Compounds and methods for modulating progranulin expression

Abstract

Provided are oligomeric compounds, methods, and pharmaceutical compositions for modulating the expression of Progranulin RNA or modulating the expression of Progranulin protein in cells or subjects. Such compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom or characteristic of a nervous system disease or disorder. Such nervous system diseases or disorders include diseases or disorders associated with insufficient expression of Progranulin, including frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, amyotrophic lateral sclerosis, and neuronal ceroid lipofuscinosis. Such symptoms or characteristics include deterioration of behavior and personality, speech disorder, impaired or altered muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness.

Description

[Technical field]

[0001] Statement of government support This invention was made with government support under grant AG064069 awarded by the National Institute of Health / National Institute on Aging, and grant UL1TR002345 awarded by the National Institute of Health / National Center for Advancing Translational Sciences. The Government has certain rights in this invention.

[0002] Sequence Listing This application has been filed in electronic format with a Sequence Listing, which is provided as a file entitled BIOL0452WOSEQ.xml, created on November 17, 2022, which is 839KB in size. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0003] Provided are oligomeric compounds, methods, and pharmaceutical compositions for modulating the expression of Progranulin RNA or modulating the expression of Progranulin protein in cells or subjects. Such compounds, methods, and pharmaceutical compositions are useful for alleviating at least one symptom or characteristic of a nervous system disease or disorder. Such nervous system diseases or disorders include diseases or disorders associated with insufficient expression of Progranulin, including frontotemporal dementia, frontotemporal lobar degeneration, Alzheimer's disease, amyotrophic lateral sclerosis, and neuronal ceroid lipofuscinosis. Such symptoms or characteristics include deterioration of behavior and personality, speech disorder, impaired or altered muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness. [Background technology]

[0004] The human gene GRN encodes the human progranulin protein. Mutations in GRN cause nervous system diseases or disorders, including frontotemporal dementia (FTD), frontotemporal lobar degeneration (FTLD), neuronal ceroid lipofuscinosis (NCL), lysosomal storage diseases, Alzheimer's disease (AD), and amyotrophic lateral sclerosis (ALS). These diseases are associated with GRN and / or progranulin haploinsufficiency. FTD refers to a group of disorders caused by progressive neuronal loss in the frontal or temporal lobes of the brain. Neuronal damage caused by FTD leads to loss of function of the frontal or temporal lobes, which are associated with behavioral and personality deterioration, speech impairment, impaired or altered muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness. FTD is associated with TDP-43 proteinopathy.

[0005] Currently, there remains a need for therapies to treat nervous system diseases or disorders associated with insufficient amounts of progranulin. Accordingly, it is an object of the present invention to provide oligomeric compounds, methods, and pharmaceutical compositions for treating such diseases or disorders. [Brief description of the drawings]

[0006] [Figure 1A] 1 shows human progranulin levels in H4 cell lysates or conditioned media after treatment with modified oligonucleotides. ELISA assay results are shown in cell lysates after treatment with (from left to right) control scrambled ASO, water, compounds 1212637, 1212638, 1212639, 1212641, 1212642, 1212646, 1212647, 1212648, 1212660, 1212661, 1212664, 1212665, 1212667, 1212671, 1212672, 1212673, 1212674, 1212675, 1212676, 1212684. [Figure 1B]1 shows human progranulin levels in H4 cell lysates or conditioned media following treatment with modified oligonucleotides. Western blot of H4 cell lysates following treatment of cells with (left to right) water, control scrambled ASO, compounds 1212637, 1212638, 1212639, 1212640, 1212641, 1212642, 1212646, 1212647, 1212672, 1212674 1212675, 1212684. [Figure 1C-D] Figure 1C shows human progranulin levels in H4 cell lysates or conditioned media after treatment with modified oligonucleotides. Western blots of H4 cell lysates after treatment of cells with (from left to right) water, control scrambled ASO, and compounds 1212646, 1212647, 1212660, 1212661, 1212664, 1212665, 1212667, 1212672, and 1212674. Figure 1D shows human progranulin levels in H4 cell lysates or conditioned media after treatment with modified oligonucleotides. Western blots of H4 cell lysates after treatment of cells with (from left to right) water, control scrambled ASO, and compound 1212676. [Figure 1E] 1 shows human progranulin levels in H4 cell lysates or conditioned medium following treatment with modified oligonucleotides. Western blots of H4 cell lysates (top panels) or conditioned medium (bottom panels) following treatment of cells with (left to right): water, control scrambled ASO, compounds 1212637, 1212638, 1212639, 1212640, 1212641, 1212642. [Figure 2A] Dose response curves of progranulin levels, presented as a percentage of GRN levels in untreated cells as measured by ELISA, following treatment of H4 cells with either control scrambled ASO or compounds 1212637, 1212638, 1212641, 1212646, 1212647, 1212672, respectively. [Figure 2B]Dose response curves of progranulin levels, presented as a percentage of GRN levels in untreated cells as measured by ELISA, following treatment of H4 cells with either control scrambled ASO or compounds 1212637, 1212638, 1212641, 1212646, 1212647, 1212672, respectively. [Figure 2C] Dose response curves of progranulin levels, presented as a percentage of GRN levels in untreated cells as measured by ELISA, following treatment of H4 cells with either control scrambled ASO or compounds 1212637, 1212638, 1212641, 1212646, 1212647, 1212672, respectively. [Figure 2D] Dose response curves of progranulin levels, presented as a percentage of GRN levels in untreated cells as measured by ELISA, following treatment of H4 cells with either control scrambled ASO or compounds 1212637, 1212638, 1212641, 1212646, 1212647, 1212672, respectively. [Figure 2E] Dose response curves of progranulin levels, presented as a percentage of GRN levels in untreated cells as measured by ELISA, following treatment of H4 cells with either control scrambled ASO or compounds 1212637, 1212638, 1212641, 1212646, 1212647, 1212672, respectively. [Figure 2F] Dose response curves of progranulin levels, presented as a percentage of GRN levels in untreated cells as measured by ELISA, following treatment of H4 cells with either control scrambled ASO or compounds 1212637, 1212638, 1212641, 1212646, 1212647, 1212672, respectively. [Diagram 3]Western blot of iPSC-derived neuronal cell lysates following treatment with control scrambled ASO or compounds 1212638, 1212641, 1212646, 1212647, and 1212672 at the indicated concentrations (μM). [Figure 4] FIG. 4A shows the results of an ELISA assay of progranulin levels (ng / mg protein) in the cortex of males after administration of modified oligonucleotides. GRN levels in treated transgenic mice homozygous for human GRN are compared to GRN levels in saline-treated transgenic GRN mice and untreated non-transgenic mice. (From left to right) untreated non-transgenic mice, transgenic GRN mice: saline, control scrambled ASO, compounds 1557990, 1557993, 1212647, 1557987. FIG. 4B shows the results of an ELISA assay of progranulin levels (ng / mg protein) in the cortex of females after administration of modified oligonucleotides. GRN levels in treated transgenic mice homozygous for human GRN are compared to GRN levels in saline-treated transgenic GRN mice and untreated non-transgenic mice. (From left to right) transgenic GRN mice: saline, control scrambled ASO, compounds 1212640, 1557993, 1557994, 1212647, 1557987. Figure 4C is a western blot of progranulin in the cortex, thalamus, or hippocampus of untreated non-transgenic mice, or transgenic GRN mice treated with saline control or compound 1557993. Summary of the Invention

[0007] Provided herein are compounds, methods, and pharmaceutical compositions for modulating the amount of Progranulin RNA and / or modulating the amount of Progranulin protein in a cell or subject. In certain embodiments, compounds useful for modulating the amount of Progranulin RNA and / or Progranulin protein are oligomeric compounds. In certain embodiments, the oligomeric compounds increase the amount of Progranulin RNA in a cell. In certain embodiments, the oligomeric compounds increase the amount of Progranulin protein in a cell. In certain embodiments, the oligomeric compounds include modified oligonucleotides. In certain embodiments, the subject has a nervous system disease or disorder. In certain embodiments, the subject has a nervous system disease or disorder associated with an insufficient amount of Progranulin protein. In certain embodiments, the subject has FTD. In certain embodiments, the subject has FTLD. In certain embodiments, the subject has NCL. In certain embodiments, the subject has TDP-43 proteinopathy. In certain embodiments, the subject has lysosomal storage disease. In some embodiments, the subject has Alzheimer's disease (AD). In certain embodiments, the subject has amyotrophic lateral sclerosis (ALS).

[0008] Also provided are methods useful for alleviating at least one symptom or characteristic of a nervous system disease or disorder. In certain embodiments, the nervous system disease or disorder is associated with an insufficient amount of progranulin protein. In certain embodiments, the nervous system disease or disorder is FTD. In certain embodiments, the nervous system disease or disorder is FTLD. In certain embodiments, the nervous system disease or disorder is NCL. In certain embodiments, the nervous system disease or disorder is TDP-43 proteinopathy. In certain embodiments, the disease or disorder is a lysosomal storage disease. In certain embodiments, the disease or condition is ALS. In certain embodiments, the disease or condition is AD. In certain embodiments, the symptoms or characteristics include behavior and personality deterioration, speech disorder, impaired or altered muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "comprising" and other forms such as "comprises" and "includes" is not limiting. Also, terms such as "element" or "component" encompass both elements and components that include one unit and elements and components that include more than one subunit, unless expressly stated otherwise.

[0010] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and papers, as well as GenBank, ENSEMBL, and NCBI reference sequence records, are expressly incorporated herein by reference in their entirety, as well as the portions of the documents discussed herein.

[0011] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, organic synthetic chemistry, and medicinal and medicinal chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0012] Unless otherwise indicated, the following terms have the following meanings. As used herein, "2'-deoxyribonucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxyribonucleoside is a 2'-β-D deoxyribonucleoside, which includes a 2'-β-D-deoxyribosyl sugar moiety, which has the β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxyribonucleoside may include a modified nucleobase or may include an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" means a 2'-O(CH2)2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" or "2'-MOE modified sugar moiety" means a sugar moiety having a 2'-O(CH2)2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, the 2'-MOE sugar moiety is in the β-D configuration. "MOE" means O-methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0015] As used herein, "2'-NMA" means a -O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of the ribosyl sugar moiety. A "2'-NMA sugar moiety" or a "2'-NMA modified sugar moiety" is a sugar moiety having a 2'-O-CH2-C(=O)-NH-CH3 group in place of the 2'-OH group of the ribosyl sugar moiety. Unless otherwise indicated, the 2'-NMA sugar moiety is in the β-D configuration. "NMA" means ON-methylacetamide.

