Compositions and methods for treatment of leukodystrophy and whole animal and cellular models for identifying efficacious agents for treatment of the same

Abstract

To provide compositions and methods for the treatment of leukodystrophy.SOLUTION: Provided is use of administering an effective amount of a compound that down-modulates the expression of both wild-type and mutant TUBB4-A in the manufacture of a pharmaceutical composition for the treatment or prevention of hypomyelination and atrophy of the basal ganglia (H-ABC) leukodystrophy, the pharmaceutical composition ameliorating symptoms of H-ABC, and the compound being selected from short hairpin RNA (shRNA), short interfering RNA (siRNA), antisense RNA, antisense DNA, chimeric antisense DNA / RNA, microRNA, and a ribozyme that is sufficiently complementary to either the gene or mRNA encoding TUBB4A.SELECTED DRAWING: Figure 1-1

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 845,637, filed May 9, 2019, and U.S. Provisional Application No. 62 / 924,910, filed October 23, 2019, the disclosures of each of the foregoing applications being incorporated herein by reference as if fully set forth.

[0002] Incorporation by Reference of Materials Submitted in Electronic Format Incorporated herein by reference in its entirety is a sequence listing submitted via EFS-Web in a text file named SequenceListing.txt, created on May 7, 2020, and having a size of 1,167 bytes.

[0003] FIELD OF THE INVENTION The present invention relates to the field of leukodystrophies and improved therapies for ameliorating the symptoms of these disorders. The present invention also provides a whole animal model for identifying agents useful in the treatment or prevention of leukodystrophies, particularly H-ABC. [Background technology]

[0004] Background of the Invention Several publications and patent documents are cited throughout this specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as if fully set forth.

[0005] Hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC) is a sporadic leukodystrophy, typically caused by heterozygous mutations in the TUBB4A gene (Simons et al., 2013a). This gene encodes the beta-tubulin 4a protein, which heterodimerizes with alpha-tubulin to assemble into microtubules. Single mutations in TUBB4A cause a range of neurological disorders, from early-onset leukoencephalopathy to adult-onset dystonia type 4 (DYT4; hoarseness and dysphonia). Individuals affected by H-ABC fall within this spectrum and typically present in early childhood with dystonia (Hersheson et al., 2013), progressive gait disturbances, speech impairments, and cognitive impairments. Also, what distinguishes these patients from other patients with TUBB4A mutations are the neuroimaging features, such as hypomyelination and atrophy of the caudate and occipital lobes, and cerebellar atrophy (van der Knaap et al., 2007).

[0006] Pathological specimens reveal neuronal loss in the dorsal striatum and granular layer of the cerebellum, accompanied by axonal swelling and diffuse loss of myelin (Simons et al., 2013a; Curiel et al., 2017b). Individuals with symptoms characteristic of H-ABC account for approximately 65% of published cases (Blumkin et al., 2014; Ferreira et al., 2014; Miyatake et al., 2014; Pizzino et al., 2014; Purnell et al., 2014), likely affected by the common mutation p.Asp249Asn (24.1% of all mutations in a cohort of 166 individuals; hereafter referred to as TUBB4A). D249N H-ABC is currently considered to represent an intermediate phenotype between the severe early-infancy variant and the mild young-adult variant (Nahhas N, 2016).

[0007] TUBB4A is highly expressed in the central nervous system (CNS), particularly in the cerebellum and white matter tracts of the brain, with more modest expression in the striatum (Hersheson et al., 2013). At the cellular level, TUBB4A is primarily localized to neurons and cells of the neuronal and oligodendrocyte (OL) lineages, with highest expression in mature, myelinating OLs (Zhang et al., 2014). TUBB4A expression patterns and associated disease phenotypes suggest a functional role for beta-tubulin 4a protein in both neurons and oligodendrocytes, but little is known about the pathological mechanisms of TUBB4A mutations. Our group reported a broader range of TUBB4A mutation effects using overexpression studies in OL cell lines and mouse cerebellar neurons. Tubb4a mutations in OL cell lines D249N Overexpression of Tubb4a reduced myelin gene expression and WT Immature OLs with fewer protrusions were formed compared to Tubb4a expression (Curiel et al., 2017b). WT Compared with the expression of Tubb4a, which is responsible for H-ABC D249N Using this mutation, we investigated abnormal neuronal phenotypes, characterized by shorter axons, fewer dendrites, and less dendritic branching (Curiel et al., 2017b). Other TUBB4A mutations specifically highlight phenotypic abnormalities in neurons and / or OL cell lines, suggesting mutation-specific effects corresponding to different clinical phenotypes. The Taiep rat, a spontaneously developing rat model harboring the homozygous p.Ala302Thr Tubb4a mutation in Tubb4a, has been reported to exhibit a low CSF pressure phenotype in some regions of the brain, optic nerve, and spinal cord. This particular mutation has not previously been observed in humans. An intriguing feature observed in Taiep rats was the accumulation of microtubules, particularly in OLs with subsequent demyelination (Duncan et al., 2017b). Currently, no animal model exists for the p.Asp249Asn mutation specifically linked to H-ABC.

[0008] There is a clear need for such models and new therapeutic approaches to treat this debilitating disorder. Summary of the Invention

[0009] The present invention provides a transgenic mouse model of H-ABC. In one aspect, the mouse has a genome comprising a promoter effective to drive expression in mouse cells operably linked to a nucleic acid encoding a human mutant Tubb4-a protein, wherein the human mutant Tubb4-a protein is expressed in neurons and / or oligodendrocytes of the mouse, producing a leukodystrophy phenotype. Table 1 provides a list of nucleic acids encoding mutant Tubb4 that can be used in the animal models, cell models, compositions, and methods described herein. In certain embodiments, the mutant Tubb4-a protein is Tubb4a. D249N It is a mutant.

[0010] The present invention also provides a method for assessing the presence of leukodystrophy in the above-mentioned transgenic mouse, the method comprising the step of measuring leukodystrophy symptoms selected from one or more of motor dysfunction, gait abnormalities, ataxia, and reduced survival rate in the transgenic mouse, and the presence of the symptoms compared to a control mouse lacking a mutant TUBB4A transgene indicates that the mouse has leukodystrophy.

[0011] In another embodiment, a method for identifying candidate compounds for treating leukodystrophy is provided.An exemplary method comprises the steps of contacting a transgenic mouse or cells, tissues or organs from the nerve cells of the transgenic mouse with a test compound, and measuring the level of physical parameters associated with leukodystrophy in the animal, cell, tissue or organ in the presence and absence of the test compound, and identifying the test compound that changes one or more of these parameters as a candidate compound.In certain embodiments, the physical parameters associated with leukodystrophy are selected from one or more of the following: reduced number of oligodendrocytes, hypomyelination, cerebellar granule neuron loss, striatal neuron loss, hypomyelination, delayed myelination, abnormal increase, ataxia, and reduced neuronal survival rate.

[0012] In another aspect, a method for identifying a therapeutic candidate compound for the treatment of hypomyelination and atrophy of the basal ganglia (H-ABC) is disclosed. An exemplary method includes exposing a transgenic mouse model of H-ABC to a test compound, measuring one or more parameters of leukodystrophy in the mouse in the presence and absence of the test compound, and identifying a test compound that improves one or more parameters as a therapeutic candidate compound.

[0013] In yet another aspect, the present invention provides a method for identifying a therapeutic candidate compound for the treatment of hypomyelination and atrophy of the basal ganglia (H-ABC), comprising: obtaining PBMCs from a subject with a TUBB-4A mutation and a control subject without a TUBB-4A mutation; reprogramming the monocytes from step a) to generate induced pluripotent stem cells (iPSCs); applying a dual SMAD inhibition protocol to differentiate the iPSCs toward a striatal spiny neuron fate, wherein the cells express one or more markers selected from DARPP32, CTIP2, GABA, and FoxP1; and contacting the cells with the compound to assess whether the compound alters a parameter associated with a leukodystrophy phenotype compared to control cells without the mutation. In some embodiments, the parameter is selected from one or more of reduced cell survival, changes in spiny neuron marker expression, and changes in cell morphology or signaling. The cells can be obtained from a patient carrying any of the TUBB-4A mutations listed in Table 1.

[0014] Another approach to treating H-ABC involves administering an effective amount of a compound that down-modulates the overall expression of TUBB4-A, thereby ameliorating the symptoms of H-ABC. In certain embodiments, the compound is selected from short hairpin RNA (shRNA), short interfering RNA (siRNA), antisense RNA, antisense DNA, chimeric antisense DNA / RNA, microRNA, and a ribozyme that is sufficiently complementary to either the gene or mRNA encoding mutant Tubb4A.

[0015] In another approach to treatment, a method for genome editing of a nucleic acid encoding TUBB4A is disclosed. An exemplary method includes administering a vector to a human subject, the subject is a human, the vector comprising a nucleic acid component of a CRISPR-mediated base editor 3 (BE3) system and a guide RNA (gRNA), the gRNA targeting a mutation in the TUBB4A gene. Base editing of the therapeutic gene introduces a corrective codon into the therapeutic gene, and the base editing is performed by the vector.

[0016] Another method for treating or preventing hypomyelination and atrophy of the basal ganglia (H-ABC) leukodystrophy in subjects with a mutant Tubb4A gene comprises administering an effective amount of a compound that increases expression of wild-type TUBB4-A protein, thereby ameliorating the symptoms of H-ABC. In certain embodiments, increased expression is achieved by overexpression of wild-type TUBB4-A via the introduction of an expression or viral vector, or nanoparticles carrying a nucleic acid encoding wild-type TUBB4-A.

[0017] Finally, the present invention provides a kit for carrying out the method according to any of the preceding claims. [Brief explanation of the drawings]

