Compositions and methods for modulating PKK expression

Abstract

To provide antisense compounds, compositions, and methods for decreasing PKK mRNA and protein expression, which are useful for treating, preventing, or ameliorating PKK-associated diseases, disorders, and conditions.SOLUTION: Provided is a compound comprising a modified oligonucleotide and a conjugate group, where the modified oligonucleotide consists of 12-30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of the specific sequences Nos. 30 to 2226.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Sequence Listing This application is filed with an electronic Sequence Listing, which is provided as a file entitled BIOL0252WOSEQ_ST25.txt, approximately 636 kb in size, created on April 27, 2015. The information in the electronic format of this Sequence Listing is incorporated herein by reference in its entirety.

[0002] Field Provided herein are compounds, compositions, and methods for reducing human plasma prekallikrein (PKK) mRNA and protein expression in animals, which are useful for treating, preventing, or ameliorating inflammatory and thromboembolic conditions. [Background technology]

[0003] Plasma prekallikrein (PKK) is the precursor of plasma kallikrein (PK) and is encoded by the KLKB1 gene. PKK is a glycoprotein involved in surface-dependent activation of blood coagulation, fibrinolysis, kinin production, and inflammation. PKK is converted to PK by factor XIIa through cleavage of an internal Arg-Ile peptide bond. PK liberates kinins from kininogen and generates plasmin from plasminogen. PK is a member of the kinin-kallikrein pathway, which consists of several proteins that play roles in inflammation, blood pressure control, coagulation, and pain. Summary of the Invention

[0004] The present disclosure provides compounds, compositions, and methods for modulating the expression of PKK mRNA and protein. In certain embodiments, compounds useful for modulating the expression of PKK mRNA and protein are antisense compounds. In certain embodiments, the antisense compounds are antisense oligonucleotides.

[0005] In certain embodiments, the regulation can be carried out in cells or tissues.In certain embodiments, the cells or tissues are present in animals.In certain embodiments, the animals are humans.In certain embodiments, the PKK mRNA level is reduced.In certain embodiments, the PKK protein level is reduced.Such reduction can occur in a time-dependent or dose-dependent manner.

[0006] Also provided are compounds, compositions, and methods for preventing, treating, and ameliorating PKK-associated diseases, disorders, and conditions. In certain embodiments, such PKK-associated diseases, disorders, and conditions are inflammatory diseases. In certain embodiments, the inflammatory disease may be an acute or chronic inflammatory disease. In certain embodiments, the inflammatory disease may include hereditary angioedema (HAE), edema, angioedema, swelling, eyelid angioedema, ocular edema, macular edema, and cerebral edema. In certain embodiments, the PKK-associated diseases, disorders, and conditions are thromboembolic diseases. In certain embodiments, the thromboembolic diseases may include thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, and myocardial infarction.

[0007] Such diseases, disorders, and conditions may have two or more risk factors, causes, or consequences in common.

[0008] Certain risk factors and causes of the development of inflammatory diseases include genetic predisposition to inflammatory diseases. and environmental factors. In certain embodiments, the subject has a mutant complement 1 esterase inhibitor (C1-INH) gene or a mutant factor 12 gene. In certain embodiments, the subject has taken or is taking an angiotensin-converting enzyme inhibitor (ACE inhibitor) or an angiotensin II receptor blocker (ARB). In certain embodiments, the subject has had an allergic reaction that caused angioedema. In certain embodiments, the subject has type I HAE. In certain embodiments, the subject has type II HAE. In certain embodiments, the subject has type III HAE.

[0009] Certain outcomes associated with the development of inflammatory diseases include edema / swelling of various body parts, including the extremities (i.e., hands, feet, arms, legs), intestine (abdomen), face, genitals, larynx (i.e., voice box), vascular permeability, vascular leakage, general inflammation, abdominal pain, bloating, vomiting, diarrhea, itchy skin, respiratory (asthmatic) reactions, rhinitis, anaphylaxis, bronchoconstriction, hypotension, coma, and death.

[0010] Certain risk factors and causes for the development of thromboembolic disease include a genetic predisposition to thromboembolic disease, immobility, surgery (especially orthopedic surgery), malignancy, pregnancy, advanced age, use of oral contraceptives, atrial fibrillation, previous thromboembolic conditions, chronic inflammatory diseases, and inherited or acquired prothrombotic coagulation disorders. Certain outcomes associated with the development of thromboembolic conditions include reduced blood flow in affected vessels, tissue death, and death.

[0011] In certain embodiments, the method of treatment comprises administering to an individual in need of treatment a PKK antisense compound. In certain embodiments, the method of treatment comprises administering to an individual in need of treatment a PKK antisense oligonucleotide. [Brief description of the drawing]

[0012] FIG. 1 shows Western blot quantification of HMWK from blood samples as described in Example 124. [Figure 2] Western blot quantification of HMWK from blood samples as described in Example 127. DETAILED DESCRIPTION OF THE INVENTION

[0013] Detailed Description It should be understood that both the general description and the following detailed description are exemplary and explanatory only and are not intended to limit the invention as claimed. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms, such as "includes" and "included," is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components that contain a single unit and elements and components that contain two or more subunits, unless expressly stated otherwise.

[0014] Unless otherwise defined, the terms used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are well known and commonly used in the art. Standard techniques can be used for chemical syntheses and chemical analyses. Certain of such techniques and procedures are described, for example, in "Carbohydrate Modifications in Antisense Research," Sangvi and Cook (eds.), American Chemical Society, Washington, DC, 1994; "Remington's Pharmaceutical Sciences," Mack Publishing Co., 1995; and "Remington's Pharmaceutical Sciences," Mack Publishing Co., 1995. o., Easton, PA, 21st ed., 2005, and "Antisense Drug Technology, Principles, Strategies, and Applications," edited by Stanley T. Crooke, CRC Press, Boca Raton, FL, and Sambrook et al., "Molecular Cloning, A Laboratory Manual," 2nd ed., Cold Spring Harbor Laboratory Press, 1989, which are incorporated herein by reference for all purposes. Where permitted, all patents, applications, published applications, and other publications, and other data referred to throughout this disclosure are incorporated herein by reference in their entirety.

[0015] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein in their entirety by reference to the portions of the documents discussed herein.

[0016] definition Unless specific definitions are provided, the terms used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are well known and commonly used in the art. Standard techniques can be used for chemical synthesis and chemical analysis. Where permitted, all patents, applications, published applications, and other publications that refer generally to the disclosure herein, GENBANK accession numbers, and related sequence information obtained from databases such as the National Center for Biotechnology Information (NCBI) and other data sources, are incorporated herein in their entirety by reference for the portions of the documents discussed herein.

[0017] Unless otherwise indicated, the following terms have the following meanings:

[0018] "2'-O-Methoxyethyl" (or 2'-MOE, 2'-OCH2CH2-OCH3 and MOE) refers to an O-methoxyethyl modification at the 2' position of the furanose ring. A 2'-O-methoxyethyl modified sugar is a modified sugar.

[0019] "2'-O-methoxyethyl modified nucleoside" (or "2'-MOE nucleoside") means a nucleoside that includes a 2'-MOE nucleoside sugar moiety.

[0020] "2'-substituted nucleoside" means a nucleoside that includes a substituent at the 2' position of the furanose ring other than H or OH. In certain embodiments, 2'-substituted nucleosides include nucleosides with bicyclic sugar modifications.

[0021] "2'-deoxynucleoside" means a nucleoside that contains a hydrogen at the 2' position of the sugar portion of the nucleoside.

[0022] "3' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 3'-most nucleotide of a particular antisense compound.

[0023] "5' target site" refers to the nucleotide of a target nucleic acid that is complementary to the 5'-most nucleotide of a particular antisense compound.

[0024] "5-methylcytosine" refers to a cytosine modified with a methyl group attached to the 5-position. 5-methylcytosine is a modified nucleobase.

[0025] "About" means within ±7% of a value. For example, a statement of "a compound that achieves at least about 70% inhibition of PKK" implies that PKK levels are inhibited within the range of 63% to 77%.

[0026] "Administered simultaneously" refers to the simultaneous administration of two therapeutic agents in any manner such that the pharmacological effects of both are experienced by the patient at the same time. Simultaneous administration does not require that both agents be administered in a single pharmaceutical composition, in the same dosage form, or by the same route of administration. The effects of both therapeutic agents need not be experienced at the same time. The effects need only overlap in time, not be coextensive.

[0027] "Administering" means providing a pharmaceutical agent to an animal, and includes, but is not limited to, administration by a medical professional and self-administration.

[0028] As used herein, "alkyl" refers to a saturated straight or branched chain hydrocarbon radical containing up to 24 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl, and the like. Alkyl groups typically contain from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms (C1-C 12 alkyl), more preferably having 1 to about 6 carbon atoms.

[0029] As used herein, "alkenyl" refers to a straight or branched hydrocarbon chain radical containing up to 24 carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene, and the like. Alkenyl groups typically contain from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms, with from 2 to about 6 carbon atoms being more preferred. As used herein, alkenyl groups may optionally contain two or more additional substituents.

[0030] As used herein, "alkynyl" refers to a straight- or branched-chain hydrocarbon radical containing up to 24 carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically contain from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms, with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally contain two or more additional substituents.

[0031] As used herein, "acyl" refers to a radical formed by removal of a hydroxyl group from an organic acid and has the general formula -C(O)-X, where X is typically aliphatic, alicyclic, or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates, and the like. As used herein, acyl groups can optionally include further substituents.

[0032] As used herein, "alicyclic" refers to a cyclic ring system in which the ring is aliphatic. The ring system can include two or more rings, with at least one ring being aliphatic. Preferred alicyclic groups include rings having from about 5 to about 9 carbon atoms in the ring. As used herein, alicyclic groups can optionally include additional substituents.

[0033] As used herein, "aliphatic" refers to straight or branched chain carbon atoms containing up to 24 carbon atoms. The term "aliphatic group" refers to a hydrogen radical, and the degree of saturation between any two carbon atoms is a single, double, or triple bond. The aliphatic group preferably contains 1 to about 24 carbon atoms, more typically 1 to about 12 carbon atoms, with 1 to about 6 carbon atoms being more preferred. The linear or branched chain of the aliphatic group may be interrupted by two or more heteroatoms, including nitrogen, oxygen, sulfur, and phosphorus. Such aliphatic groups interrupted by heteroatoms include, but are not limited to, polyalkoxy, e.g., polyalkylene glycols, polyamines, and polyimines. The aliphatic groups referred to herein may optionally contain additional substituents.

[0034] As used herein, "alkoxy" refers to a radical formed by an alkyl group and an oxygen atom through which the alkoxy group is attached to the parent molecule. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy, and the like. As used herein, alkoxy groups can optionally include further substituents.

[0035] As used herein, "aminoalkyl" refers to an amino-substituted C-C 12 It refers to an alkyl radical. The alkyl portion of the radical forms a covalent bond to the parent molecule. The amino group can be located at any position, and aminoalkyl groups can be substituted on the alkyl and / or amino moieties with further substituents.

[0036] As used herein, "aralkyl" and "arylalkyl" refer to C1-C 12"Aralkyl" refers to an aromatic group covalently linked to an alkyl radical. The alkyl radical portion of the resulting aralkyl (or arylalkyl) group forms a covalent bond with the parent molecule. Examples include, but are not limited to, benzyl, phenethyl, and the like. As used herein, aralkyl groups can optionally include additional substituents attached to the alkyl group, the aryl group, or both groups that form the radical.

[0037] As used herein, "aryl" and "aromatic" refer to a monocyclic or polycyclic carbocyclic ring system radical having two or more aromatic rings. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl, and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in the two or more rings. The aryl groups used herein can optionally include further substituents.

[0038] "Amelioration" refers to the reduction, slowing, halting, or reversal of at least one indicator of the severity of a condition or disease. The severity of the indicator can be determined by subjective or objective measures known to those skilled in the art.

[0039] "Animal" refers to a human or non-human animal, including, but not limited to, for example, mice, rats, rabbits, dogs, cats, pigs, and non-human primates (including, but not limited to, monkeys and chimpanzees).

[0040] "Antisense activity" refers to any detectable or measurable activity resulting from the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid. "Antisense compound" refers to an oligomeric compound that can undergo hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and occupancy-based compounds.

[0041] "Antisense compound" refers to an oligomeric compound that can undergo hybridization to a target nucleic acid through hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds, such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and ocupancy-based compounds.

[0042] "Antisense inhibition" refers to a reduction in target nucleic acid levels relative to target nucleic acid levels in the absence of an antisense compound or in the presence of an antisense compound complementary to the target nucleic acid. "Antisense mechanisms" refer to any mechanism involving hybridization of a compound with a target nucleic acid. The result or effect of such hybridization is target degradation or target occupancy, accompanied by the cessation of cellular machinery involved in, for example, transcription or splicing.

[0043] "Antisense mechanisms" refer to any mechanism involving hybridization of a compound with a target nucleic acid, the result or effect of which is target degradation or target occupancy, accompanied by the cessation of cellular machinery involved in, for example, transcription or splicing.

[0044] "Antisense oligonucleotide" refers to a single-stranded oligonucleotide having a nucleobase sequence that allows hybridization to a corresponding segment of a target nucleic acid. "Base complementarity" refers to the ability of the nucleobase of an antisense oligonucleotide to undergo precise base pairing (i.e., hybridization) with the corresponding nucleobase in the target nucleic acid, which is mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonds between the corresponding nucleobases.

[0045] "Base complementarity" refers to the ability of the nucleobases of an antisense oligonucleotide to undergo precise base pairing (i.e., hybridization) with corresponding nucleobases in a target nucleic acid, mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between the corresponding nucleobases.

[0046] "Bicyclic sugar" means a furanose ring modified by bridging two atoms. A bicyclic sugar is a modified sugar.

[0047] "Bicyclic nucleoside" (or BNA) means a nucleoside having a sugar moiety that includes a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic sugar system. In certain embodiments, the bridge connects the 4'-carbon and the 2'-carbon of the sugar ring.

[0048] "Cap structure" or "terminal cap moiety" means a chemical modification incorporated at either end of an antisense compound.

[0049] By "carbohydrate" is meant a naturally occurring carbohydrate, a modified carbohydrate, or a carbohydrate derivative.

[0050] "Carbohydrate cluster" refers to a compound having two or more carbohydrate residues attached to a scaffold or linker group (e.g., see Maier et al., "Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting," Bioconjugate C, incorporated herein by reference in its entirety, for an example of a carbohydrate-conjugated cluster). hemistry,2003,(14):18-29, or Rensen et al. “Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for (See "Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor," J. Med. Chem. 2004, (47):5798-5808).

[0051] By "carbohydrate derivative" is meant any compound that can be synthesized using a carbohydrate as a starting material or intermediate.

[0052] "cEt" or "constrained ethyl" means a bicyclic nucleoside having a sugar moiety that includes a bridge connecting the 4'-carbon and the 2'-carbon, wherein the bridge has the formula 4'-CH(CH3)-O-2'.

[0053] "cEt modified nucleoside" (or "constrained ethyl nucleoside") means a nucleoside that includes a bicyclic sugar moiety containing a 4'-CH(CH3)-O-2' bridge.

[0054] A "chemically distinct region" refers to a region of an antisense compound that is in some way chemically different than another region of the same antisense compound. For example, a region having 2'-O-methoxyethyl nucleosides is chemically distinct from a region having nucleosides without 2'-O-methoxyethyl modifications.

[0055] "Chemical modification" refers to a chemical difference of a compound compared to its naturally occurring counterpart. Chemical modifications of oligonucleotides include nucleoside modifications (including sugar moiety modifications and nucleobase modifications) and internucleoside linkage modifications. In the case of oligonucleotides, differences in nucleobase sequence alone are not included in chemical modifications.

[0056] "Chimeric antisense compound" means an antisense compound having at least two chemically distinct regions, each region having multiple subunits.

[0057] "Cleavable bond" means any chemical bond that can be cleaved. In certain embodiments, the cleavable bond is selected from among an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a disulfide, or a peptide.

[0058] "Cleavable moiety" refers to a bond or group that can be cleaved under physiological conditions. In certain embodiments, the cleavable moiety is cleaved inside a cell or inside an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is cleaved by an endogenous enzyme such as a nuclease. In certain embodiments, the cleavable moiety comprises a group of atoms having one, two, three, four, or five or more cleavable bonds.

[0059] "Co-administration" means administering two or more therapeutic agents to an individual. The two or more therapeutic agents may be in a single pharmaceutical composition or in separate pharmaceutical compositions. Each of the two or more therapeutic agents may be administered via the same or different routes of administration. Co-administration includes parallel or sequential administration.

[0060] "Complementary" means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0061] "Comprising" means including the stated step or element or group of steps or elements but not including any other step or element or group of steps or elements. It is understood that this does not exclude groups.

[0062] "Conjugate" or "conjugate group" refers to an atom or group of atoms attached to an oligonucleotide or oligomeric compound. Generally, conjugate groups modify two or more properties of the compound to which they are attached, including, but not limited to, pharmacodynamic properties, pharmacokinetic properties, binding properties, absorption properties, cellular distribution properties, cellular uptake properties, charge properties, and / or clearance properties. "Conjugated linker" or "linker," in reference to a conjugate group, means a portion of the conjugate group, including any atom or group of atoms, that (1) covalently links an oligonucleotide to another portion of the conjugate group, or (2) covalently links two or more portions of the conjugate group.

[0063] Conjugate groups, referred to herein as radicals, provide a bond for forming a covalent bond to an oligomeric compound, such as an antisense oligonucleotide. In certain embodiments, the point of attachment to an oligomeric compound is the 3'-oxygen atom of the 3'-hydroxyl group of the 3'-terminal nucleoside of the oligomeric compound. In certain embodiments, the point of attachment to an oligomeric compound is the 5'-oxygen atom of the 5'-hydroxyl group of the 5'-terminal nucleoside of the oligomeric compound. In certain embodiments, the bond for forming a bond to an oligomeric compound is a cleavable bond. In certain such embodiments, such a cleavable bond constitutes all or part of the cleavable moiety.

[0064] In certain embodiments, a conjugate group comprises a cleavable moiety (e.g., a cleavable bond or a cleavable nucleoside) and a carbohydrate cluster moiety, such as a GalNAc cluster moiety. Such carbohydrate cluster moieties comprise a targeting moiety and, optionally, a conjugated linker. In certain embodiments, the carbohydrate cluster moiety is identified by the number and identity of the ligand. For example, in certain embodiments, a carbohydrate cluster moiety comprises three GalNAc groups and is designated "GalNAc3." In certain embodiments, a carbohydrate cluster moiety comprises four GalNAc groups and is designated "GalNAc4." Specific carbohydrate cluster moieties (with specific tether, branching, and conjugated linker groups) are described and designated herein by a Roman numeral followed by the subscript "a." Thus, "GalNAc3-1" a " refers to a specific carbohydrate cluster portion of a conjugate group having three GalNac groups, and specifically specified tether, branching, and linking groups. Such carbohydrate cluster fragments are attached to oligomeric compounds via cleavable bonds or cleavable moieties such as cleavable nucleosides.

[0065] "Conjugate compound" means any atom, group of atoms, or linked group of atoms suitable for use as a conjugate group. In certain embodiments, a conjugate compound may have or impart two or more properties, such as, but not limited to, pharmacodynamic properties, pharmacokinetic properties, binding properties, absorption properties, cellular distribution properties, cellular uptake properties, charge properties, and / or clearance properties.

[0066] "Contiguous nucleobases" means nucleobases that are immediately adjacent to each other.

[0067] "Design" or "designed" refers to the process of creating oligomeric compounds that specifically hybridize to a selected nucleic acid molecule.

[0068] "Diluent" means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, in an injectable drug, the diluent may be a liquid, such as a saline solution.

[0069] "Dose" refers to a specific amount of a therapeutic agent provided in a single administration or at a specified time. In certain embodiments, a dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, a volume that does not easily fit into a single injection may be required, so two or more injections may be administered to achieve the desired dose. In certain embodiments, a therapeutic agent is administered over an extended period of time or by continuous infusion. A dose may be expressed as the amount of therapeutic agent per hour, day, week, or month.

[0070] By "downstream" is meant the relative direction toward the 3' or C-terminus of the nucleic acid.

[0071] With respect to modulating activity or treating or preventing a condition, an "effective amount" means the administration to a subject in need of such modulation, treatment, or prevention, either in a single dose or as part of a series, of an amount of a therapeutic agent effective to modulate the effect, or to treat or prevent or ameliorate the condition. Effective amounts may vary from individual to individual, depending on the health and physical condition of the individual being treated, the taxonomic group of the individual being treated, the formulation of the composition, an assessment of the individual's medical condition, and other relevant factors.

[0072] "Efficacy" means the ability to produce a desired effect.

[0073] "Expression" includes all of the functions that convert a gene's encoded information into structures present and operating in a cell, including, but not limited to, transcription products and translation products.

[0074] "Fully complementary" or "100% complementary" means that each nucleobase of a first nucleic acid has a complementary nucleobase in a second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the target nucleic acid is the second nucleic acid.

[0075] "Gapmer" means a chimeric antisense compound in which an inner region having multiple nucleosides that supports RNase H cleavage is positioned between outer regions having two or more nucleosides, and the nucleosides comprising the inner region are chemically distinct from one or more of the nucleosides comprising the outer regions. The inner region can be referred to as the "gap" and the outer regions can be referred to as the "wings."

[0076] "Halo" and "halogen" refer to an atom selected from fluorine, chlorine, bromine, and iodine.

[0077] "Heteroaryl" and "heteroaromatic" refer to a radical containing a monocyclic or polycyclic aromatic ring, ring system, or fused ring system in which at least one of the rings is aromatic and contains two or more heteroatoms. Heteroaryl is also intended to encompass fused ring systems, including systems in which two or more of the fused rings do not contain heteroatoms. Heteroaryl groups typically contain one ring atom selected from sulfur, nitrogen, or oxygen. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isoxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzoxazolyl, quinoxalinyl, and the like. Heteroaryl radicals can be attached directly to a parent molecule or through a linking moiety such as an aliphatic group or a heteroatom. Heteroaryl groups as used herein can optionally contain additional substituents.

[0078] "Hybridization" refers to the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and target nucleic acids. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.

[0079] "Identifying an animal with an inflammatory disease" means identifying an animal that has been diagnosed with an inflammatory disease or that is susceptible to developing an inflammatory disease. Individuals susceptible to developing an inflammatory disease include those with two or more risk factors for developing an inflammatory disease, including environmental factors, personal or family history, or a genetic predisposition to two or more diseases. Such identification can be achieved by methods including evaluation of the individual's medical history, standard clinical tests or evaluations, such as genetic testing.

[0080] "Identifying an animal with a PKK-associated disease" means identifying an animal that has been diagnosed with or is susceptible to developing a PKK-associated disease. Individuals susceptible to developing a PKK-associated disease include those with a personal or family history of two or more PKK-associated diseases or those with two or more risk factors for developing a PKK-associated disease, including a genetic predisposition. Such identification can be accomplished by methods including evaluation of the individual's medical history, standard clinical tests or evaluations, such as genetic testing.

[0081] "Identifying an animal with a thromboembolic disease" refers to identifying an animal that has been diagnosed with a thromboembolic disease or that is susceptible to developing a thromboembolic disease. Individuals susceptible to developing a thromboembolic disease include those with two or more risk factors for developing a thromboembolic disease, including, for example, a family history of a thromboembolic disease or two or more genetic predispositions, immobility, surgery (especially orthopedic surgery), malignancy, pregnancy, advanced age, use of oral contraceptives, atrial fibrillation, a history of thromboembolic disease, chronic inflammatory disease, and inherited or acquired prothrombotic coagulation disorders. Such identification can be achieved by methods including evaluation of the individual's medical history, standard clinical tests or evaluations, such as genetic testing.

[0082] "Immediately adjacent" means that there are no intervening elements between the immediately adjacent elements. "Individual" means a human or non-human animal selected for treatment or therapy.

[0083] "Individual" means a human or non-human animal selected for treatment or therapy.

[0084] "Inhibiting PKK" means reducing the level or expression of PKK mRNA and / or protein. In certain embodiments, PKK mRNA and / or protein levels are inhibited in the presence of a compound targeting PKK, including an antisense oligonucleotide targeting PKK, relative to the expression of PKK mRNA and / or protein levels in the absence of a PKK antisense compound, such as an antisense oligonucleotide.

[0085] "Inhibiting expression or activity" refers to a reduction or blocking of expression or activity, and does not necessarily indicate a complete elimination of expression or activity.

[0086] "Internucleoside linkage" refers to the chemical bond between nucleosides.

[0087] "Internucleoside neutral linking group" means a neutral linking group that directly links two nucleosides.

[0088] "Phosphorus internucleoside linking group" means a phosphorus linking group that directly links two nucleosides.

[0089] "Linkage motif" refers to a pattern of linkage modifications in an oligonucleotide or a region thereof. The nucleosides of such an oligonucleotide may be modified or unmodified. Unless otherwise indicated, a motif herein that includes only a description of a linkage is considered to be a linkage motif. Thus, in such cases, the nucleosides are not limiting.

[0090] "Linked nucleosides" means adjacent nucleosides linked together by an internucleoside linkage.

[0091] "Locked nucleic acid" or "LNA" or "LNA nucleoside" refers to a nucleic acid monomer having a bridge connecting two carbon atoms between the 4' and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to, A) α-L-methyleneoxy (4'-CH2-O-2') LNA, (B) β-D-methyleneoxy (4'-CH2-O-2') LNA, (C) ethyleneoxy (4'-(CH2)2-O-2') LNA, (D) aminooxy (4'-CH2-ON(R)-2') LNA, and (E) oxyamino (4'-CH2-N(R)-O-2') LNA.

[0092] [ka]

[0093] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4' and 2' sugar positions, where each bridge is independently [C(R1)(R2)]n -, -C(R1)=C(R2)-, -C(R1)=N-, -C(=NR1)-, -C(=O)-, -C(=S)-, -O-, -Si(R1)2-, -S(=O) x - and N(R1)-, where x is 0, 1 or 2, and n is 1, 2, 3, or 4; and each R1 and R2 is independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 substituted radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), where each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl or a protecting group.

[0094] Examples of 4'-2' bridging groups included within the definition of LNA include, but are not limited to, -[C (R1)(R2)] n -, -[C(R1)(R2)] nFurther, other bridging groups included within the definition of LNA are 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R1)-2' and 4'-CH2-N(R1)-O-2'-bridges, where each R1 and R2 is independently H, a protecting group, or C1-C 12 It is alkyl.

[0095] Also included in the definition of LNA in the present invention is an LNA in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH2-O-2') bridge, forming a bicyclic sugar moiety. The bridge can also be a methylene-(CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, and the term methyleneoxy (4'-CH2-O-2') LNA is used. Furthermore, in the case of a bicyclic sugar moiety with an ethylene bridging group at this position, the term ethyleneoxy (4'-CH2CH2-O-2') LNA is used. α-L-methyleneoxy (4'-CH2-O-2') and methyleneoxy (4'-CH2-O-2') LNA are also included in the definition of LNA used herein.

[0096] A "mismatch" or "non-complementary nucleobase" refers to the failure of a nucleobase of a first nucleic acid to pair with the corresponding nucleobase of a second or target nucleic acid.

[0097] A "modified internucleoside linkage" refers to a substitution or any alteration from a naturally occurring internucleoside bond (ie, a phosphodiester internucleoside bond).

[0098] "Modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymidine (also known as 5-methyluracil), or uracil. "Unmodified nucleobase" means the purine bases (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0099] "Modified nucleoside" means a nucleoside having, independently, a modified sugar moiety and / or a modified nucleobase.

[0100] "Modified nucleotide" means a nucleotide having, independently, a modified sugar moiety, a modified internucleotide linkage, and / or a modified nucleobase.

[0101] "Modified oligonucleotide" means an oligonucleotide containing at least one modified internucleoside linkage, modified sugar, and / or modified nucleobase.

[0102] By "modified sugar" is meant a substitution and / or some alteration from a natural sugar moiety.

[0103] The term "monocyclic or polycyclic ring system" is intended to encompass all ring systems selected from monocyclic or fused or linked polycyclic radical ring systems, including single and mixed ring systems individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic, and heteroarylalkyl. Such monocyclic and polycyclic structures can each contain rings with the same level of saturation, or each independently contain rings with varying degrees of saturation, including fully saturated, partially saturated, or fully unsaturated. Each ring can contain ring atoms selected from C, N, O, and S to produce heterocyclic rings and also rings containing only C ring atoms, which can occur in mixed motifs, such as benzimidazole, where one ring has only carbon ring atoms and the fused ring has two nitrogen atoms. Monocyclic or polycyclic ring systems can also be used in heterocyclic rings, for example, where one ring has only carbon ring atoms and the fused ring has two nitrogen atoms. The monocyclic or polycyclic ring systems can be attached to the parent molecule using a variety of strategies, including direct bonding through a ring atom, fusion through multiple ring atoms, bonding through a substituent, or bonding through a bifunctional linking moiety.

[0104] "Monomer" means a single unit of an oligomer. Monomers include, but are not limited to, naturally occurring or modified nucleosides.

[0105] "Motif" means the pattern of unmodified and modified nucleosides in an antisense compound.

[0106] By "natural sugar moiety" is meant a sugar moiety found in DNA (2'-H) or RNA (2'-OH).

[0107] By "naturally occurring internucleoside linkage" is meant a 3' to 5' phosphodiester linkage.

[0108] "Neutral linking group" refers to a linking group that is not charged. Neutral linking groups include, but are not limited to, phos, methylphosphonate, MMI (-CH2-N(CH3)-O-), amide-3 (-CH2-C(=O)-N(H)-), amide-4 (-CH2-N(H)-C(=O)-), formacetal (-O-CH2-O-), and thioform (-S-CH2-O-). Additionally, neutral linking groups include nonionic linkers, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonates, and amides (see, e.g., "Carbohydrate Modifications in Antisense Research," edited by Y.S. Sanghvi and P.D. Cook, ACS Symposium Series 580; Chapters 3 and 4 (pp. 40-65)). Additionally, neutral linking groups also include non-ionic linking moieties that contain mixed N, O, S, and CH2 moieties.

