Improved process of preparing mrna-loaded lipid nanoparticles

Abstract

To provide an improved process for a lipid nanoparticle formulation and mRNA encapsulation.SOLUTION: The present invention provides a process for encapsulation of messenger RNA (mRNA) in lipid nanoparticles, the process comprising a step of heating the mRNA-encapsulated lipid nanoparticles in a drug product formulation solution.SELECTED DRAWING: None

Description

Technical Field

[0001] Cross - reference to Related Applications This application claims priority to U.S. Provisional Patent Application No. 62 / 847,837, filed May 14, 2019, which is hereby incorporated by reference in its entirety for all purposes.

Background Art

[0002] Messenger RNA therapy (MRT) has become an increasingly important approach for the treatment of various diseases. MRT involves the administration of messenger RNA (mRNA) to patients who require therapy for the production of proteins encoded by the mRNA in the patient's body. Lipid nanoparticles are generally used to encapsulate the mRNA for efficient in vivo delivery of the mRNA.

[0003] To improve lipid nanoparticle delivery, many attempts have focused on identifying novel lipids or specific lipid compositions that can affect intracellular delivery and / or expression of mRNA, for example, in various types of mammalian tissues, organs, and / or cells (such as mammalian hepatocytes). However, these existing approaches are costly, time - consuming, and unpredictable.

Summary of the Invention

Means for Solving the Problems

[0004] The present invention provides, inter alia, an improved process for preparing messenger RNA (mRNA)-loaded lipid nanoparticles (mRNA-LNPs). The present invention involves mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution to form mRNA encapsulated within the LNPs (mRNA-LNP) in an LNP-forming solution (e.g., Process A as further described below). After the process of encapsulating messenger RNA (mRNA) into LNPs, a further step of replacing the LNP-forming solution with a pharmaceutical formulation solution and heating the mRNA-LNP in the pharmaceutical formulation solution provides the unexpected benefit of significantly increasing the encapsulation efficiency of the mRNA-LNP, i.e., the amount or percentage of mRNA encapsulated within the LNP (i.e., encapsulation rate or efficiency). The present invention is particularly useful for manufacturing mRNA-LNPs with a higher encapsulation rate or efficiency compared to conventional approaches.

[0005] Compared to conventional approaches, the process of the present invention described herein provides a higher encapsulation efficiency and thus may provide a higher potency and better efficacy of the lipid nanoparticle-delivered mRNA, thereby shifting the therapeutic index in a positive direction and providing additional benefits such as lower cost, better patient compliance, and a more patient-friendly dosing schedule. The mRNA-loaded lipid nanoparticle formulations provided by the present invention can be successfully delivered in vivo via different routes of administration such as intravenous, intramuscular, intra-articular, intrathecal, inhalation (respiratory), subcutaneous, intravitreal, and ophthalmic for more potent and effective protein expression.

[0006] The process of the present invention can be implemented using a pump system and is thus scalable, enabling, for example, an amount of improved particle formation / formulation sufficient for conducting clinical trials and / or commercial sales. Various pump systems including, but not limited to, peristaltic pumps, gear pumps, peristaltic pumps, and centrifugal pumps can be used to implement the present invention.

[0007] The process of the present invention also results in excellent encapsulation efficiency and a uniform particle size.

[0008] Thus, in one aspect, the present invention provides a process for encapsulating messenger RNA (mRNA) in lipid nanoparticles (LNP), comprising: (a) mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution to form mRNA encapsulated within the LNP in an LNP-forming solution (mRNA-LNP); (b) exchanging the LNP-forming solution with a pharmaceutical formulation solution to provide the mRNA-LNP in the pharmaceutical formulation solution; and (c) heating the mRNA-LNP in the pharmaceutical formulation solution, wherein the encapsulation efficiency of the mRNA-LNP resulting from step (c) is greater than the encapsulation efficiency of the mRNA-LNP resulting from step (b).

[0009] In some embodiments, in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the solution.

[0010] In some embodiments, in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the solution, and the solution is maintained at a temperature higher than the ambient temperature for 5 seconds or more, 10 seconds or more, 20 seconds or more, 30 seconds or more, 40 seconds or more, 50 seconds or more, 1 minute or more, 2 minutes or more, 3 minutes or more, 4 minutes or more, 5 minutes or more, 10 minutes or more, 15 minutes or more, 20 minutes or more, 25 minutes or more, 30 minutes or more, 35 minutes or more, 40 minutes or more, 45 minutes or more, 50 minutes or more, 60 minutes or more, 70 minutes or more, 80 minutes or more, 90 minutes or more, 100 minutes or more, or 120 minutes or more. In some embodiments, in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the solution, and the solution is maintained at a temperature higher than the ambient temperature for less than 120 minutes, less than 100 minutes, less than 90 minutes, less than 60 minutes, less than 45 minutes, less than 30 minutes, less than 25 minutes, less than 20 minutes, less than 15 minutes, less than 10 minutes, less than 5 minutes, less than 4 minutes, less than 3 minutes, less than 2 minutes, less than 1 minute, less than 50 seconds, less than 40 seconds, less than 30 seconds, less than 20 seconds, less than 10 seconds, or less than 5 seconds. In some embodiments, in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the solution, and the solution is maintained at a temperature higher than the ambient temperature for 10 to 20 minutes. In some embodiments, in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the solution, and the solution is maintained at a temperature higher than the ambient temperature for 20 to 90 minutes. In some embodiments, in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the solution, and the solution is maintained at a temperature higher than the ambient temperature for 30 to 60 minutes. In some embodiments, in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the solution, and the solution is maintained at a temperature higher than the ambient temperature for about 15 minutes. In some embodiments, the temperature at which the pharmaceutical formulation is heated (or the pharmaceutical formulation solution is maintained) is about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher. In some embodiments, the temperature at which the pharmaceutical formulation solution is heated is in the range of about 25 - 70°C, about 30 - 70°C, about 35 - 70°C, about 40 - 70°C, about 45 - 70°C, about 50 - 70°C, or about 60 - 70°C.In some embodiments, the temperature higher than the ambient temperature at which the pharmaceutical formulation solution is heated is about 65°C.

[0011] In some embodiments, in step (a), the lipid nanoparticles are formed by mixing a lipid dissolved in a lipid solution containing ethanol with an mRNA dissolved in an aqueous mRNA solution. In some embodiments, in step (a), the one or more lipids include one or more cationic lipids, one or more helper lipids, and one or more PEG-modified lipids (also referred to as PEG lipids). In some embodiments, the lipid also includes one or more cholesterol lipids. The mRNA-LNP is formed by mixing the lipid solution and the mRNA solution. Thus, in some embodiments, the LNP includes one or more cationic lipids, one or more helper lipids, and one or more PEG lipids. In some embodiments, the LNP also includes one or more cholesterol lipids.

[0012] In some embodiments, the one or more cationic lipids are selected from the group consisting of cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole-based), HGT5000, HGT5001, HGT4003, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA and DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), N1GL, N2GL, V1GL and combinations thereof.

[0013] In some embodiments, one or more cationic lipids are amino lipids. Amino lipids suitable for use in the present invention include those described in WO2017180917, which is incorporated herein by reference. Exemplary amino lipids in WO2017180917 include those described in paragraph

[0744] such as DLin-MC3-DMA (MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine (L608), and Compound 18. Other amino lipids include Compound 2, Compound 23, Compound 27, Compound 10, and Compound 20. Further amino lipids suitable for use in the present invention include those described in WO2017112865, which is incorporated herein by reference. Exemplary amino lipids in WO2017112865 include compounds according to one of formula (I), (Ial)-(Ia6), (Ib), (II), (Ila), (III), (Ilia), (IV), (17-1), (19-1), (19-11), and (20-1), and compounds in paragraphs

[0185] ,

[0201] ,

[0276] . In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118725, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL22 and KL25. In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118724, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL10, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and KL25.

[0014] In some embodiments, one or more non-cationic lipids are selected from DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine), DPPC (1,2-dipalmitoyl-sn-glycero-3-phosphocholine), DOPE (1,2-dioleoyl-sn-glycero-3-phosphoethanolamine), DOPC (1,2-dioleoyl-sn-glycero-3-phosphocholine), DPPE (1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine), DMPE (1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine), DOPG (1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol)).

[0015] In some embodiments, one or more PEG-modified lipids comprise a poly(ethylene) glycol chain up to 5 kDa in length covalently attached to a lipid having an alkyl chain of 6 - 20 length.

[0016] In some embodiments, after step (a), the mRNA-LNP is purified by a tangential flow filtration (TFF) process. In some embodiments, about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified mRNA-LNP has a size of less than about 150 nm (e.g., less than about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments, substantially all of the purified mRNA-LNP has a size of less than 150 nm (e.g., less than about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, about 80 nm, about 75 nm, about 70 nm, about 65 nm, about 60 nm, about 55 nm, or about 50 nm). In some embodiments, more than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified mRNA-LNP has a size in the range of 50-150 nm. In some embodiments, substantially all of the purified mRNA-LNP has a size in the range of 50-150 nm. In some embodiments, more than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified mRNA-LNP has a size in the range of 80-150 nm. In some embodiments, substantially all of the purified nanoparticles have a size in the range of 80-150 nm.

[0017] In some embodiments, the process according to the present invention results in an encapsulation efficiency after step (c) that is improved by at least 5% or more compared to the encapsulation efficiency after step (b). In some embodiments, the process according to the present invention results in an encapsulation efficiency after step (c) that is improved by at least 10% or more compared to the encapsulation efficiency after step (b). In some embodiments, the process according to the present invention results in an encapsulation efficiency after step (c) that is improved by at least 15% or more compared to the encapsulation efficiency after step (b). In some embodiments, the process according to the present invention results in an encapsulation efficiency after step (c) that is improved by at least 20% or more compared to the encapsulation efficiency after step (b). In some embodiments, the process according to the present invention results in an encapsulation efficiency after step (c) that is improved by at least 25% or more compared to the encapsulation efficiency after step (b).

[0018] In some embodiments, the process according to the present invention improves the encapsulation amount by 5% or more from the encapsulation after step (b) to the encapsulation after step (c). In some embodiments, the process according to the present invention improves the encapsulation amount by 10% or more from the encapsulation after step (b) to the encapsulation after step (c). In some embodiments, the process according to the present invention improves the encapsulation amount by 15% from the encapsulation after step (b) to the encapsulation after step (c). In some embodiments, the process according to the present invention improves the encapsulation amount by 20% from the encapsulation after step (b) to the encapsulation after step (c). In some embodiments, the process according to the present invention improves the encapsulation amount by 25% from the encapsulation after step (b) to the encapsulation after step (c).

[0019] In some embodiments, the process according to the present invention results in a recovery of more than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mRNA after step (c).

[0020] In some embodiments, the process according to the invention results in an encapsulation efficiency after step (c) of greater than about 90%, 95%, 96%, 97%, 98%, or 99%. In some embodiments, the process according to the invention results in a recovery of greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mRNA after step (c). results in a recovery of greater than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mRNA after step (c).

[0021] In some embodiments, the lipid solution and the mRNA solution are mixed using a pump system. In some embodiments, the pump system includes a pulse-free flow pump. In some embodiments, the pump system is a gear pump. In some embodiments, a suitable pump is a peristaltic pump. In some embodiments, a suitable pump is a centrifugal pump. In some embodiments, the process using the pump system is carried out on a large scale. For example, in some embodiments, the process uses the pumps described herein to mix a solution of at least about 1 mg, 5 mg, 10 mg, 50 mg, 100 mg, 500 mg, or 1000 mg of mRNA with a lipid solution comprising one or more cationic lipids, one or more helper lipids, and one or more PEG-modified lipids. In some embodiments, the process of mixing the lipid solution and the mRNA provides a composition according to the invention containing at least about 1 mg, 5 mg, 10 mg, 50 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA after step (c).

[0022] In some embodiments, the lipid solution is mixed at a flow rate in the range of about 25 to 75 ml / min, about 75 to 200 ml / min, about 200 to 350 ml / min, about 350 to 500 ml / min, about 500 to 650 ml / min, about 650 to 850 ml / min, or about 850 to 1000 ml / min. In some embodiments, the lipid solution is mixed at a flow rate of about 50 ml / min, about 100 ml / min, about 150 ml / min, about 200 ml / min, about 250 ml / min, about 300 ml / min, about 350 ml / min, about 400 ml / min, about 450 ml / min, about 500 ml / min, about 550 ml / min, about 600 ml / min, about 650 ml / min, about 700 ml / min, about 750 ml / min, about 800 ml / min, about 850 ml / min, about 900 ml / min, about 950 ml / min, or about 1000 ml / min.