[0018] [Figure 1]Figures 1A-1M: Tubb4aD249N / D249N mice exhibit reduced survival, gait abnormalities, and progressive motor dysfunction. (Figure 1A) Schematic diagram of the mouse Tubb4a gene and sequence charts for WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. The red arrow indicates the 745 nucleotide position in exon 4. WT mice exhibit a single G peak, Tubb4aD249N mice exhibit one G peak and one A peak, and Tubb4aD249N / D249N mice exhibit two T peaks. (Figure 1B) Representative images of end-stage (ES) Tubb4aD249N / D249N mice (~P35-P40) exhibiting severe dystonia and ataxia compared to WT. (Figure 1C) Kaplan-Meier survival curves (Gehan-Breslow-Wilcoxon test, n = 28) for Tubb4aD249N / D249N and Tubb4aD249N mice compared with WT littermates. (Figure 1D) Schematic diagram showing the time course of behavioral tests. (Figure 1E) Crawling and walking were scored for gait assessment (see Table 3). Crawling was scored as follows: full hind limbs on the ground (#), tail low, or on the ground (indicated by red arrows). During the transition from crawling to walking, the head begins to lift. Walking was observed only when the hind limbs were on the ground with the toes and heels elevated, indicated by [##]. (Figure 1F) Gait impairments in Tubb4aD249N / D249N mice at P7, P10, and P14. Statistical analysis was performed by two-way ANOVA followed by Tukey's post-hoc analysis, n = 10. (Figure 1G) Representative images of walking angle in Tubb4aD249N and Tubb4aD249N / D249N mice compared to WT littermates at P7, P21, and P35. (Figure 1H) Walking angle measurements in Tubb4aD249N and Tubb4aD249N / D249N mice compared to WT littermates at P7, P14, P21, P28, and P35. Statistical analysis by two-way ANOVA followed by Tukey's post-hoc analysis, n = 14. (Figure 1I) Schematic of hanging grip strength measurements. (Figure 1J) Grip strength measured by inverted angle in Tubb4aD249N and Tubb4aD249N / D249N mice compared to WT mice. Statistical testing by one-way ANOVA followed by Tukey's post-hoc analysis, n = 10.(Figure 1K) Rotarod test showing the latency to fall (seconds) in Tubb4aD249N and Tubb4aD249N / D249N mice compared to WT mice at P21, P28, and P35 (n = 14). (Figure 1L) Graph of body weight measurements in Tubb4aD249N, Tubb4aD249N / D249N, and WT mice from P7 (n = 10). (Figure 1M) Changes in righting reflex in Tubb4aD249N, Tubb4aD249N / D249N, and WT mice (n = 14). Statistical tests were performed using a two-way ANOVA with repeated measures followed by Tukey's post hoc analysis. Data are presented as mean and SEM. *p < 0.05, **p < 0.01, ***p < 0.001. [Figure 2] Figures 2A-2D: Tubb4aD249N mice show hypomyelination after 1 year. (Figure 2A) Kaplan-Meier survival curves (Gehan-Breslow-Wilcoxon test, n = 10) of Tubb4aD249N mice compared to WT mice. (Figure 2B) Rotarod test performance of Tubb4aD249N mice compared to WT mice at 9 months and 1 year of age (n = 7-8). (Figure 2C) Statistical tests were performed using one-way ANOVA with Tukey's post-hoc test. (Figure 2D) PLP (green) in the ES of WT and Tubb4aD249N mice. [Figure 3]Figures 3A-3Z: Tubb4aD249N / D249N mice exhibit severe developmental delay in myelination. (Figure 3A) Schematic diagram showing the time course of the immunohistochemical assay. (Figure 3B) Schematic diagram showing analysis of the corpus callosum (CC) and cerebellum (Cb). (Figure 3C-3D) Representative end-stage images (ES) (Figure 3C) and quantification (Figure 3D) of eriochrome cyanine (Eri-C) staining (myelin [blue]) in the corpus callosum of WT, Tubb4aD249N, and Tubb4aD249N / D249N. Scale bar = 250 µm ("$$$" indicates a significant difference between P21 and ES). (Figures 3E-3F) Representative end-stage images (Figure 3E) and quantification (Figure 3F) of Eri-C staining in the cerebellum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 1 mm ("$$$$" indicates significant differences between P21 and ES). (Figures 3G-3J) Representative images and quantification of the loss of Eri-C staining (Figures 3G and 3H) and MBP immunostaining (Figures 3I and 3J) in the CC in 1-year-old Tubb4aD249N / D249N mice. (Figures 3K-3L) Representative end-stage images (Figure 3K) and quantification (Figure 3L) of PLP (green) in the corpus callosum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14, P21, and ES. Scale bar = 250 μm. (Figure 3M-3N) Representative Western blot images (Figure 3M) and quantification (Figure 3N) of normalized PLP protein levels at P21 and ES in the forebrains of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. (Figure 3O-3P) Representative end-stage images (Figure 3O) and quantification (Figure 3P) of PLP (green) in the cerebellum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14, P21, and ES. Scale bar = 1 mm. (Figure 3Q-3R) Representative Western blot images (Figure 3Q) and quantification (Figure 3R) of normalized PLP protein levels at P21 and ES in the cerebellum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. (Figures 3S-3T) Representative ES images (Figure 3S) and quantification (Figure 3T) of MBP (red) in the cerebellum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14, P21, and ES. Scale bar = 250 μm.(Figure 3U-3V) Representative Western blot images (Figure 3U) and quantification (Figure 3V) of normalized MBP protein levels at P21 and ES in the forebrains of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. (Figure 3W-3X) Representative ES images (Figure 3W) and quantification (Figure 3X) of MBP (red) in the cerebellum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14, P21, and ES. (Figure 3Y-3Z) Representative Western blot images (Figure 3Y) and quantification (Figure 3Z) of normalized MBP protein levels at P21 and ES in the forebrains of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Statistical tests were performed using two-way ANOVA followed by Tukey's post-hoc test. Representative data are n = 4 mice / group at P14 (except for Tubb4aD249N, n = 3 at P14) and P21, and n = 3 mice / group for ES. Data are shown as mean and SEM. *p<0.05 and *** and $$$p<0.001. [Figure 4] Figure 4A-4F: Electron microscopy analysis of the spinal cord shows that Tubb4aD249N and Tubb4aD249 / D249N mice exhibit hypomyelination and hypomyelination. (Figure 4A-F) Representative electron microscopy (EM) images of the ventral spinal cord at end-stage in WT, Tubb4aD249N, and Tubb4aD249 / D249N mice. Scale bar = 1 µm. (Figure 4A-F) High-magnification images of the spinal cord show increased myelin sheath thickness in Tubb4aD249 / D249N animals, along with macrophage (M)-mediated phagocytosis of axons (blue asterisks) in WT, Tubb4aD249N, and Tubb4aD249 / D249N tissues. Scale bar = 800 nm. [Figure 5]Figures 5A-5J: Electron microscopy of the optic nerve shows that Tubb4aD249N and Tubb4aD249 / D249N mice exhibit hypomyelination and hypomyelination (Figures 5A-5C and 5H-5J). Representative electron microscopy (EM) images of optic nerves at end-stages from WT, Tubb4aD249N, and Tubb4aD249 / D249N mice. Scale bar = 800 nm (Figures 5A-5C and 5H-5J). Higher magnification images of the optic nerve showing the thickness of the myelin sheath in WT, Tubb4aD249N, and Tubb4aD249 / D249N animals. Red asterisks = unmyelinated axons; black asterisks = thinly myelinated axons. Scale bar = 400 nm. (Figure 5D) Macrophage (M)-mediated phagocytosis of axons (blue asterisks) in Tubb4aD249 / D249N tissue. Scale bar = 2 μm. (Figure 5E) Measurement of the G-ratio in the optic nerve of WT, Tubb4aD249N, and Tubb4aD249 / D249N tissues. (Figure 5F) Scatter plot of the G-ratio versus axon diameter in WT, Tubb4aD249N, and Tubb4aD249 / D249N tissues. (Figure 5G) Axon diameter was plotted for all groups. Fifty axons were counted per animal, with n = 3 animals per group. Data are presented as means and SEM. One-way ANOVA was performed with Tukey's post-hoc test. *p < 0.05, ***p < 0.001. [Figure 6]Figures 6A-6G: Tubb4aD249 / D249N mice exhibit hypomyelination at P21. (Figure 6A) Schematic diagram displaying the time course of the immunohistochemical assay. (Figure 6B) Representative P21 images of eriochrome cyanin (Eri-C) staining (myelin [blue]) in the corpus callosum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 1 mm. (Figure 6C) Representative P21 images of PLP (green) in the corpus callosum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 250 µm. (Figure 6D) Representative P21 images of MBP (red) in the corpus callosum of WT, Tubb4aD249, and Tubb4aD249N / D249N mice. Scale bar = 250 µm. (Figure 6E) Representative P21 images of eriochrome cyanine (Eri-C) staining (myelin [blue]) in the cerebella of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 1 mm. (Figure 6F) Representative P21 images of PLP (green) in the cerebella of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 1 mm. (Figure 6G) Representative P21 images of MBP (red) in the cerebella of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 250 µm. [Figure 7]Figures 7A-7J: Tubb4aD249N / D249N mice have reduced numbers of oligodendrocytes (OLs). (Figure 7A) Schematic showing the time course of the immunohistochemical assay. (Figure 7B) Schematic showing the region of the corpus callosum used to perform counts. (Figure 7C) Representative images of ASPA-positive OLs in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at end-stage (ES). Scale bars = 50 μm and 25 μm. (Figure 7D) Quantification of the number of ASPA-positive OLs / mm2 in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14, P21, and ES. (Figure 7E) Representative images of double-positive NG2+Olig2+ in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at ES. Scale bars = 50 μm and 25 μm. (Figure 7F) Quantification of double-positive NG2+Olig2+ cells / mm2 in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14, P21, and ES. (Figure 7G) Representative data from two independent experiments, n = 4 mice / group at P14 and P21 (except for Tubb4aD249N, n = 3 at P14), and n = 3 mice / group at ES. (Figure 7H) Quantification of double-positive NG2+Caspase cells / mm2 in WT, Tubb4aD249N / +, and ES Tubb4aD249N / D249N mice at P14, P21, and ~P35-P40. (Figure 7I) Representative images of double-positive NG2+ Ki-67 cells in WT, Tubb4aD249N / +, and Tubb4aD249N / D249N mice in ES. (Figure 7J) Quantification of double-positive NG2+ Ki-67 cells / mm2 in WT, Tubb4aD249N / +, and ES Tubb4aD249N / D249N mice at P14, P21, and ~P35-P40. Statistical tests were performed by two-way ANOVA followed by Tukey's post-hoc test. Data are presented as mean and SEM. *p<0.05 and ***p<0.001. [Figure 8]Figures 8A-8G: Tubb4aD249 / D249N mice exhibit hypomyelination at P14. (Figure 8A) Schematic diagram displaying the time course of the immunohistochemical assay. (Figure 8B) Representative P14 images of eriochrome cyanin (Eri-C) staining (myelin [blue]) in the corpus callosum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 1 mm. (Figure 8C) Representative P14 images of PLP (green) in the corpus callosum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 250 µm. (Figure 8D) Representative P14 images of MBP (red) in the corpus callosum of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 250 μm. (Figure 8E) Representative P14 images of terminal eriochrome cyanine (Eri-C) staining (myelin [blue]) from WT, Tubb4aD249N, and Tubb4aD249N / D249N mice in the cerebellum. Scale bar = 1 mm. (Figure 8F) Representative P14 images of PLP (green) from WT, Tubb4aD249N, and Tubb4aD249N / D249N mice in the cerebellum. Scale bar = 1 mm. (Figure 8G) Representative P14 images of MBP (red) from WT, Tubb4aD249N, and Tubb4aD249N / D249N mice in the cerebellum. Scale bar = 250 μm. [Figure 9]Figures 9A-9J: Tubb4aD249N / D249N mice exhibit severe cerebellar granule neuron loss and significant striatal neuron loss. (Figure 9A) Schematic diagram displaying the time course of the immunohistochemical assay. (Figure 9B) Schematic diagram showing whole brain mounts of WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P40. (Figure 9C) Nissl-stained images of the cerebellum from WT and Tubb4aD249N / D249N mice at P21 and P40. Scale bar = 1 mm. (Figure 9D) Representative images of NeuN (green) showing cerebellar granule neurons at P21 and end stage (ES) in WT and Tubb4aD249N / D249N mice. Scale bar = 1 mm. (Figure 9E) Quantification of the number of cerebellar granule neurons / mm2 at P14, P21, and ES. (Figure 9F) Representative images of double-immunopositive cerebellar granule neurons stained for NeuN (green) and cleaved caspase-3 (red) (indicated by white arrows) in WT and Tubb4aD249N / D249N mice at P21 and ES. Scale bar = 25 µm. (Figure 9H) Schematic diagram of the striatum showing the area (dashed box) used for quantification of neuron number. Scale bar = 1 mm. (Figure 9I) Representative images of striatal neurons stained for NeuN (green) in ES from WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 100 µm. (Figure 9J) Quantification of striatal neuron number / mm2 in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14, P21, and ES. Statistical tests were performed by two-way ANOVA followed by Tukey's post-hoc test. Representative data from two independent experiments: n = 4 mice / group at P14 and P21 (except for Tubb4aD249N, n = 3 at P14), and n = 3 mice / group at ES. Data are shown as mean and SEM. *p < 0.05 and ***p < 0.001. [Figure 10] Figures 10A-10C: Tubb4aD249 / D249N mice exhibit hypomyelination. Representative Eri-C (myelin) staining images of sagittal sections of WT and Tubb4aD249N / D249N mice at P14 (Figure 10A), P21 (Figure 10B), and ES (Figure 10C) (scale bar = 1 mm). [Figure 11] Figures 11A-11K: Oligodendrocytes and neurons in Tubb4aD249N and Tubb4aD249 / D249N mice show reduced branching and processes. (Figures 11A-C) Representative images of PLP-labeled oligodendrocytes (OLs) isolated from WT, Tubb4aD249N, and Tubb4aD249 / D249N mice. Scale bar = 50 µm. (Figure 11D) The number of Olig2-labeled cells was counted in coverslips from WT, Tubb4aD249N, and Tubb4aD249 / D249N mice and plotted as a percentage of Olig2+ cells in WT animals. (Figure 11E) The total number of PLP+ cells in WT, Tubb4aD249N, and Tubb4aD249 / D249N mice was plotted as a percentage of PLP+ cells in WT animals. (Figure 11F) The number of mature PLP+ cells from total Olig2+ cells was plotted as a percentage of WT animals. Experiments were repeated at least three times independently. (Figure 11G) Representative image of cortical neurons from WT mice stained with Tuj1 (axon marker) and MAP2 (dendrite marker). (Figure 11H) Image of cortical neurons from Tubb4aD249 / D249N mice stained with Tuj1 and MAP2. Scale bar = 75 μm. (Figure 11I) The number of surviving neurons 1 week after plating was quantified and plotted as a percentage of WT neurons. (Figure 11J) Axon length was measured using the Neurote tracer plugin and plotted across all groups. (Figure 11K) Dendrite length was measured using the Neurote tracer plugin and plotted across all groups. Data are presented as mean and SEM. Data sets were subjected to one-way ANOVA followed by Tukey's post-hoc test. *p<0.05, ***p<0.001 [Figure 12]Figures 12A-12E: Tubb4aD249 / D249N mice show a decrease in the number of oligodendrocytes at P14 and P21. (Figure 12A-B) Representative images of ASPA-positive OLs from WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14 (Figure 12A) and P21 (Figure 12B). Scale bars = 50 μm and 25 μm. (Figures 12C-12D) Representative images of double-positive NG+Olig2+ cells from WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14 (Figure 12C) and P21 (Figure 12D). Scale bars = 50 μm and 25 μm. (Figure 12E) Quantification of Olig2+ cell counts at P14, P21, and ES. Statistical testing was performed using two-way analysis of variance followed by Tukey's post-hoc test. Data are presented as means and SEM. [Figure 13] Figures 13A-13F: Microtubule polymerization is impaired in Tubb4aD249N and Tubb4aD249 / D249N mice (Figure 13A). Example kymographs generated based on EB3 tracking from WT, Tubb4aD249N, and Tubb4aD249 / D249N cortical neurons (Figure 13B). A graph of the number of EB3 comets tracked per 100 μm over 10 min is plotted (Figure 13C). Velocity plots of microtubule polymerization for WT, Tubb4aD249N, and Tubb4aD249 / D249N based on EB3 tracking (Figures 13D-E). Total running time (Figure 13D) and running time histograms (Figure 13E) were plotted for WT, Tubb4aD249N, and Tubb4aD249 / D249N EB3 comets. (Figure 13F) Total distance traveled is plotted for WT, Tubb4aD249N, and Tubb4aD249 / D249NEB3 comets. Data are shown as mean and SEM. Data sets were subjected to one-way ANOVA followed by Tukey's post-hoc test. *p<0.05, **p<0.001, ***p<0.001. [Figure 14]Figures 14A-14E: Tubb4aD249 / D249N mice show comparable Purkinje neuron numbers. (Figure 14A) Representative images of cerebellar granule neurons and caspase staining at P14 in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bars = 1 mm and 50 μm. (Figure 14B) Representative images of striatal neurons at P14 and P21 in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bars = 100 μm. (Figure 14C) Nissl staining at P14 in WT and Tubb4aD249N / D249N mice. Scale bar = 1 mm. (Figure 14D) Representative images of Purkinje neurons stained with calbindin at P21 and terminal stages in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Scale bar = 100 µm. (Figure 14E) Quantification of the number of Purkinje neurons / mm2 at P21 and terminal stages in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice. Statistical tests were performed using two-way ANOVA followed by Tukey's post-hoc test. Data are presented as mean and SEM. [Figure 15] Figures 15A-15B: Tubb4aD249 / D249N mice exhibit OL cell death at P14 and P21. (Figure 15A) Representative images of double-positive Olig2+ caspases in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P14. (Figure 15B) Representative images of double-positive Olig2+ caspases in WT, Tubb4aD249N, and Tubb4aD249N / D249N mice at P21. Scale bars = 50 μm and 25 μm. [Figure 16]Figures 16A-16D: Map2 and Dapi staining of wild-type (Figure 16A) and Tubb4aD249 / D249N (Figure 16B) cells. Total neurons (Figure 16C) and striatal neurons (Figure 16D, CTIP2+ neurons) from TUBB4AD249 NiPSC-derived neurons exhibited reduced viability compared to control iPSC-derived neurons (Figure 16E), and TUBB4AD249N increased apoptosis and neuropathology (Figure 16F-G). CRISPR-mediated deletion of TUBB4A in control patient lines has no effect on neuronal development / formation. *p<0.05, **p<0.01, ***p<0.001 [Figure 17] Figures 17A-17B: Deletion of TUBB4A is neuroprotective in TUBB4AD249N MSNs. Quantification of total neurons (Figure 17A) and medium spiny neurons (Figure 17B) TUBB4AD249N MSNs. [Figure 18] Figures 18A-18C: (Figure 18A) Diagram of ASO electroporation. (Figure 18B) Diagram of ASO working principle. (Figure 18C) Selection of two promising ASOs after screening of the ASO library. ***p<0.0001. [Figure 19] Figure 19: Schematic diagram of the H-ABC in vivo whole animal model and treatment protocol. [Figure 20] Figures 20A-20C: Therapeutic effect of TUBB4A downregulation in an established Tubb4a D249N / D249N mouse model. The established mouse model was crossed with Tubb4a knockout (KO) mice, and these mice remained viable and appeared normal. (Figure 20A) Schematic of the crossing of Tubb4a transgenic mice. (Figure 20B) The resulting Tubb4a D249N / KO mice exhibited improved motor function and increased survival compared to Tubb4a D249N / D249N mice, with the survival rate of Tubb4a D249N / KO (~P108) being prolonged compared to Tubb4a D249N / D249N mice (~P35-P40). (Figure 20C) Improved motor function compared with Tubb4aD249N / KO vs. Tubb4aD249N / D249N (n=2-3, ***p<0.0001). [Figure 21]Figures 21A-21D: Evaluation of ASOs as viable therapeutic targets. A library of ASOs was screened using mouse Oli-neu cells. Two potent ASOs (ASOs 1316 and 1851) showed maximal Tubb4a knockdown. (Figure 21A) After screening the ASO library in vitro using qRT-PCR in Oli-Neu cells, two promising ASOs were selected. ***p<0.0001. A dose-response was established by administering a single intracerebroventricular (ICV) bolus injection at varying ASO doses (25, 10, 5, 2, 1, and 0.5 μg / g). The most potent ASO, ASO 1316, was selected for its minimal toxicity (data not shown). (Figure 21B) A single ICV injection of 2 μg / g of ASO into P1 Tubb4a D249N / D249N mice increased survival in treated mice compared with control mice (PBS, scrambled ASO). (Figure 21C) Tubb4a D249N / D249N mice treated with Tubb4a ASO also showed reduced seizures from P34-P37 compared with control mice (PBS, scrambled ASO) (Figure 21D). Furthermore, these mice showed significant improvements in motor function measured by rotarod at P28 and P35 (NC5-scrambled ASO; *p<0.01, **p<0.001, ***p<0.0001). [Figure 22] Figure 22: Overexpression of GFP-WT-Tubb4a in cultured Oli-Neu cells resulted in increased levels of MBP, PLP, and CNP mRNA as seen by qRT-PCR (n=4-6, ***p<0.05). (Mock-vehicle control) DETAILED DESCRIPTION OF THE INVENTION

[0019] Hypomyelination and atrophy of the basal ganglia and cerebellum (H-ABC) is a rare hypomyelinating leukodystrophy associated with causative mutations in tubulin alpha 4 (TUBB4A), with p.Asp249Asn (D249N) being the recurrent mutation occurring in the majority of affected individuals. Monoallelic mutations in TUBB4A can also cause a broader range of neurological disorders, ranging from early-onset encephalopathy to adult-onset dystonia type 4 (hoarseness and dysphonia). H-ABC falls within this spectrum and typically develops in childhood, characterized by dystonia, ataxia, gait disturbances, and progressive motor dysfunction, resulting in loss of walking before the first decade of life. Currently, there are no therapeutic approaches for this progressive, disabling pediatric disease. To understand how TUBB4A mutations cause H-ABC and facilitate the development and preclinical testing of therapeutic strategies, our group used a CRISPR-Cas9 approach to identify heterozygous (Tubb4a D249N ) or homozygous (Tubb4a D249N / D249N ) We developed a knock-in mouse model carrying a Tubb4a mutation.

[0020] Tubb4a mice D249N / D249N Tubb4a exhibits poor survival and progressive motor dysfunction with tremor, abnormal gait, and ataxia, recapitulating the disease phenotype. D249N / D249N Neuropathological evaluation of mice using immunolabeling and Western blotting at postnatal days 14, 21, and 40 demonstrated an initial delay in myelination followed by eventual demyelination. Myelin protein levels decreased over time, and ASPA-positive oligodendrocytes (myelin-forming cells in the CNS) were dramatically reduced. Ultrathin sections of the brain using electron microscopy further confirmed hypomyelination and the continued loss of myelin in the spinal cord and optic nerves of these mice. Furthermore, Tubb4a D249N / D249N In vitro studies of cultured oligodendrocytes from mice demonstrated reduced maturity and a reduction in myelin markers. Similarly, neuropathology revealed severe neuronal loss in the striatum and cerebellar granule cells. Furthermore, cultured neurons were also affected, with Tubb4a D249N / D249NIn mouse cells, they found reduced neuronal survival and destabilized microtubule activity. D249N / D249N The mouse model of H-ABC demonstrates the complexity of cellular physiology in this disease, and TUBB4A mutations cause microtubule instability, potentially resulting in severe neurodevelopmental phenotypes with cell-autonomous effects on oligodendrocytes, striatal neurons, and cerebellar granule cells.

[0021] In additional studies, we provide reprogrammed, induced, pluripotent stem cell lines derived from peripheral blood samples collected from H-ABC patients. The use of these cell lines has led to the discovery of a new therapeutic paradigm for leukodystrophies by down-modulating the nucleic acid encoding mutant Tubb-4a with nucleic acids targeting this sequence. Another approach involves providing vectors that overexpress wild-type Tubb-4a at targeted sites. Tubb-4a overexpression is associated with increased levels of MBP, PLP, and CNP mRNA, which should alleviate H-ABC symptoms in subjects requiring such treatment.

[0022] We also developed novel therapeutic antisense oligonucleotides that effectively down-modulate TUBB4A expression, thereby providing a new approach to the treatment of leukodystrophies.

[0023] definition The present subject matter may be more readily understood by reference to the following detailed description, which forms a part of this disclosure: It is to be understood that the present invention is not limited to the specific products, methods, conditions, or parameters described and / or illustrated herein, and that the terminology used herein is for the purpose of describing particular embodiments by way of example and is not intended to limit the claimed invention.

[0024] Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.

[0025] As employed above, and throughout this disclosure, the following terms and abbreviations, unless otherwise indicated, shall be understood to have the following meanings:

[0026] In this disclosure, the singular forms "a," "an," and "the" include plural references, and reference to a particular numerical value includes at least that particular value unless the context clearly dictates otherwise. Thus, for example, a reference to a "compound" is a reference to one or more of such compounds and equivalents thereof known to those of skill in the art, and the like. As used herein, the term "plurality" means two or more. When ranges of values are expressed, another embodiment includes the one particular value and / or the other particular value. Similarly, when values are expressed as approximations, it is understood that the particular value forms another embodiment by use of the antecedent "about." All ranges are inclusive and combinable.

[0027] As used herein, the terms "component," "composition," "composition of compounds," "compound," "drug," "pharmaceutical agent," "active agent," "therapeutic," "therapy," "treatment," or "pharmaceutical product" are used interchangeably herein and refer to a compound or compounds, or a composition of matter, that, when administered to a subject (human or animal), induces a desired pharmacological and / or physiological effect through local and / or systemic action. The terms "drug" and "test compound" refer to a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract made from biological material such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues. Biological macromolecules include siRNAs, shRNAs, antisense oligonucleotides, peptides, peptide / DNA complexes, and any nucleic acid-based molecule that exhibits the ability to modulate the activity of the TUBB4A-containing nucleic acids or their encoded proteins described herein.

[0028] As used herein, the term "TUBB4A" refers to a gene encoding a member of the beta-tubulin family. Beta-tubulin is one of two core protein families (alpha and beta tubulin) that heterodimerize and assemble to form microtubules. Mutations in this gene cause hypomyelination leukodystrophy-6, autosomal dominant torsion dystonia-4, and H-ABC, now more commonly referred to as TUBB4A-associated leukoencephalopathy. Reference sequences for TUBB4A are listed in GenBank, including NM_001289123.1, NM_001289127.1, and NM_001289129.1. Alternative splicing generates multiple transcript variants encoding distinct isoforms. The sequence of the wild-type Tubb4a protein is available in UniProt under Accession No. P04350-TBB4A_human. Several TUBB4A variants known to be associated with human disease have been identified and are listed in Table 1 below. Although the present invention focuses on the D249N mutant, the findings can be generalized to other existing TUBB4A mutations. [Table 1]

[0029] Table 2 lists the specific amino acid changes associated with various forms of TUBB4A-associated leukoencephalopathy. [Table 2]

[0030] As used herein, the terms "treatment" or "therapy" (and their different forms) include treatment that prevents or contributes to the prevention of disease (e.g., prophylactic), curative, or palliative. As used herein, the term "treating" includes alleviating or alleviating at least one adverse or negative effect or symptom of a condition, disease, or disorder.

[0031] As used herein, the terms "subject," "individual," and "patient" are used interchangeably and refer to animals, such as humans, to which the pharmaceutical composition according to the present invention is administered, including preventive treatment. As used herein, the term "subject" refers to humans and non-human animals. The terms "non-human animals" and "non-human mammals" are used interchangeably and include all vertebrates, such as mammals, including non-human primates (especially higher primates), sheep, dogs, rodents (e.g., mice or rats), guinea pigs, goats, pigs, cats, rabbits, cows, horses, and non-mammals, including reptiles, amphibians, chickens, and turkeys.

[0032] The terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides of any length, deoxyribonucleotides or ribonucleotides, or their analogs. A polynucleotide may contain one or more modified nucleotides, such as methylated nucleotides or nucleotide analogs. If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. The sequence of nucleotides may be interrupted by non-nucleotide components. A polynucleotide may be further modified after polymerization, such as by conjugation with a labeling component.

[0033] The term "wild-type," as used herein, is a term of art understood by those skilled in the art and refers to the typical form of an organism, strain, gene, or trait found in nature, as distinguished from mutant or variant forms. As used herein, the term "mutant" should be taken to mean the expression of a trait having a pattern that deviates from the wild-type or that consists of non-naturally occurring components.

[0034] The terms "non-naturally occurring" and "designed" are used interchangeably and indicate the involvement of human hand. The term, when referring to a nucleic acid molecule or polypeptide, means that the nucleic acid molecule or polypeptide is at least substantially free from at least one other component with which it is naturally associated, as found in nature.

[0035] The term "effective amount" or "therapeutically effective amount" refers to an amount of an agent sufficient to produce a beneficial or desired result. A therapeutically effective amount may vary depending on one or more of the subject and disease state being treated, the subject's weight and age, the severity of the disease state, the method of administration, etc., and can be easily determined by one of ordinary skill in the art. This term also applies to a dose that provides an image for detection by any one of the imaging methods described herein. A specific dose may vary depending on one or more of the particular agent selected, the dosing regimen to be followed, whether it is administered in combination with other compounds, the timing of administration, the tissue to be imaged, and the physical delivery system in which it is delivered.

[0036] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, within the skill of the art. Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd edition (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FM Ausubel, et al. eds., (1987)); series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2:A PRACTICAL APPROACH(MJ MacPherson, BD Hames and GR Taylor eds. (1995)), Harlow and Lane, eds. (1988) ``ANTIBODIES, A LABORATORY MANUAL'', ``ANIMAL CELL CULTURE'' (RI Freshney, ed. (1987)).