[0016] As used herein, "2'-NMA nucleoside" means a nucleoside that includes a 2'-NMA sugar moiety.

[0017] As used herein, "2'-OMe" means a 2'-OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-OMe sugar moiety" or a "2'-OMe modified sugar moiety" is a sugar moiety having a 2'-OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise indicated, the 2'-OMe sugar moiety is in the β-D configuration. "OMe" means O-methyl.

[0018] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0019] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein with respect to the sugar moiety, "2'-substituted" refers to a sugar moiety that includes at least one 2'-substituent group other than H or OH.

[0020] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0021] As used herein, "administering" means providing a pharmaceutical agent to a subject.

[0022] As used herein, "alleviating" in the context of treatment means that there is an improvement in at least one symptom or characteristic compared to the same symptom or characteristic in the absence of treatment. In certain embodiments, alleviation is a decrease in the severity or frequency of a symptom or characteristic, or a delay in the onset of a symptom or characteristic, or a delay in the progression of the severity or frequency of a symptom or characteristic. In certain embodiments, the symptom or characteristic is a deterioration in behavior and personality, speech disorder, impaired or altered muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness.

[0023] As used herein, "antisense activity" refers to any detectable and / or measurable change that can result from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is an increase in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the amount or expression of the target nucleic acid or target protein in the absence of the antisense compound.

[0024] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0025] As used herein, "antisense compound" refers to an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group. An "antisense compound" may also be an oligomeric duplex capable of achieving at least one antisense activity.

[0026] As used herein, "antisense oligonucleotide" means an oligonucleotide comprising an oligonucleotide portion of an antisense compound that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity.

[0027] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0028] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety that includes two rings, where the second ring is formed via a bridge connecting two of the atoms in the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the furanosyl moiety is a ribosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0029] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties of cerebrospinal fluid (e.g., osmolality, pH, and / or electrolytes) and is biocompatible with CSF.

[0030] As used herein, "cEt" means a 4' to 2' bridge in place of the 2'OH group of the ribosyl sugar moiety, the bridge having a formula of 4'-CH(CH3)-O-2', and the methyl group of the bridge in the S configuration. A "cEt sugar moiety" is a bicyclic sugar moiety having a 4' to 2' bridge in place of the 2'OH group of the ribosyl sugar moiety, the bridge having a formula of 4'-CH(CH3)-O-2', and the methyl group of the bridge in the S configuration. "cEt" means constrained ethyl.

[0031] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0032] As used herein, "chirally enriched" with respect to a population means a plurality of molecules of the same molecular formula, where the number or percentage of molecules in the population that contain a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules in the population that would be expected to contain the same particular stereochemical configuration at the same particular chiral center if the particular chiral center were stereorandom, as defined herein. A chirally enriched population of molecules with multiple chiral centers within each molecule may contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds that include modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. As used herein, "chirally controlled" with respect to an internucleoside linkage means that the chirality of that linkage is enriched for a particular stereochemical configuration.

[0033] As used herein, "complementary" in reference to an oligonucleotide means that at least 70% of the nucleobases of an oligonucleotide or one or more portions thereof and another nucleic acid or one or more portions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and another nucleic acid are aligned in opposite directions. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl ... m C) and guanine (G), as well as hypoxanthine (inosine (I)) and cytosine (C), 5-methylcytosine ( mExamples of complementary bases include nucleobases 1 (C), uracil (U), or adenine (A). Complementary oligonucleotides and / or target nucleic acids do not need to have nucleobase complementarity at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" in reference to an oligonucleotide or a portion thereof means that an oligonucleotide or a portion thereof is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0034] As used herein, "conjugate group" refers to a group of atoms directly or indirectly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

[0035] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0036] As used herein, "conjugate moiety" means a covalently attached group of atoms that modifies one or more pharmacological properties of a molecule compared to the same molecule lacking the conjugate moiety, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0037] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0038] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated increases in the amount or activity of the target nucleic acid.

[0039] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0040] As used herein, "inosine" (I) or 9-β-D-ribosylhypoxanthine refers to a nucleoside containing the hypoxanthine nucleobase.

[0041] As used herein, "internucleoside linkage" refers to a covalent bond between adjacent nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. "Phosphorothioate internucleoside linkage" or "PS internucleoside linkage" refers to a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0042] As used herein, "linked nucleosides" are nucleosides that are linked in contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0043] As used herein, "linker nucleoside" refers to a nucleoside that either directly or indirectly connects an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide portion of an oligomeric compound even if they are contiguous with the oligonucleotide.

[0044] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or a target nucleic acid when the first and second oligonucleotides are aligned.

[0045] As used herein, "modified nucleoside" means a nucleoside that includes a modified nucleobase and / or a modified sugar moiety.

[0046] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0047] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes modifications such as substituents that do not form a bridge between two atoms of the sugar to form a second ring.

[0048] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, a "nucleobase sequence" refers to the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0049] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which, independently, is unmodified or modified.

[0050] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may be paired with a second oligomeric compound that is complementary to the first oligomeric compound, or may be unpaired. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound."

[0051] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside bonds, each of which may be modified or unmodified. Unless otherwise indicated, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification.

[0052] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution.

[0053] As used herein, "pharmaceutical acceptable carriers or diluents" refers to any substance suitable for use in administering to animals. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutical acceptable diluent is sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0054] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the parent compound.

[0055] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0056] As used herein, "RNA" means RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0057] As used herein, "Progranulin RNA" refers to the RNA transcript encoded by the Progranulin gene GRN, including pre-mRNA and mRNA, unless otherwise specified. Progranulin nucleic acid and GRN nucleic acid are used interchangeably and refer to a nucleic acid encoding the Progranulin protein. As used herein, "Progranulin nucleic acid" and "GRN nucleic acid" are interchangeable and include Progranulin DNA and Progranulin RNA, unless otherwise specified.

[0058] As used herein, "steric blocker" means an antisense agent that acts, at least in part, by directly binding to a target nucleic acid, thus blocking the interaction of the target nucleic acid with other nucleic acids or proteins.

[0059] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula means a chiral center that is not controlled during synthesis or is enriched after synthesis for a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random if it is the result of a synthetic method that is not designed to control the stereochemical configuration. For example, in a population of molecules that contain a stereorandom chiral center, the number of molecules having the (S) configuration of the stereorandom chiral center can be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral center (racemic). In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates after synthesis, for example, due to the action of a non-chiral reagent near the enriched stereochemistry of the adjacent sugar moieties. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0060] As used herein, "subject" means a human or non-human animal.

[0061] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D ribosyl sugar moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0062] As used herein, "sugar surrogate" refers to a modified sugar moiety that has other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide, but is not a furanosyl sugar moiety or a bicyclic sugar moiety. Modified nucleosides, including sugar surrogates, can be conjugated to one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids. Examples of sugar surrogates include GNA (glycol nucleic acid), FHNA (fluorohexitol nucleic acid), morpholino, and other structures described herein and known in the art. As used herein, "standard in vitro assay" refers to the assay described in Example 1 and reasonable variations thereof.

[0063] As used herein, "symptom or characteristic" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or a medical professional examining or testing the subject. In certain embodiments, the characteristic is evident by invasive diagnostic testing, including but not limited to post-mortem examination. In certain embodiments, the characteristic is evident by a brain MRI scan.

[0064] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid to which an antisense oligomer or oligomeric compound is designed to act. Target RNA refers to an RNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.

[0065] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0066] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0067] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent that provides a therapeutic effect to a subject. For example, a therapeutically effective amount ameliorates a symptom or characteristic of a disease or disorder.

[0068] As used herein, "treating" means improving a disease or disorder in a subject by administering an oligomeric compound described herein. In certain embodiments, treating a subject improves a symptom or characteristic for the same condition in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of a symptom or characteristic, or delays the onset of a symptom or characteristic, or delays the progression of a symptom or characteristic, or delays the severity or frequency of a symptom or characteristic.

[0069] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments: Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a Progranulin nucleic acid, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0070] Embodiment 2. The oligomeric compound of embodiment 1, wherein the Progranulin nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.

[0071] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 18, 19, or 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-854, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0072] Embodiment 4. The oligomeric compound of any one of embodiments 1-3, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 16, at least 17, or 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 34, 268, 345, 424, 501, 579, 657, 735, 800, 801, 806, 812, 813, 816, 821, 828, 844, and 847.

[0073] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide consisting of 18 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of any of the nucleobase sequences of SEQ ID NOs: 12-854, and the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0074] Embodiment 6. The oligomeric compound of embodiment 5, wherein the nucleobase sequence of the modified oligonucleotide consists of 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 34, 268, 345, 424, 501, 579, 657, 735, 800, 801, 806, 812, 813, 816, 821, 828, 844, and 847.

[0075] Embodiment 7. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases complementary to an equal length portion within nucleobases 8497 to 8552 of SEQ ID NO:1.

[0076] Embodiment 8. The oligomeric compound of embodiment 7, wherein the nucleobase sequence of the modified oligonucleotide consists of any of the nucleobase sequences of SEQ ID NOs: 34, 268, 345, 424, 501, 579, 657, 735, 800, 801, 806, 812, 813, 816, 821, 828, 844, and 847.

[0077] Embodiment 9. The oligomeric compound of any one of embodiments 1 to 8, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95% complementary, or 100% complementary to an equal length portion within the nucleobase sequence of either SEQ ID NO:1 or SEQ ID NO:2 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0078] Embodiment 10. The oligomeric compound according to any one of embodiments 1 to 9, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

[0079] Embodiment 11 The oligomeric compound of embodiment 10, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0080] Embodiment 12. The oligomeric compound of embodiment 11, wherein the bicyclic sugar moiety comprises a 4'-2' bridge selected from -CH2-O- and -CH(CH3)-O-.

[0081] Embodiment 13. The oligomeric compound of any one of embodiments 10-12, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

[0082] Embodiment 14. The oligomeric compound of embodiment 13, wherein the non-bicyclic modified sugar moiety is a 2'-MOE modified sugar moiety, a 2'-NMA modified sugar moiety, a 2'-OMe modified sugar moiety, or a 2'-F modified sugar moiety.