[0023] In some embodiments, the mRNA solution is mixed at a flow rate in the range of about 25 to 75 ml / min, about 75 to 200 ml / min, about 200 to 350 ml / min, about 350 to 500 ml / min, about 500 to 650 ml / min, about 650 to 850 ml / min, or about 850 to 1000 ml / min. In some embodiments, the mRNA solution is mixed at a flow rate of about 50 ml / min, about 100 ml / min, about 150 ml / min, about 200 ml / min, about 250 ml / min, about 300 ml / min, about 350 ml / min, about 400 ml / min, about 450 ml / min, about 500 ml / min, about 550 ml / min, about 600 ml / min, about 650 ml / min, about 700 ml / min, about 750 ml / min, about 800 ml / min, about 850 ml / min, about 900 ml / min, about 950 ml / min, or about 1000 ml / min.

[0024] In some embodiments, the lipid solution contains a non-aqueous solvent such as an organic solvent. In some embodiments, the lipid solution contains alcohol. In some embodiments, the lipid solution contains ethanol. In some embodiments, the process according to the present invention includes the step of first dissolving the lipid or itself in the lipid solution. In some embodiments, the process according to the present invention includes the step of first dissolving the lipid or itself in a lipid solution containing ethanol.

[0025] In some embodiments, the mRNA solution is an aqueous solution. In some embodiments, the mRNA solution contains citrate. In some embodiments, the mRNA solution is a citrate buffer. In some embodiments, the process according to the present invention includes a step of first dissolving mRNA in an aqueous solution. In some embodiments, the process according to the present invention includes a step of first dissolving mRNA in an aqueous solution containing citrate.

[0026] In some embodiments, the process according to the present invention is a lipid solution containing lipids in ethanol and mixing it with an mRNA buffer containing mRNA dissolved in a citrate buffer. In some embodiments, the LNP forming solution contains ethanol and citrate.

[0027] In some embodiments, the process according to the present invention includes a step of first generating an mRNA solution by mixing a citrate buffer with an mRNA stock solution. In certain embodiments, a suitable citrate buffer contains about 10 mM citrate, about 150 mM NaCl, and a pH of about 4.5. In some embodiments, a suitable mRNA stock solution contains mRNA at a concentration of about 1 mg / ml, about 10 mg / ml, about 50 mg / ml, or about 100 mg / ml or higher.

[0028] In some embodiments, the citrate buffer is mixed at a flow rate in the range of about 100 - 300 ml / min, 300 - 600 ml / min, 600 - 1200 ml / min, 1200 - 2400 ml / min, 2400 - 3600 ml / min, 3600 - 4800 ml / min, or 4800 - 6000 ml / min. In some embodiments, the citrate buffer is mixed at a flow rate of about 220 ml / min, about 600 ml / min, about 1200 ml / min, about 2400 ml / min, about 3600 ml / min, about 4800 ml / min, or about 6000 ml / min.

[0029] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range of about 10 to 30 ml / min, about 30 to 60 ml / min, about 60 to 120 ml / min, about 120 to 240 ml / min, about 240 to 360 ml / min, about 360 to 480 ml / min, or about 480 to 600 ml / min. In some embodiments, the mRNA stock solution is mixed at a flow rate of about 20 ml / min, about 40 ml / min, about 60 ml / min, about 80 ml / min, about 100 ml / min, about 200 ml / min, about 300 ml / min, about 400 ml / min, about 500 ml / min, or about 600 ml / min.

[0030] In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, cryoprotectants. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, sugars. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, one or more of trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, in step (b), the pharmaceutical formulation solution contains trehalose. In some embodiments, in step (b), the pharmaceutical formulation solution contains sucrose. In some embodiments, in step (b), the pharmaceutical formulation solution contains mannose. In some embodiments, in step (b), the pharmaceutical formulation solution contains lactose. In some embodiments, in step (b), the pharmaceutical formulation solution contains mannitol. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing 5 wt / vol% to 20 wt / vol% of sugars such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing 5 wt / vol% to 20 wt / vol% of trehalose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing 5 wt / vol% to 20 wt / vol% of sucrose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing 5 wt / vol% to 20 wt / vol% of mannose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing 5 wt / vol% to 20 wt / vol% of lactose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing 5 wt / vol% to 20 wt / vol% of mannitol. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing about 10 wt / vol% of sugars such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, In step (b), the pharmaceutical formulation solution is an aqueous solution containing about 10% w / v trehalose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing about 10% w / v sucrose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing about 10% w / v mannose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing about 10% w / v lactose. In some embodiments, in step (b), the pharmaceutical formulation solution is an aqueous solution containing about 10% w / v mannitol.

[0031] In some embodiments, one or both of the non-aqueous solvent such as ethanol and the citrate are not present in the pharmaceutical formulation solution (i.e., below detectable levels). In some embodiments, the citrate is not present in the pharmaceutical formulation solution (i.e., below detectable levels). In some embodiments, ethanol is not present in the pharmaceutical formulation solution (i.e., below detectable levels). In some embodiments, the pharmaceutical formulation solution contains ethanol but does not contain citrate (i.e., below detectable levels). In some embodiments, the pharmaceutical formulation solution contains citrate but does not contain ethanol (i.e., below detectable levels). In some embodiments, the pharmaceutical formulation solution contains only residual citrate. In some embodiments, the pharmaceutical formulation solution contains only residual non-aqueous solvent such as ethanol. In some embodiments, the pharmaceutical formulation solution contains less than 10 mM (e.g., less than about 9 mM, about 8 mM, about 7 mM, about 6 mM, about 5 mM, about 4 mM, about 3 mM, about 2 mM, or about 1 mM) of citrate. In some embodiments, the pharmaceutical formulation solution contains less than about 25% (e.g., less than about 20%, about 15%, about 10%, about 5%, about 4%, about 3%, about 2%, or about 1%) of non-aqueous solvent such as ethanol. In some embodiments, the pharmaceutical formulation solution does not require any further downstream processing (e.g., buffer exchange and / or further purification steps) prior to lyophilization. In some embodiments, the pharmaceutical formulation solution does not require any further downstream processing (e.g., buffer exchange and / or further purification steps) prior to administration to a subject.

[0032] In some embodiments, the pharmaceutical formulation solution has a pH of from pH 4.5 to pH 7.5. In some embodiments, the pharmaceutical formulation solution has a pH of from pH 5.0 to pH 7.0. In some embodiments, the pharmaceutical formulation solution has a pH of from pH 5.5 to pH 7.0. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 4.5. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 5.0. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 5.5. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 6.0. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 6.5.

[0033] In some embodiments, the present invention is used to encapsulate mRNA comprising one or more modified nucleotides. In some embodiments, one or more nucleotides are modified to pseudouridine. In some embodiments, one or more nucleotides are modified to 5-methylcytidine. In some embodiments, the present invention is used to encapsulate unmodified mRNA.

[0034] In yet another aspect, the present invention provides a method for delivering mRNA for in vivo protein production, comprising administering to a subject a composition of lipid nanoparticles encapsulating mRNA produced by the process described herein, wherein the mRNA encodes one or more proteins or peptides of interest.

[0035] In this application, the use of "or" means "and / or" unless stated otherwise. As used in this disclosure, the terms "comprise", as well as "comprising" and "comprises" Variant forms of the terms are not intended to exclude other additives, ingredients, integers, or steps. As used in this application, the terms "about" and "approximately" are used as equivalents. Both terms are meant to cover any normal variation understood by a person skilled in the art.

[0036] Other features, objects, and advantages of the present invention will become apparent from the following detailed description of the invention, the drawings, and the claims. However, it should be understood that the following detailed description of the invention, the drawings, and the claims illustrate embodiments of the present invention but are not limiting and are given by way of example only. Various changes and modifications within the scope of the present invention will be apparent to those skilled in the art.

[0037] The drawings are for illustrative purposes only and not for limitation.

Brief Description of the Drawings

[0038]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Mode for Carrying Out the Invention

[0039] Definitions For the present invention to be more readily understood, certain terms are first defined below. Additional definitions for the following terms and other terms are set forth throughout the specification.

[0040] Alkyl: As used herein, "alkyl" refers to a radical of a straight-chain or branched saturated hydrocarbon group having from 1 to 20 carbon atoms ("C 1-20 alkyl"). In some embodiments, the alkyl group has from 1 to 3 carbon atoms ("C 1-3 alkyl"). Examples of C 1-3 alkyl groups include methyl (C 1 ), ethyl ((C 2 )), n-propyl (C 3 ), and isopropyl (C 3 ). In some embodiments, the alkyl group has from 8 to 12 carbon atoms (C 8-12 alkyl). Examples of C 8-12 alkyl groups include, without limitation, n-octyl (C 8 ), n-nonyl (C 9 ), n-decyl (C 10 ), n-undecyl (C 11 ), n-dodecyl (C 12 ), etc. The prefix "n-" (straight-chain) refers to an unbranched alkyl group. For example, n-C 8 alkyl refers to -(CH 2 ) 7 CH 3 and n-C 10 alkyl refers to -(CH 2 )9 CH 3 etc.

[0041] Amino acid: As used herein, the term "amino acid" refers, in its broadest sense, to any compound and / or substance that can be incorporated into a polypeptide chain. In some embodiments, an amino acid has the general structure H 2 N-C(H)(R)-COOH. In some embodiments, the amino acid is a naturally occurring amino acid. In some embodiments, the amino acid is a synthetic amino acid, in some embodiments, the amino acid is a d-amino acid, and in some embodiments, the amino acid is an l-amino acid. "Standard amino acid" refers to any of the standard l-amino acids commonly found in naturally occurring peptides. "Non-standard amino acid" refers to any amino acid other than a standard amino acid, whether prepared synthetically or obtained from natural sources. As used herein, "synthetic amino acid" includes salts, amino acid derivatives (such as amides), and / or chemically modified amino acids including, but not limited to, substitutions. Amino acids that include the carboxy-terminal amino acid and / or the amino-terminal amino acid in a peptide may be modified by substitution with a methyl group, an amide group, an acetyl group, a protecting group, and / or other chemical groups that can change the circulating half-life of the peptide without adversely affecting their activity. Amino acids can participate in disulfide bonds. Amino acids can include one or more post-translational modifications such as association with one or more chemical entities (e.g., methyl group, acetic acid group, acetyl group, phosphate group, formyl moiety, isoprenoid group, sulfate group, polyethylene glycol moiety, lipid moiety, carbohydrate moiety, biotin moiety, etc.). The term "amino acid" is used interchangeably with "amino acid residue" and can refer to free amino acids and / or amino acid residues of a peptide. Whether the term refers to a free amino acid or a residue of a peptide will be apparent from the context in which it is used.

[0042] Animal: As used herein, the term "animal" refers to any member of the animal kingdom. In some embodiments, "animal" refers to a human at any stage of development. In some embodiments, "animal" refers to a non-human animal at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g., rodent, mouse, rat, rabbit, monkey, dog, cat, sheep, cow, primate, and / or pig). In some embodiments, the animal includes, but is not limited to, mammals, birds, reptiles, amphibians, fish, insects, and / or parasites. In some embodiments, the animal can be a transgenic animal, a genetically engineered animal, and / or a clone.

[0043] Approximately or about: As used herein, the term "approximately" or "about" when applied to one or more values of interest refers to a value that is similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values in either direction (greater than or less than) of the stated reference value by 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less, unless otherwise specified or otherwise apparent from the context (except when such numbers exceed 100% of the possible values).

[0044] Delivery: As used herein, the term "delivery" encompasses both local delivery and systemic delivery. For example, delivery of mRNA includes situations where the mRNA is delivered to a target tissue and the encoded protein or peptide is expressed and retained within the target tissue (also referred to as "local distribution" or "local delivery"), and situations where the mRNA is delivered to a target tissue and the encoded protein or peptide is expressed and secreted into the patient's circulatory system (e.g., serum), distributed throughout the body, and taken up by other tissues (also referred to as "systemic distribution" or "systemic delivery").

[0045] Efficacy: As used herein, the term "efficacy" or grammatical equivalents thereof refers to an improvement in a biologically relevant endpoint related to the delivery of mRNA encoding a relevant protein or peptide. In some embodiments, the biological endpoint is protection against ammonium chloride load at a particular time point after administration.

[0046] Encapsulation: As used herein, the term "encapsulation" or grammatical equivalents thereof refers to the process of confining individual mRNA molecules within a nanoparticle.

[0047] Expression: As used herein, "expression" of mRNA refers to the translation of mRNA into a peptide (e.g., an antigen), polypeptide, or protein (e.g., an enzyme), and may also include post-translational modification of the peptide, polypeptide, or fully assembled protein (e.g., an enzyme) as indicated by the context. In this application, the terms "expression" and "production," and grammatical equivalents thereof, are used interchangeably.