[0037] Some aspects of the present invention relate to one or more vectors or vector systems having such vectors. Vectors can be designed for the expression of CRISPR transcripts (e.g., nucleic acid transcripts, proteins, or enzymes) in prokaryotic or eukaryotic cells. For example, CRISPR transcripts can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors), yeast cells, or mammalian cells. Suitable host cells are further described in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press. San Diego, Calif. (1990). Alternatively, recombinant expression vectors can be transcribed and translated in vitro, for example, using T7 promoter regulatory sequences and T7 polymerase.

[0038] In some embodiments, the vector can be a mammalian expression vector used to drive expression of one or more sequences in mammalian cells. Examples of mammalian expression vectors include pCDM8 (Seed, 1987. Nature 329: 840) and pMT2PC (Kaufman, et al., 1987. EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are typically provided by one or more regulatory elements. For example, commonly used promoters are derived from poly(A) promoters, adenovirus 2, cytomegalovirus, simian virus 40, and others disclosed herein and known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, see, for example, Chapters 16 and 17 of Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[0039] In some embodiments, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., expressing the nucleic acid using tissue-specific regulatory elements). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert, et al., 1987. Genes Dev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton, 1988. Adv. Immunol. 43: 235-275), in particular promoters of T-cell receptors (Winoto and Baltimore, 1989. EMBO J. 8: 729-733) and immunoglobulins (Baneiji, et al., 1983. Cell 33: 729-740; Queen and Baltimore, 1983. Cell 33: 741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle, 1989. Proc. Natl. Acad. Sci. USA 86: 1989). 5473-5477), pancreatic-specific promoters (Edlund, et al., 1985, Science 230: 912-916), and mammary gland-specific promoters (e.g., milk whey promoters, U.S. Pat. No. 4,873,316 and European Patent Application Publication No. 264,166). Developmentally regulated promoters are also encompassed, such as mouse hox promoters (Kessel and Gruss, 1990, Science 249: 374-379) and the alpha-fetoprotein promoter (Campes and Tilghman, 1989, Genes Dev. 3: 537-546). To achieve high levels of expression, nucleic acids encoding Tubb4-A can be codon-optimized.

[0040] In general, the term "CRISPR system" collectively refers to the transcripts and other elements involved in directing the expression or activity of CRISPR-associated ("Cas") genes, including sequences encoding Cas genes, tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active portion tracrRNA), tracr mate sequences (which encompass "direct repeats" and tracrRNA-processing portion direct repeats in the context of endogenous CRISPR systems), guide sequences (also referred to as "spacers" in the context of endogenous CRISPR systems), or other sequences and transcripts from the CRISPR locus. In some embodiments, one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a particular organism that comprises an endogenous CRISPR system, such as Streptococcus pyogenes. In general, CRISPR systems are characterized by elements that promote the formation of a CRISPR complex at the site of a target sequence (also referred to as a protospacer in the context of endogenous CRISPR systems). In the context of CRISPR complex formation, a "target sequence" refers to a sequence to which a guide sequence is designed to be complementary, and hybridization between the target sequence and the guide sequence promotes CRISPR complex formation. Perfect complementarity is not required; only sufficient complementarity is required for hybridization to occur and promote CRISPR complex formation. A target sequence may be composed of any polynucleotide, such as a DNA or RNA polynucleotide. In some embodiments, the target sequence is located in the nucleus or cytoplasm of a cell. In some embodiments, the target sequence may be located within an organelle of a eukaryotic cell, such as a mitochondria or chloroplast. A sequence or template that can be used for recombination into a target locus that constitutes a target sequence is referred to as an "editing template," "editing polynucleotide," or "editing sequence." In aspects of the present invention, an exogenous template polynucleotide may be referred to as an editing template. In one aspect of the present invention, the recombination is homologous recombination.

[0041] In some embodiments, one or more vectors driving the expression of one or more elements of the CRISPR system are introduced into a host cell so that expression of the elements of the CRISPR system directs the formation of a CRISPR complex at one or more target sites. For example, a Cas enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence can each be operably linked to separate regulatory elements on separate vectors. Alternatively, two or more elements expressed from the same or different regulatory elements can be combined into a single vector, with one or more additional vectors providing any components of the CRISPR system not included in the first vector. The CRISPR system elements combined into a single vector can be arranged in any suitable orientation, such as one element being located 5' ("upstream") or 3' ("downstream") relative to the second element. The coding sequence of one element can be located on the same or opposite strand of the coding sequence of the second element and oriented in the same or opposite direction. In some embodiments, a single promoter drives expression of transcripts encoding a CRISPR enzyme and one or more of a guide sequence, a tracr mate sequence (optionally operably linked to a guide sequence), and a tracr sequence embedded within one or more intron sequences (e.g., each in a different intron, two or more in at least one intron, or all in one intron). In some embodiments, the CRISPR enzyme, guide sequence, tracr mate sequence, and tracr sequence are operably linked to and expressed from the same promoter.

[0042] In some embodiments, a vector comprises one or more insertion sites, such as restriction endonuclease recognition sequences (also referred to as "cloning sites"). In some embodiments, one or more insertion sites (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more insertion sites) are located upstream and / or downstream of one or more sequence elements of one or more vectors. In some embodiments, a vector comprises an insertion site upstream of a tracr mate sequence, and optionally downstream of a regulatory element operably linked to the tracr mate sequence, such that, upon insertion of a guide sequence into the insertion site, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell. In some embodiments, a vector comprises two or more insertion sites, each positioned between two tracer mate sequences to allow insertion of a guide sequence into each site. In such an arrangement, the two or more guide sequences may consist of two or more copies of a single guide sequence, two or more different guide sequences, or a combination thereof. When multiple different guide sequences are used, a single expression construct can be used to target CRISPR activity to multiple different corresponding target sequences in cells.For example, a single vector can contain about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20 or more guide sequences.In some embodiments, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more such guide sequence-containing vectors can be provided and optionally delivered to cells.In an alternative embodiment, the CRISPR-mediated base editor is base editor 4 (BE4) instead of BE3.It is worth noting that base editing can be used to modify any of the mutant nucleic acids listed in Table 1.

[0043] In some embodiments, the method further comprises evaluating a C base within the window for a change to another base. In embodiments, a gRNA is selected when the BE3 PAM sequence (NGG) is 13-17 nucleotides away from the target cytosine base(s). In certain embodiments, the change is from a C to a T on the sense strand, and the corrected codon is changed to a nonsense codon. In additional embodiments, the change is from a G to an A on the antisense strand, and the corrected codon is changed to a nonsense codon. In further embodiments, the change is from a C to a T on the sense strand, and the change is a missense variant. In further embodiments, the change is from a G to an A on the antisense strand, and the change is a missense variant. If the disease is a phenotype resulting from a mutation in the therapeutic gene, base editing may be performed before the onset of the disease. In certain embodiments, base editing reduces the risk of developing the disease.

[0044] The term "vector" refers to a single- or double-stranded circular nucleic acid molecule that can infect, transduce, or transform a cell and can independently or replicate within the host cell genome. Circular double-stranded nucleic acid molecules can be cut and linearized by treatment with a restriction enzyme. Knowledge of vectors, restriction enzymes, and the nucleotide sequences targeted by restriction enzymes is readily available to those skilled in the art, and includes any replicon, such as a plasmid, cosmid, bacmid, phage, or virus, to which another genetic sequence or element (either DNA or RNA) can be attached to result in replication of the attached sequence or element. The nucleic acid molecule of the present invention can be inserted into a vector by cutting the vector with a restriction enzyme and ligating the two fragments together.

[0045] In some aspects, the present invention provides methods comprising delivering one or more polynucleotides (e.g., CRISPR systems, antisense oligonucleotides, siRNAs, shRNAs, triplex nucleic acids, etc.), such as, for example, or one or more vectors described herein, one or more transcripts thereof, and / or one or more proteins transcribed therefrom, to a host cell. In some aspects, the present invention further provides cells produced by such methods, and organisms (e.g., animals, plants, or fungi) containing such cells or produced from such cells. In some embodiments, a CRISPR enzyme in combination (optionally complexed) with a guide sequence is delivered to the cell. Conventional viral and non-viral-based gene transfer methods can be used to introduce nucleic acids into mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding components of the CRISPR system to cells in culture or to a host organism. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the vectors described herein), naked nucleic acids, and nucleic acids complexed with delivery vehicles such as liposomes. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.For reviews of gene therapy procedures, see Anderson, Science 256:808-813 (1992); Nabel & Felgner, TIBTECH 11:211-217 (1993); Mitani & Caskey, TIBTECH 11:162-166 (1993); Dillon, TIBTECH 11:167-175 (1993); Miller, Nature 357:455-460 (1992); Van Brunt, Biotechnology 6(10):1149-1154 (1988); Vigne, Restorative Neurology and Neuroscience 8:35-36 (1995); Kremer & Perricaudet, British Medical Bulletin 51(1):31-44 (1995); Haddada et al., in Current Topics in Microbiology and Immunology Doerfler and Bihm (eds) (1995); and Yu et al., Gene Therapy 1:13-26 (1994).

[0046] Non-viral nucleic acid delivery methods include lipofection, nucleofection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, naked DNA, artificial virions, and drug-enhanced DNA incorporation. Lipofection is described, for example, in U.S. Patent Nos. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents (e.g., Transfectam™, Lipofectin™) are also commercially available. Cationic and neutral lipids suitable for efficient receptor-recognition lipofection of polynucleotides include those described in Feigner, WO91 / 17424; WO91 / 16024. Delivery can be to cells (e.g., in vitro or ex vivo administration) or target tissues (e.g., in vivo administration).

[0047] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those of skill in the art (e.g., Crystal, Science 270:404-410 (1995); Blaese et al., Cancer Gene Ther. 2:291-297 (1995); Behr et al., Bioconjugate Chem. 5:382-389 (1994); Remy et al., Bioconjugate Chem. 5:647-654 (1994); Gao et al., Gene Therapy 2:710-722 (1995); Ahmad et al., Cancer Res. 52:4817-4820 (1992); see U.S. Patent Nos. 4,186,183, 4,217,344, 4,235,871, 4,261,975, 4,485,054, 4,501,728, 4,774,085, 4,837,028, and 4,946,787).

[0048] The use of RNA or DNA virus-based systems for nucleic acid delivery takes advantage of the highly evolved process of targeting viruses to specific cells in the body and transporting the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or by treating cells ex vivo and then administering the treated cells to patients (ex vivo). Traditional virus-based systems include retroviral, lentiviral, adenoviral, adeno-associated viral, and herpes simplex viral vectors for gene transfer. Integration into the host genome is possible with retroviral, lentiviral, and adeno-associated viral gene transfer methods, often resulting in long-term expression of the inserted transgene. Furthermore, high transduction efficiencies have been observed in many different cell types and target tissues.

[0049] Retroviral tropism can be altered by incorporating foreign envelope proteins, expanding the potential target population of target cells. Lentiviral vectors are retroviral vectors that can transform or infect non-dividing cells and generally produce high viral titers. Therefore, the choice of retroviral gene transfer system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats and can package foreign sequences up to 6–10 kb. Minimal cis-acting LTRs are sufficient for vector replication and packaging, allowing therapeutic genes to be integrated into target cells and persistently express the transgene. Widely used retroviral vectors include those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., J. Virol. 66:2731-2739 (1992); Johann et al., J. Virol. 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., J. Virol. 63:2374-2378 (1989); Miller et al., J. Virol. 65:2220-2224 (1991); PCT / US94 / 05700).

[0050] For applications where transient expression is desired, adenovirus-based systems can be used. Adenovirus-based vectors can exhibit very high transduction efficiency in many cell types and do not require cell division. High titers and levels of expression have been obtained with such vectors. This vector can be produced in large quantities using a relatively simple system.

[0051] Adeno-associated virus ("AAV") vectors can also be used to introduce target nucleic acids into cells, e.g., in in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures (see, e.g., West et al., Virology 160:38-47 (1987); U.S. Pat. No. 4,797,368; WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994). Construction of recombinant AAV vectors is described in U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); Tratschin, et al., Mol. Cell. Biol. 4:2072-2081 (1984); Hermonat & Muzyczka, PNAS 81:6466-6470 (1984); and Samulski et al., J. Virol. 63:03822-3828 (1989)).

[0052] Packaging cells are typically used to produce viral particles capable of infecting host cells. Examples of such cells include 293 cells, which package adenovirus, and ψ2 or PA317 cells, which package retrovirus. Viral vectors used in gene therapy are typically generated by engineering cell lines that package nucleic acid vectors into viral particles. The vector contains minimal viral sequences necessary for packaging and subsequent integration into the host; other viral sequences are replaced with an expression cassette for the polynucleotide to be expressed. Missing viral functions are typically supplied in trans by the packaging cell line. For example, AAV vectors used in gene therapy contain only the ITR sequences of the AAV genome necessary for packaging and integration into the host genome. Viral DNA is packaged in a cell line containing a helper plasmid encoding other AAV genes, namely rep and cap, but lacking the ITR sequences. This cell line may also be infected with adenovirus as a helper. The helper virus facilitates AAV vector replication and expression of AAV genes from the helper plasmid. The helper plasmid is not packaged in significant amounts due to the lack of ITR sequences. Adenovirus contamination can be reduced by, for example, heat treatment, to which adenovirus is more sensitive than AAV.

[0053] In some embodiments, host cells are transiently or non-transiently transfected with one or more vectors described herein. In some embodiments, the cells are transfected as they naturally occur in the subject. In some embodiments, the transfected cells are harvested from the subject. In some embodiments, the cells are derived from cells harvested from the subject, such as a cell line.

[0054] In one aspect, the present invention provides a method for modifying a target polynucleotide in a eukaryotic cell, which may be in vivo, ex vivo, or in vitro. In some embodiments, the method comprises sampling a cell or population of cells from a human or non-human animal and modifying the cell or cells. Culturing may occur at any stage ex vivo. The cell or cells may be reintroduced into a human or non-human animal.

[0055] In one aspect, the present invention provides a method for modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to a target polynucleotide, causing cleavage of the target polynucleotide, thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within the target polynucleotide, the guide sequence being linked to a tracr mate sequence that in turn hybridizes to a tracr sequence.

[0056] In one aspect, the present invention provides a kit comprising any one or more of the elements disclosed in the methods and compositions described above. In some embodiments, the kit comprises a vector system or components for an alternative delivery system as described above, and instructions for use of the kit. In some embodiments, the vector or delivery system comprises (a) a first control element operably linked to a tracr mate sequence and one or more insertion sites for inserting a guide sequence upstream of the tracr mate sequence, wherein, upon expression, the guide sequence directs sequence-specific binding of a CRISPR complex to a target sequence in a eukaryotic cell, the CRISPR complex comprising (1) a guide sequence hybridized to the target sequence and (2) a CRISPR enzyme complexed with the tracr mate sequence hybridized to the tracr sequence, and / or (b) a second control element operably linked to an enzyme-encoding sequence encoding the CRISPR enzyme having a nuclear localization sequence. Elements may be provided individually or in combination, and may be provided in any suitable container, such as a vial, bottle, or tube. In some embodiments, the kit includes instructions in one or more languages, for example, in two or more languages.

[0057] In some embodiments, the kit includes one or more reagents for use in a process utilizing one or more elements described herein. The reagents may be provided in any suitable container. For example, the kit may provide one or more reaction or storage buffers. The reagents may be provided in a form that is ready for use in a particular assay or that requires the addition of one or more other components prior to use (e.g., concentrated or lyophilized). The buffer can be any buffer, including, but not limited to, sodium carbonate buffer, sodium bicarbonate buffer, borate buffer, Tris buffer, MOPS buffer, HEPES buffer, and combinations thereof. In some embodiments, the buffer is alkaline. In some embodiments, the buffer has a pH of about 7 to about 10. In some embodiments, the kit includes one or more oligonucleotides corresponding to guide sequences for insertion into a vector so that the guide sequence and regulatory elements are operably linked. In some embodiments, the kit includes a homologous recombination template polynucleotide.

[0058] Down-modulating or inhibitory nucleic acids include, but are not limited to, antisense molecules, aptamers, ribozymes, triplex-forming molecules, RNA interference (RNAi), CRISPR (clustered regularly interspaced short palindromic repeats) RNA (crRNA), and external guide sequences. These nucleic acid molecules can act as influencers, inhibitors, regulators, and stimulators of specific activities of target molecules, and functional nucleic acid molecules can have de novo activities that are independent of other molecules. In certain embodiments, inhibitory nucleic acids are employed.

[0059] Antisense molecules are designed to interact with target nucleic acid molecules through canonical or non-canonical base pairing. The interaction between the antisense molecule and the target molecule is designed to promote the destruction of the target molecule, for example, by RNase H-mediated degradation of RNA-DNA hybrids. Alternatively, antisense molecules are designed to inhibit the processing functions normally performed by the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. There are many methods to find the most accessible regions of the target molecule and optimize the efficiency of antisense. Exemplary methods include in vitro selection experiments and DNA modification studies using DMS or DEPC. Antisense molecules can be designed to inhibit the target molecule's normal functions, such as transcription or replication. -6 , 10 -8 , 10 -10 , 10 -12 The following dissociation constants (K d ) to bind to the target molecule. Representative examples of methods and techniques useful in the design and use of antisense molecules are described in U.S. Patent Nos. 5,135,917, 5,294,533, 5,627,158, 5,641,754, 5,691,317, 5,780,607, 5,786,138, 5,849,903, 5,856,103, 5,919,772, 5,955,590, and 5,990 ,088, 5,994,320, 5,998,602, 6,005,095, 6,007,995, 6,013,522, 6,017,898, 6,018,042, 6,025,198, 6,033,910, 6,040,296, 6,046,004, 6,046,319, and 6,057,437.

[0060] Triplex-forming functional nucleic acid molecules are molecules that can interact with double-stranded or single-stranded nucleic acids. When a triplex molecule interacts with a target region, a structure called a triplex is formed, in which three strands of DNA form a complex that relies on both Watson-Crick base pairing and Hoogsteen base pairing. Triplex molecules are preferred because they can bind to target regions with high affinity and specificity. Triplex-forming molecules can be used in a variety of applications, including: -6 , 10 -8 , 10 -10 , or 10 -12 The following K dPreferably, triplex-forming molecules are used to bind to target molecules.Representative examples of the method of using triplex-forming molecules to bind various different target molecules are described in U.S. Patent Nos. 5,176,996, 5,176,996, 5,645,985, 5,650,316, 5,683,874, 5,693,773, 5,834,185, 5,869,246, 5,874,566 and 5,962,426.In addition, RNA interference (RNAi) can suppress gene expression very specifically. This silencing was originally observed by the addition of double-stranded RNA (dsRNA) (Fire, A., et al., Nature, 391:806-11 (1998); Napoli, C., et al., Plant Cell, 2:279-89 (1990); Hannon, GJ, Nature, 418:244-51 (2002)). Once inside the cell, dsRNA is cleaved by the RNase III-like enzyme Dicer to produce double-stranded small interfering RNAs (siRNAs) of 21–23 nucleotides in length containing two-nucleotide overhangs at the 3' end (Elbashir, S.M., et al., Genes Dev., 15:188-200 (2001); Bernstein, E., et al., Nature, 409:363-6 (2001); Hammond, S.M., et al., Nature, 404:293-6 (2000)). In an ATP-dependent process, siRNAs are integrated into a multisubunit protein complex commonly known as the RNAi-induced silencing complex (RISC), which guides the siRNA to its target RNA sequence (Nykanen, A., et al., Cell, 107:309-21 (2001)). At some point, the siRNA duplex unwinds, and the antisense strand remains bound to RISC, apparently directing the degradation of the complementary mRNA sequence by a combination of endonucleases and exonucleases (Martinez, J., et al., Cell, 110:563-74 (2002)). However, the effects and uses of RNAi and siRNA are not limited to any one mechanism.