[0109] "Non-complementary nucleobases" refers to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise support hybridization.

[0110] "Non-internucleoside neutral linking group" means a neutral linking group that does not directly link two nucleosides. In certain embodiments, a non-internucleoside neutral linking group links a nucleoside to a group that is not a nucleoside. In certain embodiments, a non-internucleoside neutral linking group links two groups, neither of which is a nucleoside.

[0111] "Non-internucleoside phosphorus linking group" means a phosphorus linking group that does not directly link two nucleosides. In certain embodiments, a non-internucleoside phosphorus linking group links a nucleoside to a group other than a nucleoside. In certain embodiments, a non-internucleoside phosphorus linking group links two groups, neither of which is a nucleoside.

[0112] "Nucleic acid" refers to a molecule composed of monomeric nucleotides, including, but not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).

[0113] "Nucleobase" means a heterocyclic moiety capable of pairing with a base of another nucleic acid.

[0114] "Nucleobase complementarity" refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, a complementary nucleobase refers to a nucleobase of an antisense compound that can base pair with a nucleobase of its target nucleic acid. For example, if a nucleobase at a particular position of an antisense compound can hydrogen bond with a nucleobase at a particular position of a target nucleic acid, the hydrogen bonding positions between the oligonucleotide and the target nucleic acid are considered complementary in their nucleobase pairs.

[0115] "Nucleobase modification motif" means a pattern of modifications to nucleobases along an oligonucleotide. Unless otherwise indicated, the nucleobase modification motif is independent of the nucleobase sequence.

[0116] "Nucleobase sequence" means the order of contiguous nucleobases, independent of sugar, linkage, and / or nucleobase modifications.

[0117] "Nucleoside" means a nucleobase linked to a sugar.

[0118] "Nucleoside mimetic" includes structures used to replace sugars or sugars and bases (but not necessarily linkages) at two or more positions in an oligomeric compound, such as morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., nucleoside mimetics having non-furanose sugar units. Nucleotide mimetics include structures used to replace nucleosides and linkages at two or more positions in an oligomeric compound, such as peptide nucleic acids or morpholinos (morpholinos linked by -N(H)-C(=O)-O- or other non-phosphodiester linkages). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic, but refers to the replacement of only the sugar unit (furanose ring). The tetrahydropyranyl ring provided herein illustrates one example of a sugar surrogate in which the furanose sugar group is replaced with a tetrahydropyranyl ring system. "Mimetic" refers to groups that are substituted for sugars, nucleobases, and / or internucleoside linkages. Typically, a mimetic is substituted for a sugar or sugar-internucleoside linkage combination, while maintaining the nucleobases for hybridization to a selected target.

[0119] "Nucleoside motif" refers to a pattern of nucleoside modifications in an oligonucleotide or a region thereof. The linkages of such oligonucleotides may be modified or unmodified. Unless otherwise indicated, a motif herein that contains only a nucleoside description is considered to be a nucleoside motif. Thus, in such cases, the linkages are not limited.

[0120] "Nucleotide" means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.

[0121] "Off-target effect" refers to an unwanted or adverse biological effect associated with the modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[0122] By "oligomeric compound" or "oligomer" is meant a polymer of linked monomeric subunits that is capable of hybridizing to at least a region of a nucleic acid molecule.

[0123] "Oligonucleotide" means a polymer of linked nucleosides, each of which can be modified or unmodified independently of the others.

[0124] "Parenteral administration" means administration by injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous, intravenous, intramuscular, intraarterial, intraperitoneal, or intracranial, e.g., intrathecal or intraventricular, administration.

[0125] "Peptide" means a molecule formed by linking at least two amino acids by an amide bond. As used herein, peptide refers to, but is not limited to, polypeptides and proteins.

[0126] "Pharmaceutical agent" refers to a substance that provides a therapeutic effect when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide targeted to PKK is a pharmaceutical agent.

[0127] A "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an antisense oligonucleotide and a sterile aqueous solution.

[0128] "Pharmaceutically acceptable derivatives" include pharmaceutically acceptable salts, conjugates, prodrugs or isomers of the compounds described herein.

[0129] "Pharmaceutically acceptable salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects thereto.

[0130] "Phosphorothioate linkage" means an internucleoside linkage in which the phosphodiester bond has been modified by replacing one of the non-bridging oxygen atoms with a sulfur atom. A phosphorothioate linkage is a modified internucleoside linkage.

[0131] "Phosphorus linking group" means a linking group that includes a phosphorus atom. Phosphorus linking groups include, but are not limited to, groups having the formula:

[0132] [ka] where: R a and R d are each independently O, S, CH, NH, or NJ1, where J1 is C1-C6 alkyl or substituted C1-C6 alkyl; R b is O or S, R c is OH, SH, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy alkoxy, substituted C1-C6 alkoxy, amino or substituted amino; J1 is R b is O or S.

[0133] Phosphorus linking groups include, but are not limited to, phosphodiesters, phosphorothioates, phosphorodithioates, phosphonates, phosphoramidates, phosphorothioamidates, thionoalkylphosphonates, phosphotriesters, thionoalkylphosphotriesters, and boranophosphates.

[0134] "PKK" refers to mammalian plasma prekallikrein, including human plasma prekallikrein. Plasma prekallikrein (PKK) is the precursor of plasma kallikrein (PK) and is encoded by the KLKB1 gene.

[0135] "PKK-associated disease" means any disease associated with any PKK nucleic acid or its expression product. Such diseases may include inflammatory or thromboembolic diseases. Such diseases may include hereditary angioedema (HAE).

[0136] By "PKK mRNA" is meant any messenger RNA expression product of a DNA sequence encoding PKK.

[0137] "PKK nucleic acid" refers to any nucleic acid encoding a PKK. For example, in certain embodiments, a PKK nucleic acid includes a DNA sequence encoding a PKK, an RNA sequence transcribed from DNA encoding a PKK (including genomic DNA containing introns and exons), and an mRNA sequence encoding a PKK. "PKK mRNA" refers to an mRNA encoding a PKK protein.

[0138] "PKK protein" means the polypeptide expression product of a PKK nucleic acid.

[0139] "Portion" means a predetermined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a predetermined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a predetermined number of contiguous nucleobases of an antisense compound.

[0140] "Prevention" or "preventing" refers to delaying or forestalling the onset or occurrence of a disease, disorder, or condition over a period of minutes to days, weeks, months, or indefinitely.

[0141] "Prodrug" means a therapeutic agent that is prepared in an inactive form that is converted to the active form (i.e., drug) within the body or cells by the action of endogenous enzymes or other chemicals and / or conditions.

[0142] A "prophylactically effective amount" refers to an amount of a pharmaceutical agent that confers a prophylactic or preventative benefit on an animal.

[0143] "Protecting group" means any compound or protecting group known to those skilled in the art. Non-limiting examples of protecting groups are described in "Protective Groups in Organic Chemistry" by T.W. Greene, P.G.M. Butts, ISBN 0-471-62301-6, John Wiley & Sons, Inc., which is incorporated herein by reference in its entirety. & Sons, Inc., New York.

[0144] A "region" is defined as a portion of a target nucleic acid that has at least one identifiable structure, function, or characteristic.

[0145] "Ribonucleotide" means a nucleotide having a hydroxyl at the 2' position of the sugar moiety of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents.

[0146] "RISC-based antisense compound" means an antisense compound whose antisense activity is at least in part attributable to the RNA-induced silencing complex (RISC). It means a thysence compound.

[0147] "RNase H-based antisense compound" means an antisense compound where at least part of the antisense activity of the antisense compound results from hybridization of the antisense compound to a target nucleic acid and subsequent cleavage of the target nucleic acid by RNase H.

[0148] "Salts" means physiologically and pharmaceutically acceptable salts of antisense compounds, i.e., salts that retain the desired biological activity of the parent oligonucleotide and do not impart undesired toxicological effects.

[0149] A "segment" is defined as a smaller portion or subportion of a region within the target nucleic acid.

[0150] "Distinct regions" means portions of an oligonucleotide in which the chemical modifications or chemical modification motifs of any adjacent portions contain at least one difference that allows the distinct regions to be distinguished from one another.

[0151] "Sequence motif" means a pattern of nucleobases arranged along an oligonucleotide or a portion thereof. Unless otherwise indicated, a sequence motif is independent of chemical modification and can have any combination of chemical modifications, including no chemical modifications.

[0152] "Side effects" means physiological responses other than the desired effects resulting from treatment. In certain embodiments, side effects include, but are not limited to, injection site reactions, liver function test abnormalities, kidney function test abnormalities, liver toxicity, kidney toxicity, central nervous system abnormalities, and myopathy.

[0153] "Single-stranded oligonucleotide" means an oligonucleotide that is not hybridized to a complementary strand.

[0154] As used herein, a "site" is defined as a unique nucleobase position within a target nucleic acid.

[0155] "Specifically hybridizable" or "specifically hybridizes" refers to an antisense compound having sufficient complementarity between the antisense oligonucleotide and the target nucleic acid to induce a desired effect while exerting minimal or no effect on non-target nucleic acids under conditions where specific binding is desired, i.e., physiological conditions in the case of in vivo assays or therapeutic treatments.

[0156] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound will hybridize to its target sequence, but to only a small number of other sequences.

[0157] "Subject" means a human or non-human animal selected for treatment or therapy.

[0158] "Substituent" and "substituent group" refer to an atom or group that replaces an atom or group of a named parent compound. For example, a substituent of a modified nucleoside is any atom or group that is different from the atom or group found in naturally occurring nucleosides (e.g., a modified 2'-substituent is any atom or group other than H or OH at the 2' position of a nucleoside). Substituents can be protected or unprotected. In certain embodiments, compounds of the present disclosure are compounds that are similar to or more closely related to the parent compound. The substituents may be further substituted with other substituents and may be attached directly to the parent compound or through a linking group such as an alkyl or hydrocarbyl group.

[0159] Similarly, as used herein, a "substituent," with respect to a chemical functional group, means an atom or group of atoms that is different from the atom or group of atoms normally present in the named functional group. In certain embodiments, the substituent replaces a hydrogen atom of the functional group (e.g., in certain embodiments, the substituent of a substituted methyl group is an atom or group other than hydrogen that replaces one of the hydrogen atoms of the unsubstituted methyl group). Unless otherwise indicated, groups suitable for use as substituents include halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-C(O)R aa ), carboxyl (-C(O)OR aa ), aliphatic groups, alicyclic groups, alkoxy, substituted oxy (-OR aa ), aryl, aralkyl, heterocyclic radical, heteroaryl, heteroarylalkyl, amino (-N(R bb )(R cc )), Imino (=NR bb ), amide (-C(O)N(R bb )(R cc ) or -N(R bb )C(O)R aa), azide (-N3), nitro (-NO2), cyano (-CN), carbamide (-OC(O)N(R bb )(R cc ) or -N(R bb )C(O)OR aa ), ureido(-N(R bb )C(O)N(R bb )(R cc )), thioureido (-N(R bb )C(S)N(R bb )-(R cc )), guanidinyl (-N(R bb )C(=NR bb )N(R bb )(R cc )), amidinyl (-C(=NR bb )N(R bb )(R cc ) or -N(R bb )C(=NR bb )(R aa )), thiol (-SR bb ), sulfinyl (-S(O)R bb ), sulfonyl (-S(O)R bb ), and sulfonamidyl (-S(O)N(R bb )(R cc ) or -N(R bb )S-(O)2R bb ), but are not limited to, wherein each R aa , R bb , and R cc are independently H, an optionally linked chemical functionality, or further substituents, preferred of which include, but are not limited to, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic, and heteroarylalkyl. Selected substituents within the compounds described herein may occur to a recursive degree.

[0160] "Substituted sugar moiety" means a furanosyl that is not a naturally occurring sugar moiety. Substituted sugar moieties include, but are not limited to, furanosyl containing substituents at the 2', 3', 5', and / or 4' positions. Certain substituted sugar moieties are bicyclic sugar moieties.

[0161] "Sugar moiety" means the naturally occurring or modified sugar moiety of a nucleoside.

[0162] "Sugar motif" refers to the pattern of sugar modifications on an oligonucleotide or a region thereof.

[0163] "Sugar surrogate" refers to a structure that does not contain furanosyl and can replace the naturally occurring sugar moiety of a nucleoside such that the resulting nucleoside subunits can be linked together and / or to other nucleosides to form oligomeric compounds that can hybridize to complementary oligomeric compounds. Such structures include structures that contain a different number of atoms than the furanosyl (e.g., 4-, 6-, or 7-membered ring), or that replace the oxygen of the furanosyl with a non-oxygen atom (e.g., carbon, sulfur, or nitrogen), or both a change in the number of atoms and a replacement of the oxygen. Such structures can also include substitutions corresponding to those described for substituted sugar moieties (e.g., 6-membered carbocyclic bicyclic sugar surrogates, optionally containing additional substituents). Sugar surrogates also encompass more complex sugar surrogates (e.g., the acyclic systems of peptide nucleic acids). Sugar surrogates include, but are not limited to, morpholino, cyclohexenyl, and cyclohexitol.

[0164] "Target" refers to a protein whose modulation is desired.

[0165] "Target gene" refers to a gene that encodes a target.

[0166] "Targeting" or "targeted" refers to the process of designing and selecting an antisense compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0167] The terms "target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to a nucleic acid that can be targeted by antisense compounds.

[0168] "Target region" means a portion of a target nucleic acid that is targeted by two or more antisense compounds.

[0169] "Target segment" refers to the sequence of nucleotides in a target nucleic acid to which an antisense compound is targeted. "5' target site" refers to the 5'-most nucleotide of a target segment. "3' target site" refers to the 3'-most nucleotide of a target segment.

[0170] "Terminal group" refers to two or more atoms attached to either the 3'-end or the 5'-end, or both, of an oligonucleotide. In certain embodiments, the terminal group is a conjugated group. In certain embodiments, the terminal group comprises two or more terminal nucleosides.

[0171] "Terminal internucleoside linkage" means a linkage between at least two nucleosides of an oligonucleotide or a predetermined region thereof.

[0172] "Therapeutically effective amount" means an amount of a pharmaceutical agent that confers a therapeutic benefit on an individual.

[0173] "Treat" or "treating" or "treatment" refers to the administration of a composition to result in the amelioration of the disease or condition.

[0174] A "type of modification" or a "type" of nucleoside with respect to a nucleoside refers to the chemical modification of the nucleoside and includes modified and unmodified nucleosides. Thus, unless otherwise indicated, a "nucleoside having a first type of modification" can be an unmodified nucleoside.

[0175] "Unmodified" nucleobase means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0176] "Unmodified nucleotide" means a nucleoside composed of a naturally occurring nucleobase, sugar moiety, and internucleoside linkage. In certain embodiments, the unmodified nucleotide is an RNA nucleotide (i.e., a β-D-ribonucleoside) or a DNA nucleotide (i.e., a β-D-deoxyribonucleoside).

[0177] "Upstream" means in the relative direction toward the 5' or N-terminus of a nucleic acid.

[0178] The "wing segment" refers to a molecule that exhibits enhanced inhibitory activity, increased binding affinity to a target nucleic acid, Or it refers to multiple nucleosides modified to impart properties to the oligonucleotide, such as resistance to degradation by nucleases in vivo.

[0179] Certain embodiments Certain embodiments provide compounds, compositions, and methods for inhibiting plasma prekallikrein (PKK) mRNA and protein expression. Certain embodiments provide compounds, compositions, and methods for reducing PKK mRNA and protein levels.

[0180] Certain embodiments provide antisense compounds targeting plasma prekallikrein (PKK) nucleic acids. In certain embodiments, the PKK nucleic acid is selected from the group consisting of GENBANK Accession No. NM_000892.3 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. DC412984.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. CN265612.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. AK297672.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. DC413312.1 (incorporated herein as SEQ ID NO: 5), and the like. GENBANK Accession No. AV688858.2 (incorporated herein as SEQ ID NO:6), GENBANK Accession No. CD652077.1 (incorporated herein as SEQ ID NO:7), GENBANK Accession No. BC143911.1 (incorporated herein as SEQ ID NO:8), GENBANK Accession No. CB162532.1 (incorporated herein as SEQ ID NO:9), GENBANK Accession No. truncated to nucleobases 111693001 to 111730000 No. NT_016354.19, (incorporated herein as SEQ ID NO:10), GENBANK Accession No. NM_008455.2 (incorporated herein as SEQ ID NO:11), GENBANK Accession No. BB598673.1 (incorporated herein as SEQ ID NO:12), truncated from nucleobases 6114001 to 6144000, GENBANK Accession No. NT_039460.7 (incorporated herein as SEQ ID NO:13), GENBANK Accession No. NM_012725.2 (sequence No. 14), GENBANK accession number NW_047473.1 truncated from nucleobases 10952001 to 110982000 (incorporated herein as SEQ ID NO: 15), GENBANK accession number XM_002804276.1 (incorporated herein as SEQ ID NO: 17), and GENBANK accession number NW_001118167.1 truncated from nucleobases 2358000 to 2391000 (incorporated herein as SEQ ID NO: 18).

[0181] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-2226.

[0182] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of SEQ ID NO:570.

[0183] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and is selected from the group consisting of SEQ ID NO: 705 has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases.

[0184] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of SEQ ID NO: 1666.

[0185] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 20 linked nucleosides and has the nucleobase sequence of SEQ ID NO:570.

[0186] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 20 linked nucleosides and has the nucleobase sequence of SEQ ID NO:705.

[0187] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 16 linked nucleosides and has the nucleobase sequence of SEQ ID NO:1666.

[0188] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of SEQ ID NO:SEQ ID NOs: 62, 72, 103, 213, 312, 334-339, 344, 345, 346, 348, 349, 351, 369, 373, 381, 382, ​​383, 385, 387-391, 399, 411, 412, 414, 416, 444, 446-449, 452, 453, 454, 459, 460, 462-472, 473, 476, 477, 479, 480, 481, 484, 489-495, 497, 500, 504, 506, 522, 526, 535, 558, 559, 560, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617, 618, 619, 620, 6 64, 566, 568-571, 573, 576, 577, 578, 587, 595, 597-604, 607, 608, 610, 613, 615, 618, 619, 622, 623, 624, 633, 635, 636, 638, 639, 640, 642, 643, 645, 652, 655-658, 660, 661, 670, 674-679, 684, 685, 698, 704, 705, 707, 708, 713, 716, 717, 728, 734, 736, 767, 768, 776, 797, 7 98, 800, 802, 810, 815, 876, 880, 882, 883, 886, 891, 901-905, 908-911, 922, 923, 924, 931, 942, 950-957, 972, 974, 978, 979, 980, 987-991, 1005, 1017-1021, 1025, 1026, 1029, 1030, 1032, 1034, 1035, 1037, 1040, 1041, 1045, 1046, 1051, 1054, 1059, 1060, 1061, 1064, 106 5, 1066, 1075, 1076, 1087, 1089, 1111, 1114, 1116, 1117, 1125, 1133, 1153, 1169, 1177, 1181, 1182, 1187, 1196, 1200, 1214, 1222, 1267, 1276, 1277, 1285, 1286, 1289, 1290, 1291, 1303, 1367, 1389, 1393, 1398-1401, 1406, 1407, 1408, 1411, 1419-1422, 1426, 1430, 1431, 1. 432, 1434-1437, 1439, 1440, 1443, 1444, 1451, 1452, 1471, 1516, 1527, 1535, 1537, 1538, 1539, 1540, 1541, 1563, 1564, 1567, 1568, 1616, 1617, 1623, 1629, 1664, 1665, 1666, 1679, 1687, 1734, 1804, 1876, 1886, 1915, 2008, 2018, 2100, 2101, 2115, and 2116. In some embodiments, the modified oligonucleotide achieves at least 80% inhibition of PKK mRNA.

[0189] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of SEQ ID NO: SEQ ID NOs: 62, 72, 103, 213, 334-339, 344, 346, 348, 349, 351, 381, 382, ​​383, 385, 389, 390, 391, 446, 448, 452, 453, 454, 466-473, 476, 481, 484, 491, 492, 494, 495, 497, 504, 526, 558, 559, 566, 568-571, 576, 578, 587, 59 5, 597, 598, 600-604, 607, 610, 613, 618, 619, 624, 635, 638, 639, 645, 652, 656, 657, 658, 660, 674, 675, 676, 684, 698, 704, 705, 707, 713, 716, 768, 876, 880, 901-905, 908-911, 922, 923, 924, 931, 942, 951, 954-955 7, 972, 974, 978, 979, 987, 988, 990, 1005, 1019, 1020, 1021, 1025, 1032, 1037, 1040, 1041, 1045, 1054, 1059, 1060, 1061, 1064, 1065, 1066, 1075, 1111, 1116, 1117, 1125, 1133, 1153, 1169, 1177, 1200, 1222, 1267, 1 285, 1290, 1291, 1303, 1367, 1398, 1399, 1401, 1406, 1408, 1411, 1419, 1420, 1421, 1426, 1430, 1431, 1432, 1434-1437, 1440, 1443, 1444, 1451, 1537-1540, 1563, 1616, 1679, 1687, 1804, 2008, 2101, 2115, and 2116. In some embodiments, the modified oligonucleotide achieves at least 85% inhibition of PKK mRNA.

[0190] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of SEQ ID NO: SEQ ID NOs: 334, 346, 351, 382, ​​390, 391, 446, 448, 452, 453, 468, 469, 470, 471, 472, 476, 481, 491, 495, 504, 558, 566, 568, 570, 571, 578, 587, 597, 598, 600, 604, 613, 635, 638, 645, 656, 658, 660, 674, 675, 684, 704, 705, 880, 901-905, 909, 922, 931, 951, 954, 956, 990, 1005, 1020, 1032, 1037, 1040, 1041, 1045, 1054, 1075, 1111, 1125, 1133, 1153, 1200, 1267, 1291, 1303, 1398, 1399, 1401, 1406, 1420, 1426, 1430, 1431, 1434, 1435, 1436, 1440, 1443, 1451, 1537-1540, 2115, and 2116. In some embodiments, the modified oligonucleotide achieves at least 90% inhibition of PKK mRNA.

[0191] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of the following SEQ ID NOs: 334, 391, 448, 468, 469, 568, 570, 598, 635, 658, 674, 684, 705, 901, 903, 904, 922, 990, 1267, 1291, 1420, 1430, 1431, 1434, 1435, 1436, 1537, 1538, and 1540. In certain embodiments, the modified oligonucleotide achieves at least 95% inhibition of PKK mRNA.

[0192] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of SEQ ID NO: SEQ ID NOs: 334, 338, 346, 349, 382, ​​383, 390, 448, 452, 453, 454, 495, 526, 559, 570, 587, 598, 635, 660, 705, 901, 903, 904, 908, 923, 931, 955, 974, 988, 990, 1020, 1039, 1040, 1111, 1117, 1267, 1291, 1349, 1352, 1367, 1389, 1393, 1399, 1401, 1408, 1410, 1411, 1412, 1413, 1414, 1415, 1416, 1417, 1418, 1419, 1420, 1421, 1422, 1423, 1424, 1425, 1426, 1427, 1428, 1429, 1430, 1431, 1432, 1433, 1434, 1435, 1436, 1437, 1438, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1448, 1449, 1450, 1451, 1452, 1453, 411, 1426, 1499, 1516, 1535, 1544, 1548, 1563, 1564, 1568, 1569, 1598, 1616, 1617, 1623, 1624, 1643, 1661, 1665, 1666, 1673, 1679, 1695, 1720, 1804, 1817, 1876, 1881, 1886, 1940, 1947, 2008, 2018, 2019, 2031, 2044, 2100, 2101, 2115, and 2116. In some embodiments, the modified oligonucleotide has an IC of 0.4 or less. 50 (μM) is achieved.

[0193] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of the following SEQ ID NOs: 334, 346, 349, 382, ​​453, 454, 495, 526, 570, 587, 598, 635, 660, 901, 903, 904, 931, 955, 990, 1020, 1111, 1267, 1349, 1352, 1367, 1389, 1399, 1408, 1411, 1426, 1430, 1432, 1434, 1436, 1438, 1440, 1442, 1446, 1448, 1449, 1450, 1452, 1454, 1456, 1458, 1460, 1462, 1464, 1466, 1468, 1469, 1470, 1471, 1472, 1473, 1474, 1475, 1476, 1477, 1478, 1479, 1480, 1481, 1482, 1483, 1484, 1485, 1486, 516, 1535, 1544, 1548, 1563, 1564, 1568, 1569, 1598, 1616, 1617, 1623, 1643, 1661, 1665, 1666, 1673, 1695, 1804, 1876, 1881, 2019, 2044, 2100, 2101, 2115, and 2116. In certain embodiments, the modified oligonucleotide has an IC of 0.3 or less. 50 (μM) is achieved.

[0194] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of the following SEQ ID NOs: 334, 346, 382, ​​453, 495, 526, 570, 587, 598, 635, 901, 904, 931, 955, 1020, 1111, 1349, 1352, 1389, 1426, 1516, 1535, 1544, 1548, 1564, 1569, 1598, 1616, 1617, 1619, 1620, 1621, 1622, 1623, 1624, 1625, 1626, 1627, 1628, 1629, 1630, 1631, 1632, 1633, 1634, 1635, 1636, 1637, 1638, 1639, 1640, 1641, 1642, 1643, 1644, 1645, 1646, 1647, 1648, 1649, 1649, 1649, 1650, 1651, 1652, 1653, 1654, 7, 1665, 1666, 1804, 1876, 1881, 2019, 2044, 2101, and 2116. In certain embodiments, the modified oligonucleotide has an IC of 0.2 or less. 50 (μM) is achieved.

[0195] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of the nucleobase sequence of the following SEQ ID NOs: 334, 495, 587, 598, 635, 1349, 1352, 1389, 1516, 1544, 1548, 1569, 1598, 1617, 1665, 1666, 1804, 1881, and 2019. In certain embodiments, the modified oligonucleotide has an IC of 0.2 or less. 50 (μM) is achieved.

[0196] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 27427 to 27466 of SEQ ID NO: 10.

[0197] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 33183 to 33242 of SEQ ID NO: 10.

[0198] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 30570 to 30610 of SEQ ID NO: 10.

[0199] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 27427 to 27520 of SEQ ID NO:10.

[0200] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 33085 to 33247 of SEQ ID NO: 10.

[0201] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, The modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 30475 to 30639 of SEQ ID NO:10.

[0202] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 27362 to 27524 of SEQ ID NO: 10.

[0203] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 33101 to 33240 of SEQ ID NO: 10.

[0204] Certain embodiments provide a compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 30463 to 30638 of SEQ ID NO: 10.

[0205] Certain embodiments provide compounds comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of exon 9, exon 12, or exon 14 of a PKK nucleic acid.

[0206] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO:10.

[0207] In certain embodiments, the compound consists of a single-stranded modified oligonucleotide.

[0208] In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide is a modified internucleoside linkage.

[0209] In certain embodiments, at least one modified internucleoside linkage of the modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0210] In certain embodiments, the modified oligonucleotide comprises at least 1, 2, 3, 4, 5, 6, or 7 phosphodiester internucleoside linkages.

[0211] In certain embodiments, each internucleoside linkage of a modified oligonucleotide is selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0212] In certain embodiments, each internucleoside linkage of the modified oligonucleotide is a phosphorothioate linkage.

[0213] In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

[0214] In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0215] In certain embodiments, a modified oligonucleotide comprises at least one modified sugar.

[0216] In certain embodiments, the modified sugar is a 2'-modified sugar, BNA, or THP.

[0217] In certain embodiments, the modified sugar is 2'-O-methoxyethyl, 2'-O-methyl, constrained ethyl, LNA, or 3'-fluoroHNA.

[0218] In certain embodiments, the compound comprises at least one 2'-O-methoxyethyl nucleoside, 2'-O-methyl nucleoside, constrained ethyl nucleoside, LNA nucleoside, or 3'-fluoroHNA nucleoside.

[0219] In certain embodiments, the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; a 3' wing segment consisting of five linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment and each nucleoside of each wing segment comprises a modified sugar.

[0220] In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.

[0221] In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides.

[0222] In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides.

[0223] Certain embodiments include conjugate groups and the following formula: Tes Ges mCes Aes Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aes Aes Aes mCes Ae, A = adenine, mC = 5'-methylcytosine, G = guanine, T=thymine; e = 2'-O-methoxymethyl modified nucleoside, d=2'-deoxynucleoside, and s = phosphorothioate internucleoside linkage.

[0224] Certain embodiments include a compound having a conjugate group and the following formula: mCes mCes mCes mCes mCes Tds Tds mCds Tds Tds Ads Tds The present invention provides a compound comprising a modified oligonucleotide according to the formula: Ads Gds mCes mCes Aes Ges mCe, A = adenine, mC = 5'-methylcytosine, G = guanine, T=thymine; e = 2'-O-methoxymethyl modified nucleoside, d=2'-deoxynucleoside, and s = phosphorothioate internucleoside linkage.

[0225] Certain embodiments include a conjugate group and a compound of the formula: mCes Ges Aks Tds Ads Tds mCds Ads Tds Gds Ads Tds Tds mCks mCks mCe, wherein: A = adenine, mC = 5'-methylcytosine, G = guanine, T=thymine; e = 2'-O-methoxymethyl modified nucleoside, k = cEt-modified nucleoside; d=2'-deoxynucleoside, and s = phosphorothioate internucleoside linkage.

[0226] In certain embodiments, the conjugate group is linked to the modified oligonucleotide at the 5'-end of the modified oligonucleotide. In certain embodiments, the conjugate group is linked to the modified oligonucleotide at the 3'-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises at least one N-acetylgalactosamine (GalNAc), at least two N-acetylgalactosamines (GalNAc), or at least three N-acetylgalactosamines (GalNAc).

[0227] Certain embodiments provide compounds of the following formula:

[0228] [ka]

[0229] Certain embodiments provide compounds of the following formula:

[0230] [ka]

[0231] Certain embodiments provide compounds of the following formula:

[0232] [ka]

[0233] In certain embodiments, a compound can comprise or consist of any modified oligonucleotide and conjugate group described herein. In certain embodiments, a compound can comprise or consist of a modified oligonucleotide consisting of 12 to 30 linked nucleosides and conjugate groups, having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobase sequences of SEQ ID NOS: 30-2226, and conjugate groups.