[0083] Embodiment 15 The oligomeric compound of embodiment 10, wherein the modified sugar moiety is a sugar surrogate.

[0084] Embodiment 16 The oligomeric compound of embodiment 15, wherein the sugar surrogate is a morpholino, a modified morpholino, PNA, THP, or F-HNA.

[0085] Embodiment 17 The oligomeric compound according to embodiment 10, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

[0086] Embodiment 18. The oligomeric compound of embodiment 17, wherein each modified sugar moiety is a 2'-MOE modified sugar moiety, a 2'-NMA modified sugar moiety, a 2'-OMe modified sugar moiety, or a 2'-F modified sugar moiety.

[0087] Embodiment 19 The oligomeric compound of embodiment 17, wherein each modified sugar moiety is a 2'-MOE modified sugar moiety.

[0088] Embodiment 20 The oligomeric compound of embodiment 17, wherein each modified sugar moiety is a sugar surrogate.

[0089] Embodiment 21 The oligomeric compound of embodiment 20, wherein each modified sugar moiety is morpholino, modified morpholino, PNA, THP, or F-HNA.

[0090] Embodiment 22. The oligomeric compound according to any one of embodiments 1 to 21, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0091] Embodiment 23 The oligomeric compound according to embodiment 22, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0092] Embodiment 24. The oligomeric compound according to embodiment 22, wherein each internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0093] Embodiment 25 The oligomeric compound according to embodiment 22, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0094] Embodiment 26 The oligomeric compound according to any one of embodiments 1 to 23, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.

[0095] Embodiment 27. The oligomeric compound according to any one of embodiments 22, 23, or 26, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0096] Embodiment 28. The oligomeric compound according to any one of embodiments 22-24 or 26-27, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

[0097] Embodiment 29. The oligomeric compound according to any one of embodiments 1 to 23, wherein the modified oligonucleotide consists of 18 linked nucleosides and has an internucleoside linkage motif selected from ssssssssssssssssss and sosssssssssssss.

[0098] Embodiment 30. The oligomeric compound according to embodiment 19, wherein the modified oligonucleotide consists of 18 linked nucleosides and the internucleoside linkage motif of the modified oligonucleotide is ssssssssssssssssss.

[0099] Embodiment 31. The oligomeric compound according to embodiment 19, wherein the modified oligonucleotide consists of 18 linked nucleosides and the internucleoside linkage motif of the modified oligonucleotide is sossssssssssssss.

[0100] Embodiment 32. The oligomeric compound according to any one of embodiments 1 to 31, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0101] Embodiment 33. The oligomeric compound according to embodiment 32, wherein the modified nucleobase is 5-methylcytosine or hypoxanthine.

[0102] Embodiment 34 The oligomeric compound according to embodiment 33, wherein each cytosine is a 5-methylcytosine.

[0103] Embodiment 35. The following chemical notation (5' to 3'): G es T eo m C es m C es A es G es G es G es A es G eo A es A es T es T es T es G es G es T e; (SEQ ID NO: 855), G es T eo G es G es A es T es A es G es G es G eo A es A es A es A es G esm C es A es m C e; (SEQ ID NO: 856), G es G eo G es T es m C es m C es A es m C es T es G eo A es A es A es m C es G es G es G es G e; (SEQ ID NO: 857), G es G eo A es T es A es G es G es G es A es A eo A es A es G es m C es A es m C es m C es T e; (SEQ ID NO: 858), G es G eo T es m C es m C es A es G es G es G es A eo G es A es A es T es T es T es G es Ge; (SEQ ID NO: 859), A es A eo A es m C es G es G es G es G es A es G eo G es G es G es A es T es G es G es m C e; (SEQ ID NO: 860), G es A eo A es A es m C es G es G es G es G es A eo G es G es G es G es A es T es G es G e; (SEQ ID NO: 861), T es G eo A es A es A es m C es G es G es G es G eo A es G es G es G es G es A es T es G e; (SEQ ID NO: 862), m C es T eo G es A es A es Aes m C es G es G es G eo G es A es G es G es G es G es A es T e; (SEQ ID NO: 863), A es m C eo T es G es A es A es A es m C es G es G eo G es G es A es G es G es G es G es A e; (SEQ ID NO: 864), m C es A eo m C es T es G es A es A es A es m C es G eo G es G es G es A es G es G es G es G e; (SEQ ID NO:865), or G es G eo T es m C es m C es A es m C es T es G es Aeo A es A es m C es G es G es G es G es A e 2. An oligomeric compound comprising a modified oligonucleotide according to the formula: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound, wherein o is a phosphodiester internucleoside linkage.

[0104] Embodiment 36. The oligomeric compound according to any one of embodiments 1 to 35, wherein the modified oligonucleotide is a pharma- ceutically acceptable salt.

[0105] Embodiment 37. The oligomeric compound according to embodiment 36, wherein the modified oligonucleotide is a pharma- ceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0106] Embodiment 38. An oligomeric compound according to any one of embodiments 1 to 37, which consists of a modified oligonucleotide.

[0107] Embodiment 39. The oligomeric compound of any one of embodiments 1 to 37, wherein the oligomeric compound comprises a conjugate group.

[0108] Embodiment 40. The oligomeric compound according to embodiment 39, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0109] Embodiment 41 The oligomeric compound according to embodiment 40, wherein the conjugate linker consists of a single bond.

[0110] Embodiment 42 The oligomeric compound according to embodiment 40 or embodiment 41, wherein the conjugate linker is cleavable.

[0111] Embodiment 43. The oligomeric compound according to embodiment 40 or embodiment 41, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0112] Embodiment 44. The oligomeric compound according to any one of embodiments 40 to 42, wherein the conjugate linker does not comprise any linker nucleosides.

[0113] Embodiment 45. The oligomeric compound according to any one of embodiments 39 to 44, wherein the conjugate group is attached to the 5' end of the modified oligonucleotide.

[0114] Embodiment 46 The oligomeric compound according to any one of embodiments 39 to 44, wherein the conjugate group is attached to the 3' end of the modified oligonucleotide.

[0115] Embodiment 47. The oligomeric compound of any one of embodiments 39-44, wherein the oligomeric compound comprises a terminal group.

[0116] Embodiment 48 The oligomeric compound of embodiment 47, wherein the terminal group is an abasic sugar moiety.

[0117] Embodiment 49. The oligomeric compound according to any one of embodiments 1 to 48, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0118] Embodiment 50. The following chemical notation: A es m C eo T es G es A es A esA es m C es G es G eo G es G es A es G es G es G es G es A e An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 864), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound, wherein o is a phosphodiester internucleoside linkage.

[0119] Embodiment 51. The following chemical notation: m C es A eo m C es T es G es A es A es A es m C es G eo G es G es G es A es G es G es G es G e An oligomeric compound comprising a modified oligonucleotide according to (SEQ ID NO: 865), wherein A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; s is a phosphorothioate internucleoside linkage; An oligomeric compound, wherein o is a phosphodiester internucleoside linkage.

[0120] Embodiment 52. A modified oligonucleotide according to the following chemical structure:

[0121] [ka]

[0122] (SEQ ID NO: 864), or a salt thereof.

[0123] Embodiment 53. The modified oligonucleotide according to embodiment 52, which is a sodium or potassium salt.

[0124] Embodiment 54. A modified oligonucleotide according to the following chemical structure:

[0125] [ka]

[0126] (Sequence number 864).

[0127] Embodiment 55. A modified oligonucleotide according to the following chemical structure:

[0128] [ka]

[0129] (SEQ ID NO: 865), or a salt thereof.

[0130] Embodiment 56 The modified oligonucleotide according to embodiment 55, which is a sodium or potassium salt.

[0131] Embodiment 57. A modified oligonucleotide according to the following chemical structure:

[0132] [ka]

[0133] (Sequence number 865).

[0134] Embodiment 58. A chirally enriched population of oligomeric compounds according to any one of embodiments 1 to 51, or a chirally enriched population of modified oligonucleotides according to any one of embodiments 52 to 57, wherein the population is enriched for oligomeric compounds comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.

[0135] Embodiment 59. The chirally enriched population of embodiment 58, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0136] Embodiment 60. The chirally enriched population of embodiment 58, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration.

[0137] Embodiment 61. The chirally enriched population of embodiment 58, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0138] Embodiment 62. A chirally enriched population according to embodiment 61, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage or for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0139] Embodiment 63. The chirally enriched population of embodiment 61, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0140] Embodiment 64. The chirally enriched population of embodiment 61, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp configuration, the Sp configuration, and the Rp configuration.

[0141] Embodiment 65. A population of oligomeric compounds according to any one of embodiments 1 to 51, or a population of modified oligonucleotides according to any one of embodiments 52 to 57, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0142] Embodiment 66. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of embodiments 1 to 51.

[0143] Embodiment 67 The antisense agent of embodiment 66, wherein the antisense agent comprises a conjugate group, and the conjugate group comprises a cell targeting moiety.

[0144] Embodiment 68. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, or an antisense agent according to embodiment 66 or embodiment 67, and a pharma- ceutically acceptable diluent.

[0145] Embodiment 69. The pharmaceutical composition of embodiment 68, wherein the pharma- ceutically acceptable diluent is artificial CSF (aCSF) or phosphate buffered saline (PBS).

[0146] Embodiment 70. The pharmaceutical composition of embodiment 69, wherein the pharmaceutical composition consists essentially of an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, or an antisense agent according to embodiment 66 or embodiment 67, and aCSF.

[0147] Embodiment 71. The pharmaceutical composition of embodiment 69, wherein the pharmaceutical composition consists essentially of an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, or an antisense agent according to embodiment 66 or embodiment 67, and PBS.

[0148] Embodiment 72. A method comprising administering to a subject an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, an antisense agent according to embodiment 66 or embodiment 67, or a pharmaceutical composition according to any one of embodiments 68 to 71.

[0149] Embodiment 73. A method for treating a disease or disorder associated with insufficient expression of Progranulin, comprising administering to a subject having or at risk of developing a disease or disorder associated with insufficient expression of Progranulin a therapeutically effective amount of an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, an antisense agent according to embodiment 66 or embodiment 67, or a pharmaceutical composition according to any one of embodiments 68 to 71, thereby treating a disease or disorder associated with insufficient expression of Progranulin.