[0061] Small interfering RNA (siRNA) is a double-stranded RNA that can induce sequence-specific post-transcriptional gene silencing, thereby reducing or inhibiting gene expression. In some cases, siRNA induces specific degradation of homologous RNA molecules, such as mRNA, within the region of sequence identity between the siRNA and the target RNA. For example, WO02 / 44321 discloses siRNAs that can sequence-specifically degrade target mRNA when base-matched with the 3' overhang end, and the method for producing these siRNAs is incorporated herein by reference. Sequence-specific gene silencing can be achieved in mammalian cells using synthetic short double-stranded RNAs that mimic the siRNAs produced by the enzyme Dicer (Elbashir, SM, et al., Nature, 411:494-498 (2001); Ui-Tei, K., et al., FEBS Lett, 479:79-82 (2000)). siRNAs can be synthesized chemically or in vitro, or they can be short, double-stranded, hairpin-like RNAs (shRNAs) processed into siRNAs within cells. Synthetic siRNAs are typically designed using algorithms and conventional DNA / RNA synthesizers. Suppliers include Ambion (Austin, TX), ChemGenes (Ashland, MA), Dharmacon (Lafayette, CO), Glen Research (Sterling, VA), MWB Biotech (Esbersberg, Germany), Proligo (Boulder, CO), and Qiagen (Vento, The Netherlands). siRNAs can also be synthesized in vitro using kits such as Ambion's SILENCER™ siRNA Construction Kit.

[0062] Similar to RNAi, CRISPR (clustered regularly interspaced short palindromic repeats) interference is a powerful approach to reduce gene expression of endogenously expressed proteins through selective DNA cleavage. CRISPRs are genetic elements containing direct repeats separated by unique spacers, many of which are identical to sequences found in phages and other foreign genetic elements. Recent studies have revealed the role of CRISPR in adaptive immunity and demonstrated that CRISPR-derived small RNAs (crRNAs) have been implemented as homing oligonucleotides for targeted interference of foreign DNA (Jinek et al., Science, 337:816-821 (2012)). crRNAs are used to selectively cleave DNA at the gene level.

[0063] shRNAs (short hairpin RNAs) are RNA structures that form tight hairpin turns and are used to silence gene expression by RNA interference. The hairpin structure of shRNAs is cleaved by the cellular machinery to form small interfering RNAs (siRNAs), which then bind to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs that match the siRNAs bound to it.

[0064] As used herein, the term "overexpression" when referring to the production of a protein in a host cell means that the protein is produced in greater amounts than it would be produced in its natural environment.

[0065] As used herein, the term "genetic modification" refers to a change from the wild-type or reference sequence of one or more nucleic acid molecules. Genetic modifications include, but are not limited to, base pair substitutions, additions, and deletions of at least one nucleotide from a nucleic acid molecule of known sequence.

[0066] As used herein, the term "solid matrix" refers to any format such as beads, microparticles, microarrays, the surface of a microtiter well or test tube, a dipstick or filter, etc. The material of the matrix can be polystyrene, cellulose, latex, nitrocellulose, nylon, polyacrylamide, dextran, or agarose.

[0067] The phrase "consisting essentially of" when referring to a particular nucleotide or amino acid refers to a sequence having the characteristics of a given SEQ ID NO. For example, when used in reference to an amino acid sequence, the phrase includes the sequence itself and molecular modifications that would not affect the functional and novel properties of the sequence.

[0068] As used herein, "target nucleic acid" refers to a previously defined region of nucleic acid present in a complex nucleic acid mixture, wherein the defined wild-type region contains at least one known nucleotide mutation associated with leukodystrophy. Nucleic acid molecules can be isolated from natural sources by cDNA cloning or subtractive hybridization, or can be manually synthesized. Nucleic acid molecules can be manually synthesized by triester synthesis or can be synthesized using an automated DNA synthesizer.

[0069] The term "complementary" refers to two nucleotides that can form multiple favorable interactions with each other. For example, adenine is complementary to thymine, forming two hydrogen bonds. Similarly, guanine and cytosine are complementary because they can form three hydrogen bonds. Thus, if a nucleic acid sequence contains the base sequence thymine, adenine, guanine, and cytosine, a "complement" of this nucleic acid molecule would be a molecule containing adenine in place of thymine, thymine in place of adenine, cytosine in place of guanine, and guanine in place of cytosine. A complement can contain nucleic acid sequences that form optimal interactions with the parent nucleic acid molecule, allowing such a complement to bind to the parent molecule with high affinity.

[0070] The term "promoter element" describes a nucleotide sequence incorporated into a vector that, once inside an appropriate cell, can facilitate the binding of transcription factors and / or polymerases and the subsequent transcription of a portion of the vector DNA into mRNA. In one embodiment, a promoter element of the present invention precedes the 5' end of a leukodystrophy-specific marker nucleic acid molecule, allowing the latter to be transcribed into mRNA. The host cell's machinery then translates the mRNA into a polypeptide.

[0071] Those skilled in the art will recognize that nucleic acid vectors can contain nucleic acid elements other than promoter elements and leukodystrophy-specific marker gene nucleic acid molecules, including, but not limited to, origins of replication, ribosome binding sites, nucleic acid sequences encoding drug resistance enzymes or amino acid metabolic enzymes, and nucleic acid sequences encoding secretion signals, localization signals, or signals useful for purifying the polypeptide.

[0072] A "replicon" refers to any genetic element capable of replication largely under its own control, e.g., a plasmid, cosmid, bacmid, plastid, phage, virus, etc. Replicons can be either RNA or DNA, single- or double-stranded.

[0073] An "expression operon" refers to a nucleic acid segment that may have transcriptional and translational control sequences, such as promoters, enhancers, translation initiation signals (e.g., ATG or AUG codons), polyadenylation signals, terminators, and the like, that can facilitate the expression of a polypeptide-encoding sequence in a host cell or organism.

[0074] As used herein, the terms "reporter," "reporter system," "reporter gene," or "reporter gene product" refer to an operable genetic system in which the nucleic acid comprises a gene encoding a product that, upon expression, generates a reporter signal readily measurable, for example, by biological assay, immunoassay, radioimmunoassay, or colorimetric, fluorescent, or chemiluminescent methods. The nucleic acid may be RNA or DNA, linear or circular, single-stranded or double-stranded, and antisense or sense polarity, and is operably linked to the control elements required for expression of the reporter gene product. The necessary control elements will vary depending on the nature of the reporter system and whether the reporter gene is in DNA or RNA form, but may include, but are not limited to, promoters, enhancers, translational control sequences, poly(A) addition signals, transcription termination signals, and other elements.

[0075] As noted above, the introduced nucleic acid may or may not be integrated (covalently linked) into the nucleic acid of the recipient cell or organism. For example, in bacterial, yeast, plant, or mammalian cells, the introduced nucleic acid may be maintained as an independent replicon, such as an episomal element or a plasmid. Alternatively, the introduced nucleic acid may be integrated into the nucleic acid of the recipient cell or organism, stably maintained in that cell or organism, and further inherited or inherited by cells or organisms of the recipient cell or organism's progeny. Finally, the introduced nucleic acid may be present only transiently in the recipient cell or host organism.

[0076] The term "operably linked" means that regulatory sequences required for expression of a coding sequence are positioned in the DNA molecule in the appropriate position relative to the coding sequence to effect expression of the coding sequence. This same definition can also be applied to the arrangement of transcription units and other transcription control elements (e.g., enhancers) in an expression vector.

[0077] The phrase "modified backbone linkage" includes, but is not limited to, phosphorothioate linkage, methyl phosphonate linkage, ethyl phosphonate linkage, boranophosphate linkage, sulfonamide, carbonyl amide, phosphorodiamidate, phosphorodiamidate linkage with positively charged side groups, phosphorodithioate, aminoethylglycine, phosphotriester, aminoalkyl phosphotriester, 3'-alkylene phosphonate, 5'-alkylene phosphonate, chiral phosphonate, phosphinate, 3'-amino phosphoramidate, aminoalkyl phosphoramidate, thionophosphoramidate, thionoalkylphosphonate, thionoalkylphosphinate ... Included are phototriesters, selenophosphates, 2-5' linked boranophosphonate analogs, linkages with inverted polarity, abasic linkages, short chain alkyl linkages, cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, short chain heteroatom or heterocyclic internucleoside linkages with a siloxane backbone, sulfide, sulfoxide, sulfone, formacetyl linkages, thioformacetyl linkages, methyleneformacetyl linkages, riboacetyl linkages, alkene linkages, sulfamate backbones, methyleneimino linkages, methylenehydrazino linkages, sulfonate linkages, and amide bonds.

[0078] The phrase "modified sugar" includes, but is not limited to, 2' fluoro, 2' fluoro substituted ribose, 2'-fluoro-D-arabinonucleic acid (FANA), 2'-O-methoxyethyl ribose, 2'-O-methoxyethyl deoxyribose, 2'-O-methyl substituted ribose, morpholino, piperazine, and locked nucleic acid (LNA).

[0079] A "specific binding pair" refers to a specific binding member (sbm) and a binding partner (bp) that have a particular specificity for each other and that, under normal conditions, bind preferentially to other molecules. Examples of specific binding pairs include antigens and antibodies, ligands and receptors, and complementary nucleotide sequences. Those skilled in the art will recognize many other examples. Furthermore, the term "specific binding pair" also applies when either or both of the specific binding member and binding partner comprise portions of a larger molecule. In embodiments where the specific binding pair comprises nucleic acid sequences, they are long enough to hybridize with each other under assay conditions, preferably greater than 10 nucleotides in length, and more preferably greater than 15 or 20 nucleotides in length.

[0080] A "sample" or "patient sample" or "biological sample" generally refers to a sample that can be tested for a particular molecule, preferably a leukodystrophy-specific marker molecule, such as the markers set forth in the table below. Samples can include, but are not limited to, cells, body fluids such as blood, serum, plasma, urine, saliva, cerebrospinal fluid, tears, pleural effusion, etc.

[0081] Kits and Manufactured Products Any of the aforementioned products can be incorporated into a kit containing a TUBB-4A-induced down-modulation nucleic acid in a pharmaceutically acceptable carrier. The nucleic acid may or may not be placed in a vector capable of transducing mammalian cells. In other embodiments, the kit includes a vector expressing a nucleic acid encoding human wild-type TUBB-4A and / or mutant TUBB-4A for overexpression in target cells of interest. The kit can optionally include a nanoparticle or liposome formulation to facilitate intracellular delivery of the nucleic acid. The kit may also include instructions for use, a container, a container for administration, a substrate for an assay, or any combination thereof.

[0082] Drug development and screening methods Because the genetic alterations in TUBB4-A identified herein are associated with the pathogenesis of H-ABC, methods to identify agents that modulate the activity of the mutated gene and its encoded product should lead to the generation of effective therapeutic agents for the treatment of leukodystrophies, particularly H-ABC.

[0083] Molecular modeling should facilitate the identification of specific organic molecules capable of binding to the active site of the altered TUBB4-A protein based on structural or key amino acid residues required for function. Combinatorial chemistry techniques will be used to identify molecules with the greatest activity, and then iterations of these molecules will be developed for further cycles of screening.

[0084] The polypeptide or fragment used in drug screening assays can be free in solution, fixed on a solid support, or intracellular.One method of drug screening utilizes eukaryotic or prokaryotic host cells stably transformed with recombinant polynucleotides expressing the polypeptide or fragment, preferably by competitive binding assays.Such cells can be used in standard binding assays, either in live or immobilized form.For example, the formation of complexes between the polypeptide or fragment and the drug being tested can be determined, or the degree to which the drug being tested disrupts the formation of complexes between the polypeptide or fragment and a known substrate can be examined.

[0085] Another technique for drug screening provides for high-throughput screening of compounds with suitable binding affinity for an encoded polypeptide and is described in detail in PCT published application WO 84 / 035564 to Geysen, published September 13, 1984. Briefly, large numbers of different small peptide test compounds, as described above, are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with the target polypeptide and washed. Bound polypeptide is detected by methods well known in the art.

[0086] Another technique for drug screening involves using host eukaryotic cell lines or cells (as described above) with non-functional or modified TUBB4-A-related genes. These host cell lines or cells are defective at the polypeptide level. The host cell lines or cells are grown in the presence of a drug compound. The rate of cellular metabolism of the host cells is measured to determine whether the compound can regulate the cellular metabolism of the defective cells. Methods for introducing DNA molecules are also well known to those skilled in the art, as described above.

[0087] Host cells expressing the H-ABC-related nucleic acids of the present invention, or functional fragments thereof, provide a system for screening potential compounds or drugs for their ability to modulate the development of leukodystrophy. Thus, in one embodiment, the nucleic acid molecules of the present invention can be used to generate recombinant cell lines for use in assays to identify drugs that modulate aspects of cellular metabolism related to neuronal signaling and neuronal communication and structure. Also provided herein are methods for screening for compounds that can modulate the function of proteins encoded by TUBB4-A-containing nucleic acids.

[0088] Another approach uses a phage display library designed to express fragments of the polypeptide encoded by the modified TUBB4-A nucleic acid on the surface of the phage. Such a library is then contacted with a combinatorial chemical library under conditions that allow detection of binding affinity between the expressed peptides and components of the chemical library. U.S. Patent Nos. 6,057,098 and 5,965,456 describe methods and devices for performing such assays. Such compound libraries are commercially available from a number of companies, including, but not limited to, Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Microsour (New Milford, CT), Aldrich (Milwaukee, WI), Akos Consulting and Solutions GmbH (Basel, Switzerland), Ambinter (Paris, France), Asinex (Moscow, Russia), Aurora (Graz, Austria), BioFocus DPI (Switzerland), Bionet (Camelford, UK), Chembridge (San Diego, CA), and Chem Div (San Diego, CA). Those skilled in the art will be aware of, and can readily purchase, other sources. Once therapeutically active compounds are identified using the screening assays described herein, they can be formulated into pharmaceutical compositions and used to treat H-ABC.

[0089] The goal of rational drug design is to create structural analogs of biologically active polypeptides of interest or small molecules with which they interact (e.g., agonists, antagonists, inhibitors), e.g., to create more active or stable forms of the polypeptides, or drugs that enhance or interfere with the function of the polypeptides in vivo. See, e.g., Hodgson, (1991) Bio / Technology 9:19-21. In one approach described above, the three-dimensional structure of a protein of interest or, for example, a protein-substrate complex is solved by X-ray crystallography, nuclear magnetic resonance, computer modeling, or, most typically, a combination of approaches. Useful information about the structure of a polypeptide is rarely obtained by modeling based on the structure of a homologous protein. An example of rational drug design is the development of HIV protease inhibitors (Erickson et al., (1990) Science 249:527-533). Additionally, peptides can be analyzed by alanine scanning (Wells, (1991) Meth. Enzym. 202:390-411). In this technique, amino acid residues are substituted with Ala and the effect on the activity of the peptide is determined. In this way, each amino acid residue of the peptide is analyzed to determine the critical regions of the peptide.

[0090] It is also possible to isolate target-specific antibodies, selected by functional assays, and solve their crystal structures. In principle, this approach could yield a pharmacore from which drug design could be based.

[0091] Alternatively, protein crystallography can be avoided entirely by generating anti-idiotypic antibodies (anti-IDs) against functional, pharmacologically active antibodies. As mirror images of mirror images, the binding site of the anti-ID is predicted to be an analog of the original molecule. The anti-IDs are then used to identify and isolate peptides from banks of chemically or biologically generated peptides. Selected peptides then serve as the pharmacore.

[0092] In another embodiment, the availability of modified TUBB-4A nucleic acids allows for the production of strains of laboratory mice carrying the leukodystrophy-associated TUBB4-A nucleic acids of the present invention. Transgenic mice expressing the leukodystrophy-associated nucleic acids of the present invention provide a model system for studying the role of mutant Tubb4-a proteins encoded by g nucleic acids in the development and progression of leukodystrophy. Methods for introducing transgenes into laboratory mice are known to those skilled in the art and are described below. Three common methods include: 1. integration of a retroviral vector encoding a foreign gene of interest into early embryos; 2. injection of DNA into the pronuclei of newly fertilized eggs; and 3. integration of genetically engineered embryonic stem cells into early embryos. By generating such transgenic mice, the roles that target proteins play in various cellular metabolisms and the nervous system can be elucidated at the molecular level. Such mice provide in vivo screening tools for studying putative therapeutic agents in a whole-animal model and are encompassed by the present invention.

[0093] The term "animal" is used herein to include all vertebrates except humans. It also includes individual animals at all stages of development, including embryonic and fetal stages. A "transgenic animal" refers to an animal containing one or more cells that contain genetic information that has been altered or received, directly or indirectly, through deliberate genetic manipulation at the subcellular level, such as targeted recombination, microinjection, or infection with a recombinant virus. The term "transgenic animal" does not encompass classical crossbreeding or in vitro fertilization; rather, it is intended to encompass animals in which one or more cells have been altered by or received a recombinant DNA molecule. This molecule may be targeted to a specific locus, randomly integrated into a chromosome, or extrachromosomally replicated DNA. The term "germline transgenic animal" refers to a transgenic animal in which genetic modifications or information have been introduced into germline cells, thereby conferring the ability to transmit genetic information to offspring. If the offspring actually possess some or all of the modifications or genetic information, the offspring are also transgenic animals.

[0094] The DNA used to modify the target gene can be obtained by a variety of techniques, including, but not limited to, isolation from genomic sources, preparation of cDNA from isolated mRNA templates, direct synthesis, or a combination thereof.

[0095] A preferred type of target cell for introducing a transgene is an embryonic stem cell (ES). ES cells can be obtained from preimplantation embryos cultured in vitro (Evans et al., (1981) Nature 292:154-156; Bradley et al., (1984) Nature 309:255-258; Gossler et al., (1986) Proc. Natl. Acad. Sci. 83:9065-9069). A transgene can be efficiently introduced into ES cells by standard techniques, such as DNA transfection or retrovirus-mediated transfection. The resulting transformed ES cells can then be combined with a blastocyst of a non-human animal. The introduced ES cells then colonize the embryo and contribute to the germline of the resulting chimeric animal.

[0096] Techniques are available to inactivate or modify any gene region to the desired mutation. As used herein, a knock-in animal refers to, for example, an animal in which the endogenous mouse gene is replaced with the human leukodystrophy-associated TUBB4-A gene of the present invention. Such knock-in animals provide an ideal model system for studying the development of leukodystrophy. Knock-out animals can also be generated.

[0097] As used herein, expression of a leukodystrophy-associated nucleic acid, or fragment thereof, can be targeted in a "tissue-specific" or "cell-type-specific" manner using a vector in which a nucleic acid sequence encoding all or part of a leukodystrophy-associated nucleic acid is operably linked to regulatory sequences (e.g., promoters and / or enhancers) that direct expression of the encoded protein in a particular tissue or cell type. Such regulatory elements can be advantageously used for both in vitro and in vivo applications. Promoters for directing tissue-specific proteins are well known in the art and are described herein.

[0098] Methods for using the transgenic mice of the invention are also described herein. Transgenic mice into which a nucleic acid comprising leukodystrophy-associated TUBB4-A or its encoded protein has been introduced are useful, for example, for developing screening methods for screening therapeutic agents to identify those capable of modulating the development of leukodystrophy.

[0099] Pharmaceuticals and peptide therapeutics The elucidation of the role of the leukodystrophy-associated CNVs / SNPs described herein in neuronal signaling and brain structure facilitates the development of pharmaceutical compositions useful for the treatment and diagnosis of leukodystrophies. These compositions may contain, in addition to one of the substances described above, pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other materials will depend on the route of administration, such as oral, intravenous, cutaneous or subcutaneous, intranasal, intramuscular, or intraperitoneal.