[0048] Improve, increase, or decrease: As used herein, the terms "improve," "increase," or "decrease," or grammatical equivalents thereof, refer to a value relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control sample or subject (or multiple control samples or subjects) in which the treatment described herein is absent. A "control sample" is a sample that is subjected to the same conditions as the test sample, except for the test article. A "control subject" is a subject that has the same disease form as the treated subject and is approximately the same age as the treated subject.

[0049] Impurity: As used herein, the term "impurity" refers to a substance in a limited amount of liquid, gas, or solid that is different from the chemical composition of the target substance or compound. Impurities are also referred to as contaminants.

[0050] In vitro: As used herein, the term "in vitro" refers to events that occur in an artificial environment, such as in a test tube or reaction vessel, under cell culture, rather than within a multicellular organism.

[0051] In vivo: As used herein, the term "in vivo" refers to events that occur within multicellular organisms such as humans and non-human animals. In the context of cell-based systems, this term can be used to refer to events that occur within living cells (e.g., as contrasted with in vitro systems).

[0052] Isolated: As used herein, the term "isolated" refers to (1) being separated from at least some of the components with which it was associated when first produced (regardless of the natural and / or experimental environment), and / or (2) a substance and / or entity that has been artificially produced, prepared, and / or manufactured. Isolated substances and / or entities can be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated. In some embodiments, the isolated agent is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is "pure" when it is substantially free of other components. As used herein, the calculation of the percent purity of an isolated substance and / or entity should not include excipients (e.g., buffers, solvents, water, etc.).

[0053] Local distribution or local delivery: As used herein, the terms "local distribution", "local delivery", or grammatical equivalents refer to tissue-specific delivery or distribution. Typically, local distribution or local delivery requires that a peptide or protein (e.g., an enzyme) encoded by an mRNA be translated and expressed with limited secretion that avoids entry into the patient's circulatory system or occurs intracellularly.

[0054] Messenger RNA (mRNA): As used herein, the term "messenger RNA (mRNA)" refers to a polynucleotide that encodes at least one peptide, polypeptide, or protein. The mRNA used herein encompasses both modified and unmodified RNA. The mRNA may include one or more coding regions and non-coding regions. The mRNA may be purified from a natural source, produced using a recombinant expression system, and optionally purified, chemically synthesized, etc. As needed, for example, in the case of chemically synthesized molecules, the mRNA may include nucleoside analogs such as chemically modified bases or sugars, backbone modifications, etc. The mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, the mRNA is a natural nucleoside (e.g., adenosine, guanosine, cytidine, uridine), a nucleoside analog (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, pseudouridine, and 5-methylcytidine), a chemically modified base, a biologically modified base (e.g., a methylated base), an intercalated base, a modified sugar (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose), and / or a modified phosphate group (e.g., phosphorothioate and 5'-N-phosphoramidite linkages), or includes the same.

[0055] Nucleic acid: As used herein, the term "nucleic acid" refers, in its broadest sense, to any compound and / or substance that can be incorporated into, or can be incorporated into, a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that can be incorporated into, or can be incorporated into, a polynucleotide chain via a phosphodiester bond. In some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, "nucleic acid" refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, "nucleic acid" encompasses RNA, as well as single-stranded and / or double-stranded DNA and / or cDNA. Further, the terms "nucleic acid", "DNA", "RNA", and / or similar terms include nucleic acid analogs, i.e., analogs having other than a phosphodiester backbone.

[0056] Patient: As used herein, the term "patient" or "subject" refers to any organism to which a provided composition can be administered, for example, for experimental, diagnostic, prophylactic, cosmetic, and / or therapeutic purposes. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. Humans include prenatal and postnatal forms.

[0057] Pharmaceutically acceptable: As used herein, the term "pharmaceutically acceptable" refers to substances suitable for use in contact with human and animal tissues within the scope of sound medical judgment, without undue toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0058] Pharmaceutically acceptable salts: Pharmaceutically acceptable salts are well known in the art. For example, S.M. Berge et al. have described pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic acids and organic acids as well as inorganic bases and organic bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or with organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid or are salts of amino groups formed by ion exchange or other methods used in the art such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, etc. Salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts, and N + (C 1-4 alkyl) 4It contains salts. Representative alkali metal salts or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Further pharmaceutically acceptable salts, where appropriate, include non-toxic ammonium cations, quaternary ammonium cations, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, sulfonates, and arylsulfonates. Further pharmaceutically acceptable salts include salts formed from the quaternization of amines using appropriate electrophiles, such as alkyl halides for forming quaternized alkylated amino salts.

[0059] Efficacy: As used herein, the term "efficacy" or grammatical equivalents refers to the expression of the protein or peptide encoded by the mRNA and / or the resulting biological effect.

[0060] Salt: As used herein, the term "salt" refers to an ionic compound that results from, or can result from, a neutralization reaction between an acid and a base.

[0061] Systemic distribution or systemic delivery: As used herein, the terms "systemic distribution", "systemic delivery", or grammatical equivalents refer to a delivery or distribution mechanism or approach that affects the whole body or organism. Typically, systemic distribution or systemic delivery is accomplished via the body's circulatory system, e.g., the bloodstream. Compare with the definition of "local distribution or delivery".

[0062] Subject: As used herein, the term "subject" refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cow, pig, sheep, horse, or primate). Humans include pre-birth and post-birth forms. In many embodiments, the subject is a human. The subject can be a patient, which refers to a human who presents to a healthcare provider for diagnosis or treatment of a disease. The term "subject" is used interchangeably herein with "individual" or "patient". A subject can be affected by, or be susceptible to, a disease or disorder, and may or may not exhibit symptoms of the disease or disorder.

[0063] Substantially: As used herein, the term "substantially" refers to a qualitative state that exhibits all or almost all of the range or degree of a targeted feature or characteristic. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, complete and / or come to completion, or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0064] Target tissue: As used herein, the term "target tissue" refers to any tissue affected by the disease being treated. In some embodiments, the target tissue includes those tissues that exhibit a pathology, symptom, or characteristic associated with the disease. As used herein, the term "target tissue" refers to any tissue affected by the disease being treated. In some embodiments, the target tissue includes those tissues that exhibit a pathology, symptom, or characteristic associated with the disease.

[0065] Treat: As used herein, the terms "treat", "treatment", or "treating" refer to any method used to partially or completely alleviate, ameliorate, reduce, suppress, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a particular disease, disorder, and / or condition. Treatment can be administered to a subject who does not exhibit signs of the disease and / or exhibits only early signs of the disease for the purpose of reducing the risk of developing the pathology associated with that disease.

[0066] Yield: As used herein, the term "yield" refers to the percentage of mRNA recovered after encapsulation, compared to the total mRNA as starting material. In some embodiments, the term "recovery" is used interchangeably with the term "yield".

[0067] The present invention provides lipid nanoparticle formulations and an improved process for mRNA encapsulation. In some embodiments, the present invention provides a process for encapsulating messenger RNA (mRNA) in lipid nanoparticles, comprising: (a) mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution to form mRNA encapsulated within lipid nanoparticles (mRNA-LNP) in an LNP-forming solution; (b) exchanging the LNP-forming solution with a pharmaceutical formulation solution to provide the mRNA-LNP in the pharmaceutical formulation solution; and (c) heating the mRNA-LNP in the pharmaceutical formulation solution. Surprisingly, it has been found that the inclusion of step (c) in this process provides significantly higher encapsulation of the mRNA-LNP compared to the encapsulation of the same mRNA-LNP after step (b).

[0068] In some embodiments, the novel formulation process results in mRNA formulations that potentially have better tolerability, higher efficacy (peptide or protein expression), and higher effectiveness (improvement of biologically relevant endpoints) in both in vitro and in vivo compared to the same mRNA formulation adjusted without the additional step of heating the mRNA-LNP in the pharmaceutical formulation solution (step (c)). The higher efficacy and / or effectiveness of such formulations may provide for lower dosages and / or less frequent administrations of the pharmaceutical. In some embodiments, the present invention features an improved lipid formulation comprising a cationic lipid, a helper lipid, and a PEG-modified lipid.

[0069] In some embodiments, the resulting encapsulation for the mRNA-LNP after step (c) is increased by 10% or more relative to the encapsulation efficiency for the same mRNA-LNP after step (b). In some embodiments, the resulting percentage of encapsulation for the mRNA-LNP after step (c) is increased by 5 percentage points or more relative to the percentage of encapsulation for the same mRNA-LNP after step (b). Achieving high encapsulation efficiency is important for protecting the drug substance and reducing loss of activity in vivo for nucleic acid delivery.

[0070] Various aspects of the present invention are described in detail in the following sections. The use of the sections is not meant to limit the present invention. Each section can be applied to any aspect of the present invention.

[0071] Messenger RNA (mRNA) The present invention can be used to encapsulate any mRNA. mRNA is generally considered a type of RNA that carries information from DNA to ribosomes. Typically, in eukaryotes, mRNA processing involves adding a "cap" to the 5' end and polyadenylating the 3' end. A typical cap is the 7-methylguanosine cap, which is guanosine linked via a 5'-5'-triphosphate bound to the first transcribed nucleotide. The presence of the cap is important for providing resistance to nucleases found in most eukaryotic cells. The addition of the tail is typically the polyadenylation phenomenon, by which a polyadenylyl moiety is added to the 3' end of the mRNA molecule. The presence of this "tail" helps protect the mRNA from exonucleolytic degradation. Messenger RNA is translated by ribosomes into a series of amino acids that make up a protein.

[0072] mRNA can be synthesized according to any of a variety of known methods. For example, the mRNA according to the present invention can be synthesized via in vitro transcription (IVT). Briefly, IVT typically involves a buffer system that can contain a promoter, a pool of ribonucleotide triphosphates, DTT and magnesium ions, as well as an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or an RNAse inhibitor, using a linear or circular DNA template. Exact conditions will vary according to the specific application.

[0073] In some embodiments, the in vitro synthesized mRNA can be purified prior to formulation and encapsulation to remove undesirable impurities including various enzymes and other reagents used during mRNA synthesis.

[0074] The present invention can be used to formulate and encapsulate mRNAs of various lengths. In some embodiments, the present invention is used to formulate and encapsulate in vitro synthesized mRNAs that are about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, 15 kb, or longer than 20 kb in length. In some embodiments, the present invention is used to formulate and encapsulate in vitro synthesized mRNAs in the range of about 1 - 20 kb, about 1 - 15 kb, about 1 - 10 kb, about 5 - 20 kb, about 5 - 15 kb, about 5 - 12 kb, about 5 - 10 kb, about 8 - 20 kb, or about 8 - 15 kb in length.

[0075] The present invention can be used to formulate and encapsulate unmodified mRNA, or mRNA containing one or more modifications that typically enhance stability. In some embodiments, the modifications are selected from modified nucleotides, modified sugar phosphate backbones, and 5' and / or 3' untranslated regions.

[0076] In some embodiments, the modification of mRNA can include the modification of nucleotides of the RNA. The modified mRNA according to the present invention can include, for example, backbone modification, sugar modification, or base modification. In some embodiments, the mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides) including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), for example, 1-methyladenine, 2-methyladenine, 2-methylthio-N6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid Methyl esters, 5-methylaminomethyl-uracil, 5-methoxymethylamino-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, methyl uracil-5-oxyacetate, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queuosine, beta-D-mannosyl-queuosine, wybutoxosine, and phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, pseudouridine, 5-methylcytidine and inosine and other purines and pyrimidines may be synthesized as modified nucleotide analogs or derivatives. The preparation of such analogs is known to those skilled in the art from, for example, U.S. Patent No. 4,373,071, U.S. Patent No. 4,401,796, U.S. Patent No. 4,415,732, U.S. Patent No. 4,458,066, U.S. Patent No. 4,500,707, U.S. Patent No. 4,668,777, U.S. Patent No. 4,973,679, U.S. Patent No. 5,047,524, U.S. Patent No. 5,132,418, U.S. Patent No. 5,153,319, U.S. Patent No. 5,262,530, and U.S. Patent No. 5,700,642, the disclosures of which are hereby incorporated by reference in their entireties.

[0077] Typically, mRNA synthesis involves the addition of a "cap" to the 5' end and a "tail" to the 3' end. The presence of the cap is important for providing resistance to nucleases found in most eukaryotic cells. The presence of the "tail" serves to protect the mRNA from exonucleolytic degradation.