[0150] Embodiment 74. The method of embodiment 73, wherein the disease or disorder associated with insufficient expression of Progranulin is a nervous system disease or disorder.

[0151] Embodiment 75. The method of embodiment 73 or embodiment 74, wherein the disease or disorder associated with insufficient expression of progranulin is a lysosomal storage disease or a TDP-43 proteinopathy.

[0152] Embodiment 76. The method according to any one of embodiments 73 to 75, wherein the disease or disorder associated with insufficient expression of progranulin is frontolateral dementia (FTD), frontolateral lobar degeneration (FTLD), neuronal ceroid lipofuscinosis (NCL), Alzheimer's disease (AD), or amyotrophic lateral sclerosis (ALS).

[0153] Embodiment 77. The method of any one of embodiments 73 to 77, wherein at least one symptom or characteristic of a disease or disorder associated with insufficient expression of Progranulin is alleviated.

[0154] Embodiment 78. The method of embodiment 77, wherein the at least one symptom or characteristic is deterioration in behavior and personality, speech disorder, alterations in muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness.

[0155] Embodiment 79. The method of embodiment 77 or embodiment 78, wherein administration of the oligomeric compound of any one of embodiments 1 to 51, the modified oligonucleotide of any one of embodiments 52 to 57, the population of any one of embodiments 58 to 65, the antisense agent of embodiment 66 or embodiment 67, or the pharmaceutical composition of any one of embodiments 68 to 71 improves behavior or personality, slows deterioration of behavior or personality, improves language ability, slows deterioration of language ability, improves muscle or motor function, slows deterioration of muscle or motor function, improves memory, slows deterioration of memory, improves cognitive function, slows deterioration of cognitive function, reduces tremors, reduces seizures, or reduces dizziness.

[0156] Embodiment 80. The method of any one of embodiments 73 to 79, wherein the oligomeric compound of any one of embodiments 1 to 51, the modified oligonucleotide of any one of embodiments 52 to 57, the population of any one of embodiments 58 to 65, the antisense agent of embodiment 66 or embodiment 67, or the pharmaceutical composition of any one of embodiments 68 to 71 is administered to the central nervous system or systemically.

[0157] Embodiment 81. The method of any one of embodiments 73 to 79, wherein the oligomeric compound of any one of embodiments 1 to 51, the modified oligonucleotide of any one of embodiments 52 to 57, the population of any one of embodiments 58 to 65, the antisense agent of embodiment 66 or embodiment 67, or the pharmaceutical composition of any one of embodiments 68 to 71 is administered intrathecally, systemically, subcutaneously, or intramuscularly.

[0158] Embodiment 82. The method of any one of embodiments 73 to 81, wherein the subject is a human.

[0159] Embodiment 83. A method for increasing Progranulin RNA or one or more splice variants of the above-mentioned Progranulin RNA in a cell, comprising contacting a cell with an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, or an antisense agent according to embodiment 66 or embodiment 67.

[0160] Embodiment 84. A method for increasing Progranulin protein in a cell, comprising contacting a cell with an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, or an antisense agent according to embodiment 66 or embodiment 67.

[0161] Embodiment 85. The method of embodiment 83 or embodiment 84, wherein the cell is a neuron.

[0162] Embodiment 86. The method of any one of embodiments 83 to 85, wherein the cell is a human cell.

[0163] Embodiment 87. Use of an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, an antisense agent according to embodiment 66 or embodiment 67, or a pharmaceutical composition according to any one of embodiments 68 to 71 for treating a disease or disorder associated with insufficient expression of Progranulin.

[0164] Embodiment 88. Use of an oligomeric compound according to any one of embodiments 1 to 51, a modified oligonucleotide according to any one of embodiments 52 to 57, a population according to any one of embodiments 58 to 65, an antisense agent according to embodiment 66 or embodiment 67, or a pharmaceutical composition according to any one of embodiments 68 to 71 in the manufacture of a medicament for the treatment of a disease or disorder associated with insufficient expression of Progranulin.

[0165] Embodiment 89. The use according to embodiment 87 or embodiment 88, wherein the disease or disorder associated with insufficient expression of Progranulin is a nervous system disease or disorder.

[0166] Embodiment 90. The use according to embodiment 87 or embodiment 88, wherein the disease or disorder associated with insufficient expression of progranulin is a lysosomal storage disease or a TDP-43 proteinopathy.

[0167] Embodiment 91. The use according to any one of embodiments 87 to 90, wherein the disease or disorder associated with insufficient expression of progranulin is frontolateral dementia (FTD), frontolateral lobar degeneration (FTLD), neuronal ceroid lipofuscinosis (NCL), Alzheimer's disease (AD), or amyotrophic lateral sclerosis (ALS).

[0168] Specific Composition 1. Compound number 1557993 In certain embodiments, compound number 1557993 is a modified oligonucleotide having a nucleobase sequence (5' to 3') of ACTGAAACGGGGAGGGGA (SEQ ID NO: 781), wherein each nucleoside comprises a 2'-MOE sugar moiety, the internucleoside linkages between nucleotides 2-3, and 10-11 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleotides 1-2, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0169] In certain embodiments, compound number 1557993 has the following chemical notation: es m C eo T es G es A es A es A es m C es G es G eo G es G es A es G es G es G es G es A e (SEQ ID NO: 864), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0170] In certain embodiments, compound number 1557993 is represented by the following chemical structure:

[0171] [ka]

[0172] (Sequence number 864). Structure 1. Compound number 1557993

[0173] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by Structure 1.

[0174] In certain embodiments, the sodium salt of compound number 1557993 is represented by the following chemical structure:

[0175] [ka]

[0176] (Sequence number 864). Structure 2. Sodium salt of compound number 1557993

[0177] 2. Compound number 1557994 In certain embodiments, compound number 1557994 is a modified oligonucleotide having a nucleobase sequence (5' to 3') of CACTGAAACGGGGAGGGG (SEQ ID NO: 80), wherein each nucleoside comprises a 2'-MOE sugar moiety, the internucleoside linkages between nucleotides 2-3, and 10-11 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleotides 1-2, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0178] In certain embodiments, compound number 1557994 has the following chemical notation: m C es A eo m C es T es G es A es A es A es m C es G eo G es G es G es A es G es G es G es G e (SEQ ID NO: 865), wherein: A is an adenine nucleobase, m C is a 5-methylcytosine nucleobase, G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage.

[0179] In certain embodiments, compound number 1557994 is represented by the following chemical structure:

[0180] [ka]

[0181] (Sequence number 865). Structure 3. Compound number 1557994

[0182] In certain embodiments, the oligomeric compound comprises a sodium or potassium salt of a modified oligonucleotide represented by structure 3.

[0183] In certain embodiments, the sodium salt of compound number 1557994 is represented by the following chemical structure:

[0184] [ka]

[0185] (Sequence number 865). Structure 4. Sodium salt of compound number 1557994

[0186] Certain oligonucleotides In certain embodiments, oligomeric compounds are provided herein that comprise oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage.

[0187] A. Certain modified nucleosides Modified nucleosides include modified sugar moieties or modified nucleobases or both modified sugar moieties and modified nucleobases. In certain embodiments, modified nucleosides including the following modified sugar moieties and / or the following modified nucleobases may be incorporated into modified oligonucleotides:

[0188] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates can contain one or more substitutions that correspond to other types of modified sugar moieties.

[0189] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety that includes a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. Examples of suitable 2'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"), as well as 2'-ON-alkylacetamides, such as 2'-ON-methylacetamide ("NMA"), 2'-ON-dimethylacetamide, 2'-ON-ethylacetamide, or 2'-ON-propylacetamide. See, e.g., US 6,147,200; Prakash et al., 2003, Org. Lett., 5,403-6.

[0190] "2'-ON-methylacetamide nucleoside" or "2'-NMA nucleoside" is shown below.

[0191] [ka]

[0192] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties may be in seven isomeric configurations other than the naturally occurring β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO2019 / 157531, which is incorporated herein by reference. 2'-modified sugar moieties have an additional stereocenter at the 2'-position compared to 2'-deoxyfuranosyl sugar moieties. Thus, such sugar moieties have a total of 16 possible isomeric configurations. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0193] In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF, OCF, O-C 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1~C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), or OCH2C(=O)-N(R m )(R n ) are selected from each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10and alkyl, with the 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents may be further substituted with one or more substituents independently selected from among hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include more than one non-bridging sugar substituent, such as a 2'-F-5'-methyl sugar moiety, as well as the modified sugar moieties and modified nucleosides described in Migawa et al., WO2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0194] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, NH2, N3, OCF3, OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)ON(CH3)2(DMAOE), O(CH2)2O(CH2)2N(CH3)2(DMAEOE), and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10Alkyl, for example, OCH2C(=O)-N(H)CH3 ("NMA").

[0195] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0196] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, OCH2CH2OCH3, and OCH2C(=O)-N(H)CH3.

[0197] Certain modified sugar moieties include a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. Nucleosides that include such bicyclic sugar moieties are called bicyclic nucleosides (BNAs), locked nucleosides, or conformationally restricted nucleotides (CRNs). Certain such compounds are described in U.S. Patent Publication No. 2013 / 0190383 and PCT Publication No. WO2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. In certain such embodiments, the furanose ring is a ribose ring.Examples of such 4' to 2' bridging sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., Seth et al., US 7,399,845; Bhat et al., US 7,569,686; Swayze et al., US 7,569,686). al., US 7,741,457, and Swayze et al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345, and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., US 7,741,457, and Swayze et al., US 8,022,193), al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogues thereof (see, e.g., Seth et al., US8,278,426), 4'-C(R. a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2' (wherein each R, R a , and R b are independently H, a protecting group, or C1-C 12 alkyl) (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0198] In certain embodiments, such 4' to 2' bridges are independently -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl, or a protecting group. The quantity of the active ingredient is stable and can be isolated from Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443;Albaek et al.,J.Org.Chem.,2006,71,7731-7740;Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al Srivastava et al., J. Am. Chem. Soc., 2007, 129, 8362-8379;Elayadi et al., Curr. Opinion Invens. Drugs,2001,2,558-561;Braasch et al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207;Imanishi et al al.,US6,268,490, Imanishi et al.,US6,770,748,Imanishi et al.,USRE44,779,Wengel et al.,US6,794,499; al.,US8,080,644, Wengel et al.,US8,034,909, Wengel et al.,US8,153,365, Wengel et al.,US7,572,582, and Ramasamy et al.,US6,525,191 al., WO2004 / 106356, Wengel et al., WO1999 / 014226, Seth et al.,WO2007 / 134181, Seth et al.,US7,547,684, Seth et al.,US7,666,854, Seth et al.,US8,088,746, Seth et al.,US7,750,131, Seth et al.,US8,030,467, Seth et al. al., US8,268,980, Seth et al., US8,546,556, Seth et al., US8,530,640, Migawa et al., US9,012,421, Seth et al., US8,501,805, Allerson et al., US2008 / 0039618, and Migawa et al. al., US2015 / 0191727. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration.