[0234] In certain embodiments, the compound having the following chemical structure comprises or consists of ISIS 721744 having a 5'-X, where X is a GalNAc-containing conjugate group as described herein.

[0235] [ka]

[0236] In certain embodiments, a compound having the following chemical structure is an ISIS having a 5′-X 546254, wherein X is a GalNAc-containing conjugated group as described herein.

[0237] [ka]

[0238] Certain embodiments provide compounds comprising or consisting of the formula:

[0239] [ka]

[0240] Certain embodiments provide compounds comprising or consisting of the formula:

[0241] [ka]

[0242] Certain embodiments provide compounds comprising or consisting of the following formula, wherein:

[0243] [ka] R 1 is -OCH2CH2OCH3(MOE), and R 2 is H or R 1 and R 2 together form a bridge, where R 1 is -O- and R2 is -CH2-, -CH(CH3)-, or -CH2CH2-, and R 1 and R 2 indicates that the resulting bridges are -O-CH2-, -O-CH(CH3)-, and -O-CH2CH2- and R on the same ring are directly linked so as to be selected from 3 and R 4 For each pair, independently for each ring, R 3 is selected from H and -OCH2CH2OCH3, R 4 is H Yes or R 3 and R 4 together form a bridge, where R 3 is -O- and R 4 is -CH2-, -CH(CH3)-, or -CH2CH2-, and R 3 and R 4 indicates that the resulting bridges are -O-CH2-, -O-CH(CH3)-, and -O-CH2CH2- directly linked so as to be selected from R 5 is selected from H and CH3; Z is S - and O - is selected from.

[0244] Certain embodiments provide compositions comprising at least one compound according to any preceding claim, or a salt thereof, and a pharmaceutically acceptable carrier or diluent.

[0245] Certain embodiments provide methods comprising administering to an animal a compound or composition of any of the preceding claims.

[0246] In certain embodiments, the animal is a human.

[0247] In certain embodiments, administering the compound may be used to treat a PKK-associated disease, disorder, or Prevent, treat or ameliorate a condition.

[0248] In certain embodiments, the PKK-associated disease, disorder, or condition is hereditary angioedema (HAE), edema, angioedema, swelling, angioedema of the eyelid, ocular edema, macular edema, cerebral edema, thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, or infarction.

[0249] Certain embodiments provide the use of a compound or composition according to any preceding claim for the manufacture of a medicament for treating an inflammatory or thromboembolic disease.

[0250] Oligomeric compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetics, antisense compounds, antisense oligonucleotides, and siRNA. Oligomeric compounds may be "antisense" to a target nucleic acid, which means that they can undergo hybridization to a target nucleic acid through hydrogen bonding.

[0251] In certain embodiments, an antisense compound has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted. In certain such embodiments, an antisense oligonucleotide has a nucleobase sequence that, when written in the 5' to 3' direction, comprises the reverse complement of the target segment of the target nucleic acid to which it is targeted.

[0252] In certain embodiments, antisense compounds targeted to PKK nucleic acids are 12 to 30 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 12 to 25 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 12 to 22 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 14 to 20 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 15 to 25 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 18 to 22 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 19 to 21 subunits in length. In certain embodiments, antisense compounds are 8-80, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-30, 18-50, 19-30, 19-50, or 20-30 linked subunits in length.

[0253] In certain embodiments, antisense compounds targeted to PKK nucleic acids are 12 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 13 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 14 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 15 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 16 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 17 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 18 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 19 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 20 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 21 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are Antisense compounds targeted to PKK nucleic acids are 22 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 23 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 24 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 25 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 26 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 27 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 28 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 29 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are 30 subunits in length. In certain embodiments, antisense compounds targeted to PKK nucleic acids are linked subunits that are 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 in length, or a range defined by either of the above two values. In certain embodiments, the antisense compound is an antisense oligonucleotide, and the linked subunits are nucleosides.

[0254] In certain embodiments, antisense oligonucleotides targeting PKK nucleic acids may be shortened or truncated. A single subunit may be deleted from the 5' end (5' truncation) or from the 3' end (3' truncation). Shortened or truncated antisense compounds targeting PKK nucleic acids may have two subunits deleted from the 5' end or two subunits deleted from the 3' end of the antisense compound. Alternatively, the deleted nucleosides may be dispersed throughout the antisense compound (e.g., an antisense compound having one nucleotide deleted from the 5' end and one nucleoside deleted from the 3' end).

[0255] When a single additional subunit is present in an extended antisense compound, the additional subunit can be at the 5'-end or the 3'-end of the antisense compound. When two or more subunits are present, the additional subunits can be adjacent to each other (e.g., an antisense compound in which two subunits are added to the 5'-end (5'-addition) or 3'-end (3'-addition) of the antisense compound). Alternatively, the additional subunits can be dispersed throughout the antisense compound (e.g., an antisense compound in which one subunit is added to the 5'-end and one subunit is added to the 3'-end).

[0256] The length of antisense compounds, such as antisense oligonucleotides, can be increased or decreased and / or mismatched bases can be introduced without eliminating activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of antisense oligonucleotides ranging from 13 to 25 nucleobases in length in an oocyte injection model for their ability to induce cleavage of target RNA. 25 nucleobase-long antisense oligonucleotides containing 8 or 11 mismatched bases near the ends of the antisense oligonucleotide were able to direct specific cleavage of target mRNA, although not as effectively as antisense oligonucleotides without mismatches. Target-specific cleavage was also achieved using 13 nucleobase antisense oligonucleotides (including those with one or three mismatches).

[0257] Gautschi et al. (J. Natl. Cancer Inst. 93:463-471 , March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA could reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide also showed potent antitumor activity in vivo.

[0258] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14-nucleobase antisense oligonucleotides, as well as 28-nucleobase and 42-nucleobase antisense oligonucleotides composed of two or three of the tandem antioligonucleotide sequences, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14-nucleobase antisense oligonucleotides alone was able to inhibit translation, although to a lower level than either the 28-nucleobase or 42-nucleobase antisense oligonucleotides.

[0259] Antisense compound motif In certain embodiments, antisense compounds targeted to PKK nucleic acids have chemically modified subunits arranged in a pattern or motif that confers on the antisense compound properties such as enhanced inhibitory activity, increased binding affinity for the target nucleic acid, or resistance to degradation by in vivo nucleases.

[0260] Chimeric antisense compounds typically contain at least one region modified to confer increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity for the target nucleic acid, and / or increased inhibitory activity. A second region of the chimeric antisense compound may optionally serve as a substrate for the cellular endonuclease RNase H, which cleaves the RNA strand of an RNA:DNA duplex.

[0261] Antisense compounds with a gapmer motif are considered chimeric antisense compounds. In a gapmer, an internal region containing multiple nucleotides that support RNase H cleavage is positioned between external regions containing multiple nucleotides that are chemically distinct from the nucleosides of the internal region. In antisense oligonucleotides with a gapmer motif, the gap segment generally serves as a substrate for endonuclease cleavage, while the wing segments contain modified nucleosides. In certain embodiments, the regions of the gapmer are distinguished by the type of sugar moiety that comprises each distinct region. In some embodiments, the types of sugar moieties used to distinguish the regions of the gapmer include β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides can include, for example, 2'-MOE and 2'-O-CH3), and bicyclic sugar-modified nucleosides (such bicyclic sugar-modified nucleosides can include 4'-(CH2)). nIn certain embodiments, wings may include several modified sugar moieties, such as 2'-MOE. In certain embodiments, wings may include several modified and unmodified sugar moieties. In certain embodiments, wings may include various combinations of 2'-MOE nucleosides and 2'-deoxynucleosides.

[0262] The different regions may each contain uniform sugar moieties, different sugar moieties, or alternating sugar moieties. The wing-gap-wing motif is often written as "XYZ," where "X" represents the length of the 5'-wing, "Y" represents the length of the gap, and "Z" represents the length of the 3'-wing. "X" and "Z" may contain uniform sugar moieties, different sugar moieties, or alternating sugar moieties. In certain embodiments, "X" and "Y" can comprise two or more 2'-deoxynucleosides. "Y" can comprise a 2'-deoxynucleoside. A gapmer, described herein as "XYZ," has a configuration in which the gap is positioned directly adjacent to each of the 5'-wing and 3'-wing. Thus, there are no intervening nucleotides between the 5'-wing and the gap, or between the gap and the 3'-wing. Any of the antisense compounds described herein can have a gapmer motif. In certain embodiments, "X" and "Z" are the same; in other embodiments, they are different.

[0263] In certain embodiments, gapmers provided herein include 20-mers, for example, having a 5-10-5 motif.

[0264] Target nucleic acids, target regions and nucleotide sequences Nucleotide sequences encoding human plasma prekallikrein (PKK) include, but are not limited to, GENBANK Accession No. NM_000892.3 (incorporated herein as SEQ ID NO: 1), GENBANK Accession No. DC412984.1 (incorporated herein as SEQ ID NO: 2), GENBANK Accession No. CN265612.1 (incorporated herein as SEQ ID NO: 3), GENBANK Accession No. AK297672.1 (incorporated herein as SEQ ID NO: 4), GENBANK Accession No. DC413312.1 (incorporated herein as SEQ ID NO: 5), GENBANK Accession No. AV688858.2 (incorporated herein as SEQ ID NO: 6), GENBANK Accession No. CD652077.1 (incorporated herein as SEQ ID NO: 7), GENBANK Accession No. BC143911.1 (incorporated herein as SEQ ID NO: 8), and the like. No. 8), GENBANK accession number CB162532.1 (incorporated herein as SEQ ID NO: 9), GENBANK accession number NT_016354.19 truncated to nucleobases 111693001 to 111730000 (incorporated herein as SEQ ID NO: 10), GENBANK accession number NM_008455.2 (incorporated herein as SEQ ID NO: 11), GENBANK accession number BB598673.1 (incorporated herein as SEQ ID NO: 12), GENBANK accession number NT_039460.7 truncated to nucleobases 6114001 to 6144000 (incorporated herein as SEQ ID NO: 13), GENBANK accession number NM_012725.2 (incorporated herein as SEQ ID NO: 14), nucleobases 10952001 to 10982000 GENBANK accession number NW_047473.1 truncated to nucleobases 2,358,000 (incorporated herein as SEQ ID NO: 15), GENBANK accession number XM_002804276.1 (incorporated herein as SEQ ID NO: 17), and GENBANK accession number NW_001118167.1 truncated to nucleobases 2,358,000 to 2,391,000 (incorporated herein as SEQ ID NO: 18).

[0265] It is understood that the sequences set forth in each SEQ ID NO of the examples contained herein are independent of any modifications to the sugar moiety, internucleoside linkage, or nucleobase. Thus, antisense compounds defined by SEQ ID NO can independently contain one or more modifications to the sugar moiety, internucleoside linkage, or nucleobase. Antisense compounds defined by Isis No. represent combinations of nucleobase sequences and motifs.

[0266] In certain embodiments, the target region is a structurally defined region of the target nucleic acid. For example, the target region may include a 3'UTR, a 5'UTR, an exon, an intron, an exon / intron junction, a coding region, a translation initiation region, a translation termination region, or other defined nucleic acid region. Structurally defined regions of PKKs can be obtained by accession number from sequence databases such as NCBI, and such information is incorporated herein by reference. In certain embodiments, a target region may include the sequence from a 5' target site of one target segment within a target region to a 3' target site of another target segment within the same target region.

[0267] Targeting comprises determining at least one target segment that antisense compound hybridizes to, so as to produce desired effect.In certain embodiments, desired effect is the reduction of mRNA target nucleic acid level.In certain embodiments, desired effect is the reduction of the level of the protein coded by target nucleic acid or the change of phenotype associated with target nucleic acid.

[0268] A target region may contain two or more target segments. Multiple target segments within a target region may overlap, or may not overlap. In certain embodiments, target segments within a target region are separated by no more than about 300 nucleotides. In certain embodiments, target segments within a target region are separated by several nucleotides, i.e., no more than about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides on the target nucleic acid, no more than about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides, no more than about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 nucleotides, or a range of nucleotides defined by any two of the foregoing values. In certain embodiments, target segments within a target region are separated by no more than 5 nucleotides, or no more than about 5 nucleotides, on the target nucleic acid. In certain embodiments, the target segments are contiguous. Target regions defined by a range having a starting nucleic acid that is either a 5' target site or a 3' target site as listed herein are contemplated.

[0269] Suitable target segments can be found within 5'UTR, coding region, 3'UTR, intron, exon, or exon / intron junction. Target segments that include a start codon or a stop codon are also suitable target segments. Suitable target segments may specifically exclude certain structurally defined regions, such as the start codon or the stop codon.

[0270] Determining suitable target segments can include comparing the sequence of target nucleic acid with other sequences throughout the genome.For example, the BLAST algorithm can be used to identify similar regions between different nucleic acids.This comparison can prevent the selection of antisense compound sequences that can nonspecifically hybridize with sequences other than the selected target nucleic acid (i.e., non-target or off-target sequences).

[0271] There may be a change in activity of the antisense compound within the active target region (e.g., as defined by the percentage reduction in target nucleic acid levels). In certain embodiments, a decrease in PKK mRNA levels is indicative of inhibition of PKK expression. A decrease in PKK protein levels is also indicative of inhibition of target mRNA expression. Furthermore, a phenotypic change is indicative of inhibition of PKK expression. For example, reduced or prevented inflammation is indicative of inhibition of PKK expression. In another example, reduced or prevented edema / swelling is indicative of inhibition of PKK expression. In another example, reduced or prevented vascular permeability can be indicative of inhibition of PKK expression. In another example, reduced or prevented vascular leakage can be indicative of inhibition of PKK expression. In certain embodiments, vascular permeability is measured by quantification of a dye such as Evans Blue.

[0272] Hybridization In some embodiments, hybridization occurs between the antisense compounds disclosed herein and the target nucleic acid. The most common mechanism of hybridization is It requires hydrogen bonding (eg, Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the molecule.

[0273] Hybridization can occur under a variety of conditions. Stringent conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

[0274] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are capable of specifically hybridizing to a target nucleic acid.

[0275] Complementarity An antisense compound and a target nucleic acid are complementary to one another if a sufficient number of nucleobases of the antisense compound are capable of hydrogen bonding with corresponding nucleobases of the target nucleic acid such that the desired effect (e.g., antisense inhibition of a target nucleic acid, such as a PKK nucleic acid) occurs.

[0276] Non-complementary nucleobases between an antisense compound and a PKK nucleic acid are acceptable, provided that the antisense compound is still capable of specifically hybridizing to the target nucleic acid. Furthermore, an antisense compound may hybridize to two or more segments of a PKK nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch, or hairpin structure).

[0277] In certain embodiments, the antisense compounds provided herein, or specified portions thereof, are 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous to a PKK nucleic acid, a target region, target segment, or specified portion thereof, or are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous. Percent complementarity of an antisense compound to a target nucleic acid can be determined using routine methods.

[0278] For example, an antisense compound in which 18 nucleobases out of 20 nucleobases of an antisense compound are complementary to the target region, and therefore will specifically hybridize, would correspond to 90% complementarity.In this example, the remaining non-complementary nucleobases can be clustered or interspersed between complementary nucleobases, and do not need to be contiguous with each other or with complementary nucleobases.Therefore, an 18-nucleobase antisense compound with four non-complementary nucleobases sandwiched between two regions that are completely complementary to target nucleic acid would have a total complementarity of 77.8% with target nucleic acid, and would therefore be within the scope of the present invention. The percent complementarity of an antisense compound to a region of a target nucleic acid can be routinely determined using the BLAST (basic local alignment search tool) and PowerBLAST programs known in the art (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Percent homology, sequence identity, or sequence complementarity can be determined, for example, using the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, Madison, Wis.) using the Smith and Waterman algorithm (Adv. Appl. Math., 1981, 2, 482-489). This can be determined by the default settings provided by the University of California, San Diego Research Park.

[0279] In certain embodiments, the antisense compounds provided herein, or designated portions thereof, are fully complementary (i.e., 100% complementary) to a target nucleic acid or designated portion thereof. For example, an antisense compound can be fully complementary to a plasma prekallikrein nucleic acid, or a target region, segment, or sequence thereof. As used herein, "fully complementary" means that each nucleobase of an antisense compound has the ability to precisely base pair with a corresponding nucleobase of a target nucleic acid. For example, a 20 nucleobase antisense compound is fully complementary to a 400 nucleobase-long target sequence if a corresponding 20 nucleobase portion that is fully complementary to the antisense compound is present in the target nucleic acid. The term "fully complementary" can also be used in reference to designated portions of a first and / or second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase antisense compound can be "fully complementary" to a 400 nucleobase-long target sequence. A 20 nucleobase portion of a 30 nucleobase oligonucleotide is perfectly complementary to a target sequence if the target sequence has a corresponding 20 nucleobase portion (each nucleobase of which is complementary to the 20 nucleobase portion of the antisense compound). At the same time, the entire 30 nucleobase antisense compound may or may not be perfectly complementary to the target sequence, depending on whether the remaining 10 nucleobases of the antisense compound are also complementary to the target sequence.

[0280] The location of the non-complementary nucleobase can be at the 5'-end or 3'-end of the antisense compound. Alternatively, one or more non-complementary nucleobases can be located at an internal position of the antisense compound. When two or more non-complementary nucleobases are present, they can be contiguous (i.e., linked) or discontinuous. In one embodiment, the non-complementary nucleobase is located in the wing segment of a gapmer antisense oligonucleotide.

[0281] In certain embodiments, antisense compounds that are 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length, contain no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobases compared to a target nucleic acid or specified portion thereof.

[0282] In certain embodiments, antisense compounds that are 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, or up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length, contain no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobases compared to a target nucleic acid or specified portion thereof.

[0283] The antisense compounds provided herein also include those that are complementary to a portion of a target nucleic acid. As used herein, a "portion" refers to a predetermined number of contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A "portion" can also refer to a predetermined number of contiguous nucleobases of an antisense compound. In certain embodiments, an antisense compound is complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, an antisense compound is complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, antisense compounds are complementary to at least 13 nucleobase portions of a target segment. In certain embodiments, antisense compounds are complementary to at least 14 nucleobase portions of a target segment. In certain embodiments, antisense compounds are complementary to at least 15 nucleobase portions of a target segment. Antisense compounds are also contemplated that are complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleobase portions of a target segment, or the range defined by any two of these values.

[0284] identity The antisense compounds provided herein may also have a predetermined percent identity to a particular nucleotide sequence, SEQ ID NO: or compound represented by a specific ISIS number, or a portion thereof. An antisense compound as used herein is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, because both uracil and thymidine pair with adenine, RNA containing uracil instead of thymidine in a disclosed DNA sequence would be considered identical to that DNA sequence. Shortened and extended versions of the antisense compounds described herein are also contemplated, as are compounds with non-identical bases compared to the antisense compounds provided herein. The non-identical bases may be adjacent to each other or may be scattered throughout the antisense compound. The percent identity of an antisense compound is calculated according to the number of identical bases in the sequence being compared.

[0285] In certain embodiments, the antisense compound or portion thereof is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to two or more of the antisense compounds, SEQ ID NOs, or portions thereof disclosed herein.

[0286] In certain embodiments, a portion of the antisense compound is compared with the same length portion of the target nucleic acid.In certain embodiments, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobase portion is compared with the same length portion of the target nucleic acid.

[0287] In certain embodiments, a portion of antisense oligonucleotide is compared with the same length portion of target nucleic acid.In certain embodiments, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleobase portion is compared with the same length portion of target nucleic acid.

[0288] qualification A nucleoside is a base-sugar combination. The nucleobase (also called base) portion of a nucleoside is usually a heterocyclic base moiety. A nucleotide is a nucleoside that further contains a phosphate group covalently linked to the sugar portion of the nucleoside. In nucleosides containing a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed by covalently linking adjacent nucleosides to each other to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.

[0289] Modifications of antisense compounds include substitutions or alterations of internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds may exhibit, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, or increased stability in the presence of nucleases. They are often preferred over the native form due to desirable properties such as increased inhibitory activity.

[0290] Chemically modified nucleosides can also be used to increase the binding affinity of shortened or truncated anti-oligonucleotides to their target nucleic acids, and as a result, comparable results can often be obtained with shorter antisense compounds containing such chemically modified nucleosides.

[0291] Modified internucleoside linkages The naturally occurring internucleoside linkage in RNA and DNA is a 3' to 5' phosphodiester linkage. Antisense compounds having two or more modified (i.e., non-naturally occurring) internucleoside linkages are often chosen over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as enhanced cellular uptake, enhanced affinity for nucleic acid targets, and increased stability in the presence of nucleases.

[0292] Oligonucleotides with modified internucleoside linkages include those in which the phosphorus atom is retained and those without a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known.

[0293] In certain embodiments, antisense compounds targeting plasma prekallikrein nucleic acids comprise two or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage.

[0294] In certain embodiments, an oligonucleotide comprises modified internucleoside linkages arranged in a predetermined pattern or modified internucleoside linkage motif along the oligonucleotide or a region thereof. In certain embodiments, the internucleoside linkages are arranged in a gapped motif. In such embodiments, the internucleoside linkages in each of the two wing regions are different from the internucleoside linkages in the gap region. In certain embodiments, the internucleoside linkages in the wings are phosphodiester and the internucleoside linkages in the gap are phosphorothioate. Because the nucleoside motifs are independently selected, an oligonucleotide having a gapped internucleoside linkage motif may or may not also have a gapped nucleoside motif, and if a gapped nucleoside motif is present, the wing length and gap length may or may not be the same.

[0295] In certain embodiments, an oligonucleotide comprises a region having an alternating internucleoside linkage motif. In certain embodiments, an oligonucleotide of the invention comprises a region of uniformly modified internucleoside linkages. In certain such embodiments, an oligonucleotide comprises a region uniformly linked by phosphorothioate internucleoside linkages. In certain embodiments, an oligonucleotide is uniformly linked by phosphorothioates. In certain embodiments, each internucleoside linkage of an oligonucleotide is selected from phosphodiester and phosphorothioate. In certain embodiments, each internucleoside linkage of an oligonucleotide is selected from phosphodiester and phosphorothioate, and at least one internucleoside linkage is phosphorothioate. It is et.

[0296] In certain embodiments, the oligonucleotide comprises at least six phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least eight phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least ten phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least six consecutive phosphorothioate internucleoside linkages. In some embodiments, the oligonucleotide comprises at least one block of at least 8 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least one block of at least 10 consecutive phosphorothioate internucleoside linkages. In certain embodiments, the oligonucleotide comprises at least In certain such embodiments, at least one of the blocks comprises at least 12 consecutive phosphorothioate internucleoside linkages. , located at the 3' end of the oligonucleotide. In certain such embodiments, at least one of the aforementioned blocks is located within 3 nucleosides of the 3' end of the oligonucleotide.

[0297] In certain embodiments, the oligonucleotide comprises two or more methylphosphonate linkages. In certain embodiments, the oligonucleotide having a gapmer nucleoside motif comprises a linkage motif in which all but one or two methylphosphonate linkages are phosphorothioate linkages. In certain embodiments, one methylphosphonate linkage is in the central gap of the oligonucleotide having a gapmer nucleoside motif.

[0298] In certain embodiments, it is desirable to determine the number of phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages so as to maintain nuclease resistance. In certain embodiments, it is desirable to determine the number and position of phosphorothioate internucleoside linkages and the number and position of phosphodiester internucleoside linkages so as to maintain nuclease resistance. In certain embodiments, it is possible to decrease the number of phosphorothioate internucleoside linkages and increase the number of phosphodiester internucleoside linkages. In certain embodiments, it is possible to increase the number of phosphorothioate internucleoside linkages while maintaining nuclease resistance. The number of thioate internucleoside linkages can be reduced and the number of phosphodiester internucleoside linkages can be increased. In certain embodiments, it is desirable to reduce the number of phosphorothioate internucleoside linkages while maintaining nuclease resistance. In certain embodiments, it is desirable to increase the number of phosphodiester internucleoside linkages while maintaining nuclease activity.

[0299] modified sugar moiety Antisense compounds may optionally contain two or more nucleosides in which the sugar group has been modified. Such sugar-modified nucleosides may confer enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compound. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include those containing S, N(R), or C(R1)(R2), where R, R1, and R2 are each independently H, C1-C 12 Examples of chemically modified sugars include, but are not limited to, replacement of the ribosyl ring oxygen atom with a 5'-F-5'-methyl substituted nucleoside (see PCT International Application WO2008 / 101157, published August 21, 2008, for other disclosed 5',2'-bis substituted nucleosides). or replacement of the ribosyl ring oxygen atom by S with further substitution at the 2' position (see U.S. Patent Application Publication US2005-0130923, published June 16, 2005), or 5'-substitution of BNA (see PCT International Application WO2007 / 134181, published November 22, 2007, where the LNA is substituted with, for example, a 5'-methyl or 5'-vinyl group).

[0300] Examples of nucleosides having modified sugar moieties include, but are not limited to, nucleosides containing 5'-vinyl, 5'-methyl (R or S), 4'-S, 2'-F, 2'-OCH, 2'-OCHCH, 2'-OCHCHF, and 2'-O(CH)OCH substituents. The 2'-position substituent can be allyl, amino, azido, thio, O-allyl, O-C-C 10 Alkyl, OCF3, OCH2F, O(CH2)2SCH3, O(CH2)2-ON(R m )(R n ), O-CH2-C(=O)-N(R m )(R n ), and O-CH2-C(=O)-N(R l )-(CH2)2-N(R m )(R n ) (where each R l , R m and R n are independently H or substituted or unsubstituted C-C 10 alkyl).

[0301] As used herein, the term "bicyclic nucleoside" refers to a modified nucleoside containing a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to, nucleosides containing a bridge between the 4'-ribosyl ring atom and the 2'-ribosyl ring atom. In certain embodiments, the antisense compounds provided herein contain two or more bicyclic nucleosides containing a 4'-→2' bridge. Examples of such 4'→2' bridged bicyclic nucleosides include, but are not limited to, one of the following formulas: 4'-(CH2)-O-2' (LNA), 4'-(CH2)-S-2', 4'-(CH2)2-O-2' (ENA), 4'-CH(CH3)-O-2' (also known as constrained ethyl or cEt) and 4'-CH(CHOCH3)-O-2' (and analogs thereof, see U.S. Patent No. 7,399,845 issued July 15, 2008), 4'-C(CH3)( 4'-CH3)-O-2' (and analogs thereof, see International Application Publication No. WO 2009 / 006478, published January 8, 2009); 4'-CH2-N(OCH3)-2' (and analogs thereof, see International Application Publication No. WO / 2008 / 150729, published December 11, 2008); 4'-CH2-ON(CH3)-2' (see U.S. Patent Application Publication No. US2004-0171570, published September 2, 2004); 4'-CH2-N(R)-O-2' (wherein R is H, C1-C 12 alkyl, or a protecting group) (see U.S. Patent No. 7,427,672, issued September 23, 2008), 4'-CH2-C-(H)(CH3)-2' (see Zhou et al., J. Org. Chem., 2009, 74, 118-134), and 4'-CH2-C-(=CH2)-2' (and analogs thereof, see International Application Publication No. WO 2008 / 154401, published December 8, 2008).

[0302] Other reports on bicyclic nucleosides can be found in the published literature (e.g., Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., al., J.Am.Chem.Soc.,2007,129(26)8362-8379;Elayadi et al.,Curr.Opinion Invest.Drugs,2001,2,558-561;Braasch et al.,Chem.Biol.,2001,8,1-7;and Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;US Patent No. 6,268,490;US Patent No. 6,525,191;US Patent No. 6 ,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Application Publication Nos. US2008-0039618; US2009-0012281; U.S. Patent Application Nos. 61 / 026,995 and 61 / 097,787 See PCT International Application Publication No. WO1999 / 014226; WO2004 / 106356; WO2005 / 021570; WO2007 / 134181; WO2008 / 150729; WO2008 / 154401; WO2009 / 006478; WO2010 / 036698; WO2011 / 017521; WO2009 / 067647; and WO2009 / 100320. Each of the aforementioned bicyclic nucleosides can be prepared with two or more stereochemical sugar configurations, for example, α-L-ribofuranose and β-D-ribofuranose (see PCT International Application No. PCT / DK98 / 00393, published as WO 99 / 14226 on March 25, 1999).

[0303] In certain embodiments, the bicyclic sugar moiety of a BNA nucleoside includes, but is not limited to, compounds having at least one bridge between the 4' and 2' positions of the pentofuranosyl sugar moiety, which bridge is independently -[C(R a )(R b )] n -, -C(R a )=C(R b )-, -C(R a )=N-, -C(=O)-, -C(=NR a )-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, and During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R bare independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 is an aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 cycloaliphatic radical, substituted C5-C7 cycloaliphatic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and Each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl or a protecting group.

[0304] In certain embodiments, the bridge of the bicyclic sugar moiety is —[C(R a )(R b )] n -, -[C(R a )(R b )] n -O-, -C(R a R b )-N(R)-O- or -C(R a R bIn certain embodiments, the bridge is 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2'-, where each R is independently H, a protecting group, or C1-C 12 It is alkyl.

[0305] In certain embodiments, bicyclic nucleosides are further defined by their isomeric configuration. For example, nucleosides containing a 4'-2' methylene-oxy bridge can be in the α-L or β-D configuration. α-L-methyleneoxy (4'-CH2-O-2') BNAs have previously been incorporated into antisense oligonucleotides, which have demonstrated antisense activity (Frieden et al., 2004). Ucleic Acids Research, 2003, 21, 6365-6372).

[0306] In certain embodiments, bicyclic nucleosides include those illustrated below: (A) α-L-methyleneoxy (4'-CH2-O-2') BNA, (B) β-D-methyleneoxy (4'-CH2-O-2') BNA, (C) ethyleneoxy (4'-(CH2)2-O-2') BNA, (D) aminooxy (4'-CH2-ON(R)-2') BNA, (E) oxyamino (4'-CH2-N(R)-O-2') BNA, and (F) methyl(methyleneoxy) (4'-CH(CH)-O-2') BNA, (G) methylene-thio (4'-CH-S-2') BNA, (H) methylene-amino (4'-CH-N(R)-2') BNA, (I) methyl carbocyclic (4'-CH-CH(CH)-2') BNA, (J) propylene carbocyclic (4'-(CH)-2') BNA, and (K) vinyl BNA.