[0078] Thus, in some embodiments, the mRNA comprises a 5' cap structure. The 5' cap is typically added as follows: First, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide leaving two terminal phosphates, then guanosine triphosphate (GTP) is added to the terminal phosphate via guanylyl transferase to yield a 5'5'5 triphosphate linkage, and then the 7-nitrogen of guanine is methylated by a methyl transferase. 2'-O-methylation can also occur at the first and / or second base after the 7-methylguanosine triphosphate residue. Examples of cap structures include, but are not limited to, m7GpppNp-RNA, m7GpppNmp-RNA and m7GpppNmpNmp-RNA, where m represents a 2'-O-methyl residue.

[0079] In some embodiments, the mRNA comprises a 5' and / or 3' untranslated region. In some embodiments, the 5' untranslated region comprises one or more elements that affect the stability or translation of the mRNA, such as an iron-responsive element. In some embodiments, the 5' untranslated region can be about 50 to 500 nucleotides in length.

[0080] In some embodiments, the 3' untranslated region comprises one or more of a polyadenylation signal, a binding site for a protein that affects the positional stability of the mRNA in the cell, or one or more binding sites for miRNA. In some embodiments, the 3' untranslated region can be 50 to 500 nucleotides or more in length.

[0081] While mRNA resulting from in vitro transcription reactions may be desirable in some embodiments, other sources of mRNA, including mRNA produced from bacteria, fungi, plants, and / or animals, are intended to be within the scope of the present invention.

[0082] The present invention can be used to formulate and encapsulate mRNAs encoding various proteins. Non-limiting examples of mRNAs suitable for the present invention include mRNAs encoding spinal motor neuron 1 (SMN), alpha-galactosidase (GLA), argininosuccinate synthetase (ASS1), ornithine transcarbamylase (OTC), factor IX (FIX), phenylalanine hydroxylase (PAH), erythropoietin (EPO), cystic fibrosis transmembrane conductance receptor (CFTR), and firefly luciferase (FFL). Exemplary mRNA sequences disclosed herein are listed below: Codon-optimized human OTC coding sequence Codon-optimized human ASS1 coding sequence AUGAGCAGCAAGGGCAGCGUGGUGCUGGCCUACAGCGGCGGCCUGGACACCAGCUGCAUCCUGGUGUGGCUGAAGGAGCAGGGCUACGACGUGAUCGCCUACCUGGCCAACAUCGGCCAGAAGGAGGACUUCGAGGAGGCCCGCAAGAAGGCCCUGAAGCUGGGCGCCAAGAAGGUGUUCAUCGAGGACGUGAGCCGCGAGUUCGUGGAGGAGUUCAUCUGGCCCGCCAUCCAGAGCAGCGCCCUGUACGAGGACCGCUACCUGCUGGGCACCAGCCUGGCCCGCCCCUGCAUCGCCCGCAAGCAGGUGGAGAUCGCCCAGCGCGAGGGCGCCAAGUACGUGAGCCACGGCGCCACCGGCAAGGGCAACGACCAGGUGCGCUUCGAGCUGAGCUGCUACAGCCUGGCCCCCCAGAUCAAGGUGAUCGCCCCCUGGCGCAUGCCCGAGUUCUACAACCGCUUCAAGGGCCGCAACGACCUGAUGGAGUACGCCAAGCAGCACGGCAUCCCCAUCCCCGUGACCCCCAAGAACCCCUGGAGCAUGGACGAGAACCUGAUGCACAUCAGCUACGAGGCCGGCAUCCUGGAGAACCCCAAGAACCAGGCCCCCCCCGGCCUGUACACCAAGACCCAGGACCCCGCCAAGGCCCCCAACACCCCCGACAUCCUGGAGAUCGAGUU CAAGAAGGGCGUGCCCGUGAAGGUGACCAACGUGAAGGACGGCACCACCCACCAGACCAGCCUGGAGCUGUUCAUGUACCUGAACGAGGUGGCCGGCAAGCACGGCGUGGGCCGCAUCGACAUCGUGGAGAACCGCUUCAUCGGCAUGAAGAGCCGCGGCAUCUACGAGACCCCCGCCGGCACCAUCCUGUACCACGCCCACCUGGACAUCGAGGCCUUCACCAUGGACCGCGAGGUGCGCAAGAUCAAGCAGGGCCUGGGCCUGAAGUUCGCCGAGCUGGUGUACACCGGCUUCUGGCACAGCCCCGAGUGCGAGUUCGUGCGCCACUGCAUCGCCAAGAGCCAGGAGCGCGUGGAGGGCAAGGUGCAGGUGAGCGUGCUGAAGGGCCAGGUGUACAUCCUGGGCCGCGAGAGCCCCCUGAGCCUGUACAACGAGGAGCUGGUGAGCAUGAACGUGCAGGGCGACUACGAGCCCACCGACGCCACCGGCUUCAUCAACAUCAACAGCCUGCGCCUGAAGGAGUACCACCGCCUGCAGAGCAAGGUGACCGCCAAGUGA (SEQ ID NO: 2) Codon-optimized human CFTR coding sequence

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

Chem.

[0083] In some embodiments, the mRNA suitable for the present invention has a nucleotide sequence that is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4. In some embodiments, the mRNA suitable for the present invention comprises a nucleotide sequence identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, or SEQ ID NO: 4.

[0084] mRNA solution The mRNA can be provided in a solution to be mixed with a lipid solution such that the mRNA can be encapsulated in lipid nanoparticles. Suitable mRNA solutions can be any aqueous solution containing the mRNA to be encapsulated at various concentrations. For example, suitable mRNA solutions can be about 0.01 mg / ml, 0.05 mg / ml, 0.06 mg / ml, 0.07 mg / ml, 0.08 mg / ml, 0.09 mg / ml, 0.1 mg / ml, 0.15 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 It may contain mRNA at a concentration higher than mg / ml, 0.8 mg / ml, 0.9 mg / ml, or 1.0 mg / ml. In some embodiments, a suitable mRNA solution may contain mRNA at a concentration in the range of about 0.01 - 1.0 mg / ml, 0.01 - 0.9 mg / ml, 0.01 - 0.8 mg / ml, 0.01 - 0.7 mg / ml, 0.01 - 0.6 mg / ml, 0.01 - 0.5 mg / ml, 0.01 - 0.4 mg / ml, 0.01 - 0.3 mg / ml, 0.01 - 0.2 mg / ml, 0.01 - 0.1 mg / ml, 0.05 - 1.0 mg / ml, 0.05 - 0.9 mg / ml, 0.05 - 0.8 mg / ml, 0.05 - 0.7 mg / ml, 0.05 - 0.6 mg / ml, 0.05 - 0.5 mg / ml, 0.05 - 0.4 mg / ml, 0.05 - 0.3 mg / ml, 0.05 - 0.2 mg / ml, 0.05 - 0.1 mg / ml, 0.1 - 1.0 mg / ml, 0.2 - 0.9 mg / ml, 0.3 - 0.8 mg / ml, 0.4 - 0.7 mg / ml, or 0.5 - 0.6 mg / ml. In some embodiments, a suitable mRNA solution may contain mRNA at a concentration of up to about 5.0 mg / ml, 4.0 mg / ml, 3.0 mg / ml, 2.0 mg / ml, 1.0 mg / ml, 0.09 mg / ml, 0.08 mg / ml, 0.07 mg / ml, 0.06 mg / ml, or 0.05 mg / ml.

[0085] Typically, a suitable mRNA solution may also contain a buffer and / or a salt. Generally, buffers may include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. In some embodiments, suitable concentrations of the buffer may range from about 0.1 mM - 100 mM, 0.5 mM - 90 mM, 1.0 mM - 80 mM, 2 mM - 70 mM, 3 mM - 60 mM, 4 mM - 50 mM, 5 mM - 40 mM, 6 mM - 30 mM, 7 mM - 20 mM, 8 mM - 15 mM, or 9 - 12 mM. In some embodiments, suitable concentrations of the buffer may be about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM or more.

[0086] Exemplary salts can include sodium chloride, magnesium chloride, and potassium chloride. In some embodiments, suitable concentrations of salts in the mRNA solution can range from about 1 mM to 500 mM, 5 mM to 400 mM, 10 mM to 350 mM, 15 mM to 300 mM, 20 mM to 250 mM, 30 mM to 200 mM, 40 mM to 190 mM, 50 mM to 180 mM, 50 mM to 170 mM, 50 mM to 160 mM, 50 mM to 150 mM, or 50 mM to 100 mM. Suitable salt concentrations in the mRNA solution are 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM or more.

[0087] In some embodiments, suitable mRNA solutions may have a pH in the range of about 3.5 to 6.5, 3.5 to 6.0, 3.5 to 5.5, 3.5 to 5.0, 3.5 to 4.5, 4.0 to 5.5, 4.0 to 5.0, 4.0 to 4.9, 4.0 to 4.8, 4.0 to 4.7, 4.0 to 4.6, or 4.0 to 4.5. In some embodiments, suitable mRNA solutions may have a pH of about 3.5, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.3, and 6.5 or less.

[0088] Various methods may be used to prepare an mRNA solution suitable for the present invention. In some embodiments, the mRNA may be directly dissolved in the buffer solution described herein. In some embodiments, the mRNA solution can be generated by mixing an mRNA stock solution with a buffer solution before mixing with the lipid solution for encapsulation. In some embodiments, the mRNA solution can be generated by mixing an mRNA stock solution with a buffer solution immediately prior to mixing with the lipid solution for encapsulation. In some embodiments, suitable mRNA stock solutions are about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0. It may contain mRNA in water at a concentration of 6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml or more.

[0089] In some embodiments, the mRNA solution is prepared by mixing the mRNA stock solution with a buffer solution using a pump. Exemplary pumps include, but are not limited to, gear pumps, peristaltic pumps, and centrifugal pumps. Typically, the buffer solution is mixed at a faster rate than that of the mRNA stock solution. For example, the buffer solution may be mixed at a rate that is at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, or 20-fold faster than the rate of the mRNA stock solution. In some embodiments, the buffer solution is mixed at a flow rate of about 100 - 6000 ml / min (e.g., about 100 - 300 ml / min, 300 - 600 ml / min, 600 - 1200 ml / min, 1200 - 2400 ml / min, 2400 - 3600 ml / min, 3600 - 4800 ml / min, 4800 - 6000 ml / min, or 60 - 420 ml / min). In some embodiments, the buffer solution is mixed at a flow rate of about 60 ml / min, 100 ml / min, 140 ml / min, 180 ml / min, 220 ml / min, 260 ml / min, 300 ml / min, 340 ml / min, 380 ml / min, 420 ml / min, 480 ml / min, 540 ml / min, 600 ml / min, 1200 ml / min, 2400 ml / min, 3600 ml / min, 4800 ml / min, or 6000 ml / min or more.

[0090] In some embodiments, the mRNA stock solution is mixed at a flow rate in the range of about 10 to 600 ml / min (e.g., about 5 to 50 ml / min, about 10 to 30 ml / min, about 30 to 60 ml / min, about 60 to 120 ml / min, about 120 to 240 ml / min, about 240 to 360 ml / min, about 360 to 480 ml / min, or about 480 to 600 ml / min). In some embodiments, the mRNA stock solution is mixed at a flow rate of about 5 ml / min, 10 ml / min, 15 ml / min, 20 ml / min, 25 ml / min, 30 ml / min, 35 ml / min, 40 ml / min, 45 ml / min, 50 ml / min, 60 ml / min, 80 ml / min, 100 ml / min, 200 ml / min, 300 ml / min, 400 ml / min, 500 ml / min, or 600 ml / min or more.

[0091] Lipid solution According to the present invention, the lipid solution contains a mixture of lipids suitable for forming lipid nanoparticles for encapsulation of mRNA. In some embodiments, the suitable lipid solution is ethanol-based. For example, the suitable lipid solution may contain a mixture of the desired lipids dissolved in pure ethanol (i.e., 100% ethanol). In another embodiment, the suitable lipid solution is isopropyl alcohol-based. In another embodiment, the suitable lipid solution is dimethyl sulfoxide-based. In another embodiment, the suitable lipid solution is a mixture of suitable solvents including, but not limited to, ethanol, isopropyl alcohol, and dimethyl sulfoxide.