[0199] [ka]

[0200] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have demonstrated antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified in the exemplary embodiments herein, they are in the β-D configuration unless otherwise specified.

[0201] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, 5'-substituted and 4'-2' bridging sugars).

[0202] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and a substitution at the 2' position (see, for example, Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or a substitution at the 5' position.

[0203] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA:

[0204] [ka]

[0205] ("F-HNA", see, e.g., Swayze et al., US8,088,904, Swayze et al., US8,440,803, Swayze et al., US8,796,437, and Swayze et al., US9,005,906; F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran), and nucleosides including additional modified THP compounds having the formula:

[0206] [ka]

[0207] wherein, independently for each modified THP nucleoside: Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that links a modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links a modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, an attached conjugate group, or a 5'- or 3'-terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is independently selected from among hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0208] In certain embodiments, modified THP nucleosides are provided, wherein q1, q2, q3, q4, q5, q6, and q7 are H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided, wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0209] In certain embodiments, the sugar surrogate comprises a ring having more than 5 atoms and more than 1 heteroatom. For example, their use in nucleosides and oligonucleotides containing morpholino sugar moieties has been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure:

[0210] [ka]

[0211] In certain embodiments, morpholinos may be modified, for example, by adding or altering various substituents from the morpholino structures shown above. Such sugar surrogates are referred to herein as "modified morpholinos."

[0212] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO2011 / 133876.

[0213] Many other bicyclic and tricyclic sugars and sugar surrogate ring systems that can be used in modified nucleosides are known in the art.

[0214] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that contain modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not contain nucleobase, which are called abasic nucleoside.An example of modified nucleobase includes 5-methylcytosine.

[0215] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8 -substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, general bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-ones, 1,3-diazaphenothiazin-2-ones, and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-ones (G-clamps).Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859, Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0216] Publications teaching certain preparations of the above modified nucleobases, as well as other modified nucleobases, include Manoharan et al., US2003 / 0158403, Manoharan et al., US2003 / 0175906, Dinh et al., US4,845,205, Spielvogel et al., US5,130,302, Rogers et al., US5,134,066, Bischofberger et al., US5,175,273, Urdea et al., US5,367,066, Benner et al., US5,432,272, Matteucci et al., US5,434,257, Gmeiner et al., US5,457,187, Cook et al., US5,459,255, Froehler et al., US5,459,255, al.,US5,484,908, Matteucci et al.,US5,502,177, Hawkins et al.,US5,525,711, Haralambidis et al.,US5,552,540, Cook et al.,US5,587,469, Froehler et al.,US5,594,121, Switzer et al. al.,US5,596,091, Cook et al.,US5,614,617, Froehler et al.,US5,645,985, Cook et al.,US5,681,941, Cook et al.,US5,811,534, Cook et al.,US5,750,692, Cook et al. al., US5,948,903, Cook et al. et al., US5,587,470, Cook et al., US5,457,191, Matteucci et al., US5,763,588, Froehler et al., US5,830,653, Cook et al., US5,808,027, Cook et al., US6,166,199, and Matteucci et al., US6,005,096.

[0217] 3. Certain modified internucleoside linkages The naturally occurring internucleoside linkage of RNA and DNA is a 3'-5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide may be linked together using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, including phosphodiester linkages ("P(O2)=O") (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, methoxypropylphosphonates ("MOP"), phosphoramidates, phosphorothioates (P(O2)=S), and phosphorodithioates (HS-P=S). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides compared to naturally occurring phosphodiester internucleoside linkages. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0218] Representative internucleoside linkages with chiral centers include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages with chiral centers can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages, or as a population of modified oligonucleotides containing phosphorothioate or other internucleoside linkages in a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate internucleoside linkage. Nevertheless, each individual phosphorothioate of each individual oligonucleotide molecule has a defined stereoconfiguration. In certain embodiments, the population of modified oligonucleotides is enriched in modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate internucleoside linkages is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS, 2003, 125, 8307; Wan et al. Nuc. Acid. Res., 2014, 42, 13456 and WO2017 / 015555.In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one of the indicated phosphorothioates in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase:

[0219] [ka]

[0220] Unless otherwise indicated, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be in a specific stereochemical configuration.

[0221] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Additional neutral internucleoside linkages include nonionic linkages including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additional neutral internucleoside linkages include nonionic linkages including mixed N, O, S, and CH2 constituent moieties.

[0222] B. A specific motif In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that contain modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to nucleobases that are independent of the sequence of the nucleobases).

[0223] 1. Certain glyco-motifs In certain embodiments, an oligonucleotide comprises one or more types of modified sugars and / or unmodified sugar moieties arranged along the oligonucleotide or a portion thereof in a defined pattern or sugar motif, hi certain examples, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0224] In certain embodiments, each nucleoside of a modified oligonucleotide, or a portion thereof, comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, a sugar surrogate, or a 2'-deoxyribosyl sugar moiety. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE modified sugar moiety, a 2'-NMA modified sugar moiety, a 2'-OMe modified sugar moiety, and a 2'-F modified sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino, a modified morpholino, a PNA, a THP, and an F-HNA.

[0225] In certain embodiments, the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides comprising a modified sugar moiety. In certain embodiments, the modified sugar moiety is independently selected from a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE modified sugar moiety, a 2'-NMA modified sugar moiety, a 2'-OMe modified sugar moiety, and a 2'-F modified sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino, a modified morpholino, THP, and F-HNA.

[0226] In certain embodiments, each nucleoside throughout a modified oligonucleotide comprises a modified sugar moiety (a "fully modified oligonucleotide"). In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE modified sugar moiety, a 2'-NMA modified sugar moiety, a 2'-OMe modified sugar moiety, and a 2'-F modified sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino, a modified morpholino, THP, and F-HNA. In certain embodiments, each nucleoside of a fully modified oligonucleotide comprises the same modified sugar moiety (a "uniformly modified sugar motif"). In certain embodiments, the uniformly modified sugar moiety is 7-20 nucleosides in length. In certain embodiments, each nucleoside of a uniformly modified sugar motif comprises a 2'-substituted sugar moiety, a bicyclic sugar moiety, or a sugar surrogate. In certain embodiments, the 2'-substituted sugar moiety is selected from a 2'-MOE modified sugar moiety, a 2'-NMA modified sugar moiety, a 2'-OMe modified sugar moiety, and a 2'-F modified sugar moiety. In certain embodiments, the bicyclic sugar moiety is selected from a cEt sugar moiety and an LNA sugar moiety. In certain embodiments, the sugar surrogate is selected from a morpholino, a modified morpholino, THP, and F-HNA. In certain embodiments, a modified oligonucleotide having at least one fully modified sugar motif may also comprise at least one, at least two, at least three, or at least four 2'-deoxyribonucleosides.

[0227] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0228] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 3' end of the oligonucleotide. In certain embodiments, the block is at the 5' end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides from the 5' end of the oligonucleotide.

[0229] 3. Certain internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or a portion thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0230] In certain embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphodiester internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises at least one, at least two, at least three, at least four, or at least five phosphodiester internucleoside linkages, with the remainder of the internucleoside linkages being phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif of (5' to 3') sssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif of (5' to 3') sossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage.

[0231] C. A certain length The length of the oligonucleotide can be increased or decreased without eliminating activity. For example, in Woolf et al., Proc. Natl. Acad. Sci. USA, 1992, 89, 7305-7309, 1992), a series of oligonucleotides from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of a target nucleic acid in an oocyte injection model. Oligonucleotides 25 nucleobases in length with 8 or 11 mismatched bases near the ends of the oligonucleotide were able to induce specific cleavage of the target nucleic acid, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides, including those with one or three mismatches.

[0232] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of length ranges. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, provided that X is equal to or less than Y. For example, in certain embodiments, the oligonucleotide is selected from the group consisting of 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18 , 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 1 4~30, 15~16, 15~17, 15~18, 15~19, 15~20, 15~21, 15~22, 15~23, 15~24, 15~25, 15~26, 15~27, 15~28, 15~29, 15~30, 16~17, 16~18, 16~19, 16~20, 16~21, 16~22, 16~23, 16~24, 16~25, 16~26, 16~27, 16~ 28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28, 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30,19~20, 19~21, 19~22, 19~23, 19~24, 19~25, 19~26, 19~27, 19~28, 19~29, 19~30, 20~21, 20~22, 20~23, 20~24, 20~25, 20~26, 20~27, 20~28, 20~29, 20~30, 21~22, 21~23, 21~24, 21~25, 21~26, 21~27, 21~28, 21~29, 21~30, 22~23, 22~24, 22~25, 22~26, 22~ 27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0233] In certain embodiments, the oligonucleotide consists of 16 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 linked nucleosides. In certain embodiments, the oligonucleotide consists of 19 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 linked nucleosides.

[0234] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, such parameters are each independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a particular sugar motif may be modified or unmodified, and may or may not follow the sugar modification pattern. Unless otherwise indicated, any modification is independent of the nucleobase sequence.

[0235] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chirally enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chirally enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for β-D ribosyl sugar moieties and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chirally enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0236] F. Nucleotide sequence In certain embodiments, oligonucleotides (unmodified or modified) are further described by their nucleobase sequences. In certain embodiments, oligonucleotides have a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a portion of an oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a portion of an oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or the entire length of an oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0237] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. The conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moiety to the oligonucleotide. The conjugate group can be attached to either or both ends of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to either or both ends of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' and / or 5' end of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

[0238] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, an abasic nucleoside, a modified or unmodified nucleoside, and two or more nucleosides, independently modified or unmodified.