[0307] [ka] wherein Bx is a base moiety and R is independently H, a protecting group, C1-C 12 Alkyl or C1-C 12 It is an alkoxy.

[0308] In certain embodiments, compounds of Formula I:

[0309] [ka] [In the formula, Bx is a heterocyclic base moiety; -Q a -Q b -Q c - is -CH2-N(R c )-CH2-, -C(=O)-N(R c )-CH2-, -CH2-ON(R c )-, -CH2-N(R c )-O- or -N(R c )-O-CH2, R c is C1-C 12 is an alkyl or amino protecting group, and T a and T b are each independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium. Bicyclic nucleosides having the formula:

[0310] In certain embodiments, compounds of formula II:

[0311] [ka] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; Za is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amido, thiol, or substituted thio] Bicyclic nucleosides having the formula:

[0312] In one embodiment, each of the substituents is independently selected from halogen, oxo, hydroxyl, OJ c , N.J. c J d , S.J. c , N3, OC(=X)J c , and N.J. e C(=X)NJ c J d wherein each J c , J d and J e are independently H, C1-C6 alkyl, or substituted C1-C6 alkyl, and X is O or NJ c is.

[0313] In certain embodiments, compounds of formula III:

[0314] [ka] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; Z b is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, or substituted acyl (C(=O)-)). Bicyclic nucleosides having the formula:

[0315] In certain embodiments, compounds of formula IV:

[0316] [ka] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; R d is C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl; each q a , q b , q c and q d are independently H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl. Bicyclic nucleosides having the formula:

[0317] In certain embodiments, compounds of formula V:

[0318] [ka] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; q a , q b , q e and q fare each independently hydrogen, halogen, or C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C1-C 12 Alkoxy, substituted C1-C 12 Alkoxy, OJ j , S.J. j , SOJ j , SO2J j , N.J. j J k , N3, CN, C(=O)OJ j , C(=O)NJ j J k , C(=O)J j , OC(=O)-NJ j J k , N(H)C(=NH)NJ j J k , N(H)C(=O)-NJ j J k or N(H)C(=S)NJ j J k or q e and q f Overall, =C(q g )(q h ) and q g and q h are each independently H, halogen, or C1-C 12 Alkyl or substituted C1-C 12 alkyl] Bicyclic nucleosides having the formula:

[0319] The synthesis and preparation of methyleneoxy (4'-CH2-O-2') BNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine, and uracil, along with their oligomerization and nucleic acid recognition properties, have been previously described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630). The preparation is also described in WO98 / 39352 and WO99 / 14226.

[0320] Analogs of methyleneoxy (4'-CH2-O-2') BNA and 2'-thio-BNA have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of locked nucleoside analogs that constitute oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99 / 14226). Furthermore, the synthesis of 2'-amino-BNA, a novel conformationally restricted, high-affinity oligonucleotide analog, has also been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). In addition, 2'-amino- and 2'-methylamino-BNA have also been prepared, and the thermal stability of their duplexes with complementary RNA and DNA strands has been previously reported.

[0321] In certain embodiments, the compound of formula VI:

[0322] [ka] [In the formula, Bx is a heterocyclic base moiety; T a and T b are each independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent attachment to a support medium; each q i , q j , q k and q l are independently H, halogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12Alkynyl, C1-C 12 Alkoxyl, substituted C1-C 12 Alkoxyl, OJ j , S.J. j , SOJ j , SO2J j , N.J. j J k , N3, CN, C(=O)OJ j , C(=O)NJ j J k , C(=O)J j , OC(=O)-NJ j J k , N(H)C(=NH)NJ j J k , N(H)C(=O)NJ j J k or N(H)C(=S)NJ j J k and q i and q j or q l and q k Overall, =C(q g )(q h ) where q g and q h are each independently H, halogen, or C1-C 12 Alkyl or substituted C1-C 12 alkyl] Bicyclic nucleosides having the formula:

[0323] Carbocyclic bicyclic nucleosides with a 4'-(CH2)3-2' bridge and alkenyl analogs with a 4'-CH=CH-CH2-2' bridge have been described (Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic bicyclic nucleosides have also been described, along with their oligomerization and biochemical studies (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), 8362-8379).

[0324] As used herein, a "4'-2' bicyclic nucleoside" or "4'→2' bicyclic nucleoside" refers to a bicyclic nucleoside that includes a furanose ring that includes a bridge connecting two carbon atoms of the furanose ring, the bridge connecting the 2' and 4' carbon atoms of the sugar ring.

[0325] As used herein, a "monocyclic nucleoside" is a nucleoside that includes a modified sugar moiety that is not a bicyclic sugar moiety. In certain embodiments, the sugar moiety or sugar moiety analog of the nucleoside can be modified or substituted at any position.

[0326] As used herein, "2'-modified sugar" refers to a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include halides, substituents selected from, for example, but not limited to, substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted aryl, and substituted and unsubstituted alkynyl. In certain embodiments, the 2' modification includes, but is not limited to, O[(CH2) n O] m CH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n F, O(CH2) n ONH2, OCH2C(=O)N(H)CH3, and O(CH2) n ON[(CH2) n CH3]2, and the like, where n and m are from 1 to about 10. Other 2'-substituents are selected from C1-C 12The substituent may also be selected from alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, poly-alkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group for improving the pharmacokinetic or pharmacodynamic properties of the antisense compound, and other substituents with similar properties. In certain embodiments, the modified nucleoside comprises a 2'-MOE side chain (Baker et al., J. Biol. Chem., 1997, 272, 11944-12000). Such 2'-MOE substitutions have been described as having improved binding affinity compared to unmodified nucleosides and other modified nucleosides, such as 2'-O-methyl, O-propyl, and O-aminopropyl. Oligonucleotides with 2'-MOE substituents have also been shown to be antisense inhibitors of gene expression with promising characteristics for in vivo use (Martin, Helv. Chim. Acta, 1995, 78, 486-504; Altmann et al., Chimia, 1996, 50, 168-176; Altmann et al., Biochem. Soc. Trans., 1996, 24, 630-637; and Altmann et al., Nucleosides Nucleotides, 1997, 16, 917-926).

[0327] As used herein, "modified tetrahydropyran nucleosides" or "modified THP nucleosides" refer to nucleosides in which a six-membered tetrahydropyran "sugar" (sugar surrogate) is substituted for the pentofuranosyl residue in a conventional nucleoside. Modified THP nucleosides include, but are not limited to, those referred to in the art as hexitol nucleic acids (HNA), anitol nucleic acids (ANA), mannitol nucleic acids (MNA) (Leumann, Bioorg. Med. Chem., 2002, 10, 841-1954), or fluoro-HNA (F-HNA), which have a tetrahydropyran ring system as illustrated below.

[0328] [ka]

[0329] In certain embodiments, the compound of formula VII:

[0330] [ka] VII A sugar substitute is selected having wherein, independently for each of said at least one tetrahydropyran nucleoside analog of Formula VII: Bx is a heterocyclic base moiety; T a and T b are each independently an internucleoside linking group linking a tetrahydropyran nucleoside analog to the antisense compound, or T a and T b is an internucleoside linking group that links the tetrahydropyran nucleoside analog to the antisense compound, and T a and T b the other of which is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, and each of R1 and R2 is hydrogen, hydroxyl, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0331] In certain embodiments, modified THP nucleosides of Formula VII are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, THP nucleosides of Formula VII are provided wherein one of R1 and R2 is fluoro. In certain embodiments, R1 is fluoro and R2 is H; R1 is methoxy and R2 is H; and R1 is methoxyethoxy and R2 is H.

[0332] In certain embodiments, the sugar surrogate comprises a ring having six or more atoms and two or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligomeric compounds have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510; and U.S. Patent Nos. 5,698,685; 5,166,315; 5,185,444; and 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following formula:

[0333] [ka]

[0334] In certain embodiments, for example, various substituents may be added to the morpholino structure. Morpholinos may be modified by altering various substituents on the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0335] Combinations of modifications are also provided, such as, but not limited to, 2'-F-5'-methyl substituted nucleosides (see PCT International Application No. WO2008 / 101157, published August 21, 2008, for other 5',2'-bis substituted nucleosides disclosed), and replacement of the ribosyl ring oxygen atom with S and further substitution at the 2' position (see U.S. Patent Application Publication No. US2005-0130923, published June 16, 2005), or 5'-substitution of bicyclic nucleic acids (see PCT International Application No. WO2007 / 134181, published November 22, 2007, where the 5' position of a 4'-CH2-O-2' bicyclic nucleoside is further substituted with a 5'-methyl or 5'-vinyl group). The synthesis and preparation of carbocyclic bicyclic nucleosides has also been described, along with their oligomerization and biochemical studies (see, for example, Srivastava et al., J. Am. Chem. Soc. 2007, 129(26), 8362-8379).

[0336] In certain embodiments, the antisense compounds comprise two or more modified cyclohexenyl nucleosides, which are nucleosides having a six-membered cyclohexenyl in place of the pentofuranosyl residue in naturally occurring nucleosides. Modified cyclohexenyl nucleosides include, but are not limited to, those described in the art (e.g., commonly assigned PCT Publication WO 2010 / 036696 (published April 10, 2010); Robeyns et al., J. Am. Chem. Soc., 2008, 130(6), 1979-1984; Horvath et al., Tetrahedron Letters,2007,48,3621-3623;Nauwelaerts et al.,J.Am.Chem.Soc.,2007,129(30),9340-9348;Gu et al.,Nucleosides, Nucleotides & Nucleic Acids,2005,24(5-7),993-998;Nauwelaerts et al.,Nucleic Acids Research,2005,33(8),2452-2463;Robeyns et al.,Acta Crystallographica,Section F:Structural Biology and Crystallization Communications,2005,F61(6),585-586;Gu et al. al.,Tetrahedron,2004,60(9),2111-2123;Gu et al.,Oligonucleotides,2003,13(6),479-489;Wang et al.,J.Org.Chem.,2003,68,4499-4505;Verbeure (See, e.g., Wang et al., Nucleic Acids Research, 2001, 29(24), 4941-4947; Wang et al., J. Org. Chem., 2001, 66, 8478-82; Wang et al., Nucleosides, Nucleotides & Nucleic Acids, 2001, 20(4-7), 785-788; Wang et al., J. Am. Chem., 2000, 122, 8595-8602; PCT Publication WO 06 / 047842; and PCT Publication WO 01 / 049687; the text of each of which is incorporated herein by reference in its entirety.) Certain modified cyclohexenyl nucleosides have the formula X:

[0337] [ka] wherein, independently for each of said at least one cyclohexenyl nucleoside analog of Formula X: Bx is a heterocyclic base moiety; T3 and T4 are each independently an internucleoside linking group that links a cyclohexenyl nucleoside analog to the antisense compound, or one of T3 and T4 is an internucleoside linking group that links a tetrahydropyran nucleoside analog to the antisense compound, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugated group, or a 5'- or 3'-terminal group; and q1, q2, q3, q4, q5, q6, q7, q8, and q9 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, substituted C2-C6 alkynyl, or other sugar substituent.

[0338] As used herein, "2'-modified" or "2'-substituted" refers to nucleosides containing sugars containing a substituent other than H or OH at the 2' position. 2'-modified nucleosides include bicyclic nucleosides in which a bridge connecting two carbon atoms of the sugar ring connects the 2' carbon to another carbon of the sugar ring; and non-bridging 2' substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C 10 Alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-ON(R m )(R n ), or O-CH2-C(=O)-N(R m )(R n )[where each R m and R n are independently H or substituted or unsubstituted C-C 10 2'-modified nucleosides may further comprise other modifications, for example, at other positions on the sugar and / or at the nucleobase.

[0339] As used herein, "2'-F" refers to a nucleoside containing a sugar that contains a fluoro group at the 2' position of the sugar ring.

[0340] As used herein, "2'-OMe" or "2'-OCH3" or "2'-O-methyl" refers to a nucleoside containing a sugar that contains an -OCH3 group at the 2' position of the sugar ring, respectively.

[0341] As used herein, "MOE" or "2'-MOE" or "2'-OCH2CH2OCH3" or "2'-O-methoxyethyl" refers to a nucleoside containing a sugar that contains a -OCH2CH2OCH3 group at the 2' position of the sugar ring, respectively.

[0342] As used herein, "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, two or more of the plurality of nucleosides are modified. In certain embodiments, an oligonucleotide comprises two or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[0343] Many other bicyclic and tricyclic sugar surrogate ring systems are known in the art that can be used to modify nucleosides for incorporation into antisense compounds (see, for example, the review by Leumann, Bioorg. Med. Chem., 2002, 10, 841-1954). A variety of additional substitutions can be made to such ring systems to enhance activity.

[0344] Methods for preparing modified sugars are well known to those skilled in the art. Some representative U.S. patents that teach the preparation of such modified sugars include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,519,134; 5,519,135; 5,519,136; 5,519,137; 5,519,136 ... 567,811; US ​​5,576,427; US 5,591,722; US 5,597,909; US 5,610,300; US 5,627,053; US 5,639,873; US 5,646,265; US 5,670,633; US 5,700,920; US 5,792,847 and US 6,600,032, and international application PCT / US2005 / 019219 (filed June 2, 2005), published as WO2005 / 121371 on December 22, 2005. etc., each of which is incorporated herein by reference in its entirety.

[0345] In nucleotides having modified sugar moieties, the nucleobase moieties (natural, modified, or a combination thereof) are maintained for hybridization with an appropriate nucleic acid target.

[0346] In certain embodiments, antisense compounds comprise two or more nucleosides having modified sugar moieties. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleosides are arranged in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH3)-O-2') bridging group. In certain embodiments, the (4'-CH(CH3)-O-2') modified nucleosides are arranged throughout the wings of a gapmer motif.

[0347] Conjugated antisense compounds In certain embodiments, the present disclosure provides conjugated antisense compounds. In certain embodiments, the present disclosure provides conjugated antisense compounds comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In certain embodiments, the present disclosure provides methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide complementary to a nucleic acid transcript. In certain embodiments, the present disclosure provides methods comprising contacting a cell with a conjugated antisense compound comprising an antisense oligonucleotide and reducing the amount or activity of the nucleic acid transcript in the cell.

[0348] The asialoglycoprotein receptor (ASGP-R) has been previously described. See, for example, Park et al., PNAS vol. 102, No. 47, pp. 17125-17129 (2005). These receptors are expressed on liver cells, particularly hepatocytes. Furthermore, compounds containing clusters of three N-acetylgalactosamine (GalNAc) ligands have been shown to be capable of binding to ASGP-R and leading to the uptake of the compound into cells. See, for example, Khorev et al., Bioorganic and Medicinal Chemistry, 16, 9, pp. 5216-5231 (May 2008). Thus, conjugates containing such GalNAc clusters have been used to promote the uptake of specific compounds into liver cells, specifically hepatocytes. For example, certain GalNAc-containing conjugates have been shown to increase the activity of double-stranded siRNA compounds in liver cells in vivo. In these examples, the GalNAc-containing conjugate is typically attached to the sense strand of the siRNA duplex. Because the sense strand is disposed of before the antisense strand finally hybridizes with target nucleic acid, there is little concern that the conjugate will interfere with activity.Typically, the conjugate is attached to the 3' end of the sense strand of siRNA.See, for example, U.S. Patent No. 8,106,022.The specific conjugate group described herein is more active and / or easier to synthesize than the conjugate group described so far.

[0349] In certain embodiments of the invention, the conjugate is attached to a single-stranded antisense compound, such as, but not limited to, an RNase H-based antisense compound or an antisense compound that alters the splicing of a pre-mRNA target nucleic acid. In certain embodiments, the conjugate should remain attached to the antisense compound long enough to provide a benefit (improved cellular uptake), but should not be cleaved or otherwise interfere with subsequent steps required for activity, such as hybridization to the target nucleic acid and interaction with RNase H or enzymes involved in splicing or splicing regulation. This balance of properties is even more important for single-stranded antisense compounds than for siRNA compounds, which may simply have the conjugate attached to the sense strand. Disclosed herein are conjugated single-stranded antisense compounds that exhibit improved potency in liver cells in vivo compared to the same antisense compound lacking the conjugate. Given the balance of properties required for these compounds, such improved potency is surprising.

[0350] In certain embodiments, the conjugate group herein comprises a cleavable moiety. While not wishing to be bound by any mechanism, as described above, it is essential that the conjugate remain on the compound for a sufficient time to result in enhanced uptake, after which some portion of the conjugate, ideally all of the conjugate, is cleaved to release the parent compound (e.g., an antisense compound) in its most active form. In certain embodiments, the cleavable moiety is a cleavable nucleoside. In such embodiments, the remaining portion of the conjugate (cluster) is attached to the antisense oligonucleotide via nucleosides by two or more cleavable bonds, for example, phosphodiester linkages, thereby utilizing endogenous nucleases in cells. In certain embodiments, the cluster is attached to the cleavable nucleoside via a phosphodiester linkage. In certain embodiments, the cleavable nucleoside is attached to the antisense oligonucleotide (antisense compound) by a phosphodiester linkage. In certain embodiments, the conjugate group may comprise two or three cleavable nucleosides. In such embodiments, the cleavable nucleosides are linked to each other, to the antisense compound, and / or to the cluster by cleavable bonds (phosphodiester linkages). Certain conjugates herein do not contain cleavable nucleosides, but instead contain cleavable bonds. It is noted that sufficient cleavage of the conjugate from the oligonucleotide is achieved by at least one bond (cleavable bond) that is susceptible to cleavage within the cell.

[0351] In certain embodiments, the conjugated antisense compound is a prodrug. Such a prodrug is administered to an animal and ultimately metabolized into a more active form. For example, the conjugated antisense compound can be cleaved to remove all or part of the conjugate, resulting in an active (or more active) form of the antisense compound that lacks all or part of the conjugate.

[0352] In certain embodiments, the conjugate is attached to the 5' end of the oligonucleotide. Certain such 5' conjugates are cleaved more efficiently than counterparts with the same conjugate attached to the 3' end. In certain embodiments, improved activity can correlate with improved cleavage. In certain embodiments, the efficacy of oligonucleotides containing a 5' conjugate is higher than that of oligonucleotides containing a 3' conjugate (see, e.g., Examples 56, 81, 83, and 84). Furthermore, 5' attachment allows for simplified oligonucleotide synthesis. Oligonucleotides are typically synthesized on a solid support in a 3'→5' direction. To prepare a 3' conjugated oligonucleotide, a 3' nucleoside, pre-attached to a conjugate group, is typically attached to a solid support, followed by assembly of the oligonucleotide as usual. However, attaching the conjugated nucleoside to the solid support complicates synthesis. Furthermore, using this approach, the conjugate remains present throughout the synthesis of the oligonucleotide, potentially subject to degradation during subsequent steps or limiting the types of reactions and reagents that can be used. By using the structures and techniques described herein for 5' conjugated oligonucleotides, standard automated The technique can be used to synthesize the oligonucleotide and introduce the conjugate with the last (5'-most) nucleoside, or the oligonucleotide can be cleaved from the solid support and then the conjugate introduced.

[0353] Given the state of the art and this disclosure, one of skill in the art can readily prepare any of the conjugates and conjugated oligonucleotides described herein. Furthermore, the synthesis of certain such conjugates and conjugated oligonucleotides disclosed herein is easier and / or requires fewer steps than the synthesis of previously disclosed conjugates, thereby providing manufacturing advantages. For example, the synthesis of certain conjugates involves fewer synthetic steps, resulting in increased yields, compared to previously described conjugates. Conjugates such as GalNAc3-10 in Example 46 and GalNAc3-7 in Example 48 are much simpler than previously described conjugates, such as those described in U.S. Pat. No. 8,106,022 or U.S. Pat. No. 7,262,177, which require the assembly of numerous chemical intermediates. Thus, these and other conjugates described herein offer advantages over previously described compounds when used with any oligonucleotide, such as a single-stranded oligonucleotide or either strand of a double-stranded oligonucleotide (e.g., siRNA).

[0354] Similarly, conjugate groups containing only one or two GalNAc ligands are also disclosed herein. As shown, such conjugate groups improve the activity of antisense compounds. Such compounds are much easier to prepare than conjugates containing three GalNAc ligands. Conjugate groups containing one or two GalNAc ligands can be attached to any antisense compound, such as a single-stranded oligonucleotide or either strand of a double-stranded oligonucleotide (e.g., siRNA).

[0355] In certain embodiments, the conjugates herein do not substantially alter certain measures of tolerability. For example, it is shown herein that conjugated antisense compounds are no more immunogenic than the unconjugated parent compound. Embodiments in which tolerability remains the same (or may actually be slightly worse relative to the increased potency) because of improved potency have improved therapeutic properties.

[0356] In certain embodiments, conjugation allows for the modification of antisense compounds in ways that would otherwise be less favorable. For example, in certain embodiments, replacing two or more phosphorothioate linkages in an all-phosphorothioate antisense compound with phosphodiester linkages results in improved tolerance measures. For example, in certain cases, such antisense compounds with two or more phosphodiesters are less immunogenic than the same compound in which each linkage is phosphorothioate. However, in certain cases, as shown in Example 26, replacing two or more phosphorothioate linkages with phosphodiester linkages also results in reduced cellular uptake and / or loss of potency. In certain embodiments, the conjugated antisense compounds described herein tolerate such linkage modifications with little or no loss of uptake and potency compared to their all-phosphorothioate conjugated counterparts. In fact, in certain embodiments, for example, Examples 44, 57, 59, and 86, oligonucleotides comprising a conjugate and at least one phosphodiester internucleoside linkage actually exhibit increased potency in vivo, even when compared to their all-phosphorothioate counterparts also comprising the same conjugate. Moreover, because the conjugation results in a substantial increase in uptake / potency, a small loss of that substantial increase is acceptable for the purpose of achieving improved tolerability. Thus, in certain embodiments, the conjugated antisense compound comprises at least one phosphodiester linkage.

[0357] In certain embodiments, the conjugation of antisense compounds herein results in increased delivery, uptake, and activity in hepatocytes. Thus, more compound is delivered to liver tissue. However, in certain embodiments, such increased delivery alone cannot account for the overall increased activity. In certain such embodiments, more compound enters hepatocytes. In certain embodiments, such increased hepatocyte uptake cannot account for the overall increased activity. In such embodiments, the productive uptake of the conjugated compound increases. For example, as shown in Example 102, certain embodiments of GalNAc-containing conjugates increase the concentration of antisense oligonucleotides in hepatocytes compared to non-parenchymal cells. This concentration is beneficial for oligonucleotides that target genes expressed in hepatocytes.

[0358] In certain embodiments, the conjugated antisense compounds herein are administered to the kidney. This leads to reduced exposure.For example, as shown in Example 20, the concentration of antisense oligonucleotides comprising certain embodiments of GalNAc-containing conjugates in the kidney is lower than the concentration of antisense oligonucleotides that lack GalNAc-containing conjugates.This has several beneficial therapeutic implications.For therapeutic indications that do not require activity in the kidney, exposure to the kidney carries the risk of nephrotoxicity and does not merit any corresponding benefit.In addition, high concentration in the kidney typically leads to the loss of compound into urine, resulting in rapid clearance.Therefore, if the target is not the kidney, accumulation in the kidney is undesirable.

[0359] In certain embodiments, the present disclosure provides a compound of the formula:

[0360] [ka] [In the formula, A is an antisense oligonucleotide, B is a cleavable moiety; C is a conjugated linker; D is a branched group; Each E is a tether, each F is a ligand, and q is an integer from 1 to 5. The present invention provides a conjugate antisense compound represented by:

[0361] In the above and similar figures herein, the branching group "D" is branched as many times as necessary to accommodate the number of (EF) groups, designated "q." Thus, when q=1, the formula is:

[0362] [ka] and for q=2, the equation becomes

[0363] [ka] and for q=3, the equation in question becomes

[0364] [ka] and for q=4, the equation in question becomes

[0365] [ka] and for q=5, the equation in question becomes

[0366] [ka] is.

[0367] In certain embodiments, conjugated antisense compounds are provided having the following structure:

[0368] [ka]

[0369] In certain embodiments, conjugated antisense compounds are provided having the following structure:

[0370] [ka]

[0371] In certain embodiments, conjugated antisense compounds are provided having the following structure:

[0372] [ka]

[0373] In certain embodiments, conjugated antisense compounds are provided having the following structure:

[0374] [ka]

[0375] In embodiments having more than one of a particular variable (e.g., more than one "m" or more than one "n"), unless otherwise indicated, each such particular variable is independently selected. Thus, for structures having more than one n, each n is independently selected and may or may not be identical to one another.

[0376] i. Certain cleavable moieties In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety comprises a cleavable bond. In certain embodiments, the conjugated group comprises a cleavable moiety. In certain such embodiments, the cleavable moiety is attached to the antisense oligonucleotide. In certain such embodiments, the cleavable moiety is directly attached to the cell-targeting moiety. In certain such embodiments, the cleavable moiety is attached to the conjugated linker. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a cleavable nucleoside or nucleoside analog. In certain embodiments, the nucleoside or nucleoside analog comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside containing an optionally protected heterocyclic base selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside attached to the 3' position of the antisense oligonucleotide by a phosphodiester linkage and to the linker by a phosphodiester or phosphorothioate linkage. In certain embodiments, the cleavable moiety is a 2'-deoxyadenosine ...phosphodiester linkage. Thus, it is a 2'-deoxyadenosine attached to the 3' position of the antisense oligonucleotide and attached to the linker by a phosphodiester linkage.

[0377] In certain embodiments, the cleavable moiety is attached to the 3' position of the antisense oligonucleotide. In certain embodiments, the cleavable moiety is attached to the 5' position of the antisense oligonucleotide. In certain embodiments, the cleavable moiety is attached to the 2' position of the antisense oligonucleotide. In certain embodiments, the cleavable moiety is attached to the antisense oligonucleotide by a phosphodiester linkage. In certain embodiments, the cleavable moiety is attached to the linker by either a phosphodiester linkage or a phosphorothioate linkage. In certain embodiments, the cleavable moiety is attached to the linker by a phosphodiester linkage. In certain embodiments, the conjugate group does not comprise a cleavable moiety.

[0378] In certain embodiments, the cleavable moiety is cleaved only after the complex is administered to an animal and internalized by the target cell. The cleavable moiety is cleaved in the cell, thereby releasing the active antisense oligonucleotide. Without wishing to be bound by theory, it is believed that the cleavable moiety is cleaved by two or more nucleases in the cell. In certain embodiments, two or more nucleases cleave the phosphodiester linkage between the cleavable moiety and the linker. In certain embodiments, the cleavable moiety has a structure selected from the following:

[0379] [ka] wherein each of Bx, Bx1, Bx2, and Bx3 is independently a heterocyclic base moiety. In certain embodiments, the cleavable moiety has a structure selected from:

[0380] [ka]

[0381] ii. Certain linkers In certain embodiments, the conjugate group comprises a linker. In certain such embodiments, the linker is covalently linked to a cleavable moiety. In certain such embodiments, the linker is covalently linked to the antisense oligonucleotide. In certain embodiments, the linker is covalently linked to a cell-targeting moiety. In certain embodiments, the linker further comprises a covalent bond to a solid support. In certain embodiments, the linker further comprises a covalent bond to a protein-binding moiety. In certain embodiments, the linker further comprises a covalent bond to a solid support and further comprises a covalent bond to a protein-binding moiety. In certain embodiments, the linker comprises multiple positions for attaching a tethered ligand. In certain embodiments, the linker comprises multiple positions for attaching a tethered ligand and is not attached to a branching group. In certain embodiments, the linker further comprises two or more cleavable bonds. In certain embodiments, the conjugate group does not comprise a linker.

[0382] In certain embodiments, the linker comprises at least one linear group comprising a group selected from an alkyl, amide, disulfide, polyethylene glycol, ether, thioether (-S-), and hydroxylamino (-ON(H)-) group. In certain embodiments, the linear group comprises a group selected from an alkyl, amide, and ether group. In certain embodiments, the linear group comprises a group selected from an alkyl and ether group. In certain embodiments, the linear group comprises at least one phosphorus linking group. In certain embodiments, the linear group comprises at least one phosphodiester group. In certain embodiments, the linear group comprises at least one neutral linking group. In certain embodiments, the linear group is covalently linked to the cell targeting moiety and the cleavable moiety. In certain embodiments, the linear group is covalently linked to the cell targeting moiety and the antisense oligonucleotide. In certain embodiments, the linear group is covalently linked to the cell targeting moiety, the cleavable moiety, and the solid support. In certain embodiments, the linear group is covalently linked to the cell targeting moiety, the cleavable moiety, the solid support, and the protein-binding moiety. In certain embodiments, the linear group comprises two or more cleavable bonds.

[0383] In certain embodiments, the linker comprises a linear group covalently bonded to a scaffold group. In certain embodiments, the scaffold comprises a branched aliphatic group comprising a group selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In certain embodiments, the scaffold comprises a branched aliphatic group comprising a group selected from alkyl, amide, and ether groups. In certain embodiments, the scaffold comprises at least one monocyclic or polycyclic ring system. In certain embodiments, the scaffold comprises at least two monocyclic or polycyclic ring systems. In certain embodiments, a linear group is covalently bonded to a scaffold group, which is covalently bonded to a cleavable moiety and a linker. In certain embodiments, a linear group is covalently bonded to a scaffold group, which is covalently bonded to a cleavable moiety, a linker, and a solid support. In certain embodiments, a linear group is covalently bonded to a scaffold group, which is covalently bonded to a cleavable moiety, a linker, and a protein-binding moiety. In certain embodiments, the linear group is covalently attached to a scaffold group, which is covalently attached to a cleavable moiety, a linker, a protein-binding moiety, and a solid support. In certain embodiments, the scaffold group comprises two or more cleavable bonds.