[0100] Pharmaceutical Composition Pharmaceutical compositions containing derivatives of therapeutic, prophylactic, or diagnostic agents, such as functional nucleic acid derivatives, can be administered parenterally to subjects in need of such treatment. Parenteral administration can be performed by subcutaneous, intramuscular, or intravenous injection using a syringe, optionally a pen-type syringe. Parenteral administration can also be performed using an infusion pump. A further option is to administer the therapeutic, prophylactic, or diagnostic agent to the nose or lungs, preferably in a composition, powder, or liquid specially designed for that purpose.

[0101] Injectable compositions of therapeutic, prophylactic, or diagnostic agent derivatives can be prepared using conventional pharmaceutical techniques, including dissolving and mixing the components as needed to obtain the desired final product. Thus, according to one procedure, the therapeutic, prophylactic, or diagnostic agent derivative can be dissolved in a volume of water slightly less than the final volume of the composition to be prepared. If necessary, tonicity agents, preservatives, and buffers can be added, and the pH of the solution can be adjusted, if necessary, with an acid such as hydrochloric acid or a base such as aqueous sodium hydroxide. Finally, the volume of the solution can be adjusted with water to obtain the desired concentration of the components.

[0102] In some embodiments, the buffer may be selected from the group consisting of sodium acetate, sodium carbonate, citrate, glycylglycine, histidine, glycine, lysine, arginine, sodium dihydrogen phosphate, disodium hydrogen phosphate, sodium phosphate, and tris(hydroxymethyl)-aminomethane, bicine, tricine, malic acid, succinic acid, maleic acid, fumaric acid, tartaric acid, aspartic acid, or mixtures thereof. Each of these specific buffers, and combinations thereof, constitutes an alternative embodiment.

[0103] To facilitate the practice of the present invention, the following materials and methods are provided.

[0104] Creation of model mice Heterozygous Tubb4a D249N Mice were generated by inserting the p.Asp249Asn (c.745G>A) mutation into exon 4 of the Tubb4a gene using clustered regularly interspaced short palindromic repeats (CRISPR)-Cas-9 technology. The mouse Tubb4a gene is located on chromosome 17, which has four exons. Cas9 mRNA, gRNA, and oligonucleotides (carrying the targeting sequence and flanked by 120 bp of homologs on both sides) were co-injected into zygotes. The resulting CRISPR knock-in mouse model expresses the Tubb4a gene (Tubb4a D249N) has a heterozygous point mutation, c.745G>A, in one allele of Tubb4a. These heterozygous mice were bred to generate heterozygous Tubb4a D249N In addition to animals, homozygous Tubb4a , similar to the homozygous mutation found in the taeip rat model ( Li et al., 2003 ), D249N / D249N We generated wild-type (WT) and Tubb4a mice. D249N , Tubb4a D249N / D249N Mice were included in all analyses. Animals were genotyped at all experimental stages. Mice were housed in a clean facility under a 12-hour light:12-hour dark cycle and had free access to food and water. Experimental methods and research protocols were fully approved by the Institutional Animal Care and Use Committee at The Children's Hospital of Philadelphia and adhered to the revised National Institutes of Health Laboratory Animal Welfare Policy.

[0105] behavior analysis Gait angle, walking force, hanging grip strength, righting reflex ( Feather-Schussler and Ferguson, 2016 ), and rotarod ( Shiotsuki et al., 2010 ) were assessed at defined developmental intervals ( Figure 1 ). Behavioral testing included cohorts of at least 10 animals per condition.

[0106] Tissue processing Mice were deeply anesthetized with a mixture of 90–150 mg / kg ketamine and 7.5–16 mg / kg xylazine depending on body weight. After initial washing with 1X PBS, they were transcardially perfused with 4% paraformaldehyde (PFA) in 1X phosphate-buffered saline (PBS) (Thermo Fisher Scientific, USA). Brains were harvested and post-fixed overnight in 4% PFA in 1X PBS. The tissue was then dehydrated in 30% sucrose in 1X PBS. Brains were embedded in optimal cutting temperature compound (OCT Compound, SAKURA, 4583, USA) and sliced into coronal or sagittal sections (50 μm) using a cryostat microtome (CM 3050 S, Leica Biosystems, USA).

[0107] Immunohistochemistry and image acquisition Myelin quantification and neurofilament staining were performed with eriochrome cyanine (Eri-C) staining according to previously published protocols ( Sahinkaya et al., 2014 ).

[0108] For Nissl staining, frozen sections were stained with 0.1% cresyl violet for 15 minutes, then washed with PBS, dehydrated in graded alcohols (70-100%), followed by xylene treatment and mounting with Permount. For immunofluorescence staining, free-floating sections were blocked with 2% bovine serum albumin (BSA) and 0.1% Triton (Tx)-100 for 1 hour at room temperature, and then sequentially incubated with primary antibody overnight at 4°C and fluorescent secondary antibody for 1 hour at room temperature. Primary antibodies included rat anti-proteolipid protein (PLP) (IDDRC hybridoma, kindly provided by Dr. Judith Grinspan), rabbit anti-myelin basic protein (MBP) (1:250, Abcam, Cat: ab40389), rabbit anti-NG2 (1:250, US biological, Cat: C5067-70D), mouse anti-Olig2 (1:100, Millipore, MABN50), mouse anti-neuronal nuclei (NeuN) (1:1000, Millipore, Cat: MAB377), rabbit anti-aspartoacylase (ASPA) (1:1000, Millipore, Cat: GTX110699), rabbit anti-cleaved caspase (1:200, Cell Signaling; Cat: #9579), and rabbit anti-calbindin (1:250, Swant, Cat: CB38). The secondary antibodies used were AlexaFluor-488- or AlexaFluor-647-conjugated secondary antibodies for rabbit, mouse, or rat (1:1000, Invitrogen). Nuclei were counterstained with DAPI.

[0109] Immunoblotting To measure protein levels of the major myelin proteins, PLP and MBP, in the cerebellum and forebrain at P14, P21, and terminal stages, brain tissue was lysed in RIPA buffer (Thermo Fischer Scientific, USA) in the presence of protease and phosphatase inhibitors (Sigma-Aldrich, USA). Samples were boiled in Laemmli buffer and electrophoresed under reducing conditions on SDS-PAGE gels (4-15% Mini Protein Precast Gels, Biorad, USA). Proteins were transferred to nitrocellulose membranes by electroblotting (Trans-blot Turbo transfer system, Biorad, USA). Membranes were blocked with blocking buffer (1% nonfat milk, BioRad) prepared with 0.05% Tween 20 in Tris-buffered saline (TBST) and then incubated overnight at 4°C with primary antibodies against rat anti-PLP (1:1000, provided by Dr. Judith Grinspan, IDDRC hybridoma) and rabbit anti-MBP (1:2000, Abcam, Cat:ab40389) diluted in blocking buffer. The membranes were washed five times with TBST and incubated with secondary HRP-conjugated goat anti-rabbit antibody (1:5000, Santa Cruz, Cat:sc2357) or goat anti-rat antibody (1:5000, ThermoFisher Scientific, Cat:31470) in blocking buffer for 1 hour. Then, they were washed with TBST and developed using a standard ECL protocol (Pierce ECL, ThermoFisher Scientific) according to the manufacturer's instructions. Images were scanned and analyzed using Image J software. For normalization with loading control, mouse anti-actin (Company, 1:4000) and mouse anti-vinculin (Company, 1:2000) were used after stripping according to the manufacturer's instructions (One minute Western Blot Stripping buffer, GM Biosciences).

[0110] electron microscope Myelination was further assessed in ultrathin sections for structural analysis using electron microscopy (EM). A separate cohort of mice was transcardially perfused with saline, followed by terminal perfusion (~day 35) with 2% PFA and 2% glutaraldehyde in 0.1 M PB (PB; pH 7.4) (n = 3 / group) (Lancaster et al., 2018). Each mouse was dissected, and the optic nerve, cervical spinal cord, and cerebellum (vermis) were isolated. Tissues were postfixed for 24 hours, rinsed in 0.1 M PB, and transferred to 2% OsO4 in 0.1 M PB for 1 hour before being processed for embedding in Epon (Lancaster et al., 2018). Semithin sections were cut, stained with alkaline toluidine blue, and visualized using a light microscope (Leica DMR) with interactive software (Leica Application Suite). Ultrathin sections (70 nm) were cut, stained with lead citrate and uranyl acetate, and imaged using a Jeol-1010 transmission electron microscope (TEM). Images from EM sections taken at 100x magnification through the optic nerve were evaluated using Image J software, and medial and lateral axon areas were measured for g-ratio analysis, quantified as previously described (Lancaster et al., 2018), with 50 axons per animal and n = 3 per group.

[0111] Oligodendrocyte culture The cell-autonomous effect of the mutation was observed in WT, Tubb4a D249N , Tubb4a D249N / D249NOligodendrocytes were assessed by culturing and isolating them from mice. Primary oligodendrocyte progenitor cells (OPCs) were isolated from the cerebral cortex between postnatal days P4 and P7 using Miltenyl anti-O4 microbeads, as described in the Supplementary Methods. O4+ cells were plated at a density of 20,000 OPCs per well of a 24-well plate. These cells were expanded for 5–7 days and then differentiated for an additional 5 days in medium lacking PDGF and bFGF and containing thyroxine T4 (20 μg / ml; Sigma T0397). Cells were then fixed with 4% PFA and stained using standard immunohistochemistry protocols. Coverslips were washed twice with 1X PBS, permeabilized with 0.2% Tx-100, and blocked for 1 hour in 10% normal goat serum (NGS). Primary antibodies were prepared in 5% NGS and incubated overnight at 4°C. The primary antibodies used were the oligodendrocyte marker rabbit Olig2 (1:800; EMD Millipore AB9610), and the mature myelin markers rat PLP (1:1) and rat MBP (1:1) (provided by Dr. Judith Grinspan, IDDRC hybridoma). The following day, the cells were washed three times with PBS and incubated with the appropriate secondary fluorescent antibodies (1:500; anti-rat IgG Alexa Fluor 488, anti-rabbit IgG Alexa Fluor 647). Cells were then mounted with Prolong Gold anti-browning agent (Thermo Fisher Scientific) and imaged using a Nikon microscope with a 20x or 40x objective. Cell counts were analyzed.

[0112] Cerebral cortical neuron culture The cell-autonomous effects of the mutation were observed in WT, Tubb4a D249N , Tubb4a D249N / D249NNeurons were isolated from mice. Primary cortical neurons were isolated from E15.5 embryos as previously described (Guedes-Dias et al., 2019). Briefly, the cortex was removed from each embryo and washed with HBSS. 2.5% trypsin was added to each sample and incubated at 37°C for 7 minutes. After removing the trypsin and washing four times with freshly warmed HBSS, the cells were resuspended in adherence medium (MEM medium, 1% sodium pyruvate, 1% horse serum, glucose, and sodium chloride). Cells were triturated with a pipette until a homogenous single-cell solution was obtained. Cells were counted and plated in 24-well plates at a density of 150,000 cells / plate and 100,000 cells / well on PLL-coated MaTeK plates (center only). The medium was replaced with pre-equilibrated maintenance medium (neurobasal medium, 1% glutamax, 1% penicillin / streptomycin, glucose, sodium chloride, and 2% B27 solution) after 4 hours. After 3 days, 20-30% of the medium was removed and replenished with fresh medium supplemented with the mitotic inhibitor AraC. Neurons plated in 24-well plates were evaluated by cell survival analysis and axon and dendrite length measurements. Neurons were stained with MAP2 (1:200) and TuJ1 (1:200) to label dendrites and cell bodies / axons, respectively. Images were taken with a 20x or 40x objective to count the number of cells and measure axon and dendrite length. Axon and dendrite length were measured using the Neurite tracer plugin in FiJi software.

[0113] Live imaging of EB3 dynamics Microtubule dynamics were assessed by live cell imaging of EB3-mCherry, which tags the growing plus ends of microtubules with end-binding protein 3 (EB3). Cortical neurons were transfected with EB3-mCherry using Lipofectamine 2000 (Invitrogen). 20–24 hours after transfection, maintenance medium was replaced with low-fluorescence Hibernate E imaging medium (BrainBits) supplemented with 2% B27 and 2 mM GlutaMAX. Neurons were imaged using a PerkinElmer UltraView Vox Spinning Disk Confocal system and a Nikon Eclipse Ti inverted microscope with a Plan Apochromat 60x 1.40NA oil immersion objective in an environmental chamber at 37°C. Images were acquired over 600 seconds using a Hamamatsu EMCCD C9100-50 camera driven by Volocity software (PerkinElmer) at a frame rate of 2 seconds per frame. Quantification of EB3 dynamics was performed as previously described (Guedes-Dias et al., 2019). Kymographs were created using the ImageJ macro toolset KymoClear (Mangeol et al., 2016). The KymoClear toolset applies a Fourier filter to the original kymograph, enabling automatic identification of anterograde, retrograde, or static components, improving the signal-to-noise ratio of EB3 comets without affecting the quantitative analysis of the data. Individual EB3 comet trajectories were manually traced using a custom MATLAB GUI (Kymograph Suite), and the travel distance, travel time, and speed of each comet were measured. Researchers were blinded to the genotype of neurons during both image acquisition and kymograph analysis.

[0114] statistical analysis All graphical data are presented as mean ± standard error of the mean (SEM). In the text, "n" represents the number of mice used per experiment unless otherwise specified. Gait abnormalities, righting reflex, rotarod, and body weight assessments were analyzed using a two-way ANOVA with repeated measures, followed by a post-hoc Tukey test. Grip strength and gait were analyzed using a one-way ANOVA with a Tukey post-hoc test. Survival was analyzed using the Kaplan-Meier method, and differences between groups were estimated using the Gehan-Breslow-Wilcoxon test. Myelin quantification, comparisons of the number and fluorescence intensity of NeuN, ASPA, NG2, Olig2, and cleaved caspase-3, were analyzed using a regular two-way ANOVA with a post-hoc Tukey test for multiple comparisons. Neuronal survival, axon and dendrite length, and in vitro OL marker assessments were compared using a one-way ANOVA with a Tukey post-hoc test. EB3 dynamics in neurons was analyzed using one-way or two-way ANOVA with repeated measures. All statistical analyses were performed using Prism 7.0 (GraphPad Software), with p < 0.05 considered statistically significant.

[0115] Mouse genotyping DNA was extracted from the tail using the HotSHOT method as previously described (Truett et al., 2000). A 541-bp PCR product was amplified using the Taq-Takara system with the forward primer 5'CCGAGAGGAGTTTCCAGACAGACAGGATC3' (SEQ ID NO: 3) and the reverse primer 5'GCTCTGCACACTTAACATCTGCTCG3' (SEQ ID NO: 4). The amplified product was sequenced to identify the genotype of the mice.

[0116] Behavioral testing Gait angle: Gait abnormalities were determined by measuring the walking / hindlimb foot angle. Gait angle was measured with some modifications (Feather-Schussler and Ferguson, 2016). Gait angle was measured weekly at P7, P14, P21, P28, and P35. Data were used to perform the three measurements only if the pups were walking in a straight line with both feet on the ground.

[0117] Gait: Gait disorders were detected as previously described (Feather-Schussler and Ferguson, 2016) with some modifications. Ambulatory behavior was assessed at P7, 10, and 14. Based on these crawling and walking strategies, we investigated whether transgenic mice acquire crawling / walking skills more slowly than WT littermates. Mice were scored in a single trial for crawling, gait symmetry, and limb movement during straight walking (Figure 1 and Table 3). [Table 3]

[0118] As shown in Figure 1E, during crawling, the entire hind limbs touch the ground, as indicated by (#), and the tail is low or touching the ground. As the animal transitions from crawling to walking, the head begins to lift. Walking is first observed when the hind toes are on the ground and the heels are elevated, as indicated by [##] (Feather-Schussler and Ferguson, 2016). Symmetric limb movement refers to overlapping of the hind and forelimbs with each step, with a smooth transition from one step to the next. Mice exhibiting asymmetric limb movement have inconsistent forepaw placement and an inconsistent transition from one step to the next.

[0119] Hanging grip strength: The grip strength of the forelimbs and hindlimbs was determined by measuring the hanging grip strength. Hanging grip strength was measured as described in Feather-Schussler and Ferguson, 2016. Trials were repeated three times, and the average angle was calculated. Hanging grip strength was performed at P14 using a 13" x 9.5" metal screen mesh. A protractor was placed parallel to the mesh to measure the angle at which the pups fell. The mice were placed on the screen and allowed to adapt to this new environment for approximately 10 seconds. The screen was slowly inverted 180 degrees, and the approximate angle of the screen at which the pups fell was recorded. This trial was repeated three times, and the average angle was calculated.

[0120] Righting reflex: The righting reflex tests trunk control and motor coordination in mice. Righting reflex testing was performed as described above in Feather-Schussler and Ferguson, 2016. Righting reflex testing was performed weekly from P7, P14, P21, P28, and P35, and then from Tubb4a. D249N / D249N The righting reflex test was performed daily when mice showed motor impairment. Three trials were given, with each trial lasting a total of 1 min, as needed. Righting reflex testing was performed weekly from P7, 14, 21, 28, and 35, and then in Tubb4a mice. D249N / D249N This test was conducted daily when mice showed motor impairment. Mice were placed supine on a bench pad and held in that position for 5 seconds. The mouse was then released and the time it took to return to a flat position was recorded. Three trials were conducted, with each trial lasting a total of 1 minute, as needed.

[0121] Rotarod: Motor coordination, strength, and balance were assessed using a rotarod (UGO BASILE SRL, Gemonio, Italy). After the training period (P21), mice were tested for three test trials. The latency to fall from the rotarod was recorded for each trial, and the average was used for analysis. To assess progressive motor loss, mice were tested at P28 and P35, and the average latency to fall across age groups was used for statistical analysis. To adapt to the apparatus, mice were placed on a cylindrical rod rotating at a constant speed of 5 rpm for 100 s on day 1. The following day, three trials were performed for 300 s with an accelerating speed of 5 to 30 rpm, separated by approximately 20 min intervals. On day 3, three trials were performed for 300 s with an accelerating speed of 5 to 30 rpm.

[0122] Immunohistochemistry, image analysis, quantification Quantification of myelin and neurofilament staining: Free-floating sections were treated with 10% hydrogen peroxide in methanol for 20 minutes, blocked for 1 hour in blocking buffer (4% bovine serum albumin (BSA), 1x PBS, 0.1% Triton-X (Tx)-100), and then incubated overnight at 4°C with chicken anti-NFH (1:500, Aves, cat:NFH) in the same blocking buffer. After primary antibody incubation, sections were incubated with biotinylated anti-chicken secondary antibody (1:1000, Aves, cat:B-1005) for 1 hour, developed with Elite Avidin Biotin Conjugate (Vector), and visualized with DAB substrate. Slides were rinsed with tap water, treated with acetone, rinsed with tap water, and immersed in eriochrome cyanin (Eri-C) solution for 30 minutes. Sections were triturated with 5% iron alum, rinsed with tap water, and then triturated with borax ferricyanide. Sections were dehydrated, cleared, mounted with Permount (Fischer Scientific, USA), and coverslipped. For quantification of myelin in the corpus callosum and cerebellum (3-4 sections per mouse, n = at least 3 for PND14, P21, and terminal stage), images were taken in brightfield mode on a Keyence BZ-X-700 digital microscope. Images captured at 10x magnification were collated and displayed using Keyence BZ-X software. Stained areas were measured using Image J software and correlated with the total white matter.

[0123] NeuN and caspase counts: Striatal and cerebellar sections (3-4 sections per mouse, n = 3-4 at P14, P21, and end-stage) were imaged at 20x and 63x magnification, respectively, using Z-optical sections spaced 1-2 μm apart using a Leica DM6000B fluorescence microscope. NeuN+ cells were counted with DAPI using Image J software. Analysis was performed blind, and counts were calculated as profiles / mm. 2 reported as.