[0239] A. Certain Conjugate Groups In certain embodiments, the oligonucleotide is covalently linked to one or more conjugate groups. In certain embodiments, the conjugate group modifies one or more properties of the linked oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0240] In certain embodiments, the conjugation of one or more carbohydrate moieties to the modified oligonucleotide can optimize one or more properties of the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to the modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier to which a carbohydrate ligand is attached. The ribonucleotide subunit in which the ribose sugar of the subunit is so replaced is referred to herein as the modified sugar moiety ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, sulfur. The cyclic carrier can be a monocyclic ring system or can include two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can include one or more double bonds.

[0241] In certain embodiments, the conjugate group confers new properties to the attached oligonucleotide, such as a fluorophore or reporter group that allows for detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids, 1999, 20, 533-538). Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moieties (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moieties (Crooke et al., J.Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0242] In certain embodiments, a conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0243] In certain embodiments, the conjugate group may comprise a conjugate moiety selected from any of a C22 alkyl, a C20 alkyl, a C17 alkyl, a C16 alkyl, a C10 alkyl, a C21 alkyl, a C19 alkyl, a C18 alkyl, a C15 alkyl, a C14 alkyl, a C13 alkyl, a C12 alkyl, a C11 alkyl, a C9 alkyl, a C8 alkyl, a C7 alkyl, a C6 alkyl, or a C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0244] In certain embodiments, the conjugate group is a lipid having the following structure:

[0245] [ka]

[0246] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, lipophilic groups, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0247] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazide, chlorothiazide, diazepines, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0248] 2. Conjugate Linker The conjugate moiety is attached to the oligonucleotide via a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide via a single bond). In certain oligomeric compounds, the conjugate moiety is attached to the oligonucleotide via a more complex conjugate linker that includes one or more conjugate linker moieties, which are the subunits that make up the conjugate linker. In certain embodiments, the conjugate linker includes a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units, such as ethylene glycol, nucleoside, or amino acid units. In certain embodiments, the conjugate linker includes pyrrolidine.

[0249] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0250] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, for example, one known in the art to be useful for linking a conjugate moiety to a compound, such as an oligonucleotide, provided herein. In general, the bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to react with a specific site of the compound, and the other is selected to react with the conjugate moiety. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0251] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 alkynyl, a non-limiting list of preferred substituents includes, but is not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0252] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises 1-3 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise a modified sugar moiety. In certain embodiments, the linker nucleoside is unmodified. In certain embodiments, the linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is typically desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0253] In the present specification, linker nucleosides are not considered to be part of an oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage of complementarity with a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percentage of complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker nucleosides contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an oligomeric compound is more than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group is present. The total number of consecutive linked nucleosides in such oligomeric compounds is 30 or less. Unless otherwise indicated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker nucleoside.

[0254] In certain embodiments, it is desirable for the conjugate group to be cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds containing certain conjugate moieties are more likely to be taken up by certain cell types, but it is desirable for the conjugate group to be cleaved to release the unconjugated or parent oligonucleotide after the oligomeric compound is taken up. Thus, certain conjugate linkers may contain one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

[0255] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0256] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound by a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxyribonucleoside that is linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphodiester bond or phosphorothioate internucleoside bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0257] 1. Cell targeting moiety In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula:

[0258] [ka]

[0259] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0260] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0261] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0262] In certain embodiments, each ligand of the cell targeting moiety has affinity for at least one receptor type on target cell.In certain embodiments, each ligand has affinity for at least one receptor type on the surface of mammalian liver cells.In certain embodiments, each ligand has affinity for hepatic asialoglycoprotein receptor (ASGP-R).In certain embodiments, each ligand is a carbohydrate.

[0263] In certain embodiments, the conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, the conjugate group has the general formula:

[0264] [ka]

[0265] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0266] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0267] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one tethered ligand. In certain embodiments, the cell targeting moiety comprises two tethered ligands covalently attached to the branching group. In certain embodiments, the cell targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0268] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include 5'-phosphanates, including but not limited to 5'-vinyl phosphonates. In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or reverse nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain such embodiments, the 2'-linked group is an abasic sugar moiety.

[0269] C. Oligomeric duplex In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence that is complementary to the sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.

[0270] D. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to a target nucleic acid to provide at least one antisense activity. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity if they reduce, modulate, or increase the amount or activity of a target nucleic acid by 25% or more in a standard in vitro assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds include nucleobase sequences that hybridize to one or more target nucleic acids to provide one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids or do not hybridize to one or more non-target nucleic acids in a manner that results in significant undesired antisense activity.

[0271] In certain antisense activities, the hybridization of an antisense compound to a target nucleic acid results in the recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in the cleavage of the target nucleic acid via RNaseH. RNaseH is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, antisense compounds are provided herein that are sufficiently "DNA-like" to induce RNase H activity. In certain embodiments, one or more non-DNA-like nucleosides in the gap of a gapmer are tolerated.

[0272] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), which finally leads to cleavage of target nucleic acid.For example, certain antisense compound leads to cleavage of target nucleic acid by Argonaute.The antisense compound incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).

[0273] In certain embodiments, hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction of the target nucleic acid with a protein or other nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in the inclusion of an exon. In certain embodiments, hybridization of an antisense compound to a target nucleic acid results in an increase in the amount or activity of the target nucleic acid. In certain embodiments, hybridization of an antisense compound complementary to a target nucleic acid results in a change in splicing, resulting in the inclusion or exclusion of an exon in the mRNA.

[0274] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or subject.

[0275] III. A Specific Target Nucleic Acid In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA, including introns, exons, and untranslated regions. In certain embodiments, the target nucleic acid is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is at least 50% within an intron.

[0276] A. Complementarity / mismatch with target nucleic acid It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated the ability of an oligonucleotide with 100% complementarity with bcl-2 mRNA and three mismatches with bcl-xL mRNA to reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 and 42 nucleobase oligonucleotides composed of two or three sequences of the tandem oligonucleotides, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, albeit to a more modest level than either the 28 or 42 nucleobase oligonucleotides.

[0277] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a portion that is 100% or completely complementary to the target nucleic acid. In certain embodiments, the portion of complete complementarity is 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length.

[0278] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases relative to the target nucleic acid, in certain such embodiments, the mismatches are at positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 from the 5'-end of the oligonucleotide.

[0279] B. Progranulin In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide complementary to a target nucleic acid encoding Progranulin, or a portion thereof. In certain embodiments, the target nucleic acid has a sequence as set forth in SEQ ID NO:1 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 44342001-44356000), SEQ ID NO:2 (GENBANK Accession No. NM_002087.3), or both. In certain embodiments, the oligomeric compound comprises or consists of a modified oligonucleotide consisting of 18, 19, or 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs:12-854.

[0280] In certain embodiments, contacting a cell with an oligomeric compound modulates the amount of Progranulin RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound increases the amount of Progranulin RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound modulates the amount of Progranulin protein in the cell. In certain embodiments, contacting a cell with an oligomeric compound increases the amount of Progranulin protein in the cell. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide.

[0281] In certain embodiments, contacting a cell in a subject with an oligomeric compound alleviates one or more symptoms or characteristics of a nervous system disease or disorder. In certain embodiments, the nervous system disease or disorder is FTD. In certain embodiments, the nervous system disease or disorder is FTLD. In certain embodiments, the nervous system disease or disorder is NCL. In certain embodiments, the nervous system disease or disorder is TDP-43 proteinopathy. In certain embodiments, the disease or disorder is a lysosomal storage disease. In some embodiments, the disease or condition is ALS. In certain embodiments, the symptom or characteristic is any of the following: behavior and personality deterioration, speech disorder, impaired or altered muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness.

[0282] In certain embodiments, the oligomeric compounds are capable of increasing progranulin RNA in vitro by at least 5-fold, at least 1-fold, at least 2-fold, or at least 3-fold when tested according to standard in vitro assays.

[0283] C. A specific target nucleic acid in a specific tissue In certain embodiments, the modified oligomeric compound comprises or consists of an oligonucleotide that comprises a portion that is complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue.In certain embodiments, the pharmacologically relevant tissue is the cells and tissues that comprise the central nervous system (CNS).Such tissues include brain tissues, such as cortex, hypothalamus, hippocampus, cerebellum, and coronary brain tissue.

[0284] IV. Certain Pharmaceutical Compositions In certain embodiments, provided herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS comprises pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0285] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and an artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0286] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. In certain embodiments, the PBS comprises pharmaceutical grade PBS.

[0287] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, sodium phosphate dianhydrous dihydrate, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to a range of about 7.1 to 7.3, or about 7.2, using a suitable pH adjusting agent, for example, an acid such as hydrochloric acid and an alkali such as sodium hydroxide. In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0288] In certain embodiments, the oligomeric compounds may be mixed with pharma- ceutically acceptable active and / or inactive substances for the preparation of pharmaceutical compositions or formulations. The compositions and methods for the formulation of pharmaceutical compositions depend on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0289] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharma- ceutically acceptable salts of oligomeric compounds, esters of oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure is also directed to pharma- ceutically acceptable salts of oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharma- ceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, and magnesium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the modified oligonucleotide, which are cleaved by endogenous nucleases in the body. In certain embodiments, the prodrug comprises one or more conjugate groups attached to a modified oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0290] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF.

[0291] Lipid moieties are used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceutical agents to muscle tissue.

[0292] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those that comprise hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0293] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0294] In certain embodiments, the pharmaceutical composition includes a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are used for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the non-polar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems can be varied considerably without significantly altering their solubility and toxicity properties. Furthermore, the identity of the co-solvent components may be changed, for example, other surfactants may be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol may be changed, other biocompatible polymers may replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides may replace dextrose.

[0295] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), intraneuronal, perineural, etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients are included (e.g., ingredients that aid solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are in unit dosage form, e.g., in ampoules or multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may include formulatory agents such as suspending, stabilizing, and / or dispersing agents. Certain solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents such as sesame oil and fatty oils, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0296] Under certain conditions, certain compounds disclosed herein function as acids. Such compounds may be depicted or described in protonated (free acid) form or in ionized and associated with cations (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate linkages of oligonucleotides in aqueous solution exist in equilibrium between free acid, anionic, and salt forms. Unless otherwise indicated, compounds disclosed herein are intended to include all such forms. Furthermore, certain oligonucleotides have several such linkages, each of which is in equilibrium. Thus, oligonucleotides in solution exist as a collection of forms, all in equilibrium at multiple positions. The term "oligonucleotide" is intended to include all such forms. The illustrated structures necessarily depict a single form. Nevertheless, unless otherwise indicated, such depictions are intended to include the corresponding forms as well. As used herein, the structure of the free acid of a compound followed by the term "or a salt thereof" or "or a pharma- ceutically acceptable salt thereof" expressly includes all such forms that may be fully or partially protonated / deprotonated / associated with a cation or combination of cations. In certain embodiments, one or more certain cations are specified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, the structure of the free acid of a compound followed by the term "or a pharma- ceutically acceptable salt thereof" expressly includes all such forms that may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium.