[0384] In certain embodiments, the linker comprises a protein-binding moiety. In certain embodiments, the protein-binding moiety is a lipid, such as, but not limited to, cholesterol. ol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenic acid, dimethoxytrityl, or phenoxazine), vitamins (e.g., folate, vitamin A, vitamin E, biotin, pyridoxal), peptides, carbohydrates (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, polysaccharides), endosomolytic components, steroids (e.g., uvaol, hesigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelanol-derivatized lithocholic acid), or cationic lipids. In certain embodiments, the protein-binding moiety is a C16-C22 long chain saturated or unsaturated fatty acid, cholesterol, cholic acid, vitamin E, adamantane, or 1-pentafluoropropyl.

[0385] In certain embodiments, the linker has a structure selected from the following:

[0386] [ka] wherein each n is independently 1 to 20, and p is 1 to 6.

[0387] In certain embodiments, the linker has a structure selected from the following:

[0388] [ka] wherein each n is independently 1 to 20.

[0389] In certain embodiments, the linker has a structure selected from the following:

[0390] [ka] In the formula, n is 1 to 20.

[0391] In certain embodiments, the linker has a structure selected from the following:

[0392] [ka] wherein each L is independently a phosphorus linking group or a neutral linking group; Each n is independently 1 to 20.

[0393] In certain embodiments, the linker has a structure selected from the following:

[0394] [ka]

[0395] [ka]

[0396] In certain embodiments, the linker has a structure selected from the following:

[0397] [ka]

[0398] In certain embodiments, the linker has a structure selected from the following:

[0399] [ka]

[0400] In certain embodiments, the linker has a structure selected from the following:

[0401] [ka] In the formula, n is 1 to 20.

[0402] In certain embodiments, the linker has a structure selected from the following:

[0403] [ka]

[0404] In certain embodiments, the linker has a structure selected from the following:

[0405] [ka]

[0406] In certain embodiments, the linker has a structure selected from the following:

[0407] [ka]

[0408] In certain embodiments, the conjugated linker has the structure:

[0409] [ka]

[0410] In certain embodiments, the conjugated linker has the structure:

[0411] [ka] .

[0412] In certain embodiments, the linker has a structure selected from the following:

[0413] [ka]

[0414] In certain embodiments, the linker has a structure selected from the following:

[0415] [ka] wherein each n is independently 0, 1, 2, 3, 4, 5, 6, or 7.

[0416] iii. A specific cell-targeting moiety In certain embodiments, the conjugate group comprises a cell-targeting moiety. Certain such cell-targeting moieties increase the cellular uptake of antisense compounds. In certain embodiments, the cell-targeting moiety comprises a branching group, two or more tethers, and two or more ligands. In certain embodiments, the cell-targeting moiety comprises a branching group, two or more tethers, two or more ligands, and two or more cleavable bonds.

[0417] 1. Certain branched groups In certain embodiments, the conjugate group comprises a targeting moiety comprising a branching group and at least two tethered ligands. In certain embodiments, the branching group connects the conjugated linker. In certain embodiments, the branching group connects a cleavable moiety. In certain embodiments, the branching group connects the antisense oligonucleotide. In certain embodiments, the branching group is covalently bonded to each of the linker and the tethered ligand. In certain embodiments, the branching group comprises a branched aliphatic group comprising a group selected from alkyl, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino groups. In certain embodiments, the branching group comprises a group selected from alkyl, amide, and ether groups. In certain embodiments, the branching group comprises a group selected from alkyl and ether groups. In certain embodiments, the branching group comprises a monocyclic or polycyclic ring system. In certain embodiments, the branching group comprises two or more cleavable bonds. In certain embodiments, the conjugated group does not comprise a branching group.

[0418] In certain embodiments, the branching group has a structure selected from the following:

[0419] [ka] wherein each n is independently 1 to 20; j is 1 to 3, m is 2 to 6.

[0420] In certain embodiments, the branching group has a structure selected from the following:

[0421] [ka] each n is independently 1 to 20; m is 2 to 6.

[0422] In certain embodiments, the branching group has a structure selected from the following:

[0423] [ka]

[0424] [ka]

[0425] In certain embodiments, the branching group has a structure selected from the following:

[0426] [ka] wherein each A1 is independently O, S, C=O, or NH; Each n is independently 1 to 20.

[0427] In certain embodiments, the branching group has a structure selected from the following:

[0428] [ka] wherein each A1 is independently O, S, C=O, or NH; Each n is independently 1 to 20.

[0429] In certain embodiments, the branching group has a structure selected from the following:

[0430] [ka] wherein A1 is O, S, C=O, or NH; Each n is independently 1 to 20.

[0431] In certain embodiments, the branching group has a structure selected from the following:

[0432] [ka]

[0433] In certain embodiments, the branching group has a structure selected from the following:

[0434] [ka]

[0435] In certain embodiments, the branching group has a structure selected from the following:

[0436] [ka]

[0437] 2. A specific tether In certain embodiments, the conjugated group comprises two or more tethers covalently bonded to the branching group. In certain embodiments, the conjugated group comprises two or more tethers covalently bonded to the linking group. In certain embodiments, each tether is a linear aliphatic group comprising two or more groups selected from alkyl, ether, thioether, disulfide, amide, and polyethylene glycol groups, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising two or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amide, phosphodiester, and polyethylene glycol groups, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising two or more groups selected from alkyl, ether, and amide groups, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising two or more groups selected from alkyl, substituted alkyl, phosphodiester, and polyethylene glycol groups, in any combination. A linear aliphatic group containing two or more groups selected from diester, ether, and amide groups, in any combination. In certain embodiments, each tether is a linear aliphatic group containing two or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether contains at least one phosphorus or neutral linking group.

[0438] In certain embodiments, the tether comprises two or more cleavable bonds. In certain embodiments, the tether is attached to the branching group through either an amide group or an ether group. In certain embodiments, the tether is attached to the branching group through a phosphodiester group. In certain embodiments, the tether is attached to the branching group through a phosphorus linking group or a neutral linking group. In certain embodiments, the tether is attached to the branching group through an ether group. In certain embodiments, the tether is attached to the ligand through either an amide group or an ether group. In certain embodiments, the tether is attached to the ligand through either an amide group or an ether group. In certain embodiments, the tether is attached to the ligand through an ether group.

[0439] In certain embodiments, each tether comprises a chain length between the ligand and the branching group of about 8 to about 20 atoms. In certain embodiments, each tether comprises a chain length between the ligand and the branching group of about 10 to about 18 atoms. In certain embodiments, each tether comprises a chain length of about 13 atoms.

[0440] In certain embodiments, the tether has a structure selected from the following:

[0441] [ka] each n is independently 1 to 20; Each p is from 1 to about 6.

[0442] In certain embodiments, the tether has a structure selected from the following:

[0443] [ka]

[0444] In certain embodiments, the tether has a structure selected from the following:

[0445] [ka] wherein each n is independently 1 to 20.

[0446] In certain embodiments, the tether has a structure selected from the following:

[0447] [ka] wherein L is either a phosphorus linking group or a neutral linking group; Z1 is C(=O)O-R2, Z2 is H, C1-C6 alkyl or substituted C1-C6 alkyl; R2 is H, C1-C6 alkyl or substituted C1-C6 alkyl; Each m1 is independently 0 to 20, and at least one m1 for each tether is greater than 0.

[0448] In certain embodiments, the tether has a structure selected from the following:

[0449] [ka]

[0450] In certain embodiments, the tether has a structure selected from the following:

[0451] [ka] where Z2 is H or CH3, Each m1 is independently 0 to 20, and at least one m1 for each tether is greater than 0.

[0452] In certain embodiments, the tether has a structure selected from the following:

[0453] [ka] wherein each n is independently 0, 1, 2, 3, 4, 5, 6, or 7.

[0454] In certain embodiments, the tether comprises a phosphorus linking group. In certain embodiments, the tether does not comprise any amide bonds. In certain embodiments, the tether comprises a phosphorus linking group and does not comprise any amide bonds.

[0455] 3. A specific ligand In certain embodiments, the present disclosure provides ligands, each of which is covalently attached to a tether. In certain embodiments, each ligand is selected to have affinity for at least one receptor on a target cell. In certain embodiments, a ligand is selected to have affinity for at least one receptor on the surface of a mammalian liver cell. In certain embodiments, a ligand is selected to have affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is independently selected from galactose, N-acetylgalactosamine, mannose, glucose, glucosamine, and fucose. In certain embodiments, each ligand is N-acetylgalactosamine (GalNAc). In certain embodiments, the targeting moiety comprises 2 to 6 ligands. In certain embodiments, the targeting moiety comprises 3 ligands. In certain embodiments, the targeting moiety comprises 3 N-acetylgalactosamine ligands.

[0456] In certain embodiments, the ligand is a carbohydrate, a carbohydrate derivative, a modified carbohydrate, a polyvalent carbohydrate cluster, a polysaccharide, a modified polysaccharide, or a polysaccharide derivative. In certain embodiments, the ligand is an amino sugar or a thio sugar. For example, the amino sugar can be selected from many compounds known in the art, such as glucosamine, sialic acid, α-D-galactosamine, N-acetylgalactosamine, 2-acetamido-2-deoxy-D-galactopyranose (GalNAc), 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose (β-muramic acid), 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-sulfo-D-glucosamine, and N-glycoloyl-α-neuraminic acid. For example, the thiosugar may be selected from the group consisting of 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, and ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside.

[0457] In certain embodiments, "GalNac" or "Gal-NAc" refers to 2-(acetylamino)-2-deoxy-D-galactopyranose, which is commonly referred to in the literature as N-acetylgalactosamine. In certain embodiments, "N-acetylgalactosamine" refers to 2-(acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments, "GalNac" or "Gal-NAc" refers to 2-(acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments, "GalNac" or "Gal-NAc" refers to the β-form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and the α-form: 2-(acetylamino)-2- The term 2-(acetylamino)-2-deoxy-D-galactopyranose refers to 2-(acetylamino)-2-deoxy-D-galactopyranose, including both β-form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and α-form: 2-(acetylamino)-2-deoxy-D-galactopyranose. In certain embodiments, the terms β-form: 2-(acetylamino)-2-deoxy-β-D-galactopyranose and α-form: 2-(acetylamino)-2-deoxy-D-galactopyranose may be used interchangeably. Therefore, in structures where one form is shown, these structures are intended to include the other form as well. For example, when the structure of α-form: 2-(acetylamino)-2-deoxy-D-galactopyranose is shown, this structure is intended to include the other form as well. In certain preferred embodiments, β-form: 2-(acetylamino)-2-deoxy-D-galactopyranose is a preferred embodiment.

[0458] [ka]

[0459] In certain embodiments, two or more ligands have a structure selected from the following:

[0460] [ka] wherein each R1 is selected from OH and NHCOOH.

[0461] In certain embodiments, the two or more ligands have a structure selected from the following:

[0462] [ka]

[0463] In certain embodiments, the two or more ligands have a structure selected from the following:

[0464] [ka]

[0465] In certain embodiments, the two or more ligands have a structure selected from the following:

[0466] [ka]

[0467] i. Certain conjugates In certain embodiments, the conjugate group comprises the structural features described above. In certain such embodiments, the conjugate group has the structure:

[0468] [ka] wherein each n is independently 1 to 20.

[0469] In certain such embodiments, the conjugate group has the structure:

[0470] [ka]

[0471] In certain such embodiments, the conjugate group has the structure:

[0472] [ka] wherein each n is independently 1 to 20; Z is H or a bound solid support; Q is an antisense compound; X is O or S; Bx is a heterocyclic base moiety.

[0473] In certain such embodiments, the conjugate group has the structure:

[0474] [ka]

[0475] In certain such embodiments, the conjugate group has the structure:

[0476] [ka]

[0477] In certain such embodiments, the conjugate group has the structure:

[0478] [ka]

[0479] In certain such embodiments, the conjugate group has the structure:

[0480] [ka]

[0481] In certain such embodiments, the conjugate group has the structure:

[0482] [ka] .

[0483] In certain such embodiments, the conjugate group has the structure:

[0484] [ka]

[0485] In certain such embodiments, the conjugate group has the structure:

[0486] [ka]

[0487] In certain such embodiments, the conjugate group has the structure:

[0488] [ka]

[0489] In certain embodiments, the conjugate does not comprise pyrrolidine.

[0490] In certain such embodiments, the conjugate group has the structure:

[0491] [ka]

[0492] In certain such embodiments, the conjugate group has the structure:

[0493] [ka]

[0494] In certain such embodiments, the conjugate group has the structure:

[0495] [ka]

[0496] In certain such embodiments, the conjugate group has the structure:

[0497] [ka]

[0498] In certain such embodiments, the conjugate group has the structure:

[0499] [ka]

[0500] In certain such embodiments, the conjugate group has the structure:

[0501] [ka]

[0502] In certain such embodiments, the conjugate group has the structure:

[0503] [ka]

[0504] In certain such embodiments, the conjugate group has the structure:

[0505] [ka]

[0506] In certain such embodiments, the conjugate group has the structure:

[0507] [ka]

[0508] In certain such embodiments, the conjugate group has the structure:

[0509] [ka]

[0510] In certain such embodiments, the conjugate group has the structure:

[0511] [ka]

[0512] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0513] [ka] wherein X is a substituted or unsubstituted tether of 6 to 11 consecutively bonded atoms.

[0514] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0515] [ka] wherein X is a substituted or unsubstituted tether of 10 consecutively bonded atoms.

[0516] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0517] [ka] wherein X is a substituted or unsubstituted tether of 4 to 11 consecutively bonded atoms, the tether containing only one amide bond.

[0518] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0519] [ka] In the formula, Y and Z are C1-C 12 They are independently selected from substituted or unsubstituted alkyl, alkenyl, or alkynyl groups, or groups containing ethers, ketones, amides, esters, carbamates, amines, piperidines, phosphates, phosphodiesters, phosphorothioates, triazoles, pyrrolidines, disulfides, or thioethers.

[0520] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0521] [ka] In the formula, Y and Z are C1-C 12 They are independently selected from substituted or unsubstituted alkyl groups, or groups containing one or two ethers, amides, amines, piperidines, phosphates, phosphodiesters, or phosphorothioates.

[0522] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0523] [ka] In the formula, Y and Z are C1-C 12 are independently selected from substituted or unsubstituted alkyl groups.

[0524] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0525] [ka] wherein m and n are independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12.

[0526] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0527] [ka] wherein m is 4, 5, 6, 7, or 8, and n is 1, 2, 3, or 4.

[0528] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0529] [ka] wherein X is a substituted or unsubstituted tether of 4 to 13 consecutively bonded atoms, and X does not include an ether group.

[0530] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0531] [ka] wherein X is a substituted or unsubstituted tether of 8 consecutively bonded atoms, and X does not include an ether group.

[0532] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0533] [ka] wherein X is a substituted or unsubstituted tether of 4 to 13 consecutively bonded atoms, the tether containing only one amide bond, and X does not contain an ether group.

[0534] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0535] [ka] wherein X is a substituted or unsubstituted tether of 4 to 13 consecutively bonded atoms, the tether comprising an amide bond and a substituted or unsubstituted C2-C 11 It consists of an alkyl group.

[0536] In certain embodiments, the cell targeting portion of the conjugate group has the structure:

[0537] [ka] In the formula, Y is C1-C 12 It is selected from substituted or unsubstituted alkyl, alkenyl, or alkynyl groups, or groups containing ethers, ketones, amides, esters, carbamates, amines, piperidines, phosphates, phosphodiesters, phosphorothioates, triazoles, pyrrolidines, disulfides, or thioethers.

[0538] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0539] [ka] In the formula, Y is C1-C 12 It is selected from substituted or unsubstituted alkyl groups, or groups containing ethers, amines, piperidines, phosphates, phosphodiesters, or phosphorothioates.

[0540] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0541] [ka] In the formula, Y is C1-C 12 It is selected from substituted or unsubstituted alkyl groups.

[0542] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0543] [ka] wherein n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12.

[0544] In certain such embodiments, the cell-targeting portion of the conjugate group has the structure:

[0545] [ka] wherein n is 4, 5, 6, 7, or 8.

[0546] a. Certain conjugated antisense compounds In certain embodiments, the conjugate is attached to a nucleoside of the antisense oligonucleotide at the 2', 3', or 5' position of the nucleoside. In certain embodiments, the conjugate antisense compound has the structure:

[0547] [ka] During the ceremony, A is an antisense oligonucleotide, B is a cleavable moiety; C is a conjugated linker; D is a branched group; Each E is a tether, each F is a ligand; q is an integer of 1 to 5.

[0548] In certain embodiments, the conjugated antisense compound has the structure:

[0549] [ka] During the ceremony, A is an antisense oligonucleotide, C is a conjugated linker; D is a branched group; Each E is a tether, each F is a ligand; q is an integer of 1 to 5. In certain such embodiments, the conjugated linker comprises at least one cleavable bond. In certain such embodiments, the branching group comprises at least one cleavable bond. In certain embodiments, each tether comprises at least one cleavable bond.

[0550] In certain embodiments, the conjugate is attached to a nucleoside of the antisense oligonucleotide at the 2', 3', or 5' position of the nucleoside.

[0551] In certain embodiments, the conjugated antisense compound has the structure:

[0552] [ka] During the ceremony, A is an antisense oligonucleotide, B is a cleavable moiety; C is a conjugated linker; Each E is a tether, each F is a ligand, and q is an integer of 1 to 5.

[0553] In certain embodiments, the conjugate is attached to a nucleoside of the antisense oligonucleotide at the 2', 3', or 5' position of the nucleoside. In certain embodiments, the conjugate antisense compound has the structure:

[0554] [ka] During the ceremony, A is an antisense oligonucleotide, C is a conjugated linker; Each E is a tether, each F is a ligand, and q is an integer of 1 to 5.

[0555] In certain embodiments, the conjugated antisense compound has the structure:

[0556] [ka] During the ceremony, A is an antisense oligonucleotide, B is a cleavable moiety; D is a branched group; Each E is a tether, each F is a ligand, and q is an integer of 1 to 5.

[0557] In certain embodiments, the conjugated antisense compound has the structure:

[0558] [ka] During the ceremony, A is an antisense oligonucleotide, D is a branched group; Each E is a tether, each F is a ligand, and q is an integer of 1 to 5.

[0559] In certain such embodiments, the conjugated linker comprises at least one cleavable bond.

[0560] In certain embodiments, each tether comprises at least one cleavable bond.

[0561] In certain embodiments, the conjugated antisense compound has a structure selected from the following:

[0562] [ka]

[0563] In certain embodiments, the conjugated antisense compound has a structure selected from the following:

[0564] [ka]

[0565] In certain embodiments, the conjugated antisense compound has a structure selected from the following:

[0566] [ka]

[0567] Representative United States patents, United States patent application publications, and international patent application publications that teach the preparation of some of the above-described conjugates, conjugated antisense compounds, tethers, linkers, branching groups, ligands, cleavable moieties, and other modifications include, but are not limited to, US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 2006 / 0148740, US 2011 / 0123520, WO 2013 / 033230, and WO 2012 / 037254, each of which is incorporated herein by reference in its entirety.

[0568] Representative publications that teach the preparation of some of the above-described conjugates, conjugated antisense compounds, tethers, linkers, branching groups, ligands, cleavable moieties, as well as other modifications, include BIESSEN et al., "The Cholesterol Derivative of a Triantennary Galactoside with High Affinity for the Hepatic Asialoglycoprotein Receptor:a Potent Cholesterol Lowering Agent” J.Med.Chem.(1995)38:1846-1852, BIESSEN et al. “Synthesis of Cluster Galactoside with High Affinity for the Hepatic Asialoglycoprotein Receptor” J.Med.Chem.(1995)38:1538-1546, LEE et al. “New and more efficient multivalent glyco-ligands for asialoglycoprotein receptor of mammalian hepatocytes”Bioorganic & Medicinal Ch emistry(2011)19:2494-2500, RENSEN et al. "Determination of the Upper Size Limit for Uptake and Processing of Ligands by the Asialoglycoprotein Receptor on Hepatocytes in Vitro and in Vivo" J.Biol.Chem.(2001)276(40):37577-37584, RENSEN et al. "Design and Synthesis of Novel N-Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asialoglycoprotein Receptor” J. Med. Chem. (2004) 47:5798-5808, SLIEDREGT et al. “Design and Synthesis of Novel Amphiphilic Dendritic Galactosides for Selective Targeting of Liposomes to the Hepatic Asialoglycoprotein Receptor,” J. Med. Chem. (1999) 42:609-618, and Valentijn et al., “Solid-phase synthesis of lysine-based Cluster galactosides with high affinity for the Asialoglycoprotein Receptor,” Tetrahedron, 1997, 53(2), 759-770, each of which is incorporated herein by reference in its entirety.

[0569] In certain embodiments, the conjugate antisense compound comprises an RNase H-based oligonucleotide (such as a gapmer) or a splice control oligonucleotide (such as a fully modified oligonucleotide) and an optional conjugate group comprising at least one, two, or three GalNAc groups. In certain embodiments, conjugated antisense compounds are prepared using the methods described in the following references: Lee, Carbohydr Res, 1978, 67, 509-514; Connolly et al., J Biol Chem, 1982, 257, 939-945; Pavia et al., Int J Pep Protein Res, 1983, 22, 539-548; Lee et al., Biochem, 1984, 23, 4255-4261; Lee et al., Glycoconjugate J, 1987, 4, 317-328; Toyokuni et al., Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et al. al., J Med Chem,1995,38,1538-1546, Valentijn et al.,Tetrahedron,1997,53,759-770, Kim et al.,Tetrahedron Lett,1997,38,3487-3490, Lee et al.,Bioconjug Chem,1997,8,762-765, Kato et al., Glycobiol,2001,11,821-829, Rensen et al.,J Biol Chem,2001,276,37577-37584, Lee et al.,Methods Enzymol,2003,362,38-43, Westerlind et al.,Glycoconj J,2004,21,227-241,Lee et al.,Bioorg Med Chem Lett,2006,16(19),5132-5135、Maierhofer et al.,Bioorg Med Chem,2007,15,7661-7676、Khorev et al.,Bioorg Med Chem,2008,16,5216-5231、Lee et al.,Bioorg. Chem,2011,19,2494-2500、Kornilova et al.,Analyt Biochem,2012,425,43-46、Pujol et al.,Angew Chemie Int Ed Engl,2012,51,7445-7448、Biessen et al.,J Med. Chem,1995,38,1846- 1852、Sliedregt et al.,J Med Chem,1999,42,609-618、Rensen et al.,J Med Chem,2004,47,5798-5808、Rensen et al.,Arterioscler Thromb Vasc Biol,2006,269-1771-van Rossenberg et al al.,Gene Ther,2004,11,457-464、Sato et al.,J Am Chem Soc,2004,126,14013-14022、Lee et al.,J Org Chem,2012,77,7564-7571、Biessen et al.,FA J,2000,14,1784-1792、Rajur et al.,Bioconjug Chem,1997,8,935-940、Duff et al.,Methods Enzymol,2000,313,297-321、Maier et al.,Bioconjug Chem,2003,14,18-29、Jayaprakash et al.,Org Lett,2010,12,5410-5413, Manoharan,Antisense Nucleic Acid Drug Dev,2002,12,103-128,Merwin et al.,Bioconjug Chem,1994,5,612-620,Tomiya et al.,Bioorg Med Chem, 2013, 21, 5275-5281, International Applications WO1998 / 013381;WO2011 / 038356;WO1997 / 046098;WO2008 / 098788;WO2004 / 101619;WO2012 / 037254;WO2011 / 120053;WO2011 / 100131;WO2011 / 163121;WO2012 / 177947;WO2013 / 033230;WO2013 / 075035;WO2012 / 083185;WO 2012 / 083046;WO2009 / 082607;WO2009 / 134487;WO2010 / 144740;WO2010 / 148013;WO1997 / 020563;WO2010 / 088537;WO2002 / 04 3771;WO2010 / 129709;WO2012 / 068187;WO2009 / 126933;WO2004 / 024757;WO2010 / 054406;WO2012 / 089352;WO2012 / 089602;WO2 013 / 166121;WO2013 / 165816;US Patents 4,751,219;8,552,163;6,908,903;7,262,177;5,994,517;6,300,319;8,106,022;7,491,805;7,491,805;7,582,744;8,137,695;6,383,812;6,525,031;6,660,720;7,723,509;8,541,548;8,344,125;8,313,772;8, 349,308;8,450,467;8,501,930;8,158,601;7,262,177;6,906,182;6,620,916;8,435,491;8,404,862;7,851,615;US Patent Application Publications US2011 / 0097264;US2011 / 0097265;US2013 / 0004427;US2005 / 0164235;US2006 / 0148740;US2008 / 0281044;US2010 / 0240730;US2003 / 0119724;US2006 / 0183886;US2008 / 0206869;US2011 / 0269814;US2009 / 0286973;US2011 / 0207799;US2012 / 0136042 ;US2012 / 0165393;US2008 / 0281041;US2009 / 0203135;US2012 / 0035115;US2012 / 0095075;US2012 / 0101148;US2012 / 0128760 US2012 / 0157509; US2012 / 0230938; US2013 / 0109817; US2013 / 0121954; US2013 / 0178512; US2013 / 0236968; US2011 / 0123520; US2003 / 0077829; US2008 / 0108801; and US2009 / 0203132, each of which is incorporated by reference in its entirety.

[0570] Cell culture and treatment with antisense compounds The effect of antisense compounds on the level, activity or expression of PKK nucleic acid can be tested in vitro in various cell types.The cell types used for such analysis are available from commercial vendors (e.g., American Type Culture Collection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park, NC; Clonetics Corporation, Walkersville, MD) and are cultured using commercially available reagents (e.g., Life Technologies, Carlsbad, CA) according to the vendor's instructions.Exemplary cell types include HepaRG. TM These include, but are not limited to, T cells and mouse primary hepatocytes.

[0571] In vitro testing of antisense oligonucleotides Described herein are methods for treating cells with antisense oligonucleotides, which can be modified appropriately for treatment with other antisense compounds.

[0572] Cells can be treated with antisense oligonucleotides when the cells reach approximately 60-80% confluence in culture.

[0573] One commonly used reagent for introducing antisense oligonucleotides into cultured cells is the cationic lipid transfection reagent LIPOFECTIN (Life Technologies, Carlsbad, CA). Antisense oligonucleotides are mixed with LIPOFECTIN in OPTI-MEM1 (Life Technologies, Carlsbad, CA) to achieve the desired final antisense oligonucleotide concentration and LIPOFECTIN concentrations, which can range from 2 to 12 μg / mL per 100 nM antisense oligonucleotide.

[0574] Another reagent used to deliver antisense oligonucleotides to cultured cells is LIPOFECTAMINE (Life Technologies, Carlsbad, CA). Antisense oligonucleotides are mixed with LIPOFECTAMINE in OPTI-MEM1 reduced serum medium (Life Technologies, Carlsbad, CA) to achieve the desired antisense oligonucleotide concentration and LIPOFECTAMINE concentration, which can range from 2 to 12 μg / mL per 100 nM antisense oligonucleotide.

[0575] Another technique used to introduce antisense oligonucleotides into cultured cells is electroporation.

[0576] Yet another technique used to introduce antisense oligonucleotides into cultured cells involves free uptake of the oligonucleotides by the cells.

[0577] Cells are treated with antisense oligonucleotides using conventional methods. Cells can be harvested 16-24 hours after antisense oligonucleotide treatment, at which time RNA or protein levels of the target nucleic acid are measured using methods known in the art and described herein. Generally, when multiple replicate samples are treated, the data are expressed as the average of the replicate sample treatments.

[0578] The concentration of antisense oligonucleotides used varies for each cell line. Methods for determining the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. For transfection with lipofectamine, antisense oligonucleotides are typically used at concentrations ranging from 1 nM to 300 nM. For transfection by electroporation, higher concentrations of antisense oligonucleotides are used, ranging from 625 nM to 20,000 nM.

[0579] RNA isolation RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods for RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, by using TRIZOL Reagent (Life Technologies, Carlsbad, CA) according to the manufacturer's recommended protocol.

[0580] Analysis of inhibition of target levels or expression The level or inhibition of expression of PKK nucleic acid can be assayed by various methods well known in the art. For example, the level of target nucleic acid can be quantified by, for example, Northern blot analysis, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on total cellular RNA or poly(A)+ mRNA. Methods for RNA isolation are well known in the art. Northern blot analysis is also routine in the art. Quantitative real-time PCR can be conveniently achieved by using the commercially available ABI PRISM 7600, 7700, or 7900 sequence detection system available from PE-Applied Biosystems, Inc., Foster City, California, according to the manufacturer's instructions.

[0581] Quantitative real-time PCR analysis of target RNA levels Quantitation of target RNA levels can be achieved by quantitative real-time PCR using an ABI PRISM 7600, 7700, or 7900 Sequence Detection System (PE-Applied Biosystems, Foster City, CA) according to the manufacturer's instructions. Methods for quantitative real-time PCR are well known in the art.

[0582] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction to generate complementary DNA (cDNA), which is used as a substrate for real-time PCR amplification. RT and real-time PCR reactions are performed sequentially in the same sample well. RT and real-time PCR reagents can be obtained from Life Technologies, Inc. (Carlsbad, Calif.). RT real-time PCR reactions are performed by methods well known to those skilled in the art.

[0583] The amount of gene (or RNA) target obtained by real-time PCR is normalized either by the expression level of a gene with constant expression, such as cyclophilin A, or by quantifying total RNA using RIBOGREEN (Life Technologies, Inc., Carlsbad, CA). Cyclophilin A expression is quantified by real-time PCR, either simultaneously with the target, multiplexed, or separately. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invetrogen, Inc., Eugene, OR). The method for RIBOGREEN RNA quantification is taught in Jones, LJ, et al. (Analytical Biochemistry, 1998, 265, 368-374). A CYTOFLUOR 4000 instrument (PE Applied Biosystems) is used to measure RIBOGREEN fluorescence.

[0584] Probes and primers are designed to hybridize to PKK nucleic acids. Methods for designing real-time PCR probes and primers are well known in the art and are available from PRIME. Software such as R EXPRESS software (Applied Biosystems, Foster City, Calif.) may also be used.