[0124] Number of ASPA and Olig2 / NG2 cells: The protocol was performed according to a previously published one (Lee et al., 1985), with some modifications. The total number of ASPA and NG2 / Olig2 cells in the corpus callosum was quantified using sections labeled for ASPA and NG2 / Olig2 and counterstained with DAPI. All images were taken with a 40x oil immersion lens on an Olympus laser scanning confocal microscope using z-stacks with an optical spacing of 0.5–1 μm. Image J software was used to measure the number of cells in a standardized sample box (0.01 mm). 2 ) were placed in the region of interest. Positively labeled cells were identified as ASPA+ or NG2+ / OLG2+ or OLG2+ cells and overlaid with DAPI nuclei. Final counts were calculated as profiles / mm 2 It is reported as

[0125] Quantification of fluorescence density and area: To quantify the fluorescence-positive area and density, images were captured at 10x magnification using a Leica DM6000B fluorescence microscope. Regions of interest were selected using Image J software, and the integrated area density and gray value were calculated. The following formula was used to calculate fluorescence: Corrected total fluorescence = total density - (area of selected cells x average fluorescence of background reading).

[0126] Oligodendrocyte isolation: Briefly, cortices were microdissected from each mouse brain, and the meninges were removed to avoid contaminating the cultures. The cortices were cut into smaller fragments and dissociated using a Neural Dissociation Kit (Miltenyl Biotec (P), 130-092-628). Each sample was incubated with Enzyme Mix 1 (Enzyme P and Buffer X) at 37°C for 15 minutes, according to the protocol. Enzyme Mix 2 was then added, and the tissue was mechanically dissociated using a fire-polished Pasteur pipette and incubated at 37°C for 10 minutes. This process was repeated two more times to obtain a single-cell solution, which was then applied to a 70-μm strainer and centrifuged at 300 x g for 10 minutes. The cell pellet was resuspended in 90 μl of PBS buffer (pH 7.2) containing 0.5% bovine serum albumin. 10 μl of anti-O4 microbeads was added to the cell pellet, mixed, and incubated in a refrigerator for 15 minutes. The cells were then washed with 1-2 ml of buffer and centrifuged at 300 x g for 10 minutes. The supernatant was aspirated, and the cells were resuspended in 500 μl of buffer. The MS MACS column was placed in a magnetic field and rinsed with 500 μl of buffer. The cell suspension was then applied to the magnetic column. The flow-through fraction containing unlabeled cells was collected, and the column was rinsed three times with 500 μl of buffer. The column was then removed from the separator and placed over an appropriate collection tube. An appropriate amount of medium was applied to it, and the column was immediately flushed by depressing the plunger. This fraction was then collected using O4 + The cells were suspended in Neurobasal medium containing 2% B27, 1% penicillin-streptomycin, 1% glutamine, and the growth factors human bFGF (100 μg / ml; R&D 233-FB / CF), human PDGF-AA (100 μg / ml; Peprotech 100-13A), and human NT3 (100 μg / ml; Peprotech 450-03).

[0127] Antisense oligonucleotide synthesis Eleven ASOs were synthesized by Integrated DNA Technologies. These ASOs were screened in vitro to identify the optimal ASO design. Mouse Oli-neu cells were electroporated at 100,000 cells / well with ASO concentrations of 1 μM, 5 μM, or 10 μM in 100 μL of medium using the NEPA21 Electroporation System (NEPA GENE, USA) at 150 V. After electroporation, cells were transferred to poly-L-ornithine-coated plates and placed in an incubator. Forty-eight hours after treatment, cells were washed with PBS and RNA was extracted using the PureLink™ RNA Mini Kit (ThermoFisher Scientific, Cat: 12183018A) according to the manufacturer's instructions. After treatment with DNAase (Invitrogen), 200 ng of RNA was used to generate cDNA using the SuperScript™ IV First-Strand Synthesis System (ThermoFisher Scientific, Cat: 18091200). The mRNA expression levels of Tubb4a and the endogenous housekeeping gene encoding the splicing factor arginine / serine-rich 9 (sfrs9) were quantified by real-time PCR analysis (Taqman chemistry) using an Applied Biosystems Quanta Flex 7 (ThermoFisher Scientific, USA). Results were analyzed using the ΔΔCT method.

[0128] The following examples are provided to illustrate certain embodiments of the invention and are not intended to limit the invention in any way.

[0129] Example Example I Mouse models of H-ABC disease In this example, Tubb4a is used as an H-ABC model that reproduces the characteristics of human diseases such as dystonia, loss of motor function, and gait abnormalities. D249N / D249NThey report that they have generated knock-in mice carrying the Tubb4a mutation. Histopathological features of this mouse model include both neuronal loss in the striatum and cerebellum, and hypomyelination of the brain and spinal cord, as observed in patient tissue (Curiel et al., 2017b). D249N / D249N Using mice, we also investigated the functional effects of mutant tubulin on microtubule assembly and the cell-autonomous role of Tubb4a mutations in neurons and oligodendrocytes. This study provides the first promising model of H-ABC using the most frequently occurring mutations, which will be important for understanding the mechanisms underlying this devastating disease and developing treatments.

[0130] Tubb4a D249N Generation of CRISPR knock-in mice To understand the molecular mechanism and disease course of the classical H-ABC mutation, we used CRISPR to knock-in a mouse model of Tubb4a, which harbors the p.Asp249Asn (p.745G>A) mutation. D249N Furthermore, these Tubb4a D249N Mice were bred to be homozygous for Tubb4a D249N / D249N A colony of mice was obtained (Figure 1A). Homozygous mice were bred for Tubb4a D249N This was studied in parallel with mice, as a rodent model of Tubb4a mutations shows that homozygous expression is required for early phenotypic expression, despite heterozygous mutations in H-ABC affected individuals (13).

[0131] Tubb4a D249N / D249N Mice develop disease earlier and have reduced survival rates Tubb4a D249N and Tubb4a D249N / D249N To determine the phenotype of the mice, they were examined daily from birth. From birth until postnatal day 8, WT, Tubb4a D249N , Tubb4a D249N / D249N The mice appeared similar in terms of their development, but by P9, Tubb4a D249N / D249NMice exhibit tremor-like behavior. This phenotype gradually worsens with age, progressing to severe ataxia and dystonia over time. By P35-P40, mice are no longer able to feed themselves and their right paw movements become sluggish. This point is described as "end-stage compassionate" (p<0.001, Figures 1B and 1C). Furthermore, weight measurements revealed that Tubb4a D249N / D249N The mice began to lose weight gradually from P35, and by P37 (15.02 ± 0.67), the Tubb4a mice D249N (18.57 ± 0.38) and significantly decreased compared to WT mice (17.44 ± 0.43) (p < 0.001, Figure 1L).

[0132] Tubb4a D249N Mice appear normal and show no obvious behavioral phenotype. D249N The survival rate of the mice was similar to that of WT mice, with most of the deaths occurring due to old age (Kaplan-Meier survival curve, Figure 2A).

[0133] Tubb4a D249N / D249N Mice exhibiting abnormal gait Because individuals affected by H-ABC exhibit delayed gait, ataxia, gait abnormalities, and progressive motor dysfunction, we hypothesized that Tubb4a D249N and Tubb4a D249N / D249N We decided to perform a comprehensive behavioral analysis in mice to determine whether they similarly recapitulate the H-ABC behavioral phenotype (Fig. 1D) (1,10,20).

[0134] Tubb4a D249N and Tubb4a D249N / D249N To determine whether mice exhibited gait abnormalities, the walking angle or hind paw angle was measured. Starting at P14, Tubb4a D249N / D249N Tubb4a mice exhibit a significantly wider walking angle compared to WT littermates, while Tubb4a D249NMice walked without any deficits in gait angle (p<0.001, Figures 1G and 1H; P14 - 71.82 ± 4.26 vs 43.16 ± 2.46, P21 - 84.00 ± 7.56 vs 61.96 ± 2.93, P35 - 81.03 ± 5.37 vs 52.66 ± 1.87). D249N / D249N The wide gait angle in mice is consistent with the gait instability seen at these ages, as pups and adult mice require a larger hindlimb angle to stabilize their gait and support balance and muscle coordination (14).

[0135] WT, Tubb4a D249N and Tubb4a D249N / D249N In mice, gait was assessed early as mice transitioned from crawling to walking (see Table 3 for gait scores). D249N and Tubb4a D249N / D249N Mice exhibited asymmetric crawling behavior similar to WT control mice (Figure 1E). By P10, Tubb4a D249N / D249N Mice exhibited asymmetric limb movements during crawling gait, as seen in young pups, and also exhibited tremors compared to WT littermate controls (P10 - 1.20 ± 0.13 vs 2.20 ± 0.25) (p < 0.05, Figures 1E and 1F). D249N They showed more symmetrical limb movements in crawling / walking gait. D249N / D249N All mice, including the homozygous Tubb4a mice, acquired the ability to walk by P14. D249N / D249N The mouse still exhibits tremors.

[0136] Tubb4a D249N / D249N Mice exhibit progressive motor dysfunction Tubb4a D249N and Tubb4a D249N / D249NTo assess whether mice exhibited further impairments in motor development, their grasping ability was measured by performing a hanging grip test at P14. Because grasping with all four paws is essential for mice to climb and run on uneven surfaces (14), impaired grip performance indicates impaired motor skills in mice. D249N Mice exhibited similar grip strength compared to WT littermates, whereas Tubb4a D249N / D249N The fall angle of the mice was significantly smaller than that of the WT mice (86.40 ± 2.51 vs 103.9 ± 1.84; p < 0.001, Figures 1I and 1J).

[0137] To assess whether the disease is progressive and whether the Tubb4a mutation in young mice affects coordination and balance, we assessed the performance of these mice on the rotarod at P21, P28, and P35. D249N The performance of mice (measured as the latency to fall (seconds)) was not significantly different compared to WT littermates, whereas homozygous Tubb4a D249N / D249N Mice had shorter latencies to fall on the accelerating rotarod at P21 (107.1 ± 7.58 vs 213.8 ± 15.16 s), P28 (101.0 ± 10.30 vs 239.0 ± 10.76 s), and P35 (20.69 ± 6.71 vs 257.9 ± 11.40 s), which progressively worsened over time (p < 0.001, Figure 1K).

[0138] Tubb4a D249N To examine whether the mice would develop behavioral deficits at later stages, we performed the rotarod test at 9 months and 1 year of age, but no changes were observed compared to WT mice ( Fig. 2<em>B ).

[0139] Finally, from P7 to P35 every week, followed by P35 to Tubb4a D249N / D249NMice were assessed daily for righting reflex until terminal stage. The surface righting test tests the trunk control and coordination of mice (14). It is also used as an ethical endpoint in this study because it is a necessary ability for self-care and feeding (21,22). By P14, all mice were able to right themselves immediately, but from day 38 onwards, Tubb4a mice were unable to right themselves. D249N / D249N Mice had a significantly reduced ability to sit up compared to WT littermates (p<0.001, Fig. 1L).

[0140] Tubb4a D249N / D249N Mice exhibit severe developmental delay in myelination, and Tubb4a mice D249N Mouse and Tubb4a D249N / D249 Mice also eventually show a loss of myelination Tubb4a D249N and Tubb4a D249N / D249N Mice mimicking the myelin abnormalities typically seen in people with H-ABC (3,10) and expressing Tubb4a D249N / D249N Mice exhibit developmental or degenerative myelin loss. Myelination in the mouse spinal cord begins at birth and exhibits a near-adult pattern by P21 (23). Tubb4a D249N / D249N Tubb4a mice exhibit a marked lack of typical myelin development, as measured by immunohistochemistry (Eri-C), in the corpus callosum and cerebellum at P14 and P21 compared to WT littermates. D249N / D249N Tubb4a mice exhibit an early delay in myelination (P14 - p<0.001, P21 - p<0.001, Figure 6B), followed by a terminal loss of previously achieved myelination (0.053 ± 0.004 vs 0.948 ± 0.009 in the corpus callosum, 0.037 ± 0.001 vs 0.854 ± 0.033 in the cerebellum) (p<0.001, Figures 3C-3F). D249N To assess the later onset of the myelin phenotype in mice, Eri-C staining was performed at 1 year of age and showed decreased myelin staining (p<0.001, Figures 3G and 3H).

[0141] Additionally, Tubb4a D249N / D249NIn mice, immunostaining confirmed the absence of a major myelin protein: Tubb4a. D249N / D249N In mice, expression of MBP and PLP was unchanged in the corpus callosum and cerebellum at P14 (Figures 6C-6G), but was significantly decreased by P21 (p<0.001, Figures 8C-8G) and late in the corpus callosum (p<0.001, Figures 3K-3L and 3S-3T; PLP -27.99±3.02 vs 113.46±16.18, and MBP -25.73±3.42 vs 92.40±5.76) and cerebellum (p<0.001, Figures 3O-3P and 3W-3X; PLP -11.11±1.17 vs 58.90±8.19, and MBP -12.65±2.98 vs 69.79±1.20). D249N The mouse is Tubb4a D249N / D249N At P21 and late stages, Tubb4a mice showed similar levels of MBP and PLP expression in the corpus callosum and cerebellum as wild-type mice. However, after 1 year, Tubb4a D249N Mice exhibit reduced levels of PLP (p<0.05, Figures 2C-2D) and MBP (p<0.05, Figures 3I-3J) compared to WT.

[0142] Tubb4a D249N / D249N In mice, a similar decrease in PLP and MBP levels is detected using Western blot in the forebrain (PLP -0.286 ± 0.08 vs 1.101 ± 0.01, Figures 3M-3N; MBP -0.605 ± 0.06 vs 2.615 ± 0.09, Figures 3U-3V) and cerebellum (PLP -0.123 ± 0.03 vs 0.860 ± 0.12, Figures 3Q-3R; and MBP -1.307 ± 0.178 vs 2.306 ± 0.14, Figures 3Y-3Z) at P21 (p<0.05) and end-stage (p<0.001) stages.

[0143] Tubb4a D249N / D249N Mice show a significant reduction in oligodendrocytes Tubb4a D249N and Tubb4a D249N / D249NConsidering both developmental and degenerative abnormalities in myelination in the rat, we assessed the numbers of oligodendrocytes (OLs) and oligodendrocyte progenitor cells (OPCs) (23). OL numbers were examined in the corpus callosum at P14, P21, and terminal stages by immunostaining with ASPA, an OL marker.

[0144] At P14, P21, and late stages ( Figure 7C-D ), Tubb4a D249N / D249N In mice, the number of ASPA-positive OLs in the corpus callosum was significantly reduced compared to WT littermates (p<0.001, 166±32.34 vs 681±38.45). To assess whether there was an alteration in the number of OPCs, we counted double-positive NG2+Olig2+ (pan OL lineage marker) cells in the corpus callosum. The number of NG2+Olig2+ cells was significantly increased by Tubb4a expression. D249N / D249N The number of Olig2+ cells did not change at P14, P21 (Figure 12A-B), or at the end of the mouse development (Figure 7E-F). Furthermore, the number of Olig2+ cells was significantly increased by Tubb4a D249N / D249N These were comparable at P14, P21, and terminal stages in mice (Fig. 12C-E), suggesting no change in the numbers of all OL lineage cells.

[0145] To examine whether OL lineage cells undergo apoptosis, we performed double immunostaining for caspase, a marker for cell apoptosis, and Olig2, a marker for the OL lineage. D249N / D249N In mice, we found a significant and progressive increase in the number of caspase- and OL(ASPA)-double positive cells in the corpus callosum at P14, P21 (Figure 15A-D), and terminal stages (p<0.001, Figure 7G-H). D249N / D249N In mice, the numbers of OPCs and Olig2 cells are maintained, suggesting that the Tubb4a mutation is toxic to mature OLs, resulting in their loss.

[0146] Ultrastructural analysis revealed that Tubb4a D249N and Tubb4a D249N / D249N Evidence for impaired myelination in mice Electron microscopic observation of optic nerve sections revealed that Tubb4aD249N / D249N In mice, unmyelinated and undermyelinated axons were observed from P21 onward compared with WT control mice (data not shown), which worsened at the end stage (Figures 5A-5C and 5H-5J). D249N / D249N In the tissue, hollowed and degenerated axons (blue asterisks) were observed due to macrophage engulfment (Figure 5D). Interestingly, the g-ratio, which measures the axonal myelin thickness, was significantly higher than that of Tubb4a. D249N / D249N mice (p<0.001; 0.914±0.004) as well as Tubb4a D249N The g-ratio in the optic nerve (p<0.001; 0.859 ± 0.006) was also significantly different compared to WT mice (Figure 5E, 0.802 ± 0.005). Quantification of myelin thickness, measured by plotting the g-ratio as a function of axon diameter (Figure 5F), revealed that Tubb4a D249N and Tubb4a D249N / D249N This indicates that myelin sheath development is arrested in Tubb4a mice. Furthermore, the mean age of Tubb4a mice was 0.945 ± 0.024 compared to control mice. D249N / D249N Axonal caliber was significantly reduced in optic nerve tissue (Fig. 5G, p<0.05; 0.87±0.034), indicating that Tubb4a D249N / D249N In mice, thick axons were lost at the final stage. TEM cross-sections of the spinal cord also showed that Tubb4a D249N / D249N Mice showed dramatic loss of myelin in the ventral white matter (Figures 4A–4F) and progressive axonal engulfment by macrophages (Figure 4F), but large motor neuron loss was not examined in the anterior horn of the spinal cord between different groups (data not shown).

[0147] Tubb4a D249N / D249N At the end of the disease, mice lose neurons in the striatum and cerebellum. Pathological specimens from individuals with H-ABC show neuronal loss in the basal ganglia and granule cell layer of the cerebellum (4,10). D249N and Tubb4a D249N / D249NIn mice, neuronal loss was observed in the striatum and cerebellum at P14 (Fig. 14A), P21, and late stages (Fig. 9C) by immunostaining with NeuN and Nissl staining.

[0148] At P14 and P21 (Fig. 14D), Tubb4a D249N and Tubb4a D249N / D249N The number of NeuNs in the striatum of Tubb4a mice was comparable to that of WT controls, whereas the number of NeuNs in the striatum of Tubb4a mice was comparable to that of WT controls. D249N / D249N Mice showed significant striatal neuronal loss at the end stage (p<0.01, Figure 9J; 183±8.44 vs 246±28.51). D249N / D249N Nissl staining of cerebellar sections from Tubb4a mice revealed a severe and progressive loss of the granular neuron layer from P21 to terminal stage, as well as a marked reduction in cerebellar volume (Figure 9C). D249N / D249N Although WT mice exhibited comparable numbers of granular neurons to WT mice at P14 (Figure 14B), dramatic and progressive granular neuron loss was observed at P21 (212 ± 6.71 vs. 312 ± 4.30) and terminal stages (p < 0.001, Figure 9D-E; 57 ± 4.7 vs. 262 ± 14.85). Furthermore, the number of caspase-3-positive cells colocalizing with NeuN significantly increased at P21 (11 ± 3.99 vs. 0.3 ± 0.16) and terminal stages (13.5 ± 0.38 vs. 0.75 ± 0.38), suggesting cell apoptosis (p < 0.001, Figure 9F-G). To further assess whether there was loss of other neuronal populations in the cerebellum, Purkinje neurons were assessed by calbindin immunostaining, whereas Tubb4a expression was significantly increased. D249N / D249N and WT mice (Figures 14C, 14D).