[0092] Suitable lipid solutions may contain a mixture of desired lipids at various concentrations. For example, suitable lipid solutions may contain a mixture of desired lipids at a total concentration of about 0.1 mg / ml, 0.5 mg / ml, 1.0 mg / ml, 2.0 mg / ml, 3.0 mg / ml, 4.0 mg / ml, 5.0 mg / ml, 6.0 mg / ml, 7.0 mg / ml, 8.0 mg / ml, 9.0 mg / ml, 10 mg / ml, 15 mg / ml, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, or 100 mg / ml or more. In some embodiments, suitable lipid solutions may contain a mixture of desired lipids at a total concentration in the range of about 0.1 - 100 mg / ml, 0.5 - 90 mg / ml, 1.0 - 80 mg / ml, 1.0 - 70 mg / ml, 1.0 - 60 mg / ml, 1.0 - 50 mg / ml, 1.0 - 40 mg / ml, 1.0 - 30 mg / ml, 1.0 - 20 mg / m l, 1.0 - 15 mg / ml, 1.0 - 10 mg / ml, 1.0 - 9 mg / ml, 1.0 - 8 mg / ml, 1.0 - 7 mg / ml, 1.0 - 6 mg / ml, or 1.0 - 5 mg / ml. In some embodiments, suitable lipid solutions may contain a mixture of desired lipids at a total concentration of up to about 100 mg / ml, 90 mg / ml, 80 mg / ml, 70 mg / ml, 60 mg / ml, 50 mg / ml, 40 mg / ml, 30 mg / ml, 20 mg / ml, or 10 mg / ml.

[0093] Any desired lipids can be mixed in any ratio suitable for encapsulating the mRNA. In some embodiments, suitable lipid solutions contain a mixture of desired lipids including cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and / or PEGylated lipids. In some embodiments, suitable lipid solutions contain a mixture of desired lipids including one or more cationic lipids, one or more helper lipids (e.g., non-cationic lipids and / or cholesterol lipids) and one or more PEGylated lipids.

[0094] Exemplary mixtures of lipids for use in the present invention are composed of four lipid components: a cationic lipid, a non-cationic lipid (e.g., DSPC, DPPC, DOPE, or DEPE), a cholesterol-based lipid (e.g., cholesterol), and a PEG-modified lipid (e.g., DMG-PEG2K). In some embodiments, the molar ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid can be, respectively, about 20-50:25-35:20-50:1-5. In some embodiments, the ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid is, respectively, approximately 20:30:48.5:1.5. In some embodiments, the ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid is, respectively, approximately 40:30:20:10. In some embodiments, the ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid is, respectively, approximately 40:30:25:5. In some embodiments, the ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid is, respectively, approximately 40:32:25:3. In some embodiments, the ratio of cationic lipid to non-cationic lipid to cholesterol-based lipid to PEG-modified lipid is approximately 50:25:20:5.

[0095] In some embodiments, the mixture of lipids for use in the present invention may comprise three or fewer distinct lipid components. In some embodiments, one distinct lipid component in such a mixture is a cholesterol-based or imidazole-based cationic lipid. An exemplary mixture of lipids can be composed of three lipid components: a cationic lipid (e.g., a cholesterol-based or imidazole-based cationic lipid such as ICE, HGT4001 or HGT4002), a non-cationic lipid (e.g., DSPC, DPPC, DOPE or DEPE), and a PEG-modified lipid (e.g., DMG-PEG2K). The molar ratio of cationic lipid:non-cationic lipid:PEG-modified lipid can be, respectively, about 55-65:30-40:1-15. In some embodiments, a molar ratio of 60:35:5 of cationic lipid (e.g., a cholesterol-based or imidazole-based lipid such as ICE, HGT4001 or HGT4002) to non-cationic lipid (e.g., DSPC, DPPC, DOPE or DEPE) to PEG-modified lipid (e.g., DMG-PEG2K) is particularly suitable for use in the present invention.

[0096] Cationic lipid As used herein, the phrase "cationic lipid" refers to any of a number of lipid species having a net positive charge at a selected pH, such as physiological pH. A number of cationic lipids have been described in the literature and many are commercially available. Particularly suitable cationic lipids for use in the compositions and methods of the present invention are those described in WO2010 / 053572 (specifically, C12-200 described in paragraph

[0225] ) and WO2012 / Including those described in 170930, both of which are incorporated herein by reference. In certain embodiments, cationic lipids suitable for the compositions and methods of the present invention are, for example, (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-15,18-dien-1-amine (HGT5000), (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-4,15,18-triene-1-amine (HGT5001), and (15Z,18Z)-N,N-dimethyl-6-((9Z,12Z)-octadeca-9,12-dien-1-yl)tetracosa-5,15,18-triene-1-amine (HGT5002), etc., which are ionizable cationic lipids described in U.S. Provisional Patent Application No. 61 / 617,468, filed on March 29, 2012 (incorporated herein by reference).

[0097] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include cationic lipids such as 3,6-bis(4-(bis((9Z,12Z)-2-hydroxyoctadeca-9,12-dien-1-yl)amino)butyl)piperazine-2,5-dione (OF-02).

[0098] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention are named "Biodegradable lipids for delivery of nucleic acids" such as 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)butyl)-1,4-dioxane-2,5-dione (Target 23), 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione (Target 24), etc., which are described in WO2015 / 184256A2 (incorporated herein by reference). Including the cationic lipids described in WO2015 / 184256A2 (incorporated herein by reference) of the name "Biodegradable lipids for delivery of nucleic acids".

[0099] In some embodiments, cationic lipids suitable for the compositions and methods of the present invention include the cationic lipids described in WO2013 / 063468 with the title "Lipid Formulations for Delivery of Messenger RNA" and in a U.S. provisional application, both of which are incorporated herein by reference. In some embodiments, the cationic lipid is a compound of formula I-c1-a:

Chemical formula

[0100] In some embodiments, each R 2 is independently hydrogen, methyl or ethyl. In some embodiments, each R 2 is independently hydrogen or methyl. In some embodiments, each R 2 is hydrogen.

[0101] In some embodiments, each q is independently from 3 to 6. In some embodiments, each q is independently from 3 to 5. In some embodiments, each q is 4.

[0102] In some embodiments, each R' is independently hydrogen, methyl, or ethyl. In some embodiments, each R' is independently hydrogen or methyl. In some embodiments, each R' is independently hydrogen.

[0103] In some embodiments, each R L is independently C 8-12is alkyl. In some embodiments, each R L is independently n-C 8-12 alkyl. In some embodiments, each R L is independently C 9-11 alkyl. In some embodiments, each R L is independently n-C 9-11 alkyl. In some embodiments, each R L is independently C 10 alkyl. In some embodiments, each R L is independently n-C 10 alkyl.

[0104] In some embodiments, each R 2 is independently hydrogen or methyl, each q is independently 3 to 5, each R' is independently hydrogen or methyl, and each R L is independently C 8-12 alkyl.

[0105] In some embodiments, each R 2 is hydrogen, each q is independently 3 to 5, each R' is hydrogen, and each R L is independently C 8-12 alkyl.

[0106] In some embodiments, each R 2 is hydrogen, each q is 4, each R' is hydrogen, and each R L is independently C 8-12 alkyl.

[0107] In some embodiments, the cationic lipid is a compound of formula I-g:

Chemical formula

[0108] In certain embodiments, suitable cationic lipids are cKK-E12 or (3,6-bis(4-(bis(2-hydroxydodecyl)amino)butyl)piperazine-2,5-dione). The structure of cKK-E12 is shown below. [Chemical formula]

[0109] Other suitable cationic lipids include the cleavable cationic lipids described in International Patent Publication No. WO2012 / 170889, which is incorporated herein by reference. In some embodiments, the compositions and methods of the present invention include a cationic lipid of the following formula: [Chemical formula] wherein R 1 is selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (such as alkylamino like dimethylamino), and pyridyl, and R 2 is selected from the group consisting of one of the following two formulas: [Chemical formula] wherein R 3 and R 4 are each independently optionally substituted variable saturated or unsaturated C 6 -C 20 alkyl and optionally substituted variable saturated or unsaturated C 6 -C20 Selected from the group consisting of acyl, where n is 0 or any positive integer (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more). In certain embodiments, the compositions and methods of the invention comprise the cationic lipid "HGT4001" having the following compound structure: [Chemical formula] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the invention comprise the cationic lipid "HGT4002" having the following compound structure: [Chemical formula] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the invention comprise the cationic lipid "HGT4003" having the following compound structure: [Chemical formula] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the invention comprise the cationic lipid "HGT4004" having the following compound structure: [Chemical formula] and pharmaceutically acceptable salts thereof. In certain embodiments, the compositions and methods of the invention comprise the cationic lipid "HGT4005" having the following compound structure: [Chemical formula] and pharmaceutically acceptable salts thereof.

[0110] Further exemplary cationic lipids are the cationic lipids of formula I: [Chemical formula] and pharmaceutically acceptable salts thereof, wherein, R is [Chem.] or R is [Chem.] or R is [Chem.] or R is [Chem.] i.e., (see, e.g., Fenton, Owen S., et al. “Bioinspired Alkenyl Amino Alcohol Ionizable Lipid Materials for Highly Potent In Vivo mRNA Delivery.” Advanced materials (2016)).

[0111] In some embodiments, one or more cationic lipids suitable for the present invention can be N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride, or "DOTMA" (Feigner et al. (Proc. Nat’l Acad. Sci. 84, 7413 (1987), U.S. Patent No. 4,897,355). Other suitable cationic lipids include, for example, 5-carboxyspermylglycinedioctadecylamide or "DOGS", 2,3-dioleyloxy-N-[2(spermine-carboxamido)ethyl]-N,N-dimethyl-l-propanaminium or "DOSPA" (Behr et al. Proc. Nat.’l Acad. Sci. 86, 6982 (1989), U.S. Patent No. 5,171,678, U.S. Patent No. 5,334,761), l,2-dioleoyl-3-dimethylammonium-propane or "DODAP", l,2-dioleoyl-3-trimethylammonium-propane or " DOTAP".

[0112] Further exemplary cationic lipids include 1,2-distearyloxy-N,N-dimethyl-3-aminopropane or "DSDMA", 1,2-dioleyloxy-N,N-dimethyl-3-aminopropane or "DODMA", 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane or "DLinDMA", 1,2-dilinolenyloxy-N,N-dimethyl-3-aminopropane or "DLenDMA", N-dioleyl-N,N-dimethylammonium chloride or "DODAC", N,N-distearyl-N,N-dimethylammonium bromide or "DDAB", N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide or "DMRIE", 3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-1-(cis,cis-9,12-octadecadienooxy)propane or "CLinDMA", 2-[5'-(cholest-5-en-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-1-1-(cis,cis-9',1-2'-octadecadienooxy)propane or "CpLinDMA", N,N-dimethyl-3,4-dioleyloxybenzylamine or "DMOBA", 1,2-N,N'-dioleylcarbamyl-3-dimethylaminopropane or "DOcarbDAP", 2,3-dilinoleoyloxy-N,N-dimethylpropylamine or "DLinDAP", 1,2-N,N'-dilinoleyloxycarbamyl-3-dimethylaminopropane or "DLincarbDAP", 1,2-dilinoleylcarbamyl-3-dimethylaminopropane or "DLinCDAP", 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane or "DLin- -DMA", 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane or "DLin-K-XTC2-DMA", and 2-(2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1,3-dioxolan-4-yl)-N,N-dimethylethanamine (DLin-KC2-DMA) (see WO2010 / 042877; Semple et al., Nature Biotech. 28:172-176 (2010)), or mixtures thereof. (Heyes, J., et al., J Controlled Release 107:276-287 (2005); Morrissey, D.V., et al., Nat. Biotechnol. 23(8):1003-1007 (2005); PCT Publication No. WO2005 / 121348A1). In some embodiments, one or more of the cationic lipids comprise at least one of an imidazole moiety, a dialkylamino moiety, or a guanidium moiety.

[0113] In some embodiments, one or more cationic lipids are XTC (2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane), MC3 (((6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraene-19-yl 4-(dimethylamino)butanoate)), ALNY-100 ((3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadeca-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine)), NC98-5 (4,7,13-tris(3-oxo-3-(undecylamino)propyl)-N1,N16-doundecyl-4,7,10,13-tetraazhexadecane-1,16-diamide), DODAP (1,2-dioleyl-3-dimethylammonium propane), aminoalcohol lipidoids such as those disclosed in HGT4003 (WO2012 / 170889, the teachings of which are incorporated herein by reference in their entirety), ICE (WO2011 / 068810, the teachings of which are incorporated herein by reference in their entirety), HGT5000 (U.S. Provisional Patent Application No. 61 / 617,468, the teachings of which are incorporated herein by reference in their entirety) or HGT5001 (cis or trans) (Provisional Patent Application No. 61 / 617,468), WO2010 / 053572, DOTAP (1,2-Dioleoyl-3-trimethylammonium propane), DOTMA (1,2-di-O-octadecenyl-3-trimethylammonium propane), DLinDMA (Heyes, J.; Palmer, L.; Bremner, K.; MacLachlan, I. “Cationic lipid saturation influences intracellular delivery of encapsulated nucleic acids” J. Contr. Rel. 2005, 107, 276-287), DLin-KC2-DMA (Semple, S.C. et al. “Rational Design of Cationic Lipids for siRNA Delivery” Nature Biotech. 2010, 28, 172-176), C12-200 (Love, K.T. et al. “Lipid-like materials for low-dose in vivo gene silencing” PNAS 2010, 107, 1864-1869), N1GL, N2GL, V1GL, and combinations thereof may be selected.