[0585] Analysis of protein levels Antisense inhibition of PKK nucleic acids can be assessed by measuring PKK protein levels. PKK protein levels can be assessed or quantified by various methods known in the art, such as immunoprecipitation, Western blot analysis (immunoblotting), enzyme-linked immunosorbent assay (ELISA), quantitative protein assay, protein activity assay (e.g., caspase activity assay), immunohistochemistry, immunocytochemistry, or fluorescence-activated cell sorting (FACS). Antibodies against the target can be identified and obtained from various sources, such as the MSRS catalog of antibodies (Aerie Corporation, Birmingham, MO), and can be prepared by conventional monoclonal or polyclonal antibody generation methods known in the art.

[0586] In vivo testing of antisense compounds Antisense compounds, eg, antisense oligonucleotides, are tested in animals to assess their ability to inhibit expression of PKK and cause phenotypic changes.

[0587] In certain embodiments, such phenotypic changes include those associated with inflammatory diseases, such as decreased inflammation, edema / swelling, vascular permeability, and vascular leakage, hi certain embodiments, inflammation is measured by measuring an increase or decrease in edema, body temperature, pain, tissue color, and abdominal function in the animal.

[0588] In certain embodiments, such phenotypic changes include those associated with thromboembolic disease, such as a prolonged aPTT, a prolonged aPTT time when combined with a normal PT, a decreased amount of platelet factor 4 (PF-4), a decreased formation of thrombus, or an increased time to thrombus formation.

[0589] Tests may be conducted in normal animals or experimental disease models. For administration to animals, antisense oligonucleotides are formulated in a pharmaceutically acceptable diluent, such as phosphate-buffered saline. Administration is via parenteral routes, such as intraperitoneal, intravenous, and subcutaneous. Calculation of the dosage and frequency of antisense oligonucleotides is within the skill of those skilled in the art and depends on factors such as the route of administration and the animal's body weight. After a period of treatment with antisense oligonucleotides, RNA is isolated from liver tissue to measure changes in PKK nucleic acid expression.

[0590] Certain Indications In certain embodiments, the present invention provides methods of treating an individual, comprising administering one or more pharmaceutical compositions described herein.

[0591] In certain embodiments, the individual has an inflammatory disease. In certain embodiments, the individual is at risk for developing inflammatory conditions, including, but not limited to, hereditary angioedema (HAE), edema, angioedema, swelling, eyelid angioedema, ocular edema, macular edema, and cerebral edema. This includes individuals with acquired problems, diseases, or disorders that put them at risk for inflammation, such as a genetic predisposition to inflammatory conditions, environmental factors, and exposure to certain medications, such as ACE inhibitors and ARBs. In certain embodiments, the individual has been determined to be in need of anti-inflammatory treatment. Examples of such individuals include, but are not limited to, individuals with mutations in the genetic coding for complement 1 esterase inhibitor (i.e., C1-INH) or factor 12. In certain embodiments, the abnormal coding can lead to a deficiency of C1-INH (type I HAE), the inability of existing C1-INH to function properly (type II HAE), or hyperactive factor 12 (type III HAE).

[0592] In certain embodiments, the individual has a thromboembolic disorder. In certain embodiments, the individual is at risk for a blood clotting disorder, including, but not limited to, infarction, thrombosis, embolism, thromboembolism such as deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. This includes individuals with acquired problems, diseases, or disorders that lead to a risk of thrombosis, such as surgery, cancer, immobility, sepsis, atherosclerosis, and atrial fibrillation, as well as individuals with a genetic predisposition, such as antiphospholipid syndrome and autosomal significant conditions, such as Factor V Leiden. In certain embodiments, the individual has been determined to be in need of anti-inflammatory treatment. Examples of such individuals include, but are not limited to, individuals undergoing major orthopedic surgery (e.g., hip / knee replacement or hip fracture surgery) and patients with arterial fibrillation who require chronic treatment to prevent stroke.

[0593] In certain embodiments, the present invention provides methods for prophylactically reducing PKK expression in an individual, comprising treating an individual in need thereof by administering to the individual a therapeutically effective amount of an antisense compound targeted to a PKK nucleic acid.

[0594] In one embodiment, administration of a therapeutically effective amount of an antisense compound targeted to a PKK nucleic acid is accompanied by monitoring PKK levels in the individual's serum to determine the individual's response to administration of the antisense compound, which is used by a physician to determine the amount and duration of therapeutic intervention.

[0595] In certain embodiments, administering an antisense compound targeted to a PKK nucleic acid reduces PKK expression by at least 15, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, or a range defined by two of these values. In certain embodiments, pharmaceutical compositions comprising antisense compounds targeted to PKK are used to prepare medicaments for treating patients suffering from or suspected of having an inflammatory or thromboembolic disease.

[0596] Certain compositions 1. ISIS 546254 In one particular embodiment, ISIS 546254 is characterized as a 5-10-5 MOE gapmer and has the sequence (5' to 3')TGCAAGTCTCTTGGCAAACA (incorporated herein as SEQ ID NO: 570), wherein each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5'-methylcytosine, each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl modified nucleoside, and each of nucleosides 6-15 is a 2'-deoxynucleoside.

[0597] In certain embodiments, ISIS 546254 is described by the following chemical notation: Tes Ges mCes Aes Aes Gds Tds mCds Tds mCds Tds Gds Gds mCds Aes Aes Aes mCes Ae, where: A = adenine, mC = 5'-methylcytosine, G = guanine, T=thymine; e = 2'-O-methoxymethyl modified nucleoside, d=2'-deoxynucleoside, and s = phosphorothioate internucleoside linkage.

[0598] In certain embodiments, ISIS 546254 is described by the following chemical structure:

[0599] [ka]

[0600] Structure 1 ISIS 546254 In one specific embodiment, as provided in Example 2 (below), ISIS 546254 inhibited human PKK mRNA by 95% in cultured HepaRG™ cells (at a density of 20,000 cells per well) when transfected with 5,000 nM antisense oligonucleotides using electroporation and measured by using human primer probe set RTS3454, as measured by quantitative real-time PCR, and adjusted according to total RNA content measured by RIBOGREEN® after a 24-hour treatment period.

[0601] In certain embodiments, as provided in Example 5 (see Tables 34 and 41 below), ISIS 546254 exhibited IC values ​​of 0.2 μM and 0.3 μM in a four-point dose-response curve (0.19 μM, 0.56 μM, 1.67 μM, and 5.0 μM) in cultured HepaRG™ cells (at a density of 20,000 cells per well) when transfected using electroporation and measured by quantitative real-time PCR using human primer probe set RTS3454 after a 16-hour treatment period, and adjusted according to total RNA content measured by RIBOGREEN®. 50 was achieved.

[0602] In certain embodiments, as provided in Example 7 (below), ISIS 546254 achieved 31%, 55%, 84%, and 83% inhibition of human PKK mRNA and 0%, 36%, 51%, and 76% inhibition of human PKK protein when transgenic mice carrying the human PKK gene sequence were subcutaneously injected with ISIS 546254 at 2.5 mg / kg / week, 5.0 mg / kg / week, 10 mg / kg / week, or 20 mg / kg / week twice weekly for 3 weeks.

[0603] In certain embodiments, as provided in Example 8 (below), ISISI 546 254 is effective in inhibiting PKK mRNA and protein expression and is tolerated by primates.

[0604] 2. ISIS 546343 In certain embodiments, ISIS 546343 features a 5-10-5 MOE gapmer and comprises (5' to 3') CCCCCTTCTTTATAGCCAGC (SEQ ID NO: No. 705, herein incorporated by reference, in which each internucleoside linkage is a phosphorothioate linkage, each cytosine is a 5'-methylcytosine, each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl modified nucleoside, and each of nucleosides 6-15 is a 2'-deoxynucleoside.

[0605] In certain embodiments, ISIS 546343 has the following chemical designations: mCes mCes mCes mCes mCes Tds Tds mCds Tds Tds It is written as Tds Ads Tds Ads Gds mCes mCes Aes Ges mCe, where: A = adenine, mC = 5'-methylcytosine, G = guanine, T=thymine; e = 2'-O-methoxymethyl modified nucleoside, d=2'-deoxynucleoside, and s = phosphorothioate internucleoside linkage.

[0606] In certain embodiments, ISIS 546343 is described by the following chemical structure:

[0607] [ka]

[0608] Structure 2 ISIS 546343 In one specific embodiment, as provided in Example 2 (see Tables 9 and 10 below), ISIS 546343 was transfected with 5,000 nM of antisense oligonucleotide using electroporation after a 24 hour treatment period, and human It inhibited human PKK mRNA by 97% and 91% in cultured HepaRG™ cells (at a density of 20,000 cells per well) as measured by quantitative real-time PCR using primer probe set RTS3454 and adjusted according to total RNA content measured by RIBOGREEN®.

[0609] In a specific embodiment, as provided in Example 5 (see Tables 34 and 41 below), ISIS 546343 exhibited an IC of 0.4 μM in a four-point dose-response curve (0.19 μM, 0.56 μM, 1.67 μM, and 5.0 μM) in cultured HepaRG™ cells (at a density of 20,000 cells per well) when transfected by electroporation and measured by quantitative real-time PCR using human primer probe set RTS3454 after a 16-hour treatment period, and adjusted according to total RNA content measured by RIBOGREEN®. 50 was achieved.

[0610] In certain embodiments, as provided in Example 7 (below), ISIS 546343 achieved 46%, 66%, and 86% inhibition of human PKK mRNA and 0%, 38%, and 79% inhibition of human PKK protein when transgenic mice carrying the human PKK gene sequence were subcutaneously injected with ISIS 546343 at 2.5 mg / kg / week, 5.0 mg / kg / week, 10 mg / kg / week, or 20 mg / kg / week twice weekly for 3 weeks.

[0611] In certain embodiments, as provided in Example 8 (below), ISISI 546343 is effective in inhibiting PKK mRNA and protein expression and is tolerated by primates.

[0612] 3. ISIS 548048 In certain embodiments, ISIS 548048 features a modified antisense oligonucleotide having the nucleobase sequence (5' to 3') CGATATCATGATTCCC (incorporated herein as SEQ ID NO: 1666), consisting of a combination of 16 2'-deoxynucleosides, 2'-O-methoxyethyl-modified nucleosides, and cEt-modified nucleosides, wherein each of nucleosides 1, 2, and 16 is a 2'-O-methoxyethyl-modified nucleoside, each of nucleosides 3, 14, and 15 is a cEt-modified nucleoside, each of nucleosides 4-13 is a 2'-deoxynucleoside, each internucleoside linkage is a phosphorothioate internucleoside linkage, and each cytosine is a 5'-methylcytosine.

[0613] In certain embodiments, ISIS 548048 is described by the following chemical designation: mCes Ges Aks Tds Ads Tds mCds Ads Tds Gds Ads Tds Tds mCks mCks mCe, wherein A = adenine, mC = 5'-methylcytosine, G = guanine, T=thymine; e = 2'-O-methoxymethyl modified nucleoside, k = cEt-modified nucleoside; d=2'-deoxynucleoside, and s = phosphorothioate internucleoside linkage

[0614] In certain embodiments, ISIS 548048 is described by the following chemical structure:

[0615] [ka]

[0616] Structure 3 ISIS 548048 In one specific embodiment, as provided in Example 3 (below), ISIS 548048 inhibited mRNA by 84% in cultured HepaRG™ cells (at a density of 20,000 cells per well) transfected with 1,000 nM antisense oligonucleotide using electroporation after a 24-hour treatment period, as measured by quantitative real-time PCR using human primer probe set RTS3454, and adjusted according to total RNA content measured by RIBOGREEN®.

[0617] In certain embodiments, as provided in Example 6 (below), ISIS 548048 exhibited an IC of 0.1 μM in a four-point dose-response curve (0.11 μM, 0.33 μM, 1.00 μM, and 3.00 μM) in cultured HepaRG™ cells (at a density of 20,000 cells per well) when transfected using electroporation and measured by quantitative real-time PCR using human primer probe set RTS3454, adjusted according to total RNA content measured by RIBOGREEN® after a 16-hour treatment period. 50 was achieved.

[0618] In certain embodiments, as provided in Example 7 (below), ISIS 548048 achieved 7%, 77%, 72%, and 80% inhibition of human PKK mRNA and 23%, 70%, 89%, and 98% inhibition of human PKK protein when transgenic mice carrying the human PKK gene sequence were injected subcutaneously with ISIS 548048 twice weekly for 3 weeks at 2.5 mg / kg / week, 5.0 mg / kg / week, 10 mg / kg / week, or 20 mg / kg / week.

[0619] In certain embodiments, as provided in Example 8 (below), ISISI 548048 is effective in inhibiting PKK mRNA and protein expression and is tolerated by primates. can be.

[0620] 4. ISIS 721744 In certain embodiments, ISIS 721744 is characterized as a 5-10-5 MOE gapmer and has the sequence (5' to 3') TGCAAGTCTCTTGGCAAACA (incorporated herein as SEQ ID NO: 570), wherein the internucleoside linkages between nucleosides 3-4, 4-5, 16-17, and 17-18 are phosphodiester linkages, and the internucleosides 1-2, 2-3, 5-6, 6-7, 7-8, 8-9, 9-10 are phosphodiester linkages. The internucleoside bond between nucleosides 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 is a phosphorothioate bond, each cytosine is a 5'-methylcytosine, each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl modified nucleoside, and each of nucleosides 6-15 is a 2'-deoxynucleoside.

[0621] In certain embodiments, ISIS 721744 has the following chemical designation: GalNAc3-7 a-o’ Tes Ges mCeo Aeo Aes Gds Tds mCds It is described by Tds mCds Tds Tds Gds Gds mCds Aeo Aeo Aes mCes Ae, where: A = adenine, mC = 5'-methylcytosine, G = guanine, T=thymine; e = 2'-O-methoxymethyl modified nucleoside, d=2'-deoxynucleoside, and o = phosphodiester internucleoside linkage; s = phosphorothioate internucleoside linkage, and GalNAc3-7 a-o’ =

[0622] [ka]

[0623] In certain embodiments, ISIS 721744 is described by the following chemical structure:

[0624] [ka]

[0625] A specific hot spot area 1. Nucleic acid bases 27427 to 27466 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 27427-27466 of SEQ ID NO: 10 (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 27427-27466 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 27427-27466 of SEQ ID NO: 10 are targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0626] In certain embodiments, nucleobases 27427 to 27466 of SEQ ID NO: 10 are ISI Targeted by S numbers: 530993, 530994, 530995, 546251, 546252, 546253, 546254, 546255, 546256, 547410, 547411, 547978, 547979, 547980, and 547981.

[0627] In certain embodiments, nucleobases 27427-27466 of nucleobases of SEQ ID NO: 10 are targeted by SEQ ID NOs: 94, 95, 96, 566, 567, 568, 569, 570, 571, 572, 573, 1597, 1598, 1599, and 1600.

[0628] In certain embodiments, an antisense oligonucleotide targeted to nucleobases 27427-27466 of SEQ ID NO: 10 is at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% reduction in PKK and / or protein levels in vitro and / or in vivo.

[0629] 2. Nucleic acid bases 33183 to 33242 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 33183-33242 of SEQ ID NO: 10 (GENBANK accession number NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 33183-33242 of SEQ ID NO: 10 are hotspot regions. In certain embodiments, nucleobases 33183-33242 of SEQ ID NO: 10 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotide is 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0630] In certain embodiments, nucleobases 33183 to 33242 of SEQ ID NO: 10 are selected from the group consisting of ISIS numbers: 531052, 531053, 531054, 531055, 531056, 531057, 531058, 531059, 531060, 531061, 531 Targeted by 31057, 531158, 546343, 546345, 547480, 547481, 547482, and 547483.

[0631] In certain embodiments, 33183 to 33242 of SEQ ID NO: 10 are targeted by SEQ ID NOs: 155, 156, 157, 158, 159, 160, 261, 702, 703, 704, 705, 706, and 707.

[0632] In certain embodiments, antisense oligonucleotides targeting nucleobases 33183-33242 of SEQ ID NO: 10 are at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, , at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% reduction in PKK mRNA and / or protein levels in vitro and / or in vivo.

[0633] 3. Nucleic acid bases 30570 to 30610 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 30570-30610 of SEQ ID NO: 10 (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 30570-30610 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 30570-30610 of SEQ ID NO: 10 are targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0634] In certain embodiments, sequences 30570 to 30610 of SEQ ID NO: 10 are targeted by ISIS numbers 531026, 546309, 546310, 546311, 546313, 547453, 547454, 547455, 547456, 547457, 547458, 548046, 548047, 548048, 548049, and 548050. can be.

[0635] In certain embodiments, 30570 to 30610 of SEQ ID NO: 10 are targeted by SEQ ID NOs: 129, 652, 653, 654, 655, 656, 657, 658, 659, 660, 661, 1664, 1665, 1666, 1667, and 1668.

[0636] In certain embodiments, antisense oligonucleotides targeting nucleobases 30570 to 30610 of SEQ ID NO: 10 are at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least In some embodiments, the compound reduces PKK mRNA and / or protein levels in vitro and / or in vivo by at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

[0637] 4. Nucleic acid bases 27427 to 27520 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 27427-27520 of SEQ ID NO: 10 (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 27427-27520 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 27427-27520 of SEQ ID NO: 10 are targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0638] In certain embodiments, nucleobases 27427-27520 of SEQ ID NO: 10 are targeted by ISIS numbers 530993-530999, 546251-546256, 546258-546260, 546263, 546265-546268, 547410-547417, and 547978-547992.

[0639] In certain embodiments, nucleobases 27427-27520 of nucleobases SEQ ID NO: 10 are targeted by SEQ ID NOs: 94-100, 566-587, and 1597-1611.

[0640] In certain embodiments, an antisense oligonucleotide targeting nucleobases 27427 to 27520 of SEQ ID NO: 10 is at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, , at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% to achieve a reduction in PKK and / or protein levels in vitro and / or in vivo.

[0641] 5. Nucleic acid bases 33085 to 33247 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 33085-33247 of SEQ ID NO: 10 (GENBANK accession number NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 33085-33247 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 33085-33247 of SEQ ID NO: 10 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotide is 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0642] In certain embodiments, nucleobases 33085-33247 of SEQ ID NO: 10 are targeted by ISIS numbers 531041-531158, 546336, 546339, 546340, 546343, 546345, 547474-547483, 547778, 548077-548082, and 548677-548678.

[0643] In certain embodiments, nucleobases 33085-33247 of the nucleobases of SEQ ID NO: 10 are substituted with nucleobases 33085-33247 of SEQ ID NOs: 144-160, 261, 693-707, 1256, 1320-1325 , 2214, and 2215.

[0644] In certain embodiments, the antisense oligonucleotide targeted to nucleobases 33085 to 33247 of SEQ ID NO: 10 is at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% reduction in PKK and / or protein levels in vitro and / or in vitro.

[0645] 6. Nucleic acid bases 30475 to 30639 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 30475-30639 of SEQ ID NO: 10 (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 30475-30639 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 30475-30639 of SEQ ID NO: 10 are targeted by antisense oligonucleotides. In certain embodiments, the antisense oligonucleotide is 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0646] In certain embodiments, nucleobases 30475-30639 of SEQ ID NO: 10 are targeted by ISIS numbers 531021-531029, 531146, 546297, 546299-546304, 546306-546311, 546313, 546316-546319, 547444-547462, 548031, 548032, and 548034-548056.

[0647] In certain embodiments, nucleobases 30475-30639 of nucleobases of SEQ ID NO: 10 are targeted by SEQ ID NOs: 124-132, 249, 633-669, and 1650-1674.

[0648] In certain embodiments, antisense oligonucleotides targeting nucleobases 30475 to 30639 of SEQ ID NO: 10 are at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least In some embodiments, the present invention achieves at least a 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% reduction in PKK and / or protein levels in vivo and / or in vitro.

[0649] 7. Nucleic acid bases 27362 to 27524 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 27362-27524 of SEQ ID NO: 10 (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 27362-27524 correspond to exon 9 of PKK (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 27362-27524 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 27362-27524 of SEQ ID NO: 10 are targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0650] In certain embodiments, nucleobases 27361-27524 of SEQ ID NO: 10 are targeted by ISIS numbers 530985-530999, 546244, 546247-546256, 546258-546260, 546263, 546265-546268, 547403-547417, 547723, 547968-547970, and 547972-547992.

[0651] In certain embodiments, nucleobases 27361 to 27524 of the nucleobases of SEQ ID NO: 10 are targeted by SEQ ID NOs: 86-100, 554-587, 1217, and 1588-1611.

[0652] In certain embodiments, antisense oligonucleotides targeting nucleobases 27362 to 27524 of SEQ ID NO: 10 are at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least In some embodiments, the method achieves at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% reduction in PKK and / or protein levels in vitro and / or in vivo.

[0653] 8. Nucleic acid bases 33101 to 33240 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 33101-33240 of SEQ ID NO: 10 (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 33101-33240 correspond to exon 14 of PKK (GENBANK Accession No. NT_016354.19, truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 33101-33240 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 33101-33240 of SEQ ID NO: 10 are targeted by antisense oligonucleotides. In certain embodiments, antisense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0654] In certain embodiments, nucleobases 33101-33240 of SEQ ID NO: 10 are targeted by ISIS numbers 531041-531158, 546336, 546339, 546340, 546343, 546345, 547474-547483, 548077-548082, and 548678-548678.

[0655] In certain embodiments, nucleobases 33101-33240 of nucleobases of SEQ ID NO: 10 are targeted by SEQ ID NOs: 144-160, 261, 693-707, 1320-1325, and 2215.

[0656] In certain embodiments, an antisense oligonucleotide targeted to nucleobases 33101-33240 of SEQ ID NO: 10 is at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% reduction in PKK and / or protein levels in vitro and / or in vivo.

[0657] 9. Nucleic acid bases 30463 to 30638 of SEQ ID NO: 10 In certain embodiments, antisense oligonucleotides are designed to target nucleobases 30463-30638 of SEQ ID NO: 10 (GENBANK accession number NT_016354.19 truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 30463-30638 correspond to exon 12 of PKK (GENBANK accession number NT_016354.19 truncated from nucleobases 111693001-111730000). In certain embodiments, nucleobases 30463-30638 of SEQ ID NO: 10 are a hotspot region. In certain embodiments, nucleobases 30463-30638 of SEQ ID NO: 10 are targeted by antisense oligonucleotides. In certain embodiments, antisense oligonucleotides are 15, 16, 17, 18, 19, or 20 nucleobases in length. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5MOE gapmer, a 4-9-4MOE gapmer, a 4-10-4MOE gapmer, a 4-10-3MOE gapmer, a 3-10-4MOE gapmer, or a 3-10-3MOE gapmer. In certain embodiments, the gapmer is a 5-10-5MOE and cEt gapmer, a 4-9-4MOE and cEt gapmer, a 4-10-4MOE and cEt gapmer, a 4-10-3MOE and cEt gapmer, a 3-10-4MOE and cEt gapmer, or a 3-10-3MOE and cEt gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate internucleoside linkages.

[0658] In certain embodiments, nucleobases 30463-30638 of SEQ ID NO: 10 are selected from the group consisting of ISIS numbers 531021-531029, 531146, 546297, 546299-546304, 546306-546311, 546313, 546316-546319, 547444-547462, 548031, 548032, and 548034-548 Targeted by 056.

[0659] In certain embodiments, nucleobases 30463-30638 of nucleobases of SEQ ID NO: 10 are targeted by SEQ ID NOs: 124-132, 249, 633-669, and 1650-1674.

[0660] In certain embodiments, an antisense oligonucleotide targeted to nucleobases 30463-30638 of SEQ ID NO: 10 is at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 100%, at least 101%, at least 102%, at least 103%, at least 104%, at least 105%, at least 106%, at least at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% reduction in PKK and / or protein levels in vitro and / or in vivo. [Example]

[0661] Non-limiting disclosure and incorporation by reference While certain compounds, compositions, and methods described herein have been specifically described according to certain embodiments, the following examples are intended only to illustrate, but not to limit, the compounds described herein. Each of the references cited in this application is incorporated herein by reference in its entirety.

[0662] The following examples illustrate certain specific embodiments of the present disclosure, but do not limit them.Furthermore, when describing specific embodiments, the inventors intend the general application of these specific embodiments.For example, the disclosure of an oligonucleotide having a specific motif provides rational support for other oligonucleotides having this motif or similar motifs.Similarly, for example, if a specific high-affinity modification is found at a specific position, other high-affinity modifications at the same position are also considered suitable, unless otherwise indicated.

[0663] Example 1: General method for the preparation of phosphoramidites (compounds 1, 1a, and 2)

[0664] [ka] Compounds 1, 1a, and 2 were prepared according to procedures known in the art and described herein (Seth et al., Bioorg. Med. Chem., 2011, 21(4), 1122-1125, J. Org. Chem., 2010, 75(5), 1569-1581, Nucleic Acids Symposium Series, 2008, 52(1), 553-554), as well as published PCT international applications (WO2011 / 115818, WO2010 / 077578, WO2010 / 036698, WO2009 / 143369, WO2009 / 006478, and WO2007 / 090071), and see also U.S. Pat. No. 7,569,686).

[0665] Example 2: Preparation of Compound 7

[0666] [ka] Compound 3 (2-acetamido-1,3,4,6-tetra-O-acetyl-2-deoxy-β-D-galactopyranose or galactosamine pentaacetate) is commercially available. Compound 5 was prepared according to a published procedure (Weber et al., J. Med. Chem., 1991, 34, 2692).

[0667] Example 3: Preparation of Compound 11

[0668] [ka] Compounds 8 and 9 are commercially available.

[0669] Example 4: Preparation of Compound 18

[0670] [ka] Compound 11 was prepared according to the procedure illustrated in Example 3. Compound 14 is commercially available. Compound 17 was prepared using a similar procedure reported by Rensen et al. (J. Med. Chem., 2004, 47, 5798-5808).

[0671] Example 5: Preparation of Compound 23

[0672] [ka] Compounds 19 and 21 are commercially available.

[0673] Example 6: Preparation of Compound 24

[0674] [ka] Compounds 18 and 23 were prepared according to the procedures illustrated in Examples 4 and 5.

[0675] Example 7: Preparation of Compound 25

[0676] [ka] Compound 24 was prepared according to the procedure illustrated in Example 6.

[0677] Example 8: Preparation of Compound 26

[0678] [ka] Compound 24 is prepared as per the procedure illustrated in Example 6.

[0679] Example 9: General preparation of conjugated ASO containing GalNAc3-1 at the 3' end (compound 29)

[0680] [ka]

[0681] [ka] The protected GalNAc3-1 has the following structure:

[0682] [ka] Conjugated group GalNAc3-1 (GalNAc3-1 a The GalNAc3 cluster portion of GalNAc3-1 can be combined with any cleavable moiety to provide a variety of conjugate groups. a has the following formula:

[0683] [ka]

[0684] Protected GalNAc3-1 (compound 25) bound to a solid support was prepared as illustrated in Example 7. Oligomeric compound 29 containing GalNAc3-1 at the 3' end was prepared using standard procedures for automated DNA / RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). Phosphoramidite building blocks (compounds 1 and 1a) were prepared as illustrated in Example 1. The illustrated phosphoramidites are representative and not intended to be limiting, as other phosphoramidite building blocks can be used to prepare oligomeric compounds with defined sequences and compositions. The order and amounts of phosphoramidites added to the solid support can be adjusted to prepare the gapped oligomeric compounds described herein. Such gapped oligomeric compounds can have defined compositions and base sequences dictated by any given target.

[0685] Example 10: General preparation of conjugated ASO containing GalNAc3-1 at the 5' end (compound 34)

[0686] [ka] Unylinker™ 30 is commercially available. Oligomeric compound 34 containing a GalNAc3-1 cluster at the 5' end is prepared using standard procedures for automated DNA / RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). Phosphoramidite building blocks (compounds 1 and 1a) were prepared as illustrated in Example 1. Other phosphoramidites were prepared as described in Example 1. The illustrated phosphoramidites are representative and not intended to be limiting, as oligomeric compounds with predetermined sequences and compositions can be prepared using phosphoramidite building blocks. The order and amounts of phosphoramidites added to the solid support can be adjusted to prepare gapped oligomeric compounds described herein. Such gapped oligomeric compounds can have predetermined compositions and base sequences determined by any given target.

[0687] Example 11: Preparation of Compound 39

[0688] [ka]

[0689] [ka] Compounds 4, 13, and 23 were prepared according to the procedures illustrated in Examples 2, 4, and 5. Compound 35 was prepared using a similar procedure published in Rouchaud et al., Eur. J. Org. Chem., 2011, 12, 2346-2353.

[0690] Example 12: Preparation of Compound 40

[0691] [ka] Compound 38 is prepared as per the procedure illustrated in Example 11.

[0692] Example 13: Preparation of Compound 44

[0693] [ka]

[0694] [ka] Compounds 23 and 36 are prepared according to the procedures illustrated in Examples 5 and 11. Compound 41 is prepared using a similar procedure published in WO2009082607.

[0695] Example 14: Preparation of Compound 45

[0696] [ka] Compound 43 is prepared as per the procedure illustrated in Example 13.

[0697] Example 15: Preparation of Compound 47

[0698] [ka] Compound 46 is commercially available.

[0699] Example 16: Preparation of Compound 53

[0700] [ka] Compounds 48 and 49 are commercially available. Compounds 17 and 47 are prepared according to the procedures illustrated in Examples 4 and 15.

[0701] Example 17: Preparation of Compound 54

[0702] [ka] Compound 53 is prepared as per the procedure illustrated in Example 16.

[0703] Example 18: Preparation of Compound 55

[0704] [ka] Compound 53 is prepared as per the procedure illustrated in Example 16.

[0705] Example 19: General method for the preparation of conjugated ASOs containing GalNAc3-1 at the 3' position by solid phase techniques (preparation of ISIS 647535, 647536, and 651900) Unless otherwise specified, all reagents and solutions used in the synthesis of oligomeric compounds are purchased from commercial sources. Standard phosphoramidite building blocks and solid supports are available from, for example, T, A, G, and m A 0.1 M solution of phosphoramidite in anhydrous acetonitrile was used to incorporate bD-2'-deoxyribonucleic acid nucleoside residues, including C residues. Used for bonucleosides and 2'-MOE.