[0149] Tubb4a in oligodendrocytes D249N and Tubb4a D249N / D249N Cell-autonomous effects of mutations We used a WT control, Tubb4a D249N , Tubb4a D249N / D249NWe investigated the cell-autonomous effects of Tubb4a mutations in OLs using in vitro cultures derived from mice. O4+ (premyelinating marker) OPCs were isolated from these mice and differentiated toward an OL fate. These cells were examined for PLP, a marker of mature OLs, which colocalizes with Olig2, a pan-OL lineage marker. D249N mice (p<0.05, 72.12%±8.99) and Tubb4a D249N / D249N We confirmed that the number of mature PLP+ OLs was significantly reduced in Tubb4a mice (p<0.01, 55.23% ± 4.97) compared to mature OLs from WT mice (Figure 11E). However, the total number of Olig2+ cells was similar in all groups (Figure 11D). Consequently, the number of mature PLP+ OLs was significantly reduced in Tubb4a mice compared to WT mice (p<0.05, 90.5% ± 14.18). D249N mice (p<0.05, 55.34%±6.83) and Tubb4a D249N / D249N The proportion of mature OLs among all cells committed to the OL lineage (PLP+ / Olig2 cells, Figure ​(Figure11F)) was significantly reduced in mice (p<0.05, 56.04%±5.39). These results generally reflect similar changes seen in vivo in mouse tissues, suggesting a role for Tubb4a in OL lineage cell development. D249N supporting a cell-autonomous contribution of the mutation.

[0150] Tubb4a in neurons D249N / D249N Cell-autonomous effects of mutations Also, WT control, Tubb4a D249N , and Tubb4a D249N / D249N We investigated the cell-autonomous effects of Tubb4a mutation in cortical neurons using in vitro cultures derived from mice. For survival analysis, we analyzed the number of neurons labeled with Tuj1 and MAP2 staining 1 week after plating and compared the number of Tubb4a-positive neurons with those labeled with Tuj1 and MAP2 staining. D249N / D249N We observed that Tubb4a neurons showed a significant decrease in survival compared to WT neurons (Figures 6G, 6H, 6I, p<0.01, 69.53%±4.8). D249NTubb4a neurons showed no difference in neuronal survival compared to WT neurons. We next assessed whether the tubulin mutation altered neuronal health and morphology by affecting axonal outgrowth and dendritic branching. D249N The axon length of the Tubb4a mice neurons was shorter compared to that of the WT neurons (Figure 11J, 155.8 ± 24.42 μm vs. 187.5 ± 23.29 μm). D249N / D249N The axon length of Tubb4a mice neurons was significantly shorter than that of WT neurons (p<0.05, 117.7±10.18μm). Similarly, we examined the dendritic branching of Tubb4a neurons (Fig. S1K). D249N / D249N The total dendrite length of Tubb4a neurons was significantly shorter than that of WT neurons (p<0.001, 27.43±1.53μm vs. 41.26±4.01μm). D249N No significant changes were observed in neurons (31.31 ± 3.81 μm). These morphological studies suggest that Tubb4a bound to H-ABC D249N / D249N These results suggest that ATP affects the structure and formation of neurons.

[0151] Tubb4a D249N and Tubb4a D249N / D249N leads to unstable microtubule dynamics in neurons In addition to morphological studies, we investigated the effects of Tubb4a mutations on the WT, Tubb4a D249N , Tubb4a D249N / D249N We performed functional studies to assess whether Tubb4a affects microtubule (MT) dynamics in mouse-derived cortical neurons. Neurons were transfected with the MT plus-end binding protein EB3-mCherry and imaged the growing ends of MTs 1 week after plating. Kymographs were generated from time-lapse videos to assess EB3 comets in distal axons (Figure 13A). The number of EB3 comets was significantly higher in WT, Tubb4a, and Tubb4a neurons. D249N , Tubb4a D249N / D249N Interestingly, although there was no significant difference in mouse neurons (Fig. 13B), Tubb4a D249N / D249NIn mouse neurons, distinct populations of EB3 comets were observed, with some expressing fewer and others expressing fewer (Fig. 13C). Furthermore, the overall velocity of EB3 comets in neurons was similar across the different groups (Fig. 13D; WT -0.25 ± 0.049 μm / s, Tubb4a D249N -0.241±0.055μm / s, Tubb4a D249N / D249N -0.254±0.066 μm / s), indicating that the polymerization rates are similar.

[0152] Tubb4a D249N / D249N The average execution time of these EB3 comets in neurons (Figure 13E) was 1.5 times longer than that of WT neurons (29.67 ± 0.79 s) and Tubb4a neurons (1.5 ± 0.79 s). D249N The time to complete the saccade was significantly shorter (p<0.001, 24.86±0.59 s) than that of Tubb4a neurons (28.55±0.58 s). D249N / D249N The average sliding distance of EB3 comets in neurons (6.0 ± 0.146 μm) and Tubb4a D249N The average run length of EB3 comets in Tubb4a neurons (6.7 ± 0.14 μm) was significantly shorter than that in WT neurons (7.20 ± 0.19 μm, p < 0.001, Figure 13F). D249N / D249N In neurons, MT dynamics were significantly and profoundly altered, confirming a functional cell-autonomous effect in neurons due to the presence of a Tubb4a mutation.

[0153] Discussion: The mouse model described here recapitulates the behavioral phenotype of H-ABC, exhibiting motor and gait defects. Furthermore, we validated the histological phenotype of this model, including characteristic pathologies of H-ABC, such as developmental loss of myelin, severe cerebellar atrophy, and loss of striatal neurons.

[0154] Since the discovery in 2013 that mutations in the TUBB4A gene are associated with H-ABC (24), numerous other mutations in the TUBB4A gene have been identified (10, 20). The TUBB4A p.Asp249Asn (D249N) mutation is closely related to the classical function of H-ABC and has a broader phenotype than that associated with other mutations. Unfortunately, no therapeutic approach is currently available. The Taeip rat model has been reported to contain a Tubb4a mutation (homozygous p.Ala302Thr), but this model does not exhibit atrophy of the cerebellum and striatum (13, 25). In this study, we investigated the classical mutation (Tubb4a D249N We attempted to fully model the H-ABC by developing a Crispr-Cas9 transgenic model of Tubb4a. In particular, this approach is applicable to any of the nucleic acids encoding mutant Tubb4a listed in Table 1. While homozygous mice, such as the Taeip rat, are required to exhibit an early-onset phenotype, heterozygous mutations, such as those seen in humans, can also result in late-onset disease. One possible explanation for the species differences is dosage sensitivity, resulting in differential penetrance of the phenotype. This has been reported in the Taeip rat model (13); furthermore, several genes, such as GATA3 (26), TBX1 (27), and GLI3 (28), have been reported in which heterozygous mutations exist in humans but homozygous mice exhibit phenotypes similar to those observed in humans.

[0155] Tubb4a D249N / D249N Mice exhibit tremor behavior from ~P9 and show deficits in motor development skills and gait consistent with cerebellar ataxia and tremor, similar to that seen in H-ABC affected individuals. Over time, there is a severe decline in motor function consistent with the onset of dystonia. D249N / D249N Mice exhibit a significant reduction in body weight and survival at approximately P37, as they are unable to feed themselves due to severe dystonia and spastic ataxia. D249NMice do not show early evidence of the severe behavioral and neuropathological phenotype seen in homozygous mice, but after one year exhibit myelin loss without any discernible behavioral phenotype.

[0156] In neuropathology, Tubb4a D249N / D249N Mice exhibited a progressive loss of myelin and developmental loss, consistent with a mixture of hypomyelination and hypomyelination over time, which may underlie the early-onset tremor seen in Shiverer (29), Shimild (30), and Jimpy mice (31). D249N / D249N Mice exhibit severe oligodendrocyte (OL) loss at P14. The loss of myelin may be due to OL death, as evidenced by a histologically based reduction in the number of OLs. Furthermore, based on the high expression of Tubb4a in OLs (11) and caspase staining, it is thought that mutations in Tubb4a contribute to OL death. Tubb4a D249N / D249N In mice, OPC numbers are maintained, suggesting that Tubb4a mutations may also affect the differentiation of OLs from OPCs. Together, these mechanisms may contribute to the complex symptoms of hypomyelination and heteromyelination seen in this model. D249N / D249N Mice also show a significant loss of cerebellar granule neurons at P21 and evidence of significant striatal neuron degeneration after ~P37. This is consistent with the pathological features reported in patients with H-ABC (9, 32). However, Purkinje neurons remain completely intact. The progressive gait abnormalities, ataxia, and motor dysfunction observed in this mouse model and patients likely underlie dramatic changes in the cerebellum over time. The somewhat milder impairment of striatal neurons may be related to variable Tubb4a expression, with Tubb4a expression being relatively higher in the cerebellum than in the striatum (2). As an increasing number of TUBB4A mutations have been reported (9, 33, 34), it is becoming increasingly recognized that mutation-specific cellular effects, involving independent involvement of the striatum, myelinating cells, and cerebellum, may account for the wide phenotypic variability observed in this disease (4, 9).

[0157] Tubb4a D249N / D249N Mice provide the first model that allows complete molecular dissection of the relevant cell subtypes affected in H-ABC, where the cellular effects observed in neurons and OLs may occur independently or may be additive, non-cell-autonomous effects. Examining the vulnerability of each cell population is critical for developing effective treatment options for H-ABC patients.

[0158] To elucidate this, we used a reduced cell culture model to investigate the cell-autonomous effects of Tubb4a on neurons and OLs. D249N Mice and Tubb4a D249N / D249N OPCs isolated from these mice differentiated less efficiently into OLs compared with WT control mice, and Tubb4a expression in OLs was significantly reduced. D249N This cell-autonomous effect of Tubb4a has been confirmed, which is reflected in the hypomyelination and dysmyelination observed in vivo. D249N Mouse and Tubb4a D249N / D249N In mice, the total number of Olig2-labeled cells is similar, but the number of mature OLs is reduced, suggesting that Tubb4a mutations inhibit the differentiation of OPCs into a mature OL fate. Further investigation of the non-cell-autonomous effects of Tubb4a mutations requires thorough genetic investigation using conditional transgenic mouse models.

[0159] Some evidence for microtubule (MT) dysfunction and associated OL maturation due to TUBB4A mutations has been obtained from studies conducted in the Taeip rat model. Taeip rats exhibited microtubule accumulation in OLs, and RNAs for the PLP, MAG, and MBP myelin genes were localized perinuclearly, which is further attributed to increased activity of the motor protein dynein for MBP transport in OLs (35). These key myelin proteins must be transported from the OL cell body to the periphery along MTs for myelin synthesis. Given the complexity of OL processes and myelin sheath development, inefficient transport of cargo along MTs may be a contributing factor to the Tubb4a mutation. D249N / D249N This is expected to contribute to the decline in the maturity and complexity of OL.

[0160] To analyze cell-autonomous effects in neurons, Tubb4a D249N and Tubb4a D249N / D249N Similar studies of cultured cortical neurons from mice showed reduced survival and impaired axonal and dendritic branching. D249N and Tubb4a D249N / D249N Neurons with the mutation exhibited shorter MT plus-end polymerization distances and shorter times, revealing unstable MT dynamics. MTs are essential for neuronal development and function, contributing to neuronal structure, polarity, growth cone dynamics, and intracellular transport (36), and mutant Tubb4a proteins may affect these important functions. Many mutations in α-tubulin and β-tubulin have been implicated in a range of neurological disorders characterized by impaired neuronal migration, differentiation, and axon guidance (37-39). Similar to our study, Tubb3 mutations in mouse cortical neurons and yeast showed altered MT dynamics and disrupted interactions between MTs and kinesin motors (40). Studies of Parkinson's disease (41) and ALS (42) have shown that altered MT dynamics impairs axonal transport, essential for active transport, suggesting that Tubb4a plays a key role. D249N / D249NThese studies suggest that Tubb4a may result in inefficient MT dynamics, impairing the transport of cargo required for axon elongation and dendritic branching. D249N / D249N Although this was performed on mouse cortical neurons, similar or even more dramatic effects are expected in granular neurons of the striatum or cerebellum.

[0161] Specific residues on the surface of MTs regulate the interactions of many proteins, and alterations in these residues affect their function and cause various neurological disorders (39). MT dynamics can be altered by post-translational modifications (PTMs), such as tyrosination, acetylation, polyamination, glutamation, glycylation, and glutathionylation (43), which enhance MT stability. The location of the p.Asp249Asn mutation in the functional domain of TUBB4A is thought to affect the stability of assembled microtubules (4), suggesting that PTM alterations may alter Tubb4a D249N PTMs may contribute to MT abnormalities via PTMs. PTMs may further alter the binding of motor proteins, such as kinesin and dynein, and MT-associated proteins (MAPs), such as tau and doublecortin, which are important for cargo transport at the organelle and molecular level (36). However, the exact mechanisms by which Tubb4a mutations affect microtubule function remain unclear and require further investigation.

[0162] Heterozygous mutations in TUBB4A cause various brain malformations, suggesting that Tubb4a may play an important role in neuronal and glial function. However, Tubb4a knockout (KO) mouse models suggest that Tubb4a may be redundant in brain function. Tubb4a KO mice with LacZ expression (44) are available on the World Wide Web at .mousephenotype.org / data / genes / MGI:10784#section-associations in the KOMP repository, along with partial phenotypic data. Homozygous Tubb4a KO mice exhibit normal embryonic development and grow normally at normal weight compared to WT mice. Phenotypic LacZ expression data indicate that the nervous system appears normal, with no discernible loss of cerebellar neurons. Current data suggest that TUBB4A may not be essential for brain development and function, suggesting a deleterious gain-of-function effect of TUBB4A mutations on neurons and oligodendrocytes. Furthermore, previous in vitro cell studies (45) and recent studies of induced pluripotent stem cell-derived neurons (46) have reported that the D249N mutation causes alterations in the rate of tubulin polymerization, supporting a dominant gain-of-function effect in the pathogenesis of H-ABC disease.

[0163] H-ABC is a devastating, progressively disabling childhood disease for which there are no available treatment strategies. D249 / D249NN Mice were the first to develop molecular, behavioral, and neurodegenerative features of classical H-ABC disease. The mice exhibited defects in both neurons and oligodendroglial cells. These data support a model in which microtubule alterations are a key factor in disease pathogenesis. These mice provide an important tool for elucidating the molecular mechanisms of this complex disease, which involves neurons and glia, and for testing the efficacy of therapeutic strategies.