[0114] In some embodiments, one or more cationic lipids are amino lipids. Amino lipids suitable for use in the present invention include those described in WO2017180917, which is incorporated herein by reference. Exemplary amino lipids in WO2017180917 include those described in paragraph

[0744] such as DLin-MC3-DMA (MC3), (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine (L608), and Compound 18. Other amino lipids include Compound 2, Compound 23, Compound 27, Compound 10, and Compound 20. Further amino lipids suitable for use in the present invention include those described in WO2017112865, which is incorporated herein by reference. Exemplary amino lipids in WO2017112865 include compounds according to one of formula (I), (Ial)-(Ia6), (lb), (II), (Ila), (III), (Ilia), (IV), (17-1), (19-1), (19-11), and (20-1), and compounds in paragraphs

[0185] ,

[0201] ,

[0276] . In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118725, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL22 and KL25. In some embodiments, cationic lipids suitable for use in the present invention include those described in WO2016118724, which is incorporated herein by reference. Exemplary cationic lipids in WO2016118725 include those such as KL10, 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLin-DMA), and KL25.

[0115] In some embodiments, the cationic lipid constitutes, by weight or mole, at least about 5%, 10%, 20%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70% of the total lipids in a suitable lipid solution. In some embodiments, the cationic lipid constitutes, by weight or mole, about 30 - 70% (e.g., about 30 - 65%, about 30 - 60%, about 30 - 55%, about 30 - 50%, about 30 - 45%, about 30 - 40%, about 35 - 50%, about 35 - 45%, or about 35 - 40%) of the total lipid mixture.

[0116] Non-cationic / helper lipid As used herein, the phrase "non-cationic lipid" refers to any neutral lipid, zwitterionic lipid, or anionic lipid. As used herein, the phrase "anionic lipid" refers to any of a number of lipid species that have a net negative charge at a selected pH, such as physiological pH. Non-cationic lipids include distearoyl phosphatidylcholine (DSPC), dioleoyl phosphatidylcholine (DOPC), dipalmitoyl phosphatidylcholine (DPPC), dioleoyl phosphatidylglycerol (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), dioleoyl phosphatidylethanol Dioleoyl amine (DOPE), palmitoyl oleoyl phosphatidylcholine (POPC), palmitoyl oleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 1,2-dielucoyl-sn-glycero-3-phosphoethanolamine (DEPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), or mixtures thereof, but not limited thereto. In some embodiments, the mixture of lipids for use in the present invention may include DSPC as a non-cationic lipid component. In some embodiments, the mixture of lipids for use in the present invention may include DPPC as a non-cationic lipid component. In some embodiments, the mixture of lipids for use in the present invention may include DOPE as a non-cationic lipid component. In some embodiments, the mixture of lipids for use in the present invention may include DEPE as a non-cationic lipid component.

[0117] In some embodiments, the non-cationic lipid can constitute at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% or 70% of the total lipids in a suitable lipid solution by weight or mole. In some embodiments, the non-cationic lipid constitutes about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) of the total lipids in a suitable lipid solution by weight or mole.

[0118] Cholesterol-based lipids In some embodiments, a suitable lipid solution comprises one or more cholesterol-based lipids. By way of example, suitable cholesterol-based cationic lipids include, for example, DC-Choi (N,N-dimethyl-N-ethylcarboxyamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao, et al. Biochem. Biophys. Res. Comm. 179, 280 (1991); Wolf et al. BioTechniques 23, 139 (1997); U.S. Patent No. 5,744,335), or ICE. In some embodiments, the cholesterol-based lipid constitutes at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% of the total lipids in the suitable lipid solution, by weight or mole. In some embodiments, the cholesterol-based lipid constitutes from about 30 to 50% (e.g., about 30 to 45%, about 30 to 40%, about 35 to 50%, about 35 to 45%, or about 35 to 40%) of the total lipids in the suitable lipid solution, by weight or mole.

[0119] PEGylated lipid In some embodiments, a suitable lipid solution comprises one or more PEGylated lipids. For example, the use of derivatized lipids such as polyethylene glycol (PEG)-modified phospholipids and derivatized ceramides (PEG-CER) including N-octanoyl-sphingosine-1-[succinyl (methoxypolyethylene glycol)-2000] (C8 PEG-2000 ceramide) is also contemplated by the present invention. The contemplated PEG-modified lipids include polyethylene glycol chains up to 2 kDa, up to 3 kDa, up to 4 kDa, or up to 5 kDa covalently attached to lipids having an alkyl chain of C 6 -C 20 length, but are not limited thereto. In some embodiments, the PEG-modified or PEGylated lipid is PEGylated cholesterol or PEG-2K. A suitable lipid solution may include PEG-modified lipids such as 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG2K). In some embodiments, certain useful exchangeable lipids have shorter acyl chains (e.g., C 14or C 18 is a PEG ceramide having

[0120] PEG-modified phospholipids and derivatized lipids can constitute at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, or 70% by weight or mole of the total lipids in a suitable lipid solution. In some embodiments, the PEG-modified phospholipids and derivatized lipids constitute from about 0% to about 20%, from about 0.5% to about 20%, from about 1% to about 15%, from about 1.5% to about 5% of the total lipids present in the liposomal delivery vehicle. In some embodiments, one or more PEG-modified lipids constitute about 1.5%, about 2%, about 3%, about 4%, or about 5% by mole of the total lipids. In some embodiments, the PEGylated lipids constitute about 30-50% (e.g., about 30-45%, about 30-40%, about 35-50%, about 35-45%, or about 35-40%) by weight or mole of the total lipids in a suitable lipid solution.

[0121] Can be used to prepare pre-formed lipid nanoparticles, and the various combinations of lipids contained therein, namely cationic lipids, non-cationic lipids, PEG-modified lipids, and optionally cholesterol, are described in the literature and herein. For example, suitable lipid solutions may contain CKK-E12, DOPE, cholesterol, and DMG-PEG2K; C12-200, DOPE, cholesterol and DMG-PEG2K; HGT5000, DOPE, cholesterol and DMG-PEG2K; HGT5001, DOPE, cholesterol and DMG-PEG2K; cKK-E12, DPPC, cholesterol and DMG-PEG2K; C12-200, DPPC, cholesterol, and DMG-PEG2K; HGT5000, DPPC, chol, and DMG-PEG2K; HGT5001, DPPC, cholesterol, and DMG-PEG2K; or ICE, DOPE, and DMG-PEG2K. Further combinations of lipids are described in the art, for example, US 62 / 420,421 (filed November 10, 2016), US 62 / 421,021 (filed November 11, 2016), US 62 / 464,327 (filed February 27, 2017), and PCT application "Novel ICE-based Lipid Nanoparticle Formulation for Delivery of mRNA" (filed November 10, 2017), the disclosures of which are hereby incorporated by reference in their entirety. The selection of cationic lipids, non-cationic lipids, and / or PEG-modified lipids, including lipid mixtures, and the relative molar ratios of such lipids to each other are based on the characteristics of the lipids selected, as well as the nature and characteristics of the mRNA to be encapsulated. Additional considerations include, for example, the degree of saturation of the alkyl chains of the lipids selected, as well as size, charge, pH, pKa, fusibility, and toxicity. Thus, the molar ratios can be adjusted accordingly.

[0122] mRNA-LNP Formation A process for forming lipid nanoparticles encapsulating mRNA (mRNA-LNP) by mixing the above-described mRNA solution with the above-described lipid solution to generate an LNP-forming solution suitable for mRNA-LNP formation has been previously described. For example, U.S. Patent No. 9,668,980, entitled "Encapsulation of messenger RNA", the entire disclosure of which is incorporated herein by reference, provides a process for encapsulating messenger RNA (mRNA) into lipid nanoparticles by mixing an mRNA solution and a lipid solution, wherein the mRNA solution and / or the lipid solution are heated to a predetermined temperature higher than ambient temperature prior to mixing to form lipid nanoparticles encapsulating the mRNA. Alternatively, the mRNA solution and the lipid solution can be mixed into an LNP-forming solution that provides mRNA-LNP formation without heating any one or more of the mRNA solution, the lipid solution, and the LNP-forming solution.

[0123] For certain cationic lipid nanoparticle formulations of mRNA, the mRNA solution contains a citrate buffer to achieve enhanced encapsulation of the mRNA. In some embodiments, the citrate buffer mRNA solution is heated, for example, up to 65°C. In those processes or methods, heating after mixing the mRNA solution with the lipid solution (post-formation of the nanoparticles), heating of the LNP-forming solution has been found not to increase the encapsulation efficiency of the mRNA in the lipid nanoparticles, so heating needs to occur prior to the step of mixing the mRNA solution with the lipid solution (i.e., heating the separate components). In some embodiments, one or both of the mRNA solution and the lipid solution are maintained and mixed at ambient temperature. In some embodiments, one or both of the mRNA solution and the lipid solution are maintained and mixed at ambient temperature.

[0124] As used herein, the term "ambient temperature" refers to the temperature in a room or the temperature surrounding the object of interest without heating or cooling. In some embodiments, the ambient temperature at which one or more of the solutions are maintained is about 35°C, 30°C, 25°C, 20°C, or 16°C or less. In some embodiments, the ambient temperature at which one or more of the solutions are maintained is in the range of about 15 - 35°C, about 15 - 30°C, about 15 - 25°C, about 15 - 20°C, about 20 - 35°C, about 25 - 35°C, about 30 - 35°C, about 20 - 30°C, about 25 - 30°C, or about 20 - 25°C. In some embodiments, the ambient temperature at which one or more of the solutions are maintained is 20 - 25°C.

[0125] Accordingly, a predetermined temperature higher than the ambient temperature is typically higher than about 25°C. In some embodiments, the predetermined temperature suitable for the present invention is about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, or 70°C or higher. In some embodiments, the predetermined temperature suitable for the present invention is in the range of about 25 - 70°C, about 30 - 70°C, about 35 - 70°C, about 40 - 70°C, about 45 - 70°C, about 50 - 70°C, or about 60 - 70°C. In certain embodiments, the predetermined temperature suitable for the present invention is about 65°C.

[0126] In some embodiments, the mRNA solution and / or the lipid solution, or both, can be heated to a predetermined temperature higher than the ambient temperature prior to mixing. In some embodiments, the mRNA solution and the lipid solution are separately heated to a predetermined temperature prior to mixing. In some embodiments, the mRNA solution and the lipid solution are mixed at the ambient temperature but then heated to a predetermined temperature after mixing. In some embodiments, the lipid solution is heated to a predetermined temperature and mixed with the mRNA solution at the ambient temperature. In some embodiments, the mRNA solution is heated to a predetermined temperature and mixed with the lipid solution at the ambient temperature.

[0127] In some embodiments, the mRNA solution is heated to a predetermined temperature by adding the mRNA stock solution at ambient temperature to a heated buffer solution to achieve the desired predetermined temperature.

[0128] In some embodiments, the lipid solution containing the dissolved lipid can be heated to a predetermined temperature higher than the ambient temperature before mixing. In some embodiments, the lipid solution containing the dissolved lipid is separately heated to a predetermined temperature before mixing with the mRNA solution. In some embodiments, the lipid solution containing the dissolved lipid is mixed with the mRNA solution at ambient temperature but then heated to a predetermined temperature after mixing. In some embodiments, the lipid solution containing the dissolved lipid is heated to a predetermined temperature and mixed with the aqueous solution at ambient temperature. In some embodiments, the heating of the mRNA solution, lipid solution, or LNP-forming solution does not occur before or after the step of mixing one or more lipids in the lipid solution with one or more mRNAs in the mRNA solution to form the mRNA encapsulated within the LNP (mRNA-LNP) in the LNP-forming solution.

[0129] In some embodiments, the mRNA solution and the lipid solution are mixed using a pump. Since such mixing by encapsulation means can occur on a wide range of scales, different types of pumps can be used to accommodate the desired scale. However, generally it is desirable to use a pulse-free flow pump. As used herein, a pulse-free flow pump means any pump that can establish a continuous flow with a stable flow rate. Suitable pump types can include, but are not limited to, gear pumps and centrifugal pumps. Exemplary gear pumps include, but are not limited to, Cole-Parmer or Diener gear pumps. Exemplary centrifugal pumps include, but are not limited to, those manufactured by Grainger or Cole-Parmer.

[0130] ​The mRNA solution and the lipid solution can be mixed at various flow rates. Typically, the mRNA solution may be mixed at a faster rate than that of the lipid solution. For example, the mRNA solution may be mixed at a rate that is at least 1-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, or 20-fold faster than the rate of the lipid solution.

