid chromatography (SE-HPLC)

[0233] Dilute the lyophilized product dissolved in Example 3-2 with mobile phase (1xPBS, Lonza) to a concentration of 1 mg / mL.The sample was then filtered using a 0.2 μm injection filter. Subsequently, 200 μL of the filtered sample was injected into a vial insert and then prepared in a screw-cap vial.

[0234] The mobile phase was then connected to a pump, and the analytical column (TSKgel G3000SWXL, Tosoh) was mounted on a Waters e2695 and Waters 2489 Instruments (Waters), with the mobile phase flowing at a rate of 0.5 mL / min. The sample was equilibrated by allowing the mobile phase to flow at 0.5 mL / min for 30 minutes or longer until the detector signal stabilized. When the autosampler temperature dropped to 4°C, the sample was placed in the sampler, and 10 μL of sample was injected. The mobile phase was then allowed to flow for 35 minutes, and the detection peak was identified at 214 nm. The analysis was performed on a PC using Empower Pro software.

[0235] Examples 3-4: Conditions for Improving Natural Form Recovery Based on pH, Fill Volume Changes, and Sugar Type

[0236] First, the comparison of the cake appearance of the lyophilized formulations prepared in Examples 3-2 showed that no severe collapse was observed under all conditions (Figures 3 and 4).

[0237] The results of detecting the natural form recovery rate in the prepared lyophilized formulations by size exclusion chromatography showed that, under conditions containing three sugars, the proportion of natural form in the final stock solution hardly decreased regardless of pH, but under all sugar-free conditions, the proportion of natural form in the final stock solution decreased (Figures 5 and 6).

[0238] These results indicate that the lyophilized formulations containing the fusion protein of the present invention with sugars exhibit excellent natural form recovery rates, regardless of the specific type of sugar.

[0239] In addition, for the comparison of the final feed fill volume, the natural form recovery rate was higher with a 6 mL fill volume (Figures 5 and 6).

[0240] Example 4: Optimal Concentration of Sucrose (White Sugar) for Improving Natural Form Recovery

[0241] Example 4-1: Preparation of Lyophilized Formulations

[0242] After confirming excellent natural form recovery at pH 6.8, various lyophilized formulations were prepared by adjusting the amount of sucrose (white sugar), a representative example of sugar, and then size exclusion chromatography was performed.

[0243] Each solution of the formulation having the composition shown in Table 7 below was aliquoted into 6 mL glass vials (20 mL), partially capped with rubber stoppers, and then placed on the rack of a freeze dryer (Lyostar 3, SP Scientific). Subsequently, lyophilization was performed under the conditions shown in Table 7 below, and the prepared lyophilized formulations were capped with aluminum caps after aluminum lyophilization.

[0244] Specification, pages 22 / 25, CN 121793950 A

[0245]

[0246] Example 4-2: Dissolution and appearance of lyophilized formulation

[0247] The lyophilized vials were allowed to stand at room temperature for 30 minutes to remove any moisture that would have formed on the surface of the vials, and then the appearance of the cake was checked.

[0248] A 25G needle (1 inch or larger) was attached to a 2 mL syringe, and 2 mL of distilled water was drawn and injected at a 90-degree angle into each vial containing the lyophilized product. The distilled water was injected automatically as a vacuum was maintained inside the vial.

[0249] After the distilled water injection was complete, the needle and syringe were separated to release any remaining vacuum inside the vial, and then the needle was removed. The vials were shaken 5 times and allowed to stand until the lyophilized cake dissolved.

[0250] Example 4-3: Size Exclusion Liquid Chromatography (SE-HPLC)

[0251] The lyophilized product dissolved in Example 4-2 was diluted to a concentration of 1 mg / mL with the mobile phase (1xPBS, Lonza) and then filtered through a 0.2 μm injection filter. Subsequently, 200 μL of the filtered sample was injected into the vial insert and then prepared in screw-cap vials.

[0252] Subsequently, the mobile phase was connected to the pump, and the analytical column (TSKgel G3000SWXL, Tosoh) was installed on a Waters e2695 and Waters 2489 Instruments (Waters), with the mobile phase flowing at a flow rate of 0.5 mL / min. The sample was equilibrated by allowing the mobile phase to flow at a flow rate of 0.5 mL / min for 30 minutes or longer until the detector signal stabilized. When the temperature of the autosampler dropped to 4°C, the sample was placed in the sampler, and 10 μL of sample was injected. Then, the mobile phase was allowed to flow for 35 minutes, and the detection peak was identified at 214 nm. The analysis was performed on a PC using Empower Pro software.