[0297] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0298] In this specification, certain doses are described. The doses may be in the form of dosage units. For clarity of explanation, the dose (or dosage unit) of the modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for the purpose of calculating the dose, it is assumed that the modified oligonucleotide or oligomeric compound is present as a solvent-free, sodium acetate-free, anhydrous, free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound is partially or completely deprotonated and becomes Na + However, the mass of the proton is still counted in the weight of the dose, and Na + The mass of ions is not counted in the weight of the dose. Thus, for example, a dose or dosage unit of 10 mg of Compound No. 1557993 is equal to the number of fully protonated molecules having a weight of 10 mg. This corresponds to 10.51 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1557993. If an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dose of such oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for the purpose of calculating the dose.

[0299] In certain embodiments, when the modified oligonucleotide or oligomeric compound is in a solution such as aCSF that contains sodium, potassium, calcium, and magnesium, the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium, potassium, calcium, and / or magnesium. However, the mass of the protons is still counted in the dose weight, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the dose weight.

[0300] In certain embodiments, when an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also contains an acid, the conjugate group is also assumed to be fully protonated for purposes of calculating the dosage.

[0301] V. Certain hotspot areas In certain embodiments, nucleobases 8,497-8,552 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion within nucleobases 8,497-8,552 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide is 18 nucleobases in length. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a 2'-MOE sugar moiety. In certain embodiments, all internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises an internucleoside linkage motif of (5' to 3') sossssssssssssss.

[0302] The nucleobase sequences of SEQ ID NOs: 34, 268, 345, 424, 501, 579, 657, 735, 800, 801, 806, 812, 813, 816, 821, 828, 844, and 847 are complementary to a portion of nucleobases 8,497 to 8,552 of SEQ ID NO:1.

[0303] The nucleic acid base sequences of compound numbers 1212177, 1212178, 1212179, 1212180, 1212181, 1212182, 1212183, 1212184, 1366757, 1366758, 1366763, 1366769, 1366770, 1366773, 1366778, 1366785, 1366801, and 1366804 are complementary to a portion of nucleic acid bases 8,497 to 8,552 of SEQ ID NO:1.

[0304] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 8,497-8,552 of SEQ ID NO:1 achieve at least 100% expression of Progranulin RNA in a standard in vitro assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 8,497-8,552 of SEQ ID NO:1 achieve an average of 147% expression of Progranulin RNA in a standard in vitro assay.

[0305] Non-Limiting Disclosure and Incorporation by Reference Each of the literature and patent publications cited herein is incorporated by reference in its entirety. Although certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are merely illustrative of the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, ENSEMBL identifiers, etc. listed in this application are incorporated by reference in their entirety.

[0306] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" as appropriate, in practice these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that the designation as "RNA" or "DNA" to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base may be described as a DNA with a modified sugar moiety (2'-OH instead of one 2'-H of DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to such nucleic acids with modified nucleobases, unless otherwise specified. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can be used in combination with other compounds, including, but not limited to, those having the sequence "AUCGAUCG", as well as those compounds having some DNA bases and some RNA bases, such as "AUCGATCG", and those having some RNA bases, such as "AT m and oligomeric compounds having other modified nucleobases such as "AACGAUCG", m C denotes a cytosine base containing a methyl group at the 5-position. Finally, for clarity, unless otherwise indicated, the phrase "nucleobase sequence of SEQ ID NO:X" refers only to the nucleobase sequence of SEQ ID NO:X, independent of any sugar modifications or internucleoside linkage modifications also set forth in such SEQ ID NO:X.

[0307] Certain compounds (e.g., modified oligonucleotides) described herein have one or more asymmetric centers, thus giving rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), as α or β, such as sugar anomers, or as (D) or (L), such as amino acids. Compounds provided herein that are depicted or described as having a particular stereoisomeric configuration include only the compounds shown. Compounds provided herein that are depicted or described with undefined stereochemistry include all such possible isomers (including their stereorandom and optically pure forms), unless otherwise specified. Similarly, all cis and trans isomers and tautomeric forms of the compounds described herein are included, unless otherwise indicated. Oligomeric compounds described herein include chirally pure or enriched mixtures, as well as racemic mixtures. For example, oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include such compounds in which the chirality of the phosphorothioate internucleoside linkages is controlled or random.Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

[0308] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds herein containing hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O. 17 O or 18 O, and 32 Instead of S. 33 S, 34 S, 35S, or 36 These include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution may provide the oligomeric compound with new properties beneficial for use as a therapeutic or research tool. In certain embodiments, radioactive isotope substitution may make the compound suitable for research or diagnostic purposes, such as imaging. EXAMPLES

[0309] The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting. Moreover, when specific embodiments are provided, the inventors have contemplated the general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a specific motif provides reasonable support for additional oligonucleotides having the same or similar motifs. Moreover, for example, when a specific high affinity modification appears at a specific position, other high affinity modifications at the same position are considered to be suitable unless otherwise indicated.

[0310] Example 1: Effect of uniformly MOE-modified oligonucleotides with uniform phosphorothioate internucleoside linkages on human progranulin in vitro at a single dose Modified oligonucleotides complementary to human Progranulin nucleic acid were designed and tested for their effect on Progranulin RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0311] "Start Site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End Site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 44342001-44356000), SEQ ID NO:2 (GENBANK Accession No. NM_002087.3), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0312] The modified oligonucleotides in the following table are 18 nucleosides in length, the sugar motif of the modified oligonucleotides is (5' to 3') eeeeeeeeeeeeeeeeeeee, where "e" represents a 2'-MOE sugar moiety, the internucleoside linkage motif of the modified oligonucleotides is (5' to 3') sssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage, and each cytosine residue is a 5-methylcytosine.

[0313] A-431 cells cultured at a density of 10,000 cells per well were treated with modified oligonucleotides at a concentration of 6,000 nM by free uptake. After a treatment period of about 48 hours, RNA was isolated from the cells and progranulin RNA levels were measured by quantitative real-time PCR. Progranulin RNA upregulation was measured using human primer probe set RTS42426 (forward sequence AGGACTAACAGGGCAGTGG, designated herein as SEQ ID NO: 3; reverse sequence CAGCAGCCATACTTCCCA, designated herein as SEQ ID NO: 4; probe sequence TTGTCCAGCTCGGTCATGTGTCC, designated herein as SEQ ID NO: 5). Progranulin RNA levels were normalized to total RNA content measured by RIBOGREEN®. Results are presented as a percentage of progranulin RNA relative to the amount in untreated control cells (%UTC). Each individual experiment described in this example is identified by an assay identification letter in the table column labeled "AID".

[0314] Values ​​marked with "†" indicate that the RNAi compound is complementary to the amplicon region of the primer-probe set. Values ​​marked with "ND" are not defined. Each individual experiment described in this example is identified by an assay identification letter in the table row labeled "AID."

[0315] [Table 1-1]

[0316] [Table 1-2]

[0317] [Table 1-3]

[0318]

Table 1-4

[0319]

Table 1-5

[0320]

Table 1-6

[0321]

Table 1-7

[0322]

Table 1-8

[0323]

Table 1-9

[0324]

Table 1-10

[0325]

Table 1-11

[0326]

Table 1-12

[0327]

Table 1-13

[0328]

Table 1-14

[0329] [Table 1-15]

[0330] [Table 1-16]

[0331] [Table 1-17]

[0332] Example 2: Effect of uniformly MOE-modified oligonucleotides with uniform phosphorothioate internucleoside linkages on human progranulin in vitro at a single dose Modified oligonucleotides complementary to human Progranulin nucleic acid were designed and tested for their effect on Progranulin RNA in vitro. The modified oligonucleotides were tested in a series of experiments with similar culture conditions.

[0333] "Start Site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End Site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NC_000017.11 truncated from nucleotides 44342001-44356000), SEQ ID NO:2 (GENBANK Accession No. NM_002087.3), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0334] The modified oligonucleotides in the following table are 18 nucleosides in length, the sugar motif of the modified oligonucleotides is (5' to 3') eeeeeeeeeeeeeeeeeeee, where "e" represents a 2'-MOE sugar moiety, the internucleoside linkage motif of the modified oligonucleotides is (5' to 3') sssssssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage, and each cytosine residue is a 5-methylcytosine.

[0335] A-431 cells cultured at a density of 10,000 cells per well were treated with modified oligonucleotides at a concentration of 4,000 nM by free uptake. After a treatment period of about 48 hours, RNA was isolated from the cells and Progranulin RNA levels were measured by quantitative real-time PCR. Progranulin RNA upregulation was measured using human primer probe set RTS42426 (described hereinabove). Progranulin RNA levels were normalized to total RNA content measured by RIBOGREEN®. Results are presented as the percentage of Progranulin RNA relative to the amount in untreated control cells (%UTC).

[0336] [Table 2-1]

[0337] [Table 2-2]

[0338] Example 3: Effects of modified oligonucleotides on human progranulin in vitro, multiple doses Modified oligonucleotides selected from the above examples were tested in A-431 cells. The modified oligonucleotides were tested in a series of experiments using the same culture conditions. The results of each experiment are shown in a separate table below.

[0339] A-431 cells plated at a density of 10,000 cells per well were treated by free uptake at various doses as shown in the table below. After a treatment period of about 48 hours, total RNA was isolated from the cells and Progranulin RNA levels were measured by quantitative real-time PCR. Progranulin RNA was measured using human Progranulin primer probe set RTS42426 (described hereinabove). Progranulin RNA levels were normalized to total RNA content measured by RIBOGREEN®. The results are presented in the table below as a percentage of Progranulin RNA relative to the amount in untreated control cells (%UTC). The fold increase in the amount of Progranulin RNA at 20 μM relative to untreated control cells was calculated and is presented in the table below.