[0706] ASO synthesis was performed on an ABI 394 synthesizer (1-2 μmol scale) or a GE Healthcare Bioscience AKTA Oligo Pilot Synthesizer (40-200 μmol scale) by phosphoramidite coupling on a column-packed GalNAc3-1-loaded VIMAD solid support (110 μmol / g, Guzaev et al., 2003). For this coupling step, a four-fold amount of phosphoramidite was delivered relative to the load on the solid support, and phosphoramidite condensation was carried out for 10 min. All other steps followed the standard protocol provided by the manufacturer. The dimethyltrityl (DMT) group was removed from the 5'-hydroxyl group of the nucleotide using a 6% dichloroacetic acid solution in toluene. During the coupling step, 4,5-dicyanoimidazole (0.7 M) in anhydrous CH3CN was used as the activating agent. Phosphorothioate linkages were introduced by sulfurization with a 0.1 M solution of xanthan hydride in 1:1 pyridine / CH3CN for a contact time of 3 minutes. Phosphodiester internucleoside linkages were obtained using a solution of 20% tert-butyl hydroperoxide in CH3CN containing 6% water as the oxidizing agent for a contact time of 12 minutes.

[0707] After the desired sequence was assembled, the cyanoethylphosphate protecting groups were deprotected using a 1:1 (v / v) mixture of triethylamine and acetonitrile with a contact time of 45 min. The solid support-bound ASO was suspended in aqueous ammonia (28–30 wt%) and heated at 55 °C for 6 h.

[0708] The unbound ASO was then filtered, and the ammonia was boiled off. The residue was purified by high-pressure liquid chromatography on a strong anion-exchange column (GE Healthcare Bioscience, Source 30Q, 30 μm, 2.54 × 8 cm, A = 100 mM ammonium acetate in 30% aqueous CH3CN, B = 1.5 M NaBr in A, 0–40% B after 60 min, flow rate 14 mL / min, λ = 260 nm). The residue was desalted by HPLC on a reverse-phase column to give the desired ASO in isolated yields of 15–30% based on the initial loading on the solid support. The ASO was characterized by ion-pair HPLC / MS analysis using an Agilent 1100 MSD system.

[0709] Conjugate-free antisense oligonucleotides were synthesized using standard oligonucleotide synthesis procedures well known in the art.

[0710] Using these methods, three distinct antisense compounds were prepared that target ApoC III.As summarized in Table 17 below, each of the three antisense compounds that target ApoC III has the same nucleobase sequence: ISIS 304801 is a 5-10-5MOE gapmer with all phosphorothioate linkages; ISIS 647535 is identical to ISIS 304801 except that GalNAc3-1 is conjugated at its 3' end; and ISIS 647536 is identical to ISIS 647535 except that the specific internucleoside linkage of this compound is a phosphodiester linkage.As further summarized in Table 17, two distinct antisense compounds that target SRB-1 were synthesized. ISIS 440762 was a 2-10-2 cEt gapmer with all phosphorothioate internucleoside linkages, and ISIS 651900 was identical to ISIS 440762 except for the inclusion of GalNAc3-1 at its 3' end.

[0711] [Table 1] The subscript "e" indicates a 2'-MOE modified nucleoside, "d" indicates a β-D-2'-deoxyribonucleoside, "k" indicates a 6'-(S)-CH3 bicyclic nucleoside (e.g., cEt), "s" indicates a phosphorothioate internucleoside linkage (PS), "o" indicates a phosphodiester internucleoside linkage (PO), and "o'" indicates -OP(=O)(OH)-. The superscript "m" indicates 5-methylcytosine. "GalNAc3-1" refers to the conjugate group having the structure shown in Example 9 above. GalNAc3-1 contains a cleavable adenosine that links the ASO to the remainder of the conjugate. a " This nomenclature is used in the tables above to refer to all nucleobase sequences that contain an adenosine that is part of a conjugate. Thus, in the tables above, "A do" can also be omitted to list a sequence ending in "GalNAc3-1." This convention of using the subscript "a" to indicate the portion of the conjugate group lacking a cleavable nucleoside or cleavable moiety is used throughout these embodiments. This portion of the conjugate group lacking a cleavable moiety is referred to herein as a "cluster" or "conjugate cluster" or "GalNAc3 cluster." In certain instances, it is convenient to describe the conjugate group by providing the cluster and the cleavable moiety separately.

[0712] Example 20: Dose-dependent antisense inhibition of human ApoC III in huApoC III transgenic mice ISIS 304801 and ISIS 647535, each of which targets human ApoC III and is described above, were tested separately and demonstrated a dose-dependent increase in human ApoC III. Their ability to inhibit human ApoC III in III transgenic mice was evaluated. process

[0713] Human ApoCIII transgenic mice were maintained on a 12-hour light / dark cycle and fed Teklad laboratory diet ad libitum. Animals were allowed to acclimate for at least 7 days in the research facility before the start of the experiment. ASOs were prepared in PBS and sterilized by filtering through a 0.2 micron filter. For injection, ASOs were dissolved in 0.9% PBS.

[0714] Human ApoC III transgenic mice were intraperitoneally injected weekly for 2 weeks with ISIS 304801 or 647535 at 0.08, 0.25, 0.75, 2.25, or 6.75 μmol / kg, or with PBS as a control. Each treatment group consisted of four animals. 48 hours after administration of the final dose, blood was collected from each mouse, and the mice were sacrificed and tissues were collected. ApoC III mRNA analysis

[0715] ApoC III mRNA levels were determined in mouse livers using real-time PCR and RIBOGREEN® RNA quantification reagent (Molecular Probes, Inc. Eugene, OR) according to standard protocols. ApoC III mRNA levels were determined relative to total RNA (using Ribogreen) before normalizing to PBS-treated controls. Results below are presented as the mean percent ApoC III mRNA levels for each treatment group normalized to PBS-treated controls and are denoted as "%PBS." The median effective concentration (ED) of each ASO was 0.01. 50 ) are also shown in Table 18 below.

[0716] As illustrated, both antisense compounds reduced ApoC III RNA compared to the PBS control. Furthermore, the antisense compound conjugated to GalNAc3-1 (ISIS 647535) was much more potent than the antisense compound lacking the GalNAc3-1 conjugate (ISIS 304801).

[0717] [Table 2]

[0718] ApoC III protein analysis (turbidimetric assay) Plasma ApoC III protein analysis was performed using the procedure reported by Graham et al (Circulation Research), published online ahead of print on March 29, 2013.

[0719] Approximately 100 μL of plasma isolated from mice was analyzed undiluted using an Olympus clinical analyzer and a commercially available turbidimetric ApoC III assay (Kamiya, catalog number KAI-006, Kamiya Biomedical, Seattle, WA). The assay protocol was performed as described by the supplier.

[0720] As shown below in Table 19, both antisense compounds reduced ApoC III protein compared to the PBS control. Furthermore, the antisense compound conjugated to GalNAc3-1 (ISIS 647535) was much more potent than the antisense compound lacking the GalNAc3-1 conjugate (ISIS 304801).

[0721] [Table 3]

[0722] Plasma triglycerides and cholesterol were extracted using the method of Bligh and Dyer (Bligh, E G and Dyer, W J Can. J. Biochem. Physiol. 37:911-917, 1959) (Bligh, E and Dyer, W, Can. J. Biochem. Physiol. 37, 911-917, 1959) (Bligh, E and Dyer, W, Can. J. Biochem. Physiol. 37, 911-917, 1959) and measured using a Beckmann Coulter clinical analyzer and commercially available reagents.

[0723] Triglyceride levels were measured relative to mice injected with PBS and expressed as "% PBS." The results are presented in Table 20. As illustrated, both antisense compounds reduced triglyceride levels. Furthermore, the antisense compound conjugated to GalNAc3-1 (ISIS 647535) was substantially more potent than the antisense compound lacking the GalNAc3-1 conjugate (ISIS 304801).

[0724] [Table 4]

[0725] Plasma samples were analyzed by HPLC to determine the amount of total cholesterol and the amounts of different cholesterol fractions (HDL and LDL). The results are presented in Tables 21 and 22. As illustrated, both antisense compounds reduced total cholesterol levels, lowered LDL, and increased HDL. Furthermore, the antisense compound conjugated to GalNAc3-1 (ISIS 647535) was substantially more potent than the antisense compound lacking the GalNAc3-1 conjugate (ISIS 304801). The increase in HDL levels and the decrease in LDL levels are cardiovascular beneficial effects of antisense inhibition of ApoC III.

[0726] [Table 5]

[0727] [Table 6]

[0728] Pharmacokinetic analysis (PK) The PK of the ASO was also evaluated. Liver and kidney samples were minced and extracted using standard protocols. Samples were analyzed by MSD1 using IP-HPLC-MS. Tissue levels (μg / g) of full-length ISIS 304801 and 647535 were measured, and the results are provided in Table 23. As illustrated, the liver concentrations of the total full-length antisense compound were similar for these two antisense compounds. Thus, while the GalNAc3-1 conjugated antisense compound is more active in the liver (as demonstrated by the RNA and protein data above), it is not present at significantly higher concentrations in the liver. In fact, the calculated EC 50 (provided in Table 23) confirm that the observed increase in potency of the conjugates is not entirely due to increased accumulation. This result suggests that the conjugates improved potency by a mechanism other than liver accumulation alone, possibly by improving productive uptake of the antisense compounds into cells.

[0729] The results also show that the concentration of GalNAc3-1-conjugated antisense compounds in the kidney is lower than that of antisense compounds lacking the GalNAc conjugate. This has several beneficial therapeutic implications. In therapeutic indications where renal activity is not required, exposure to the kidney carries the risk of nephrotoxicity without corresponding benefit. Furthermore, high concentrations in the kidney typically result in compound loss in the urine, resulting in more rapid clearance. Therefore, for non-renal targets, renal accumulation is undesirable. These data suggest that GalNAc3-1 conjugation reduces renal accumulation.

[0730] [Table 7]

[0731] Metabolites of ISIS 647535 were also identified, and their masses were confirmed by high-resolution mass spectrometry. The cleavage sites and structures of the observed metabolites are shown below. Standard procedures were used to calculate the relative percentage of full-length ASO, and the results are presented in Table 23a. The major metabolite of ISIS 647535 was the full-length ASO (i.e., ISIS 304801) lacking all conjugates, resulting from cleavage at cleavage site A shown below. Additionally, additional metabolites derived from other cleavage sites were also observed. These results suggest that the introduction of other cleavable bonds, such as esters, peptides, disulfides, phosphoramidates, or acylhydrazones between the GalNAc3-1 sugar and the ASO, which may be cleaved by intracellular enzymes, cleaved in the reducing environment of the cytosol, or unstable to the acidic pH in endosomes and lysosomes, may also be useful.

[0732] [Table 8]

[0733] [ka]

[0734] [ka]

[0735] Example 21: Antisense inhibition of human ApoC III in human ApoC III transgenic mice in a single-dose study ISIS 304801, 647535, and 647536, each of which targets human ApoC III and are listed in Table 17, were further evaluated for their ability to inhibit human ApoC III in human ApoC III transgenic mice in a single-dose study.

[0736] process Human ApoCIII transgenic mice were maintained on a 12-hour light / dark cycle and fed Teklad laboratory diet ad libitum. Animals were allowed to acclimate for at least 7 days in the research facility before the start of the experiment. ASOs were prepared in PBS and filter-sterilized through a 0.2 micron filter. For injection, ASOs were dissolved in 0.9% PBS.

[0737] Human ApoC III transgenic mice were intraperitoneally injected once with ISIS 304801, 647535, or 647536 (as described above), or a PBS-treated control, at the doses indicated below. Treatment groups consisted of three animals, and the control group consisted of four animals. Blood was collected from each mouse before treatment and after the final dose, and plasma samples were analyzed. Mice were sacrificed 72 hours after the final dose.

[0738] Samples were collected and analyzed to determine ApoC III mRNA and protein levels in the liver, plasma triglycerides, and cholesterol, including HDL and LDL fractions, and were assessed as described above (Example 20). Data from these analyses are presented in Tables 24-28 below. Serum liver transaminase levels, i.e., alanine aminotransferase (ALT) and aspartate aminotransferase (AST), were measured relative to saline-injected mice using standard protocols. ALT and AST levels indicated that the antisense compound was well tolerated at all doses.

[0739] These results demonstrate improved potency of antisense compounds containing a GalNAc3-1 conjugate at the 3' end (ISIS 647535 and 647536) compared with an antisense compound lacking the GalNAc3-1 conjugate (ISIS 304801). Furthermore, ISIS 647536, which contains a GalNAc3-1 conjugate and several phosphodiester linkages, is as potent as ISIS 647535, which contains the same conjugates, but all internucleoside linkages within the ASO are phosphorothioate linkages.

[0740] [Table 9]

[0741] [Table 10]

[0742] [Table 11]

[0743] [Table 12]

[0744] [Table 13]

[0745] These results confirm that GalNAc3-1 conjugates improve the potency of antisense compounds. These results also demonstrate comparable potency of GalNAc3-1 conjugated antisense compounds, which have hybrid linkages (ISIS 647536, which has six phosphodiester linkages) and a fully phosphorothioate version of the same antisense compound (ISIS 647535).

[0746] Phosphorothioate linkages provide several properties to antisense compounds. For example, they resist nuclease digestion, bind to proteins, and lead to accumulation of the compound in the liver rather than the kidneys / urine. These are particularly desirable properties when treating liver indications. However, phosphorothioate linkages are also associated with inflammatory responses. Therefore, reducing the number of phosphorothioate linkages in a compound may reduce the risk of inflammation, but it also reduces the concentration of the compound in the liver, increases its concentration in the kidneys and urine, reduces stability in the presence of nucleases, and reduces overall potency. These results indicate that GalNAc3-1-conjugated antisense compounds in which certain phosphorothioate linkages are replaced with phosphodiester linkages are as potent against liver targets as their counterparts with intact phosphorothioate linkages. Such compounds are also likely to be less proinflammatory (see Example 24, which describes an experiment demonstrating that reducing PS results in reduced inflammatory effects).

[0747] Example 22: Effects of GalNAc3-1 conjugate-modified ASO targeting SRB-1 in vivo ISIS 440762 and 651900, which each target SRB-1 and are listed in Table 17, were evaluated for their ability to inhibit SRB-1 in Balb / c mice in a dose-dependent study.

[0748] process Six-week-old male Balb / c mice (Jackson Laboratory, Bar Harbor, ME) were subcutaneously injected once with ISIS 440762, 651900, or a PBS-treated control at the doses indicated below. Each treatment group consisted of four animals. Forty-eight hours after the final dose, mice were sacrificed, and SRB-1 mRNA levels in the liver were determined using real-time PCR and RIBOGREEN® RNA quantification reagent (Molecular Probes, Inc. Eugene, OR) according to standard protocols. SRB-1 mRNA levels were determined relative to total RNA (using Ribogreen) before normalization to the PBS-treated control. The results below are presented as the average percentage of SRB-1 mRNA levels for each treatment group normalized to the PBS-treated control and are denoted as "%PBS."

[0749] As illustrated in Table 29, both antisense compounds reduced SRB-1 mRNA levels. Furthermore, the antisense compound containing the GalNAc3-1 conjugate (ISIS 651900) was much more potent than the antisense compound lacking the GalNAc3-1 conjugate (ISIS 440762). These results demonstrate that the potency benefit of the GalNAc3-1 conjugate can be observed using antisense oligonucleotides complementary to different targets and bearing different chemically modified nucleosides; in this case, the modified nucleosides contain a constrained ethyl sugar moiety (bicyclic sugar moiety).

[0750] [Table 14]

[0751] Example 23: Human peripheral blood mononuclear cell (hPBMC) assay protocol The hPBMC assay was performed using the BD Vacutainer CPT tube method. Whole blood samples were obtained from volunteer donors who provided informed consent at the US HealthWorks clinic (Faraday & El Camino Real, Carlsbad) and collected into four to fifteen BD Vacutainer CPT 8 mL tubes (VWR catalog number BD362753). The PBMC assay data sheet was used to record the approximate starting total whole blood volume in each donor's CPT tube.

[0752] Immediately prior to centrifugation, the blood sample was mixed again by gently inverting the tube 8-10 times. The CPT tubes were centrifuged at 1500-1800 RCF (2700 RPM, Beckman Allegra 6R) in a horizontal (swing-out) rotor at room temperature (18-25°C) for 30 minutes with the brake off. Cells were collected from the buffy coat interface (between the Ficoll and polymer gel layers) and transferred to a sterile 50 mL conical tube, pooling up to five CPT tubes / 50 mL conical tubes / donor. The cells were then resuspended in PBS (Ca). ++ , Mg ++The tubes were filled to a maximum of 50 mL and mixed by inverting several times. The samples were then centrifuged at 330 × g (1215 RPM, Beckman Allegra 6R) for 15 minutes at room temperature, and as much of the supernatant as possible was aspirated without disturbing the pellet. The tubes were gently spun to remove the cell pellet, and the cells were resuspended in RPMI + 10% FBS + pen / strep (approximately 1 mL per 10 mL starting whole blood volume). 60 μL of the sample was pipetted into a sample vial (Beckman Coulter) containing 600 μL of VersaLyse reagent (Beckman Coulter, catalog number A09777) and gently vortexed for 10–15 seconds. The samples were incubated at room temperature for 10 minutes and mixed again before counting. The cell suspension was counted in a Vicell XR cell viability analyzer (Beckman Coulter) using the PBMC cell type (a dilution factor of 1:11 was kept along with other parameters). Viable cells / mL and viability were recorded. The cell suspension was diluted to 1 x 10 in RPMI + 10% FBS + pen / strep. 7 Diluted to live PBMC / mL.

[0753] Cells were plated in 50 μL of 96-well tissue culture plates (Falcon Microtest). 5 x 10 per well 5 Plated at 1000 x g for 24 h. 50 μL / well of 2x concentrated oligos / controls diluted in RPMI + 10% FBS + pen / strep was added according to the experimental template (total 100 μL / well). Plates were placed on a shaker and allowed to mix for approximately 1 minute. After 24 hours of incubation at 37°C, 5% CO2, plates were centrifuged at 400 x g for 10 minutes, after which the supernatant was removed for MSD cytokine assays (i.e., human IL-6, IL-10, IL-8, and MCP-1).

[0754] Example 24: Evaluation of the pro-inflammatory effects of GalNAc3-1-conjugated ASOs in an hPBMC assay The antisense oligonucleotides (ASOs) listed in Table 30 were evaluated for pro-inflammatory effects in the hPBMC assay using the protocol described in Example 23. ISIS 353512 is an internal standard known to be a high responder for IL-6 release in this assay. hPBMCs were isolated from fresh volunteer donors and treated with ASOs at concentrations of 0, 0.0128, 0.064, 0.32, 1.6, 8, 40, and 200 μM. Cytokine levels were measured 24 hours after treatment.

[0755] IL-6 levels were used as the primary readout. EC 50 and E max The results were compared between the two donors. max / EC 50 It is expressed as the average ratio of max / EC 50 A lower ratio indicates a relative decrease in the pro-inflammatory response, and a higher ratio indicates a relative increase in the pro-inflammatory response.

[0756] Of the tested compounds, the least proinflammatory compound was the PS / PO-linked ASO (ISIS 616468). The GalNAc3-1-conjugated ASO (ISIS 647535) was slightly less proinflammatory than its unconjugated counterpart (ISIS 304801). These results indicate that the incorporation of some PO linkages reduces the proinflammatory response, and that the addition of GalNAc3-1 conjugates does not increase the proinflammatory potential of the compound, but may reduce the proinflammatory response. Therefore, it would be expected that antisense compounds containing both hybrid PS / PO linkages and GalNAc3-1 conjugates would result in a lower proinflammatory response compared to fully PS-linked antisense compounds (with or without GalNAc3-1 conjugates). These results support the conclusion that GalNAc 3- 1 conjugated antisense compounds, especially those with reduced PS content, are less pro-inflammatory.

[0757] Taken together, these results suggest that GalNAc3-1 conjugate compounds, especially those with reduced PS content, can be administered at higher doses than their fully PS-containing counterparts, antisense compounds lacking the GalNAc3-1 conjugate. Because the half-lives of these compounds are not expected to differ substantially, such higher doses would result in less frequent dosing. In fact, the GalNAc3-1 conjugate compounds have higher potency (see Examples 20-22), and re-dosing would be required when the compound concentration falls below a desired level, which would be based on potency, making such dosing even less frequent.

[0758] [Table 15] The subscript "e" indicates a 2'-MOE modified nucleoside, "d" indicates a β-D-2'-deoxyribonucleoside, "k" indicates a 6'-(S)-CH3 bicyclic nucleoside (e.g., cEt), "s" indicates a phosphorothioate internucleoside linkage (PS), "o" indicates a phosphodiester internucleoside linkage (PO), and "o'" indicates -OP(=O)(OH)-. The superscript "m" indicates 5-methylcytosine. "A do’ -GalNAc3-1 a " indicates a conjugate having the structure GalNAc3-1 shown in Example 9 attached to the 3' end of an antisense oligonucleotide as shown.

[0759] [Table 16]

[0760] Example 25: Effects of GalNAc3-1 conjugated modified ASO targeting human ApoC III in vitro ISIS 304801 and 647535 were tested in vitro. Primary hepatocytes from transgenic mice at a density of 25,000 cells / well were treated with modified oligonucleotides at concentrations of 0.03, 0.08, 0.24, 0.74, 2.22, 6.67, and 20 μM. After a treatment period of approximately 16 hours, RNA was isolated from the cells, and mRNA levels were measured by quantitative real-time PCR. hApoC III mRNA levels were adjusted according to total RNA content measured by RIBOGREEN.

[0761] IC using standard methods 50 was calculated and the results are presented in Table 32. As illustrated, similar titers were observed in cells treated with ISIS 647535 compared to the control ISIS 304801.

[0762] [Table 17]

[0763] In this experiment, the large potency benefit of GalNAc3-1 conjugation observed in vivo was not observed in vitro. Subsequent free uptake experiments in primary hepatocytes in vitro demonstrated increased potency of oligonucleotides containing various GalNAc conjugates compared to oligonucleotides lacking the GalNAc conjugate (see Examples 60, 82, and 92).

[0764] Example 26: Effect of the PO / PS junction on ApoC III ASO activity Human ApoC III transgenic mice were intraperitoneally injected with ISIS 304801 or ISIS 616468 (both as described above) or a PBS-treated control at 25 mg / kg once weekly for 2 weeks. Treatment groups consisted of three animals, and the control group consisted of four animals. Blood was collected from each mouse before treatment and after the final dose, and plasma samples were analyzed. Mice were sacrificed 72 hours after the final dose.

[0765] Samples were collected and analyzed to determine ApoC III protein levels in the liver as described above (Example 20). Data from these analyses are presented in Table 33 below.

[0766] These results show a decrease in potency of the antisense compound with PO / PS in the wings (ISIS 616468) compared to the intact PS (ISIS 304801).

[0767] [Table 18]

[0768] Example 27: Compound 56

[0769] [ka] Compound 56 is commercially available from Glen Research or can be prepared according to the published procedure reported by Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454.

[0770] Example 28: Preparation of Compound 60

[0771] [ka] Compound 4 was prepared according to the procedure illustrated in Example 2. Compound 57 is commercially available. Compound 60 was confirmed by structural analysis.

[0772] Compound 57 is representative and not intended to be limiting, as phosphoramidites of defined compositions can be prepared using other monoprotected substituted or unsubstituted alkyl diols, including but not limited to those presented herein.

[0773] Example 29: Preparation of Compound 63

[0774] [ka] Compounds 61 and 62 are prepared using procedures similar to those reported by Tober et al., Eur. J. Org. Chem., 2013, 3, 566-577, and Jiang et al., Tetrahedron, 2007, 63(19), 3982-3988.

[0775] Alternatively, compound 63 is prepared using procedures similar to those reported in the scientific and patent literature by Kim et al. (Synlett, 2003, 12, 1838-1840, and published PCT International Application WO2004063208 to Kim et al.).

[0776] Example 30: Preparation of Compound 63b

[0777] [ka] Compound 63a is prepared using a procedure similar to that reported by Hanessian et al., Canadian Journal of Chemistry, 1996, 74(9), 1731-1737.

[0778] Example 31: Preparation of Compound 63d

[0779] [ka] Compound 63c is prepared using a procedure similar to that reported by Chen et al., Chinese Chemical Letters, 1998, 9(5), 451-453.

[0780] Example 32: Preparation of Compound 67

[0781] [ka] Compound 64 was prepared according to the procedure illustrated in Example 2. Compound 65 was prepared according to the procedure described in Or et al. 65 is prepared using procedures similar to those reported by JP-A-2009-003009, published PCT International Application No. WO2009003009. The protecting groups used in compound 65 are representative and not intended to be limiting, as other protecting groups can be used, including but not limited to those presented herein.

[0782] Example 33: Preparation of Compound 70

[0783] [ka] Compound 64 was prepared according to the procedure illustrated in Example 2. Compound 68 is commercially available. The protecting groups used in compound 68 are representative and not intended to be limiting, as other protecting groups can be used, including but not limited to those presented herein.

[0784] Example 34: Preparation of Compound 75a

[0785] [ka] Compound 75 is prepared according to the published procedure reported by Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454.

[0786] Example 35: Preparation of Compound 79

[0787] [ka] Compound 76 was prepared according to the published procedure reported by Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454.

[0788] Example 36: Preparation of Compound 79a

[0789] [ka] Compound 77 is prepared as per the procedure illustrated in Example 35.

[0790] Example 37: General method for the preparation of conjugated oligomeric compound 82 containing a phosphodiester-linked GalNAc3-2 conjugate at the 5' end on a solid support (Method I)

[0791] [ka]

[0792] [ka] GalNAc3-2 has the following structure:

[0793] [ka] Conjugated group GalNAc3-2 (GalNAc3-2 a The GalNAc3 cluster portion of GalNAc3-2 can be combined with any cleavable moiety to provide a variety of conjugate groups. a has the following formula:

[0794] [ka]

[0795] VIMAD-linked oligomeric compound 79b was prepared using standard procedures for automated DNA / RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). Phosphoramidite compounds 56 and 60 were prepared according to the procedures illustrated in Examples 27 and 28, respectively. Other phosphoramidite building blocks, such as, but not limited to, those provided herein, may also be used. The illustrated phosphoramidites are representative and not intended to be limiting, as those shown can be used to prepare oligomeric compounds having phosphodiester-linked conjugate groups at the 5' termini. The order and amounts of phosphoramidites added to the solid support can be adjusted to prepare oligomeric compounds described herein with any predetermined sequence and composition.

[0796] Example 38: Alternative Method for the Preparation of Oligomeric Compound 82 Containing a Phosphodiester-Linked GalNAc3-2 Conjugate at the 5'-Terminus (Method II)

[0797] [ka] VIMAD-linked oligomeric compound 79b was prepared using standard procedures for automated DNA / RNA synthesis (see Dupouy et al., Angew. Chem. Int. Ed., 2006, 45, 3623-3627). GalNAc3-2 cluster phosphoramidite (compound 79) was prepared as illustrated in Example 35. This alternative method allows for the one-step introduction of a phosphodiester-linked GalNAc3-2 conjugate into an oligomeric compound at the final step of synthesis. The exemplified phosphoramidite building blocks, including but not limited to those presented herein, can be used to prepare oligomeric compounds with phosphodiester conjugates at the 5'-terminus. The phosphoramidites are representative and not intended to be limiting. The order and amounts of phosphoramidites added to the solid support can be adjusted to prepare oligomeric compounds described herein with any predetermined sequence and composition.

[0798] Example 39: General method for the preparation of oligomeric compound 83h containing a GalNAc3-3 conjugate at the 5' end (GalNAc3-1 modified for 5' end attachment) on solid support

[0799] [ka]

[0800] [ka] Compound 18 was prepared according to the procedure illustrated in Example 4. Compounds 83a and 83b are commercially available. Oligomeric compound 83e containing a phosphodiester-linked hexylamine was prepared using standard oligonucleotide synthesis procedures. Treatment of the protected oligomeric compound with aqueous ammonia provided 5'-GalNAc3-3 conjugated oligomeric compound (83h).

[0801] GalNAc3-3 has the following structure:

[0802] [ka]

[0803] Conjugated group GalNAc3-3 (GalNAc3-3 a The GalNAc3 cluster portion of GalNAc3-3 can be combined with any cleavable moiety to provide a variety of conjugate groups. a has the following formula:

[0804] [ka]

[0805] Example 40: General method for the preparation of oligomeric compound 89 containing a phosphodiester-linked GalNAc3-4 conjugate at the 3' terminus on solid support

[0806] [ka]

[0807] [ka] GalNAc3-4 has the following structure:

[0808] [ka] wherein CM is a cleavable moiety. In certain embodiments, the cleavable moiety is:

[0809] [ka] Conjugated group GalNAc3-4 (GalNAc3-4 a The GalNAc3 cluster portion of GalNAc3-4 can be combined with any cleavable moiety to provide a variety of conjugate groups. a has the following formula:

[0810] [ka]

[0811] The protected Unylinker-functionalized solid support compound 30 is commercially available. Compound 84 is prepared using a procedure similar to that reported in the literature (see Shchepinov et al., Nucleic Acids Research, 1997, 25(22), 4447-4454; Shchepinov et al., Nucleic Acids Research, 1999, 27, 3035-3041; and Hornet et al., Nucleic Acids Research, 1997, 25, 4842-4849).

[0812] Phosphoramidite building blocks (compounds 60 and 79a) are prepared as illustrated in Examples 28 and 36. The illustrated phosphoramidites are representative and not intended to be limiting, as other phosphoramidite building blocks can be used to prepare oligomeric compounds having phosphodiester-linked conjugates at the 3' terminus with defined sequences and compositions. The order and amounts of phosphoramidites added to the solid support can be adjusted to prepare oligomeric compounds described herein with any defined sequence and composition.