[0253] Example 4-4: Optimal concentration of white sugar to improve the recovery rate of the original form

[0254] First, the comparison results of the cake appearance of the lyophilized formulation prepared in Example 4-2 showed that there was no serious collapse under all conditions (Figure 7).

[0255] The results of size exclusion chromatography analysis of the recovery rate of the natural form in the prepared lyophilized formulation showed that the reduction in the proportion of the natural form relative to the final stock solution was minimal under the condition of containing 2.5 mg / mL white sugar (#2) (Figure 8).

[0256] Example 5: Long-term storage stability of the optimal lyophilized formulation

[0257] Example 5-1: Preparation of the lyophilized formulation

[0258] Considering the optimal recovery conditions of the natural form obtained by the foregoing examples, an optimal lyophilized formulation was prepared and then size exclusion chromatography analysis was performed at regular intervals while stored under refrigeration conditions (5±3°C).

[0259] Specifically, the solution of the formulation having the composition shown in Table 9 below was aliquoted into 6 mL glass vials (20 mL), partially sealed with rubber stoppers, and then loaded onto the rack of a freeze dryer (Lyostar 3, SP Scientific). Subsequently, inFreeze-drying was performed under the conditions shown in Table 10 below. After the aluminum freeze-drying was completed, the prepared freeze-dried formulation was sealed with an aluminum cap. Instructions 23 / 25 pages 26 CN 121793950 A

[0260]

[0261]

[0262] Example 5-2: Dissolution and Appearance of Freeze-Dried Formulation

[0263] The freeze-dried vials were left to stand at room temperature for 30 minutes to remove moisture generated on the surface of the vials, and then the appearance of the cake was checked.

[0264] A 25G needle (1 inch or larger) was attached to a 2 mL syringe, and 2 mL of distilled water was drawn and injected into each vial containing the freeze-dried product at a 90-degree angle. The distilled water was injected automatically as a vacuum was maintained inside the vial.

[0265] After the distilled water injection was completed, the needle and syringe were separated to release the remaining vacuum inside the vial, and then the needle was removed. The vials were shaken 5 times and left to stand until the freeze-dried cake dissolved.

[0266] Example 5-3: Moisture Content

[0267] Three lyophilized vials for each condition were placed in a moisture content analysis chamber with controlled humidity of 40% or lower for at least one hour. Three sets of 885 KF Thermoprep vials and caps were prepared as control groups (blanks).

[0268] The lyophilized cake in each vial was crushed as finely as possible using a scraper, transferred to a zero-calibrated 885 KF Thermoprep vial, weighed, and capped. The control vial was capped and not weighed separately. The prepared vials were then placed in an autosampler in the order of control group, then sample group.

[0269] An 831 KF Coulometer Remote Controller was programmed to measure each control vial three times and each test sample three times. The total number of samples to be analyzed was entered into an 885 Compact Oven, and the analysis was performed.

[0270] Examples 5-4: Size Exclusion Liquid Chromatography (SE-HPLC)

[0271] The lyophilized product dissolved in Example 5-2 was diluted to a concentration of 1 mg / mL with mobile phase (1xPBS, Lonza) and then filtered through a 0.2 μm injection filter. 200 μL of the filtered sample was then injected into a vial insert and prepared in a screw-cap vial.

[0272] Subsequently, the mobile phase was connected to a pump, and the analytical column (TSKgel G3000SWXL, Tosoh) was installed on a Waters e2695 and Waters 2489 Instruments (Waters), with the mobile phase flowing at a rate of 0.5 mL / min. The sample was equilibrated by allowing the mobile phase to flow at 0.5 mL / min for 30 minutes or longer until the detector signal stabilized. When the autosampler temperature dropped to 4°C, 10 μL of sample was injected into the sampler. The mobile phase was then allowed to flow for 35 minutes at 214 °C.The detection peak was identified at nm. The analysis was performed on a PC using Empower Pro software.

[0273] Example 5-5: Long-term storage stability of the best lyophilized formulation

[0274] The appearance and moisture content of the lyophilized formulation prepared in Example 5-1 were analyzed. The results showed that even after 12 months of refrigeration (5±3℃), the appearance of the cake or the appearance after dissolution remained transparent, and the moisture content remained at 1.0% even after 6 months (Figure 9).

[0275] The recovery rate of the natural form was checked by size exclusion chromatography after refrigeration (5±3℃) for 3, 6 and 12 months. The results showed that the proportion of the natural form remained unchanged even after 12 months, with almost no decrease compared to 0 months (Figure 10).