[0131] Suitable flow rates for mixing can be determined based on the scale. In some embodiments, the mRNA solution is mixed at a flow rate in the range of about 40 - 400 ml / min, 60 - 500 ml / min, 70 - 600 ml / min, 80 - 700 ml / min, 90 - 800 ml / min, 100 - 900 ml / min, 110 - 1000 ml / min, 120 - 1100 ml / min, 130 - 1200 ml / min, 140 - 1300 ml / min, 150 - 1400 ml / min, 160 - 1500 ml / min, 170 - 1600 ml / min, 180 - 1700 ml / min, 150 - 250 ml / min, 250 - 500 ml / min, 500 - 1000 ml / min, 1000 - 2000 ml / min, 2000 - 3000 ml / min, 3000 - 4000 ml / min, or 4000 - 5000 ml / min. In some embodiments, the mRNA solution is mixed at a flow rate of about 200 ml / min, about 500 ml / min, about 1000 ml / min, about 2000 ml / min, about 3000 ml / min, about 4000 ml / min, or about 5000 ml / min.

[0132] In some embodiments, the lipid solution is mixed at a flow rate in the range of about 25 - 75 ml / min, 20 - 50 ml / min, 25 - 75 ml / min, 30 - 90 ml / min, 40 - 100 ml / min, 50 - 110 ml / min, 75 - 200 ml / min, 200 - 350 ml / min, 350 - 500 ml / min, 500 - 650 ml / min, 650 - 850 ml / min, or 850 - 1000 ml. In some embodiments, the lipid solution is mixed at a flow rate of about 50 ml / min, about 100 ml / min, about 150 ml / min, about 200 ml / min, about 250 ml / min, about 300 ml / min, about 350 ml / min, about 400 ml / min, about 450 ml / min, about 500 ml / min, about 550 ml / min, about 600 ml / min, about 650 ml / min, about 700 ml / min, about 750 ml / min, about 800 ml / min, about 850 ml / min, about 900 ml / min, about 950 ml / min, or about 1000 ml / min.

[0133] Pharmaceutical formulation solution The present invention relates, in part, to a mixture of an mRNA solution and a lipid solution into an LNP-forming solution in which mRNA-encapsulated LNPs are formed, and subsequent exchange of the LNP-forming solution into a solution constituting a pharmaceutical formulation solution (e.g., 10% trehalose). After this exchange, the encapsulation of mRNA in the LNPs can be further enhanced by heating the pharmaceutical formulation solution containing the mRNA-LNPs, as well as any free mRNA that was not encapsulated in the LNP-forming solution.

[0134] The exchange of the solution containing mRNA-LNPs from the LNP-forming solution to the pharmaceutical formulation solution can be achieved by any of a variety of buffer exchange techniques known in the art. For example, in some embodiments, this exchange of solutions is achieved by diafiltration. In some embodiments, the step of exchanging the LNP-forming solution with the pharmaceutical formulation solution to provide mRNA-LNPs in the pharmaceutical formulation solution involves purification and / or concentration of the mRNA-LNPs. Various methods may be used to achieve the exchange of the solution along with purification of the mRNA-LNPs or concentration of the mRNA-LNPs in the solution. In some embodiments, the solution is an exchange , mRNA-LNP is purified using tangential flow filtration. Tangential flow filtration (TFF), also known as cross-flow filtration, is a type of filtration in which the substance to be filtered passes in the tangential direction rather than through the filter. In TFF, unwanted permeates pass through the filter while the desired retentate passes along the filter and is collected downstream. It is important to note that the desired substance is typically contained in the retentate in TFF, the opposite of what is commonly encountered in conventional dead-end filtration.

[0135] Depending on the substance to be filtered, TFF is typically used either for microfiltration or ultrafiltration. Microfiltration is typically defined as when the filter has a pore size of 0.05 μm to 1.0 μm inclusive, while ultrafiltration typically involves a filter with a pore size of less than 0.05 μm. The pore size also determines the nominal molecular weight cut-off (NMWL), also called the molecular weight cut-off (MWCO) for a particular filter. Microfiltration membranes typically have an NMWL above 1,000 kilodaltons (kDa), while ultrafiltration filters have an NMWL of 1 kDa to 1,000 kDa.

[0136] The main advantage of tangential flow filtration is that non-permeable particles (sometimes called a "filter cake") that would aggregate on the filter and clog it during conventional "dead-end" filtration are instead carried along the surface of the filter. This advantage means that the filter generally does not need to be removed and cleaned, significantly reducing downtime and allowing tangential flow filtration to be widely used in industrial processes that require continuous operation.

[0137] Tangential flow filtration can be used for several purposes, including, inter alia, solution exchange, concentration, and purification. Concentration is a process in which solvent is removed from the solution while solute molecules are retained. To effectively concentrate a sample, a membrane with an NMWL or MWCO that is substantially smaller than the molecular weight of the solute molecules to be retained is used. Generally, one of ordinary skill in the art can select a filter with an NMWL or MWCO that is 3 to 6 times smaller than the molecular weight of the target molecule.

[0138] Diafiltration is a fractionation process by which small unwanted particles pass through the filter while larger desired nanoparticles are retained within the retentate without changing the concentration of those nanoparticles in the solution. Diafiltration is often used to remove salts or reaction buffers from a solution. Diafiltration can be either continuous or discontinuous. In continuous diafiltration, the diafiltration solution is added to the sample feed at the same rate at which the filtrate is produced. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting concentration. Discontinuous diafiltration may be repeated until the desired nanoparticle concentration is reached.

[0139] The composition of a pharmaceutical formulation solution can include various components found in the pharmaceutical formulation. For example, in some embodiments, the pharmaceutical formulation solution can include a buffer such as PBS.

[0140] In some embodiments, the pharmaceutical formulation solution can include a buffering agent or a salt. Exemplary buffering agents can include HEPES, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, and sodium phosphate. Exemplary salts can include sodium chloride, magnesium chloride, and potassium chloride.

[0141] In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, cryoprotectants. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing pharmaceutically acceptable excipients including, but not limited to, sugars such as one or more of trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, the pharmaceutical formulation solution contains trehalose. In some embodiments, the pharmaceutical formulation solution contains sucrose. In some embodiments, the pharmaceutical formulation solution contains mannose. In some embodiments, the pharmaceutical formulation solution contains lactose. In some embodiments, the pharmaceutical formulation solution contains mannitol.

[0142] In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing 5% to 20% w / v sugars such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing 5% to 20% w / v trehalose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing 5% to 20% w / v sucrose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing 5% to 20% w / v mannose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing 5% to 20% w / v lactose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing 5% to 20% w / v mannitol.

[0143] In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing about 10 weight / volume % of sugars such as trehalose, sucrose, mannose, lactose, and mannitol. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing about 10 weight / volume % of trehalose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing about 10 weight / volume % of sucrose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing about 10 weight / volume % of mannose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing about 10 weight / volume % of lactose. In some embodiments, the pharmaceutical formulation solution is an aqueous solution containing about 10 weight / volume % of mannitol.

[0144] In some embodiments, one or both of a non-aqueous solvent such as ethanol and a citrate are not present in the pharmaceutical formulation solution. In some embodiments, the pharmaceutical formulation solution contains only residual citrate. In some embodiments, the pharmaceutical formulation solution contains only a residual non-aqueous solvent such as ethanol. In some embodiments, the pharmaceutical formulation solution contains less than 10 mM (e.g., less than about 9 mM, about 8 mM, about 7 mM, about 6 mM, about 5 mM, about 4 mM, about 3 mM, about 2 mM, or about 1 mM) of citrate. In some embodiments, the pharmaceutical formulation solution contains less than about 25% (e.g., less than about 20%, about 15%, about 10%, about 5%, about 4%, about 3%, about 2%, or about 1%) of a non-aqueous solvent such as ethanol. In some embodiments, the pharmaceutical formulation solution does not require any further downstream processing (e.g., buffer exchange and / or further purification steps and / or additional excipients) prior to lyophilization. In some embodiments, the pharmaceutical formulation solution does not require further downstream processing (e.g., buffer exchange and / or further purification steps and / or additional excipients) prior to sterile filling into vials, syringes, or other containers for administration. In some embodiments, the pharmaceutical formulation solution does not require further downstream processing (e.g., buffer exchange and / or further purification steps and / or additional excipients) prior to administration to a subject.

[0145] In some embodiments, the pharmaceutical formulation solution has a pH of from pH 4.5 to pH 7.5. In some embodiments, the pharmaceutical formulation solution has a pH of from pH 5.0 to pH 7.0. In some embodiments, the pharmaceutical formulation solution has a pH of from pH 5.5 to pH 7.0. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 4.5. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 5.0. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 5.5. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 6.0. In some embodiments, the pharmaceutical formulation solution has a pH higher than pH 6.5.

[0146] In some embodiments, improvement in encapsulation of mRNA-LNP in the pharmaceutical formulation solution after heating The amount that is encapsulated or enhanced is retained after subsequent freeze-thaw of the pharmaceutical formulation solution. In some embodiments, the pharmaceutical formulation solution is 10% trehalose and can be stably frozen.

[0147] In some embodiments, the mRNA-LNP in the pharmaceutical formulation solution after heating can be stably frozen (e.g., retain enhanced encapsulation) in a trehalose solution of about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, or about 50%. In some embodiments, the pharmaceutical formulation solution can be stably stored in frozen form without any downstream purification or processing.

[0148] Provided LNP (mRNA-LNP) encapsulating mRNA The process according to the present invention provides higher potency and efficacy, thereby allowing for lower dosages and thereby shifting the therapeutic index in a positive direction. In some embodiments, the process according to the present invention results in homogeneous and small particle sizes. In some embodiments, the process according to the present invention results in homogeneous and small particle sizes of 200 nm or less. In some embodiments, the process according to the present invention results in homogeneous and small particle sizes of 150 nm or less. In some embodiments, the process according to the present invention results in homogeneous and small particle sizes, as well as significantly improved encapsulation efficiency and / or mRNA recovery rate, compared to prior art processes.

[0149] Accordingly, the present invention provides a composition comprising the purified mRNA-encapsulating nanoparticles described herein. In some embodiments, a majority of the mRNA-encapsulating nanoparticles in the composition, i.e., about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified nanoparticles, have a size of about 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all of the purified nanoparticles have a size of about 150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). The exemplary processes described herein routinely produce lipid nanoparticle compositions, and the lipid nanoparticles have an average size of about 150 nm or less, e.g., 75 nm to 150 nm, particularly 100 nm to 150 nm.

[0150] Furthermore, homogeneous nanoparticles having a narrow particle size range are achieved by the process of the present invention. For example, more than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% of the purified nanoparticles in the composition provided by the present invention are in the range of about 75 - 200 nm (e.g., about 75 - 150 nm, about 75 - 140 nm, about 75 - 135 nm, about 75 - 130 nm, about 75 - 125 nm, about 75 - 120 nm, about 75 - 115 nm, about 75 - 110 nm, about 75 - 105 nm, about 75 - 100 nm, about 75 - 95 nm, about 75 - 90 nm, or 75 - 85 nm). In some embodiments, substantially all of the purified nanoparticles have a size in the range of about 75 - 200 nm (e.g., about 75 - 150 nm, about 75 - 140 nm, about 75 - 135 nm, about 75 - 130 nm, about 75 - 125 nm, about 75 - 120 nm, about 75 - 115 nm, about 75 - 110 nm, about 75 - 105 nm, about 75 - 100 nm, about 75 - 95 nm, about 75 - 90 nm, or 75 - 85 nm).

[0151] In some embodiments, the measurement value (PDI) of the molecular size dispersity, or heterogeneity, of the nanoparticles in the composition provided by the present invention is less than about 0.23 (e.g., about 0.3, 0.2, 0.19, 0.18, 0.17, 0.16, 0.15, 0.14, 0.13 、0.12, 0.11, 0.10, 0.09, or less than 0.08). The exemplary processes described herein routinely produce lipid nanoparticle compositions having a PDI of about 0.15 or less, e.g., about 0.01 - 0.15.

[0152] In some embodiments, more than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the nanoparticles in the composition provided by the present invention encapsulate mRNA within each individual particle. In some embodiments, substantially all of the nanoparticles in the composition encapsulate mRNA within each individual particle.

[0153] In some embodiments, the LNPs according to the present invention contain at least about 1 mg, 5 mg, 10 mg, 100 mg, 500 mg, or 1000 mg of encapsulated mRNA. In some embodiments, the process according to the present invention results in a recovery of more than 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the mRNA.