[0164] References: 1. Simons C, Wolf NI, McNeil N, Caldovic L, Devaney JM, Takanohashi A, Crawford J, Ru K, Grimmond SM, Miller D, et al. A de novo mutation in the beta-tubulin gene TUBB4A results in the leukoencephalopathy hypomyelination with atrophy of the basal ganglia and cerebellum. Am J Hum Genet. 2013;92(5):767-73. 2. Hersheson J, Mencacci NE, Davis M, MacDonald N, Trabzuni D, Ryten M, Pittman A, Paudel R, Kara E, Fawcett K, et al. Mutations in the autoregulatory domain of beta-tubulin 4a cause hereditary dystonia. Ann Neurol. 2013;73(4):546-53. 3. van der Knaap MS, Linnankivi T, Paetau A, Feigenbaum A, Wakusawa K, Haginoya K, Kohler W, Henneke M, Dinopoulos A, Grattan-Smith P, et al. Hypomyelination with atrophy of the basal ganglia and cerebellum: follow-up and pathology. Neurology. 2007;69(2):166-71. 4. Curiel J, Rodriguez Bey G, Takanohashi A, Bugiani M, Fu X, Wolf NI, Nmezi B, Schiffmann R, Bugaighis M, Pierson T, et al. TUBB4A mutations result in specific neuronal and oligodendrocytic defects that closely match clinically distinct phenotypes. Hum Mol Genet. 2017;26(22):4506-18. 5. Blumkin L, Halevy A, Ben-Ami-Raichman D, Dahari D, Haviv A, Sarit C, Lev D, van der Knaap MS, Lerman-Sagie T, and Leshinsky-Silver E. Expansion of the spectrum of TUBB4A-related disorders: a new phenotype associated with a novel mutation in the TUBB4A gene. Neurogenetics. 2014;15(2):107-13. 6. Ferreira C, Poretti A, Cohen J, Hamosh A, and Naidu S. Novel TUBB4A mutations and expansion of the neuroimaging phenotype of hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC). Am J Med Genet A. 2014;164A(7):1802-7. [ PubMed ] 7. Purnell SM, Bleyl SB, and Bonkowski JL. Clinical exome sequencing identifies a novel TUBB4A mutation in a child with static hypomyelinating leukodystrophy. Pediatr Neurol. 2014;50(6):608-11. 8. Miyatake S, Osaka H, Shiina M, Sasaki M, Takanashi J, Haginoya K, Wada T, Morimoto M, Ando N, Ikuta Y, et al. Expanding the phenotypic spectrum of TUBB4A-associated hypomyelinating leukoencephalopathies. Neurology. 2014;82(24):2230-7. 9. Pizzino A, Pierson TM, Guo Y, Helman G, Fortini S, Guerrero K, Saitta S, Murphy JL, Padiath Q, Xie Y, et al. TUBB4A de novo mutations cause isolated hypomyelination. Neurology. 2014;83(10):898-902. 10. Nahhas N CA, Hamilton A, Curiel J, Simons C, van der Knaap MS and Vanderver A. In: Adam MP AH, Pagon RA ed. GeneReviews R [Internet]. Seattle (WA): University of Washington; 2016. 11. Zhang Y, Chen K, Sloan SA, Bennett ML, Scholze AR, O'Keeffe S, Phatnani HP, Guarnieri P, Caneda C, Ruderisch N, et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J Neurosci. 2014;34(36):11929-47. 12. Duncan ID, Bugiani M, Radcliff AB, Moran JJ, Lopez-Anido C, Duong P, August BK, Wolf NI, van der Knaap MS, and Svaren J. A mutation in the Tubb4a gene leads to microtubule accumulation with hypomyelination and demyelination. Ann Neurol. 2017;81(5):690-702. 13. Li FY, Song J, and Duncan ID. Mapping of taiep rat phenotype to rat Chromosome 9. Mamm Genome. 2003;14(10):703-5. 14. Feather-Schussler DN, and Ferguson TS. A Battery of Motor Tests in a Neonatal Mouse Model of Cerebral Palsy. J Vis Exp. 2016117). 15. Shiotsuki H, Yoshimi K, Shimo Y, Funayama M, Takamatsu Y, Ikeda K, Takahashi R, Kitazawa S, and Hattori N. A rotarod test for evaluation of motor skill learning. J Neurosci Methods. 2010;189(2):180-5. 16. Sahinkaya FR, Milich LM, and McTigue DM. Changes in NG2 cells and oligodendrocytes in a new model of intraspinal hemorrhage. Exp Neurol. 2014;255(113-26. 17. Lancaster E, Li J, Hanania T, Liem R, Scheideler MA, and Scherer SS. Myelinated axons fail to develop properly in a genetically authentic mouse model of Charcot-Marie-Tooth disease type 2E. Exp Neurol. 2018;308(13-25. 18. Guedes-Dias P, Nirschl JJ, Abreu N, Tokito MK, Janke C, Magiera MM, and Holzbaur ELF. Kinesin-3 Responds to Local Microtubule Dynamics to Target Synaptic Cargo Delivery to the Presynapse. Curr Biol. 2019;29(2):268-82 e8. 19. Mangeol P, Prevo B, and Peterman EJ. KymographClear and KymographDirect: two tools for the automated quantitative analysis of molecular and cellular dynamics using kymographs. Mol Biol Cell. 2016;27(12):1948-57. 20. Hamilton EM, Polder E, Vanderver A, Naidu S, Schiffmann R, Fisher K, Raguz AB, Blumkin L, Group HAR, van Berkel CG, et al. Hypomyelination with atrophy of the basal ganglia and cerebellum: further delineation of the phenotype and genotype-phenotype correlation. Brain. 2014;137(Pt 7):1921-30. 21. Wenzel DG, and Lal H. The relative reliability of the escape reaction and righting-reflex sleeping times in the mouse. J Am Pharm Assoc Am Pharm Assoc. 1959;48(2):90-1. 22. Rahn EJ, Iannitti T, Donahue RR, and Taylor BK. Sex differences in a mouse model of multiple sclerosis: neuropathic pain behavior in females but not males and protection from neurological deficits during proestrus. Biol Sex Differ. 2014;5(1):4. 23. Baumann N, and Pham-Dinh D. Biology of oligodendrocyte and myelin in the mammalian central nervous system. Physiol Rev. 2001;81(2):871-927. 24. Simons C, Wolf NI, McNeil N, Caldovic L, Devaney JM, Takanohashi A, Crawford J, Ru K, Grimmond SM, Miller D, et al. A de novo mutation in the beta-tubulin gene TUBB4A results in the leukoencephalopathy hypomyelination with atrophy of the basal ganglia and cerebellum. American journal of human genetics. 2013;92(5):767-73. 25. Duncan ID, Bugiani M, Radcliff AB, Moran JJ, Lopez-Anido C, Duong P, August BK, Wolf NI, van der Knaap MS, and Svaren J. A mutation in the Tubb4a gene leads to microtubule accumulation with hypomyelination and demyelination. Annals of neurology. 2017;81(5):690-702. 26. Lim KC, Lakshmanan G, Crawford SE, Gu Y, Grosveld F, and Engel JD. Gata3 loss leads to embryonic lethality due to noradrenaline deficiency of the sympathetic nervous system. Nat Genet. 2000;25(2):209-12. 27. Jerome LA, and Papaioannou VE. DiGeorge syndrome phenotype in mice mutant for the T-box gene, Tbx1. Nat Genet. 2001;27(3):286-91. 28. Bose J, Grotewold L, and Ruther U. Pallister-Hall syndrome phenotype in mice mutant for Gli3. Hum Mol Genet. 2002;11(9):1129-35. 29. Biddle F, March E, and Miller J. Research news. Mouse News Lett. 1973;48(24). 30. Readhead C, and Hood L. The dysmyelinating mouse mutations shiverer (shi) and myelin deficient (shimld). Behav Genet. 1990;20(2):213-34. 31. Nave KA, Lai C, Bloom FE, and Milner RJ. Jimpy mutant mouse: a 74-base deletion in the mRNA for myelin proteolipid protein and evidence for a primary defect in RNA splicing. Proc Natl Acad Sci U S A. 1986;83(23):9264-8. 32. van der Knaap MS, Naidu S, Pouwels PJ, Bonavita S, van Coster R, Lagae L, Sperner J, Surtees R, Schiffmann R, and Valk J. A new syndrome characterized by hypomyelination with atrophy of the basal ganglia and cerebellum. AJNR Am J Neuroradiol. 2002;23(9):1466-74. [ PMC free article ] [ PubMed ] 33. Lu Y, Ondo Y, Shimojima K, Osaka H, and Yamamoto T. A novel TUBB4A mutation G96R identified in a patient with hypomyelinating leukodystrophy onset beyond adolescence. Human Genome Variation. 2017;4(17035). [ PubMed ] 34. Tonduti D, Aiello C, Renaldo F, Dorboz I, Saaman S, Rodriguez D, Fettah H, Elmaleh M, Biancheri R, Barresi S, et al. TUBB4A-related hypomyelinating leukodystrophy: New insights from a series of 12 patients. European Journal of Pediatric Neurology : EJPN : official journal of the European Pediatric Neurology Society. 2016;20(2):323-30. 35. Song J, Carson JH, Barbarese E, Li FY, and Duncan ID. RNA transport in oligodendrocytes from the taiep mutant rat. Mol Cell Neurosci. 2003;24(4):926-38. 36. Clark JA, Yeaman EJ, Blizzard CA, Chuckowree JA, and Dickson TC. A Case for Microtubule Vulnerability in Amyotrophic Lateral Sclerosis: Altered Dynamics During Disease. Front Cell Neurosci. 2016;10(204. 37. Keays DA, Tian G, Poirier K, Huang GJ, Siebold C, Cleak J, Oliver PL, Fray M, Harvey RJ, Molnar Z, et al. Mutations in alpha-tubulin cause abnormal neuronal migration in mice and lissencephaly in humans. Cell. 2007;128(1):45-57. 38. Tischfield MA, Cederquist GY, Gupta ML, Jr., and Engle EC. Phenotypic spectrum of the tubulin-related disorders and functional implications of disease-causing mutations. Curr Opin Genet Dev. 2011;21(3):286-94. 39. Chakraborti S, Natarajan K, Curiel J, Janke C, and Liu J. The emerging role of the tubulin code: From the tubulin molecule to neuronal function and disease. Cytoskeleton (Hoboken). 2016;73(10):521-50. 40. Tischfield MA, Baris HN, Wu C, Rudolph G, Van Maldergem L, He W, Chan WM, Andrews C, Demer JL, Robertson RL, et al. Human TUBB3 mutations perturb microtubule dynamics, kinesin interactions, and axon guidance. Cell. 2010;140(1):74-87. 41. Cartelli D, Ronchi C, Maggioni MG, Rodighiero S, Giavini E, and Cappelletti G. Microtubule dysfunction precedes transport impairment and mitochondria damage in MPP+ -induced neurodegeneration. J Neurochem. 2010;115(1):247-58. 42. Fanara P, Banerjee J, Hueck RV, Harper MR, Awada M, Turner H, Husted KH, Brandt R, and Hellerstein MK. Stabilization of hyperdynamic microtubules is neuroprotective in amyotrophic lateral sclerosis. J Biol Chem. 2007;282(32):23465-72. 43. Janke C. The tubulin code: molecular components, readout mechanisms, and functions. J Cell Biol. 2014;206(4):461-72. 44. Skarnes WC, Rosen B, West AP, Koutsourakis M, Bushell W, Iyer V, Mujica AO, Thomas M, Harrow J, Cox T, et al. A conditional knockout resource for the genome-wide study of mouse gene function. Nature. 2011;474(7351):337-42. 45. Curiel J, Rodriguez Bey G, Takanohashi A, Bugiani M, Fu X, Wolf NI, Nmezi B, Schiffmann R, Bugaighis M, Pierson T, et al. TUBB4A mutations result in specific neuronal and oligodendrocytic defects that closely match clinically distinct phenotypes. Human molecular genetics. 2017;26(22):4506-18. 46. Vulinovic F, Krajka V, Hausrat TJ, Seibler P, Alvarez-Fischer D, Madoev H, Park JS, Kumar KR, Sue CM, Lohmann K, et al. Motor protein binding and mitochondrial transport are altered by pathogenic TUBB4A variants. Human mutation. 2018;39(12):1901-15. 47. Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, and Warman ML. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 2000;29(1):52, 4. 48. Lee YW, Mirocha CJ, Shroeder DJ, and Walser MM. TDP-1, a toxic component causing tibial dyschondroplasia in broiler chickens, and trichothecenes from Fusarium roseum 'Graminearum'. Appl Environ Microbiol. 1985;50(1):102-7.

[0165] The following materials and methods are provided to facilitate the practice of Example II.

[0166] iPS cell culture method: Peripheral blood monocytes (PBMCs) isolated from individuals with and without TUBB4A mutations (controls) were reprogrammed into induced pluripotent stem cells (iPSCs). All iPSC lines were confirmed for pluripotency markers using flow cytometry and DNA fingerprinting to confirm the genetic integrity of the iPSC clones (Maguire et al., 2019). iPSC clones displayed normal karyotypes throughout serial passages, and mycoplasma testing was negative for all lines.

[0167] Neuronal differentiation of iPSCs Neural induction toward striatal medium spiny neuron (MSN) fate was performed using a previously published dual SMAD inhibition protocol (Telezhkin 2016). Briefly, iPSCs were cultured in Essential 8 medium containing TGF-β and bFGF until 70% confluency. Cells were washed with PBS and then added to neural induction SLI medium containing 10 μM SB431542, 1.5 μM LDN 193189, and 1.5 μM IWR1 in Neurobasal medium without retinoic acid (RA). On day 4, confluent cultures were passaged 1:2 onto new Matrigel-coated plates. On day 8, cells were passaged 1:2 and cultured in L1 medium containing 200 nM LDN 193189 and 1.5 μM IWR1 in Neurobasal medium without RA. The medium was changed daily. D16 iPSC-derived neural progenitor cells (NPCs) were either used directly for neuronal differentiation or frozen for later differentiation. Flow cytometry was performed on NPCs to examine early differentiation markers, including SOX2, Pax6, FOXG1, and Nestin.

[0168] For neuronal differentiation, NPCs were dissociated using Accutase and plated at 100,000 cells per well onto 24-well plates coated with Matrigel and 100 μg / ml poly-L-lysine (PLL). d16 NPCs were cultured for the first 7 days in SCM1 medium containing Advanced DMEMF12, 2 μM PD0332991, 10 μM DAPT, 0.6 mM CaCl2, 200 μM ascorbic acid, 10 μM forskolin, 3 μM CHIR99021, and 300 μM GABA.

[0169] After plating NPCs on day 8 (or day 23 total), NPCs were cultured in SCM2 medium containing 1:1 Advanced DMEM / F-12:Neurobasal A, containing RA, 2 μM PD0332991, 3 μM CHIR99021, 0.3 mM CaCl2, 200 μM ascorbic acid, and 10 ng / ml BDNF. Medium was changed every 3 days until day 38, after which the cells were ready for experiments.

[0170] Neuronal survival and analysis: Neurons grown on coverslips were fixed with 4% PFA for 20 minutes and stained for Tuj1 (a neuronal marker), MAP2 (a dendritic marker), and specific markers of MSNs, such as DARPP32, CTIP2, GABA, and FOXP1. Cells were fixed at different time points after maturation (days 38, 45, and 52), and survival analysis and neuropathology were performed by staining and imaging the coverslips under a Leica microscope. Data were analyzed blinded, and statistical analysis was performed using GraphPad Prism. All analyses were performed using one-way or two-way ANOVA followed by Tukey's post-hoc test. *p<0.05, **p<0.01, ***p<0.01.

[0171] Example II TUBB4A human iPS cells As mentioned previously, hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC) is a rare leukodystrophy identified by our group as caused by sporadic de novo heterozygous mutations in the TUBB4A gene (Simons et al. 2013). Monoallelic mutations in the TUBB4A gene can cause a range of neurological disorders, from early-onset encephalopathy to adult-onset dystonia type 4 (hoarseness and dysphonia). Individuals affected by H-ABC fall within this spectrum and typically present with dystonia in early childhood (Hersheson et al. 2013), progressive gait disturbances, speech impairments, and cognitive impairments. Furthermore, what distinguishes these individuals from other patients with TUBB4A mutations is the neuroimaging features of hypomyelination and atrophy of the caudate nucleus and putamen, accompanied by cerebellar atrophy (van der Knaap et al. 2007). Pathological specimens show neuronal loss in the dorsal striatal region and the granular layer of the cerebellum, accompanied by axonal swelling and reduced myelin (Curiel et al. 2017; Simons et al. 2013). H-ABC patients account for approximately 65% of published TUBB4A mutations and are likely affected by a single common mutation, p.Asp249Asn (hereafter referred to as D249N).

[0172] In this example, we describe induced pluripotent stem cell (iPSC) lines reprogrammed from peripheral blood monocytes (PBMCs) isolated from individuals with H-ABC and other TUBB4A mutations at the CHOP Stem Cell Core (see Table 1). D249N The lineage was specifically reprogrammed to differentiate into striatal medium spiny neurons and the pathology was examined. D249NMedium spiny neurons differentiated from iPSCs (red bars) exhibited reduced viability (Figure 16A-D, **p<0.01, ***p<0.001) and obvious neuropathology (Figure 16E, *p<0.05) compared to neurons derived from control patients (black bars). To verify whether TUBB4A-associated pathology was due to loss of function or gain of function, we deleted TUBB4A using CRISPR in control patient iPSC lines and tested whether the knockout (TUBB4A KO) lines were developmentally normal and efficiently differentiated into striatal neurons. Indeed, we observed comparable differentiation of control and control TUBB4A KO iPSCs (Figure 16F, G), indicating that TUBB4A does not play a developmental role in generating striatal neurons.

[0173] Since the function of TUBB4A is not lost even when it is deleted, we next investigated the role of TUBB4A D249N We investigated whether deleting TUBB4A in patient iPSCs rescues the pathology and neuronal death (seen in Figure 16) by using TUBB4AKO (TUBB4A D249N Furthermore, we created and verified the TUBB4A D249N When TUBB4A KO iPSCs were differentiated into neurons, D249N Compared with neurons, TUBB4A D249N KO significantly reduced the total number of neurons (Figure 17; *p<0.05, 67.10±4.76 vs. 41.55±5.82) and CTIP2+ MSNs (Figure 16B; **p<0.01, 43.14±3.38 vs. 17.38±2.01).

[0174] These findings suggest that suppressing mutant TUBB4A expression or increasing wild-type TUBB4A may be a potential treatment for H-ABC and related TUBB4A-associated leukodystrophies. Therapeutic approaches using this method include antisense oligonucleotides, RNA silencing approaches, or overexpression of wild-type TUBB4A to compete with mutant TUBB4A.

[0175] Example III Antisense molecules for down-modulation of the target TUBB4A gene We have developed a series of antisense oligonucleotides that are effective in down-modulating the overall level of TUBB4A gene expression. The approach described below can be used to down-modulate the expression of wild-type and mutant TUBB4-A in target cells of interest.

[0176] Eleven ASOs were synthesized by Integrated DNA Technologies. These ASOs were screened in vitro to identify the optimal ASO design. Mouse Oli-neu cells were electroporated at 100,000 cells / well with ASO concentrations of 1 μM, 5 μM, or 10 μM in 100 μL of medium using the NEPA21 Electroporation System (NEPA GENE, USA) at 150 V. After electroporation, cells were transferred to poly-L-ornithine-coated plates and placed in an incubator. Forty-eight hours after treatment, cells were washed with PBS and RNA was extracted using the PureLink™ RNA Mini Kit (ThermoFisher Scientific, Cat: 12183018A) according to the manufacturer's instructions. After treatment with DNAase (Invitrogen), 200 ng of RNA was used to generate cDNA using the SuperScript™ IV First-Strand Synthesis System (ThermoFisher Scientific, Cat: 18091200). The mRNA expression levels of Tubb4a and the endogenous housekeeping gene encoding the splicing factor arginine / serine-rich 9 (sfrs9) were quantified by real-time PCR analysis (Taqman chemistry) using an Applied Biosystems Quanta Flex 7 (ThermoFisher Scientific, USA). Results were analyzed using the ΔΔCT method.

[0177] Antisense oligonucleotide (ASO) sequences: After electroporation, the following ASO sequences showed maximal downregulation of Tubb4a at 10 μM. See Figure 18 and Figure 21A. ASO 1316: Array:5'+A*+C*+A*T*A*C*G*G*C*T*G*T*C*+T*+T*+G3' (Sequence ID number: 1) ASO 1851: Array:5'+G*+A*+T*C*T*A*A*G*A*A*G*G*T*+G*+G*+A3' (Sequence ID number: 2) *Melting Tm should not be assessed using Mg2+ or dNTP concentrations +LNA modification

[0178] Each of the above sequences can optionally contain one or more modified backbone linkages and / or modified sugars. These ASOs are viable therapeutic targets for downregulating Tubb4A. (Figure 21) These ASOs have been shown to effectively downregulate Tubb4A at concentrations of 0.5 μM, 1 μM, 2 μM, 5 μM, 10 μM, and 25 μM with minimal toxicity. (Figure 21A) Indeed, when treated with ASOs, subjects demonstrated increased survival (Figure 21B), reduced seizures (Figure 21C), and significantly improved motor function (Figure 21D).

[0179] FIG. 19 is a schematic representation of in vivo whole animal therapy using antisense oligonucleotides of the invention.

[0180] Figure 20 shows the established Tubb4a D249N / D249N We demonstrated the therapeutic effect of downregulating TUBB4A in a mouse model by crossing TUBB4A with viable, normal-appearing Tubb4a knockout (KO) mice. D249N / KO Mice showed improved motor function, increased and prolonged survival (Figure 20B), and improved motor function (Figure 20C).

[0181] Example IV Overexpression of WT TUBB4A The above information can be applied to rescue phenotypes associated with tubulin mutations by overexpression of wild-type tubulin.

[0182] α- and β-tubulin form dimers and cross-dimerize with different tubulin isoforms. Tubulin mutations can cause developmental brain defects, but overexpression of wild-type (WT) tubulin outcompetes mutated β-tubulin and rescues the associated phenotypes in Drosophila and C. elegans.

[0183] In a preferred embodiment, we demonstrate that overexpression of WT TUBB4A increases myelin gene expression in OL cell lines (Figure 22). Thus, overexpression of WT TUBB4A using an expression vector (e.g., adeno-associated virus (AAV)) increases Tubb4a expression. D249N / D249N This method overcomes the toxicity of gain-of-function TUBB4A mutations in mice and rescues the phenotype. AAV delivery is only one method for delivering nucleic acids of interest into cells. Some additional approaches and reagents required for delivery are described above.

[0184] Overexpression of WT tubulin can rescue mutant tubulin models. Therefore, altering tubulin stoichiometry by increasing WT versus mutant Tubb4A in affected cells could prevent H-ABC neurodegeneration. In a preferred embodiment, the unique capsid effectively targets cells of interest in primate models. In another embodiment, novel viral vectors target SNs, CGCs, and / or OLs to overexpress WT TUBB4A and rescue the phenotype in vitro. Targeting these vectors could improve therapeutic approaches targeting relevant cell types (OLs, striatal neurons, cerebellar granule neurons).

[0185] While certain features of the invention have been described herein, many modifications, substitutions, changes, and equivalents will occur to those skilled in the art, and it is therefore to be understood that the appended claims are intended to cover all such modifications and changes that fall within the true spirit of the invention.

Claims

1. 1. Use of administering an effective amount of a compound that down-modulates the expression of both wild-type and mutant TUBB4-A in the manufacture of a pharmaceutical composition for the treatment or prevention of hypomyelination and atrophy of the basal ganglia (H-ABC) leukodystrophy, wherein said pharmaceutical composition ameliorates symptoms of H-ABC; The compound is selected from a short hairpin RNA (shRNA), a short interfering RNA (siRNA), an antisense RNA, an antisense DNA, a chimeric antisense DNA / RNA, a microRNA, and a ribozyme that is sufficiently complementary to either the gene or mRNA encoding TUBB4A.

2. The use of claim 1, wherein the compound is an siRNA.

3. 2. The use of claim 1, wherein the compound is an antisense RNA or an antisense nucleic acid selected from SEQ ID NO: 1 and SEQ ID NO:

2.

4. A pharmaceutical composition comprising an antisense nucleic acid that down-modulates the expression of the TUBB4A gene in a pharmaceutically acceptable carrier, wherein the antisense nucleic acid is selected from SEQ ID NO: 1 and SEQ ID NO:

2.

5. 5. The pharmaceutical composition of claim 4, wherein the antisense oligonucleotide is complexed to a nanoparticle or present in a liposome.

6. A pharmaceutical composition having, in a pharmaceutically acceptable carrier, a nucleic acid encoding a wild-type TUBB4A protein for increasing expression of TUBB4A in a cell of interest.

7. 7. The pharmaceutical composition of claim 6, wherein the nucleic acid encoding TUBB4A is codon-optimized.

8. 8. The pharmaceutical composition according to claim 6 or 7, wherein the nucleic acid is a nucleic acid encoding an amino acid sequence provided in UniProt, accession no. P04350-TBB4A_human, or a nucleic acid encoding a functional fragment thereof; the nucleic acid is present in an expression vector or a viral vector; or the nucleic acid or vector is complexed to a nanoparticle, or A pharmaceutical composition wherein the nucleic acid or vector is present in a liposome.

9. 1. Use of a vector having a nucleic acid component of a CRISPR-mediated base editor 3 (BE3) system and a guide RNA (gRNA) that targets a mutation in the TUBB4A gene in the manufacture of a composition for introducing a corrected codon into a therapeutic gene by base editing the gene, wherein the base editing is performed by the vector.

10. 10. The use of claim 9, wherein the base editing is performed before the onset of a disease, and the disease is a phenotype caused by a mutation in the TUBB4A gene.

11. The use according to claim 9, wherein the modified codon is introduced by a mutation as set forth in Table 1 below.

Images