[0276] Although the invention has been described with reference to specific illustrative embodiments, those skilled in the art will understand that the invention may be practiced in other specific forms without departing from the technical spirit or essential characteristics of the invention. Therefore, the above exemplary embodiments should be interpreted as exemplary and not as limiting the scope of this disclosure. The scope of the invention should be interpreted as the meaning and scope of the appended claims rather than a detailed description, and all changes or variations derived from equivalent concepts fall within the scope of the invention. (Table of contents: 25 / 25 pages, 28 CN 121793950 A, Figure 1, Figure 2; 1 / 5 pages, 29 CN 121793950 A, Figure 3, Figure 4; 2 / 5 pages, 30 CN 121793950 A, Figure 5, Figure 6; 3 / 5 pages, 31 CN 121793950 A, Figure 7, Figure 8; 4 / 5 pages, 32 CN 121793950 A, Figure 9, Figure 10; 5 / 5 pages, 33 CN 121793950 A)

Claims

1. A lyophilized formulation comprising a fusion protein wherein α-galactosidase A is linked to the Fc region of an immunoglobulin, said lyophilized formulation comprising a mixture obtained by lyophilizing an aqueous solution, said aqueous solution containing: The fusion protein at a concentration of 10 to 40 mg / mL; Buffer solutions with a pH of 6.5 to 8.0; and Sugars or sugar alcohols with a concentration of 1 to 20 mg / mL.

2. The freeze-dried formulation according to claim 1, wherein the sugar is glucose, fructose, galactose, lactose, maltose, sucrose, trehalose, or a combination thereof.

3. The freeze-dried formulation according to claim 1, wherein the sugar alcohol is mannitol, sorbitol, or a combination thereof.

4. The lyophilized formulation according to claim 1, wherein the aqueous solution further contains amino acids at a concentration of 1.0 to 3.0% (w / v).

5. The freeze-dried formulation according to claim 4, wherein the amino acid is selected from serine, arginine, threonine, glutamine, glycine, alanine, and combinations thereof.

6. The lyophilized formulation according to claim 1, wherein the aqueous solution further contains a nonionic surfactant at a concentration of 0.001 to 0.1% (w / v).

7. The lyophilized formulation according to claim 6, wherein the nonionic surfactant is selected from poloxamer 188, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and combinations thereof.

8. The lyophilized formulation according to claim 1, wherein the buffer solution contains histidine or a salt thereof, citric acid or a salt thereof, acetic acid or a salt thereof, phosphate or a salt thereof, or a combination thereof.

9. The lyophilized formulation according to claim 1, wherein the buffer solution contains 5-30 mM histidine.

10. The lyophilized formulation of claim 1, wherein the lyophilized formulation comprises a mixture obtained by lyophilizing 1 to 10 mL of an aqueous solution.

11. The lyophilized formulation according to claim 1, wherein the aqueous solution does not further contain an isotensive agent.

12. The lyophilized formulation according to claim 1, wherein the α-galactosidase A comprises the amino acid sequence of SEQ ID NO:

1.

13. The lyophilized formulation according to claim 1, wherein the fusion protein comprises the amino acid sequence of SEQ ID NO:

4.

14. The lyophilized formulation according to claim 1, wherein the fusion protein has a structure in which two α-galactosidase A molecules are respectively linked to monomers of the Fc region of immunoglobulin in dimer form.

15. The lyophilized formulation of claim 1, wherein the lyophilized formulation comprises a mixture obtained by lyophilizing an aqueous solution, the aqueous solution containing: The fusion protein at a concentration of 15-35 mg / mL; Histidine at a concentration of 5-30 mM; Sugars or sugar alcohols with a concentration of 2.5-10 mg / mL; Polysorbate 20 at concentrations of 0.001 to 0.05% (w / v); and Serine at a concentration of 1.0-3.0% (w / v).

16. The lyophilized formulation of claim 1, wherein the lyophilized formulation is used for the prevention or treatment of Fabry disease.

17. A method for preparing a lyophilized formulation according to any one of claims 1 to 16, the method comprising lyophilizing an aqueous solution containing i) an α-galactosidase A fusion protein wherein α-galactosidase A is linked to the Fc region of an immunoglobulin, ii) a buffer solution, and iii) a sugar or sugar alcohol.

18. The method of claim 17, wherein the method comprises lyophilizing 1 to 10 mL of an aqueous solution containing i) an α-galactosidase A fusion protein wherein α-galactosidase A is linked to the Fc region of immunoglobulin, ii) a buffer solution, and iii) a sugar or sugar alcohol.

19. A method for reconstructing a lyophilized formulation according to any one of claims 1 to 18, the method comprising adding a reconstructed solution to the lyophilized formulation according to any one of claims 1 to 18.

20. The method of claim 19, wherein the reconstitution solution is distilled water.

21. The method of claim 19, wherein the formulation reconstituted by the method contains 10 to 100 mg / mL of the α-galactosidase A fusion protein.