[0154] In some embodiments, the compositions according to the present invention are formulated for administration to a subject. In some embodiments, the compositions of mRNA-encapsulating LNPs described herein are formulated at a dose concentration of less than 1.0 mg / kg of mRNA lipid nanoparticles (e.g., 0.6 mg / kg, 0.5 mg / kg, 0.3 mg / kg, 0.016 mg / kg, 0.05 mg / kg, and 0.016 mg / kg). In some embodiments, the dose is reduced due to the unexpected finding that lower doses result in higher potency and efficacy. In some embodiments, the dose is reduced by about 70%, 65%, 60%, 55%, 50%, 45% or 40%.

[0155] In some embodiments, the potency of the mRNA-encapsulating LNPs produced by the present invention is more than 100% (i.e., more than 200%, more than 300%, more than 400%, more than 500%, more than 600%, more than 700%, more than 800%, or more than 900%) to more than 1000% more potent when prepared by step (c).

Example

[0156] Certain compounds, compositions and methods of the present invention are specifically described according to certain embodiments, while the following examples serve only to illustrate the present invention and are not intended to limit it.

[0157] Lipid material The formulations described in the following examples contain a variable ratio multi-component lipid mixture using one or more cationic lipids, helper lipids (e.g., non-cationic lipids and / or cholesterol lipids), and PEGylated lipids, designed to encapsulate various nucleic acid materials, as previously described, unless otherwise specified.

[0158] Example 1. Enhanced Encapsulation of mRNA within Lipid Nanoparticles by an Additional Step of Heating a Pharmaceutical Formulation Solution This example demonstrates a current exemplary process for enhanced encapsulation of mRNA within lipid nanoparticles by applying Process A and subsequently exchanging the LNP-forming solution containing mRNA-LNP and free mRNA with a pharmaceutical formulation solution and heating the pharmaceutical solution. As used herein, Process A refers to a conventional method of encapsulating mRNA, for example, by first mixing the mRNA with a mixture of lipids without pre-forming the lipids into lipid nanoparticles, as described in U.S. Patent Application No. US2018 / 0008680, which is hereby incorporated by reference in its entirety.

[0159] An exemplary formulation process A is shown in Figure 1. In this process, in some embodiments, a lipid solution (e.g., a solution containing ethanol) in which the LNP component lipids are dissolved and an aqueous mRNA solution (containing citrate at pH 4.5) were prepared separately. In particular, a solution of the lipid solution (cationic lipid, helper lipid, zwitterionic lipid, PEG lipid, etc.) was prepared by dissolving the lipids in ethanol. The mRNA solution was prepared by dissolving the mRNA in a citrate buffer, and mRNA in a citrate buffer at a pH of 4.5 was obtained. Subsequently, the mixtures were heated to 65°C for both before mixing. Then, these two solutions were mixed using a pumping system to obtain mRNA-encapsulated LNPs in an LNP-forming solution containing a mixture of the lipid solution and the mRNA solution. In some examples, the two solutions were mixed using a gear pump system. In certain embodiments, the two solutions were mixed using a "T" junction (or "Y" junction).

[0160] Next, the LNP-forming solution containing mRNA-LNP and free mRNA was diafiltered by a TFF process. As part of that process, the LNP-forming solution was removed and replaced with a pharmaceutical formulation solution containing 10% trehalose. As shown in Figure 2, the resulting mRNA-LNP and free mRNA in the pharmaceutical formulation solution were then heated to 65°C for 15 minutes. After heating, the mRNA-LNP and free mRNA in the pharmaceutical formulation solution were cooled and stored at 2-8°C for subsequent analysis.

[0161] As outlined in Figure 2, the encapsulation process described above was performed on 12 different mRNA-LNPs as specifically described by Table 1 below. For each test article, the amount of mRNA encapsulated in the formed LNP before and after heating in a pharmaceutical formulation solution of 10% trehalose was measured using the RiboGreen assay kit, free RNA was measured according to published methods, and then calculations were performed to determine the encapsulated mRNA. Further, using the same assay, the amount of mRNA encapsulated in the LNP formed after subsequent freeze-thaw was measured to determine whether the enhanced encapsulation observed from heating the mRNA-LNP in the pharmaceutical formulation generally remained consistent with the subsequent freeze-thaw of the mRNA-LNP.

Table 1

[0162] As shown in Table 1 and Figure 3, the percentage of encapsulation of mRNA encapsulated in the formed LNP was significant after heating in the pharmaceutical formulation solution compared to immediately before heating in the same pharmaceutical formulation solution for all test articles evaluated. Further, this enhanced encapsulation was maintained even after subsequent freeze-thaw of the mRNA-LNP in the same pharmaceutical formulation solution.

[0163] In summary, the data of this example show a significant increase in the encapsulation of mRNA-encapsulated lipid nanoparticles produced by Process A and subsequent heating in the pharmaceutical formulation solution.

[0164] Example 2. In Vivo Expression of hEPO Delivered by mRNA-LNP after Heating of Pharmaceutical Formulation Solution This example demonstrates a significant increase in encapsulation of mRNA-encapsulated lipid nanoparticles produced by Process A followed by heating in a pharmaceutical formulation solution. Further, the data of this example show the in vivo expression of human EPO (hEPO) in mice after administration of hEPO mRNA encapsulated in lipid nanoparticles prepared according to the present invention.

[0165] In this example, hEPO mRNA was encapsulated in lipid nanoparticles as shown in Table 2, as described in Example 1. For each test article, the amount of mRNA encapsulated in the formed LNP was measured before and after heating in a pharmaceutical formulation solution of 10 mM citrate in 10% sucrose using the method described in Example 1. A was measured before and after heating in a pharmaceutical formulation solution of 10 mM citrate in 10% sucrose using the method described in Example 1.

[0166] As shown in Table 2, the encapsulation % of mRNA encapsulated in the formed LNP was significant after heating in the pharmaceutical formulation solution compared to immediately before heating in the same pharmaceutical formulation solution for all test articles (each containing a different cationic lipid) evaluated.

[0167] Next, after heating the drug formulation, mice were administered a single dose of 1 μg / 30 μL of hEPO mRNA-encapsulated lipid nanoparticles produced by Process A via the intramuscular route. Serum levels of hEPO protein were measured 6 and 24 hours after administration.

[0168] The level of hEPO protein in the serum of treated mice can be used to evaluate the efficacy of mRNA via different delivery methods. As shown in Table 2, the intramuscularly injected hEPO mRNA lipid nanoparticle formulation resulted in high levels of hEPO protein.

Table 2

[0169] Example 3. In Vivo Expression of mRNA Delivered by Lung Administration This example demonstrates a significant increase in the encapsulation of mRNA encapsulated lipid nanoparticles produced by Process A followed by heating in a pharmaceutical formulation solution and is applicable across a wide variety of cationic lipids. Further, the data of this example show the in vivo expression of mRNA in mice after lung administration of mRNA encapsulated in lipid nanoparticles prepared according to the present invention.

[0170] In this example, mRNA was encapsulated in lipid nanoparticles as shown in Table 3, as described in Example 1. For each test article, the amount of mRNA encapsulated in the formed LNP was measured before and after heating in the pharmaceutical formulation using the method described in Example 1. [Table 3]

[0171] As shown in Tables 3 and 4, the encapsulation % of mRNA encapsulated in the formed LNP was significant after heating in the pharmaceutical formulation solution compared to immediately before heating in the same pharmaceutical formulation solution for all test articles evaluated (each containing a different cationic lipid).

[0172] Next, after heating the drug formulation, 10 μg of mRNA-LNP prepared by Process A was administered to mice via lung delivery. The fluorescence level of the expressed protein was measured 24 hours after administration. The protein expression as a result of the delivered mRNA was measured in p / s / cm 2 / sr units, as shown in Figure 5. The data show that the mRNA lipid nanoparticle formulation administered by lung delivery resulted in high levels of protein expression.

[0173] In summary, the data of this example show that the mRNA-LNP prepared according to the present invention results in high encapsulation efficiency and translates to high expression and potency.

[0174] Equivalents One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above description, but rather is as set forth in the following claims.

Claims

1. A process for encapsulating messenger RNA (mRNA) in lipid nanoparticles (LNPs), comprising: (a) mixing one or more lipids in a lipid solution with one or more mRNAs in an mRNA solution to form mRNA encapsulated within said LNPs (mRNA-LNPs) in a lipid nanoparticle (LNP)-forming solution; (b) exchanging the LNP-forming solution with a pharmaceutical formulation solution to provide the mRNA-LNP in the pharmaceutical formulation solution; (c) heating the pharmaceutical formulation solution to a temperature in the range of 45-70°C; wherein the encapsulation efficiency of the mRNA-LNP after step (c) is greater than the encapsulation efficiency of the mRNA-LNP after step (b).

2. 2. The process of claim 1, wherein the lipid solution and / or the mRNA solution is heated to a temperature in the range of 45-70°C before mixing, or the mRNA solution and the lipid solution are heated to a temperature in the range of 45-70°C after mixing.

3. 3. The process of claim 1 or 2, wherein in step (a), the one or more lipids comprise a cationic lipid, a helper lipid, and a PEG-modified lipid.

4. 4. The process of claim 3, The cationic lipids include cKK-E12, OF-02, C12-200, MC3, DLinDMA, DLinkC2DMA, ICE (imidazole-based), HGT5000, HGT5001, HGT4001, HGT4002, HGT4003, HGT4004, HGT4005, DODAC, DDAB, DMRIE, DOSPA, DOGS, and DODAP. DODMA and DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, 3-(4-(bis(2-hydroxydodecyl)amino)butyl)-6-(4-((2-hydroxydodecyl)amino)butyl)- 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione, 3-(5-(bis(2-hydroxydodecyl)amino)pentan-2-yl)-6-(5-((2-hydroxydodecyl)(2-hydroxyundecyl)amino)pentan-2-yl)-1,4-dioxane-2,5-dione, and combinations thereof; The one or more helper lipids may be distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-2-(2-methylpropyl ... and / or selected from 16-O-monomethyl-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), 1,2-dierucoyl-sn-glycero-3-phosphoethanolamine (DEPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidiethanolamine (SOPE), and combinations thereof; The PEG-modified lipid is C 6 -C 20 The process further comprises a polyethylene glycol chain of up to 2 kDa, up to 3 kDa, up to 4 kDa or up to 5 kDa in length covalently attached to a lipid having a long alkyl chain.

5. 5. The process of claim 3 or 4, wherein the one or more lipids further comprise one or more cholesterol-based lipids (e.g., cholesterol).

6. 6. The process of claim 5, wherein the molar ratio of cationic lipid to helper lipid to cholesterol-based lipid to PEG-modified lipid is 20-50:25-35:20-50:1-5.

7. The lipid component of the lipid solution is cationic lipids, Helper lipids, and PEG-modified lipid, 3. The process according to claim 1 or 2, comprising:

8. 8. The process of claim 7, wherein the cationic lipid is a cholesterol-based cationic lipid or an imidazole-based cationic lipid.

9. 9. The process according to claim 7 or 8, wherein the molar ratio of cationic lipid to helper lipid to cholesterol-based lipid to PEG-modified lipid is 55-65:30-40:1-15.

10. The process of any one of claims 1 to 9, wherein the one or more mRNAs each encode a protein or peptide.

11. 11. The process of any one of claims 1 to 10, wherein in step (c), the pharmaceutical formulation solution is heated by applying heat from a heat source to the pharmaceutical formulation solution, and the pharmaceutical formulation solution is maintained at a temperature in the range of 45 to 70°C for 10 to 20 minutes.

12. 12. The process of any one of claims 1 to 11, wherein the encapsulation efficiency after step (c) is improved by at least 5% or more from the encapsulation efficiency after step (b).

13. 13. The process of any one of claims 1 to 12, wherein the encapsulation efficiency after step (c) is improved by at least 10% or more from the encapsulation efficiency after step (b).

14. 14. The process of claim 1, wherein in step (a), the lipid solution comprises one or more lipids dissolved in ethanol, and the mRNA solution comprises one or more mRNAs dissolved in a citrate buffer.

15. The process of any one of claims 1 to 14, wherein the pharmaceutical formulation solution is an aqueous solution containing a sugar.

16. 16. The process of claim 15, wherein the sugar is trehalose or sucrose.

17. 17. The process of claim 16, wherein the aqueous solution comprises 10% weight to volume of trehalose or sucrose.

18. 18. The process of any one of claims 1 to 17, wherein ethanol is not present in the pharmaceutical formulation solution.

19. 19. The process of any one of claims 1 to 18, wherein the mRNA solution has a pH below pH 5.

0.

20. 20. The process of any one of claims 1 to 19, wherein the pharmaceutical formulation solution has a pH between pH 5.0 and pH 7.0.

Images