[0340] [Table 3]

[0341] [Table 4]

[0342] [Table 5]

[0343] [Table 6]

[0344] [Table 7]

[0345] Example 4: Design of uniform MOE-modified oligonucleotides with mixed PS / PO internucleoside linkages complementary to human progranulin RNA Modified oligonucleotides complementary to human Progranulin RNA were designed as described in Table 8 below.

[0346] The modified oligonucleotides in the following table are 18 nucleosides in length, the sugar motif of the modified oligonucleotides is (5' to 3') eeeeeeeeeeeeeeeeeeee, where "e" represents a 2'-MOE sugar moiety, the internucleoside linkage motif of the modified oligonucleotides is (5' to 3') sossssssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage, and each cytosine residue is a 5-methylcytosine.

[0347] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "End site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described hereinabove), SEQ ID NO: 2 (described hereinabove), or both. "N / A" indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

[0348] [Table 8]

[0349] Example 5: Effects of modified oligonucleotides complementary to human GRN in H4 cells at a single dose Selected modified oligonucleotides from the above examples were tested for their effect on Progranulin protein levels in vitro. Also tested was a control scrambled modified oligonucleotide ("Control Scrambled ASO") (a phosphorothioate backbone with a uniform 2'MOE modification and the nucleobase sequence (5' to 3') TTAGTTTAATCACGCTCG (SEQ ID NO: 10).

[0350] H4 human glioma cells (ATCC HTB-148) were treated with modified oligonucleotides at a concentration of 5000 nM for 24 hours. Progranulin levels were measured in cell lysates by ELISA. Progranulin concentrations were determined in duplicate using a sandwich ELISA assay (R&D Systems, DPGRN0) using 10-15 μl of lysate per well (typically 8-20 μg total protein per well). Data are presented in Figure 1A as mean + / - SD, with * indicating p<0.05, ** indicating p<0.01, *** indicating p<0.001, and **** indicating p<0.0002 as determined by one-way ANOVA with Dunnett's post-hoc test.

[0351] H4 human glioma cells were treated with modified oligonucleotides at a concentration of 10 μM for 24 hours. Progranulin levels in cell lysates were measured by Western blot (Figure 1B, 1C, and 1D). In a separate experiment, H4 cells were treated with modified oligonucleotides at 10 μM for 24 hours, and progranulin levels in cell lysates as well as secreted progranulin levels in conditioned medium were assessed by Western blot. Modified oligonucleotides that increased cellular progranulin levels (upper panel of Figure 1E) also increased secreted progranulin levels in the medium (lower panel of Figure 1E).

[0352] Primary antibodies used for immunoblot analysis include anti-human progranulin linker 5 polyclonal antibody #614, which recognizes an epitope between amino acids 497 and 515 (Nguyen, AD, et al., J. Biol. Chem. 288, 8627-8635 (2013)), and anti-human vinculin monoclonal antibody (loading control for protein levels) (Cell Signaling Technology, 13901).

[0353] Example 6: Effects of modified oligonucleotides complementary to human GRN in vitro at multiple doses Modified oligonucleotides selected from the above examples, and the control scrambled ASO described above, were tested for their effect on Progranulin protein levels in H4 cells. Cells were treated with modified oligonucleotides at the doses shown in Figures 2A-2F for 24 hours. Progranulin levels were measured in cell lysates by ELISA as in Example 5. Data are shown in the EC 50 Values ​​are presented as mean ± SD.

[0354] Example 7: Effects of modified oligonucleotides complementary to human GRN in iPSC-derived neurons Modified oligonucleotides selected from the above examples, and the control scrambled ASO described above, were tested for their effects on progranulin protein levels in iPSC-derived neurons. Human iPSCs with doxycycline-responsive neurogenin-2 (NGN2) expression for differentiation into i3 cortical neurons were prepared as described (Fernandopulle, MS, et al., Curr. Protoc. Cell Biol. 79, e51 (2018)). After 2 weeks of differentiation, i3 neurons were treated with modified oligonucleotides at the indicated concentrations (μM) for 3-4 days. Western blot analysis was performed as in Example 5, and the data are shown in Figure 3.

[0355] Example 8: Effects of modified oligonucleotides complementary to human GRN in vivo Homozygous knock-ins in mice for human GRN were prepared from heterozygous C57BL / 6J breeder pairs (Petkau et al., Neurobiol. Dis. 153, 105314 (2021)). These transgenic GRN mice were treated with 500 μg of modified oligonucleotides by bolus intracerebroventricular injection into the right lateral ventricle (Jafar-Nejad, P., et al., Nucleic Acids Res. 49, 657-673 (2021); Farr, SA, et al., J. Alzheimers Dis. 40, 1005-1016 (2014)). Three weeks after administration, mice were euthanized and brain tissue was collected for protein analysis. Human progranulin levels in the cortex of mice treated with the indicated modified oligonucleotides, the control scrambled ASO described above, and saline, as determined by ELISA (progranulin levels were determined in duplicate), are shown in Figure 4B and Figure 4C. Human progranulin levels were increased by 53% and 55%, respectively, in male and female mice treated with compound 1557993 compared to mice of the same sex that received the scrambled control ASO. Data are presented as mean ± SEM, and * indicates p<0.05 as determined by one-way ANOVA with Dunnett's post-hoc test. Non-Tg = untreated non-transgenic mice that are littermate of transgenic mice and do not carry the human GRN allele. Western blots of human progranulin in the cortex, thalamus, and hippocampus of male mice treated with control or compound 1557993 (Figure 4C) were performed as in Example 5 and show increased human progranulin in the cortex, thalamus, and hippocampus of compound-treated male mice.

Claims

1. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion of a Progranulin nucleic acid, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. 2. The oligomeric compound of claim 1, wherein the progranulin nucleic acid has the nucleic acid base sequence of SEQ ID NO: 1 or SEQ ID NO:

2.

3. 2. The oligomeric compound of claim 1, wherein the modified oligonucleotide consists of 18, 19, or 20 linked nucleosides and the nucleobase sequence of said modified oligonucleotide comprises at least 16, at least 17, or 18 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 12-854.

4. 4. The oligomeric compound of any one of claims 1-3, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 16, at least 17, or 18 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 501, 735, 657, 424, 579, 34, 268, 345, 800, 801, 806, 812, 813, 816, 821, 828, 844, and 847.

5. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 50 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases complementary to an equal-length portion within nucleobases 8497-8552 of SEQ ID NO:

1.

6. 6. The oligomeric compound of claim 5, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 501, 735, 657, 424, 579, 34, 268, 345, 800, 801, 806, 812, 813, 816, 821, 828, 844, and 847.

7. 7. The oligomeric compound of any one of claims 1-3 and 5-6, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion within the nucleobase sequence of either SEQ ID NO: 1 or SEQ ID NO: 2, when measured across the entire nucleobase sequence of the modified oligonucleotide.

8. The oligomeric compound of any one of claims 1 to 3 and 5 to 6, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

9. 9. The oligomeric compound of claim 8, wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

10. 10. The oligomeric compound of claim 9, wherein each modified sugar moiety is a 2'-MOE-modified sugar moiety, a 2'-NMA-modified sugar moiety, a 2'-OMe-modified sugar moiety, or a 2'-F-modified sugar moiety.

11. The oligomeric compound of any one of claims 1 to 3 and 5 to 6, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

12. 12. The oligomeric compound of claim 11, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

13. 12. The oligomeric compound of claim 11, wherein each internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

14. The oligomeric compound of any one of claims 1 to 3 and 5 to 6, wherein at least one internucleoside linkage of the modified oligonucleotide is a phosphodiester internucleoside linkage.

15. 12. The oligomeric compound of claim 11, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

16. 12. The oligomeric compound of claim 11, wherein at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

17. 7. The oligomeric compound of any one of claims 1-3 and 5-6, wherein the modified oligonucleotide consists of 18 linked nucleosides and has an internucleoside linkage motif selected from ssssssssssssssssss and sosssssssssssss.

18. 7. The oligomeric compound of any one of claims 1 to 3 and 5 to 6, wherein the modified oligonucleotide comprises at least one modified nucleobase, said modified nucleobase being 5-methylcytosine or hypoxanthine.

19. 7. The population of oligomeric compounds of any one of claims 1-3 and 5-6, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

20. 7. A pharmaceutical composition comprising the oligomeric compound of any one of claims 1 to 3 and 5 to 6 and a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate buffered saline (PBS).

21. 21. The pharmaceutical composition of claim 20, wherein the pharmaceutical composition consists essentially of the oligomeric compound and aCSF or PBS.

22. 20. A pharmaceutical composition comprising the population of claim 19 and a pharmaceutically acceptable diluent, wherein the pharmaceutically acceptable diluent is artificial CSF (aCSF) or phosphate buffered saline (PBS).

23. 23. The pharmaceutical composition of claim 22, wherein the pharmaceutical composition consists essentially of the population and aCSF or PBS.

24. A pharmaceutical composition for treating a disease or disorder associated with insufficient expression of progranulin, comprising an oligomeric compound according to any one of claims 1 to 3 and 5 to 6.

25. The pharmaceutical composition of claim 24, wherein the disease or disorder associated with insufficient expression of progranulin is frontolateral dementia (FTD), frontolateral lobar degeneration (FTLD), neuronal ceroid lipofuscinosis (NCL), Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), lysosomal storage disease, or TDP-43 proteinopathy.

26. The pharmaceutical composition of claim 25, wherein at least one symptom or characteristic of the disease or disorder associated with insufficient expression of progranulin is alleviated, and the at least one symptom or characteristic is deterioration in behavior and personality, speech impairment, altered muscle or motor function, memory loss, cognitive impairment, tremors, seizures, or dizziness.

27. 27. The pharmaceutical composition of claim 26, wherein administration of the oligomeric compound improves behavior or personality, delays deterioration of behavior or personality, improves language ability, delays deterioration of language ability, improves muscle or motor function, delays deterioration of muscle or motor function, improves memory, delays deterioration of memory, improves cognitive function, delays deterioration of cognitive function, reduces tremors, reduces seizures, or reduces dizziness.

28. 25. The pharmaceutical composition of claim 24, for administration to a human.

29. 10. A method for increasing Progranulin RNA or one or more splice variants of said Progranulin RNA in a cell, said method comprising contacting said cell with an oligomeric compound according to any one of claims 1 to 3 and 5 to 6.

Images