[0813] Example 41: General method for the preparation of ASOs containing a phosphodiester-linked GalNAc3-2 (see Example 37 where Bx is adenine) conjugate at the 5' position by solid-phase techniques (preparation of ISIS 661134) Unless otherwise specified, all reagents and solutions used in the synthesis of oligomeric compounds are purchased from commercial sources. Standard phosphoramidite building blocks and solid supports are available from, for example, T, A, G, and m Used for the incorporation of nucleoside residues, including C residues. 5'-terminal phosphodiester-linked GalNAc3-2 conjugates were synthesized using phosphoramidite compounds 56 and 60. 0.1 M solutions of phosphoramidites in anhydrous acetonitrile were used for bD-2'-deoxyribonucleosides and 2'-MOE.

[0814] The column was packed with VIMAD solid support (110 μmol / g, Guzaev et al. ASO synthesis was performed on an ABI 394 synthesizer (1–2 μmol scale) or a GE Healthcare Bioscience AKTA Oligo Pilot Synthesizer (40–200 μmol scale) using the phosphoramidite coupling method (see [link missing]). For this coupling step, a 4-fold excess of phosphoramidite was delivered relative to the initial loading of the solid support, and phosphoramidite coupling was carried out for 10 min. All other steps followed the standard protocol provided by the manufacturer. The dimethoxytrityl (DMT) group was removed from the 5'-hydroxyl group of the nucleotide using a 6% dichloroacetic acid solution in toluene. During the coupling step, 4,5-dicyanoimidazole (0.7 M) in anhydrous CH3CN was used as the activating agent. Phosphorothioate linkages were introduced by sulfurization with a 0.1 M solution of xanthan hydride in 1:1 pyridine / CH3CN for a contact time of 3 min. A solution of 20% tert-butyl hydroperoxide in CH3CN containing 6% water was used as the oxidizing agent with a contact time of 12 minutes to provide phosphodiester internucleoside linkages.

[0815] After the desired sequence was assembled, the cyanoethyl phosphate protecting group was deprotected using 20% ​​diethylamine in toluene (v / v) with a contact time of 45 min. The solid support-bound ASO was suspended in aqueous ammonia (28–30 wt%) and heated at 55 °C for 6 h. The unbound ASO was then filtered, and the ammonia was boiled off. The residue was purified by high-pressure liquid chromatography on a strong anion-exchange column (GE Healthcare Bioscience, Source 30Q, 30 μm, 2.54 × 8 cm, A = 100 mM ammonium acetate in 30% aqueous CH3CN, B = 1.5 M NaBr in A, 0–40% B after 60 min, flow rate 14 mL / min, λ = 260 nm). The residue was desalted by HPLC on a reverse-phase column to give the desired ASO in isolated yields of 15–30% based on the initial loading on the solid support. ASOs were characterized by ion-pair HPLC / MS analysis using an Agilent 1100 MSD system.

[0816] [Table 19] The subscript "e" indicates a 2'-MOE modified nucleoside, "d" indicates a β-D-2'-deoxyribonucleoside, "k" indicates a 6'-(S)-CH3 bicyclic nucleoside (e.g., cEt), "s" indicates a phosphorothioate internucleoside linkage (PS), "o" indicates a phosphodiester internucleoside linkage (PO), and "o'" indicates -OP(=O)(OH)-. The superscript "m" indicates 5-methylcytosine. GalNAc3-2 a The structure is shown in Example 37.

[0817] Example 42: General method for the preparation of ASOs containing GalNAc3-3 conjugates at the 5' position by solid phase techniques (preparation of ISIS 661166) The synthesis of ISIS 661166 was carried out using procedures similar to those illustrated in Examples 39 and 41.

[0818] ISIS 661166 is a 5-10-5MOE gapmer containing a GalNAc3-3 conjugate at the 5' position. The ASO was characterized by ion-pair HPLC / MS analysis using an Agilent 1100 MSD system.

[0819] [Table 20] The subscript "e" indicates a 2'-MOE modified nucleoside, "d" indicates a β-D-2'-deoxyribonucleoside, "s" indicates a phosphorothioate internucleoside linkage (PS), "o" indicates a phosphodiester internucleoside linkage (PO), and "o'" indicates -OP(=O)(OH)-. The superscript "m" indicates 5-methylcytosine. The structure of "5'-GalNAc3-3a" is shown in Example 39.

[0820] Example 43: Dose-dependent study of phosphodiester-linked GalNAc3-2 at the 5' end targeting SRB-1 in vivo (see Examples 37 and 41 where Bx is adenine) ISIS 661134, which contains a phosphodiester-linked GalNAc3-2 conjugate at the 5' end (see Example 41), was tested for antisense inhibition of SRB-1 in mice in a dose-dependent study. Unconjugated ISIS 440762 and 651900 (GalNAc3-1 conjugates at the 3' end, see Example 9) were included in the study for comparison and are listed in Table 17 above.

[0821] process Six-week-old male Balb / c mice (Jackson Laboratory, Bar Harbor, ME) were subcutaneously injected once with ISIS 440762, 651900, 661134, or a PBS-treated control at the doses indicated below. Each treatment group consisted of four animals. Seventy-two hours after the final dose, mice were sacrificed, and SRB-1 mRNA levels in the liver were determined using real-time PCR and RIBOGREEN® RNA quantification reagent (Molecular Probes, Inc. Eugene, OR) according to standard protocols. SRB-1 mRNA levels were determined relative to total RNA (using Ribogreen) before normalizing to the PBS-treated control. The results below are presented as the average percent SRB-1 mRNA levels for each treatment group normalized to the PBS-treated control and are denoted as "%PBS." ED was performed using a similar method. 50 were measured and are presented below.

[0822] As illustrated in Table 35, treatment with antisense oligonucleotides reduced SRB-1 mRNA levels in a dose-dependent manner. Indeed, antisense oligonucleotides containing a phosphodiester-linked GalNAc3-2 conjugate at the 5' end (ISIS 661134) or a GalNAc3-1 conjugate at the 3' end (ISIS 651900) showed significantly improved potency compared with unconjugated antisense oligonucleotides (ISIS 440762). Furthermore, ISIS 661134, which contains a phosphodiester-linked GalNAc3-2 conjugate at the 5' end, was equipotent compared with ISIS 651900, which contains a GalNAc3-1 conjugate at the 3' end.

[0823] [Table 21] The structures of 3'GalNAc3-1 and 5'GalNAc3-2 are described in Examples 9 and 37 above.

[0824] Pharmacokinetic analysis (PK) The PK of the ASOs at the high dose (7 mg / kg) was investigated and evaluated using a method identical to that described in Example 20. Liver samples were dissected and extracted using standard protocols. Full-length metabolites of ISIS 661134 (5'GalNAc3-2) and ISIS 651900 (3'GalNAc3-1) were identified, and their masses were confirmed by high-resolution mass spectrometry. Results indicated that the major metabolite detected for the ASO containing a phosphodiester-linked GalNAc3-2 conjugate at the 5' end (ISIS 661134) was ISIS 440762 (data not shown). No additional metabolites were observed at detectable levels. Unlike its counterpart, additional metabolites similar to those reported in Table 23a above were observed for the ASO containing a GalNAc3-1 conjugate at the 3' end (ISIS 651900). These results suggest that having phosphodiester-linked GalNAc3-1 or GalNAc3-2 conjugates may improve the PK profile of ASOs without compromising their potency.

[0825] Example 44: Effect of the PO / PS linkage on antisense inhibition of ASOs containing a GalNAc3-1 conjugate at the 3' end (see Example 9) targeting SRB-1 ISIS 655861 and 655862, each containing a GalNAc3-1 conjugate at the 3' end, targeting SRB-1, were tested for their ability to inhibit SRB-1 in mice in a single-dose study. The parent unconjugated compound, ISIS 353382, was included for comparison.

[0826] The ASOs are 5-10-5 MOE gapmers, with the gap region containing 10 2'-deoxyribonucleosides and each wing region containing 5 2'-MOE modified nucleosides. The ASOs were prepared using methods similar to those illustrated in Example 19 above and are shown in Table 36 below.

[0827] [Table 22] The subscript "e" indicates a 2'-MOE modified nucleoside, "d" indicates a β-D-2'-deoxyribonucleoside, "s" indicates a phosphorothioate internucleoside linkage (PS), "o" indicates a phosphodiester internucleoside linkage (PO), and "o'" indicates -OP(=O)(OH)-. The superscript "m" indicates 5-methylcytosine. The structure of "GalNAc3-1" is shown in Example 9. process

[0828] Six-week-old male Balb / c mice (Jackson Laboratory, Bar Harbor, ME) were subcutaneously injected once with ISIS 353382, 655861, 655862, or a PBS-treated control at the doses indicated below. Each treatment group consisted of four animals. Blood was collected from each mouse before treatment and after the final dose, and plasma samples were analyzed. 72 hours after the final dose, mice were sacrificed, and SRB-1 mRNA levels in the liver were determined using real-time PCR and RIBOGREEN® RNA quantification reagent (Molecular Probes, Inc. Eugene, OR). SRB-1 mRNA levels were determined relative to total RNA (using Ribogreen) before normalizing to the PBS-treated control. The results below are presented as the average percent SRB-1 mRNA levels for each treatment group normalized to the PBS-treated control and are denoted as "%PBS." ED was performed using a similar method. 50 are measured and reported below.

[0829] As illustrated in Table 37, treatment with antisense oligonucleotides reduced SRB-1 mRNA levels in a dose-dependent manner compared to PBS-treated controls. Indeed, antisense oligonucleotides containing a GalNAc3-1 conjugate at the 3' end (ISIS 655861 and 655862) showed significantly improved potency compared to the unconjugated antisense oligonucleotide (ISIS 353382). Furthermore, ISIS 655862, which contains a hybrid PS / PO linkage, showed improved potency compared to the full PS (ISIS 655861).

[0830] [Table 23]

[0831] Serum liver transaminase levels, i.e., alanine aminotransferase (ALT) and aspartate aminotransferase (AST), were measured relative to saline-injected mice using standard protocols. Organ weights were also assessed. Results showed that no increase in transaminase levels (Table 38) or organ weights (data not shown) was observed in ASO-treated mice compared with PBS contro...

Claims

1. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of the nucleobase sequences of SEQ ID NOs: 30-2226.

2. 1. A compound comprising: a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of SEQ ID NO:

570.

3. 1. A compound comprising: a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of SEQ ID NO:

705.

4. 1. A compound comprising: a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of SEQ ID NO:1666.

5. A compound comprising a modified oligonucleotide and a conjugate group, said modified oligonucleotide consisting of 20 linked nucleosides and having the nucleobase sequence of SEQ ID NO:

570.

6. A compound comprising a modified oligonucleotide and a conjugate group, said modified oligonucleotide consisting of 20 linked nucleosides and having a nucleobase sequence of SEQ ID NO:

705.

7. A compound comprising a modified oligonucleotide and a conjugate group, said modified oligonucleotide consisting of 16 linked nucleosides and having the nucleobase sequence of SEQ ID NO:1666.

8. modified oligonucleotides and conjugate groups, wherein the modified oligonucleotides consist of 12 to 30 linked nucleosides, and 391, 399, 411, 412, 414, 416, 444, 446-449, 452, 453, 454, 459, 460, 462-472, 473, 476, 477, 479, 480, 481, 484, 489-495, 497, 500, 504, 506, 522, 526, 535, 558, 559, 560, 564, 566, 568-571, 573, 576, 577, 578, 587, 595, 597-604, 607, 608, 610, 613, 615, 618, 619, 622, 623, 624, 633, 635, 636, 638, 639, 640, 642, 643, 645, 652, 655-658, 660, 661, 670, 674-679, 684, 685, 698, 704, 705, 707, 708, 713, 716, 717, 728, 734, 736, 767, 768, 776, 797, 798, 800, 802, 810, 815, 876, 880, 882, 883, 886, 891, 901-905, 908- 911, 922, 923, 924, 931, 942, 950-957, 972, 974, 978, 979, 980, 987-991, 1005, 1017-1021, 1025, 1026, 1029, 1030, 1032, 1034, 1035, 1037, 1040, 1041, 1045, 1046, 1051, 1054, 1059, 1060, 1061, 1064, 1065, 1066, 1 075, 1076, 1087, 1089, 1111, 1114, 1116, 1117, 1125, 1133, 1153, 1169, 1177, 1181, 1182, 1187, 1196, 1200, 1214, 1222, 1267, 1276, 1277, 1285, 1286, 1289, 1290, 1291, 1303, 1367, 1389, 1393, 1398-1401, 1406, 140 7, 1408, 1411, 1419-1422, 1426, 1430, 1431, 1432, 1434-1437, 1439, 1440, 1443, 1444, 1451, 1452, 1471, 1516, 1527, 1535, 1537, 1538, 1539, 1540, 1541, 1563, 1564, 1567, 1568, 1616, 1617, 1623, 1629, 1664, 1665, A compound having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleobases of any of the nucleobase sequences: 1666, 1679, 1687, 1734, 1804, 1876, 1886, 1915, 2008, 2018, 2100, 2101, 2115, and 2116.

9. The compound of claim 8 , wherein the modified oligonucleotide achieves at least 80% inhibition of PKK mRNA.

10. a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides; 1, 576, 578, 587, 595, 597, 598, 600-604, 607, 610, 613, 618, 619, 624, 635, 638, 639, 645, 652, 656, 657, 658, 660, 674, 675, 676, 684, 698, 704, 705, 707, 713, 716, 768, 876, 880, 901-905, 908-911, 922, 923, 924, 931, 942, 951, 954-957, 972, 974, 978, 979, 987, 988, 9 90, 1005, 1019, 1020, 1021, 1025, 1032, 1037, 1040, 1041, 1045, 1054, 1059, 1060, 1061, 1064, 1065, 1066, 1075, 1111, 1116, 1117, 1125, 1133, 1153, 1169, 1177, 1200, 1222, 1267, 1285, 1290, 1291, 1303, 1367, 1398, 1399, 1401, 1406, 1408, 1411, 1419, 1420, 1421, 1426, 1430, 1431, 1432, 1434-1437, 1440, 1443, 1444, 1451, 1537-1540, 1563, 1616, 1679, 1687, 1804, 2008, 2101, 2115, and 2116.

11. The compound of claim 10 , wherein the modified oligonucleotide achieves at least 85% inhibition of PKK mRNA.

12. modified oligonucleotides and conjugate groups, wherein the modified oligonucleotides consist of 12 to 30 linked nucleosides; 0, 391, 446, 448, 452, 453, 468, 469, 470, 471, 472, 476, 481, 491, 495, 504, 558, 566, 568, 570, 571, 578, 587, 597, 598, 600, 604, 613, 635, 638, 645, 656, 658, 660, 674, 675, 684, 704, 705, 880, 901-905, 909, 922, 931, 951, 954, 956, 990, 1005, 1020, 1032, 1037, 1040, 1041, 1045, 1054, 1075, 11 11, 1125, 1133, 1153, 1200, 1267, 1291, 1303, 1398, 1399, 1401, 1406, 1420, 1426, 1430, 1431, 1434, 1435, 1436, 1440, 1443, 1451, 1537-1540, 2115, and 2116.

13. The compound of claim 12, wherein the modified oligonucleotide achieves at least 90% inhibition of PKK mRNA.

14. 1. A compound comprising: a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 334, 391, 448, 468, 469, 568, 570, 598, 635, 658, 674, 684, 705, 901, 903, 904, 922, 990, 1267, 1291, 1420, 1430, 1431, 1434, 1435, 1436, 1537, 1538, and 1540.

15. The compound of claim 14 , wherein the modified oligonucleotide achieves at least 95% inhibition of PKK mRNA.

16. modified oligonucleotides and conjugate groups, wherein the modified oligonucleotides consist of 12 to 30 linked nucleosides, and 01, 903, 904, 908, 923, 931, 955, 974, 988, 990, 1020, 1039, 1040, 1111, 1117, 1267, 1291, 1349, 1352, 1367, 1389, 1393, 1399, 1401, 1408, 1411, 1426, 1499, 1516, 1535, 1544 , 1548, 1563, 1564, 1568, 1569, 1598, 1616, 1617, 1623, 1624, 1643, 1661, 1665, 1666, 1673, 1679, 1695, 1720, 1804, 1817, 1876, 1881, 1886, 1940, 1947, 2008, 2018, 2019, 2031, 2044, 2100, 2101, 2115, and 2116.

17. The modified oligonucleotide has an IC of 0.4 or less. ５０ (μM).

18. modified oligonucleotides and conjugate groups, wherein the modified oligonucleotides consist of 12 to 30 linked nucleosides; 3, 454, 495, 526, 570, 587, 598, 635, 660, 901, 903, 904, 931, 955, 990, 1020, 1111, 1267, 1349, 1352, 1367, 1389, 1399, 1408, 1411, 1426, 1516, 1535, 1544, 1548, 1563, 1564, 1568, 1569, 1598, 1616, 1617, 1623, 1643, 16 1665, 1666, 1673, 1695, 1804, 1876, 1881, 2019, 2044, 2100, 2101, 2115, and 2116 nucleobase sequences.

19. The modified oligonucleotide has an IC of 0.3 or less ５０ 19. The compound of claim 18, which achieves (μM).

20. modified oligonucleotides and conjugate groups, wherein the modified oligonucleotides consist of 12 to 30 linked nucleosides, and 9, 1598, 1616, 1617, 1665, 1666, 1804, 1876, 1881, 2019, 2044, 2101, and 2116 nucleobase sequences comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the following nucleobase sequences:

21. The modified oligonucleotide has an IC of 0.2 or less. ５０ (μM).

22. 1. A compound comprising: a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 contiguous nucleobases of any of the nucleobase sequences of SEQ ID NOs: 334, 495, 587, 598, 635, 1349, 1352, 1389, 1516, 1544, 1548, 1569, 1598, 1617, 1665, 1666, 1804, 1881, and 2019.

23. The modified oligonucleotide has an IC of 0.2 or less. ５０ (μM).

24. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 27427-27466 of SEQ ID NO:

10.

25. a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and has at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 nucleosides complementary to an equal length portion of nucleobases 33183 to 33242 of SEQ ID NO: 10; A compound comprising a nucleobase sequence comprising consecutive nucleobases.

26. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 30570 to 30610 of SEQ ID NO:

10.

27. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 27427-27521 of SEQ ID NO:

10.

28. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 33085 to 33248 of SEQ ID NO:

10.

29. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 30475 to 30639 of SEQ ID NO:

10.

30. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 27362 to 27525 of SEQ ID NO:

10.

31. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 33101-33241 of SEQ ID NO:

10.

32. 1. A compound comprising a modified oligonucleotide and a conjugate group, wherein said modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases complementary to an equal length portion of nucleobases 30463-30639 of SEQ ID NO:

10.

33. A compound comprising a modified oligonucleotide and a conjugate group, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides and comprises a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases complementary to an equal length portion of exon 9, exon 12, or exon 14 of a PKK nucleic acid.

34. 34. The compound of claims 24-33, wherein the nucleobase sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQ ID NO:

10.

35. 10. A compound according to any preceding claim, consisting of a single-stranded modified oligonucleotide and a conjugate group.

36. 10. A compound according to any preceding claim, wherein at least one internucleoside linkage is a modified internucleoside linkage.

37. 37. The compound of claim 36, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

38. 37. The compound of claim 36, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

39. 37. The compound of claim 36, wherein the modified oligonucleotide comprises at least two phosphodiester internucleoside linkages.

40. 37. The compound of claim 36, wherein the modified oligonucleotide comprises at least three phosphodiester internucleoside linkages.

41. 37. The compound of claim 36, wherein the modified oligonucleotide comprises at least four phosphodiester internucleoside linkages.

42. 37. The compound of claim 36, wherein the modified oligonucleotide comprises at least five phosphointernucleoside linkages.

43. 37. The compound of claim 36, wherein the modified oligonucleotide comprises at least six phosphodiester internucleoside linkages.

44. 37. The compound of claim 36, wherein the modified oligonucleotide comprises at least seven phosphodiester internucleoside linkages.

45. 45. The compound of any one of claims 38 to 44, wherein each internucleoside linkage of the modified oligonucleotide is selected from a phosphodiester linkage and a phosphorothioate internucleoside linkage.

46. 38. The compound of claim 37, wherein each internucleoside linkage is a phosphorothioate linkage.

47. 10. The compound of claim 1, wherein at least one nucleoside comprises a modified nucleobase.

48. 40. The compound of claim 39, wherein the modified nucleobase is 5-methylcytosine.

49. 10. The compound of claim 1, wherein the modified oligonucleotide comprises at least one modified sugar.

50. 50. The compound of claim 49, wherein the modified sugar is a 2' modified sugar, BNA, or THP.

51. 51. The compound of claim 50, wherein the modified sugar is either 2'-O-methoxyethyl, 2'-O-methyl, constrained ethyl, LNA, or 3'-fluoroHNA.

52. 10. The compound of any preceding claim, comprising at least one 2'-O-methoxyethyl nucleoside, 2'-O-methyl nucleoside, constrained ethyl nucleoside, LNA nucleoside, or 3'-fluoro-HNA nucleoside.

53. The modified oligonucleotide a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of five linked nucleosides; a 3' wing segment consisting of five linked nucleosides; 10. The compound of claim 9, comprising: wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment; and each nucleoside of each wing segment comprises a modified sugar.

54. 10. The compound of any preceding claim, wherein the modified oligonucleotide consists of 20 linked nucleosides.

55. 10. The compound of any preceding claim, wherein the modified oligonucleotide consists of 19 linked nucleosides.

56. 10. The compound of any preceding claim, wherein the modified oligonucleotide consists of 18 linked nucleosides.

57. A compound consisting of a conjugate group and a modified oligonucleotide according to the following formula: Tes Ges mCes Aes Aes Gds Tds mCds Tds mCds Tds Tds Gds Gds mCds Aes Aes Aes mCes Ae, A = adenine, mC = 5'-methylcytosine; G = guanine, T = thymine; e=2′-O-methoxymethyl modified nucleoside; d=2′-deoxynucleoside, and s = phosphorothioate internucleoside linkage A compound.

58. Conjugated groups and the following formula: mCes mCes mCes mCes mCes Tds Tds mCds Tds Tds Tds Ads Tds Ads Gds mCes A compound consisting of a modified oligonucleotide according to mCes Aes Ges mCe, A = adenine, mC = 5'-methylcytosine; G = guanine, T = thymine; e=2′-O-methoxymethyl modified nucleoside; d=2′-deoxynucleoside, and s = phosphorothioate internucleoside linkage A compound.

59. A compound consisting of a conjugate group and a modified oligonucleotide according to the following formula: mCes Ges Aks Tds Ads Tds mCds Ads Tds Gds Ads Tds Tds mCks mCks mCe, A = adenine, mC = 5'-methylcytosine; G = guanine, T = thymine; e=2′-O-methoxymethyl modified nucleoside; k = cEt modified nucleoside, d=2′-deoxynucleoside, and s = phosphorothioate internucleoside linkage A compound.

60. A compound comprising a conjugate group and a modified oligonucleotide according to the formula: 【Chemical 1】

61. A compound comprising a conjugate group and a modified oligonucleotide according to the formula: 【Chemistry 2】

62. A compound comprising a conjugate group and a modified oligonucleotide according to the formula: 【Chemistry 3】

63. 63. The compound of any one of claims 1 to 62, wherein the conjugate group is linked to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

64. 63. The compound of any one of claims 1 to 62, wherein the conjugate group is linked to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

65. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises only one ligand.

66. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises only two ligands.

67. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises three or more ligands.

68. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises only three ligands.

69. Each ligand may be a polysaccharide, a modified polysaccharide, mannose, galactose, a mannose derivative, a galactose derivative, D-mannopyranose, L-mannopyranose, D-arabinose, L-galactose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, Ranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, α-D-galactosamine, N-acetylgalactosamine, 2-amino-3-O-[ (R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycoloyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2,3,4-tri-O-acetyl-1-thio The compound according to any one of claims 65 to 68, which is selected from the group consisting of O-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-gluco-heptopyranoside, 2,5-anhydro-D-allononitrile, ribose, D-ribose, D-4-thioribose, L-ribose, and L-4-thioribose.

70. 70. The compound of claim 69, wherein each ligand is an N-acetylgalactosamine.

71. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises: 【Chemistry 4】

72. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises: 【Chemistry 5】

73. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises: 【Chemistry 6】

74. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises: 【Chemistry 7】

75. 65. The compound of any one of claims 1 to 64, wherein the conjugate group comprises: 【Chemistry 8】

76. 71. The compound of any of claims 64 to 70, wherein the conjugated group comprises at least one phosphorus conjugated group or a neutral conjugated group.

77. The conjugated group comprises a structure selected from the following: 【Chemistry 9-1】 【Chemistry 9-2】 n is 1 to 12; m is 1 to 12; A compound according to any one of claims 1 to 76.

78. The conjugated group has a tether having a structure selected from the following: 【Chemistry 10】 L is either a phosphorus conjugated group or a neutral linking group; Z １ is C(=O) OR ２ and Z ２ is H, C １ -C ６ Alkyl or substituted C １ -C ６ is alkyl, R ２ is H, C １ -C ６ Alkyl or substituted C １ -C ６ is alkyl, each m １ are independently 0 to 20, and at least one m １ is greater than 0 for each tether, A compound according to any one of claims 1 to 76.

79. The conjugated group has a tether having a structure selected from the following: 【Chemistry 11】 Z ２ is H or CH ３ and each m １ are independently 0 to 20, and at least one m １ is greater than 0 for each tether, 79. The compound of claim 78.

80. The conjugated group has a tether having a structure selected from the following: 【Chemistry 12】 ； n is 1 to 12; m is 1 to 12; The compound according to any one of claims 64 to 70.

81. 81. The compound of any one of claims 1 to 80, wherein the conjugate group is covalently attached to the modified oligonucleotide.

82. having a structure represented by the formula: 【Chemistry 13】 where: A is a modified oligonucleotide, B is a cleavable moiety; C is a conjugated linker; D is a branched group; Each E is a tether, each F is a ligand; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

83. having a structure represented by the formula: 【Chemistry 14】 where: A is a modified oligonucleotide, B is a cleavable moiety; C is a conjugated linker; D is a branched group; Each E is a tether, each F is a ligand; each n is independently 0 or 1; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

84. having a structure represented by the formula: 【Chemistry 15】 where: A is a modified oligonucleotide, B is a cleavable moiety; C is a conjugated linker; Each E is a tether, each F is a ligand; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

85. having a structure represented by the formula: 【Chemistry 16】 where: A is a modified oligonucleotide, C is a conjugated linker; D is a branched group; Each E is a tether, each F is a ligand; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

86. having a structure represented by the formula: 【Chemistry 17】 where: A is a modified oligonucleotide, C is a conjugated linker; Each E is a tether, each F is a ligand; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

87. having a structure represented by the formula: 【Chemistry 18】 where: A is a modified oligonucleotide, B is a cleavable moiety; D is a branched group; Each E is a tether, each F is a ligand; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

88. having a structure represented by the formula: 【Chemistry 19】 where: A is a modified oligonucleotide, B is a cleavable moiety; Each E is a tether, each F is a ligand; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

89. having a structure represented by the formula: 【Chemistry 20】 where: A is a modified oligonucleotide, D is a branched group; Each E is a tether, each F is a ligand; q is an integer from 1 to 5; A compound according to any one of claims 1 to 81.

90. The conjugated linker has a structure selected from the following: 【Chemical 21】 wherein each L is independently a phosphorus conjugated group or a neutral conjugated group; each n is independently 1 to 20; A compound according to any one of claims 82 to 89.

92. The compound of any one of claims 83 to 90, wherein the conjugated linker has a structure selected from the following: 【Chemical 22】

93. The compound of any one of claims 83 to 90, wherein the conjugated linker has the following structure: 【Chemical 23】

94. The compound of any one of claims 83 to 90, wherein the conjugated linker has a structure selected from the following: 【Chemistry 24】

95. The compound of any one of claims 83 to 90, wherein the conjugated linker has a structure selected from the following: 【Chemistry 25】

96. The compound of any one of claims 83 to 90, wherein the conjugated linker has a structure selected from the following: 【Chemical Formula 26】

97. 97. The compound of any one of claims 83 to 96, wherein the conjugated linker comprises pyrrolidine.

98. 97. The compound of any one of claims 83 to 96, wherein the conjugated linker does not contain pyrrolidine.

99. The compound of any one of claims 83 to 98, wherein the conjugated linker comprises PEG.

100. 100. The compound of any one of claims 83 to 99, wherein the conjugated linker comprises an amide.

101. 100. The compound of any one of claims 83 to 99, wherein the conjugated linker comprises at least two amides.

102. 100. The compound of any one of claims 83 to 99, wherein the conjugated linker does not contain an amide.

103. The compound of any one of claims 83 to 102, wherein the conjugated linker comprises a polyamide.

104. The compound of any one of claims 83 to 103, wherein the conjugated linker comprises an amine.

105. The compound of any one of claims 83 to 104, wherein the conjugated linker comprises two or more disulfide bonds.

106. The compound of any one of claims 83 to 105, wherein the conjugated linker comprises a protein-binding moiety.

107. 107. The compound of claim 106, wherein the protein-binding moiety comprises a lipid.

108. The protein-binding moiety may be selected from the group consisting of cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholenoic acid, dimethoxytrityl, and phenoxazine), vitamin 107. The compound of claim 106, wherein the compound is selected from the group consisting of amines (e.g., folic acid, vitamin A, vitamin E, biotin, pyridoxal), peptides, carbohydrates (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, polysaccharides), endosomolytic components, steroids (e.g., uvaol, hecigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelinol-derivatized lithocholic acid), and cationic lipids.

109. 107. The compound of claim 106, wherein the protein-binding moiety is selected from the group consisting of C16-C22 long chain saturated or unsaturated fatty acids, cholesterol, cholic acid, vitamin E, adamantane, or 1-pentafluoropropyl.

110. The conjugated linker has a structure selected from the following: 【Chemical 27】 wherein each n is independently 1 to 20 and p is 1 to 6; The compound according to any one of claims 82 to 109.

111. The conjugated linker has a structure selected from the following: 【Chemical 28】 wherein each n is independently 1 to 20; The compound according to any one of claims 82 to 110.

112. The compound of any one of claims 82 to 110, wherein the conjugated linker has a structure selected from the following: 【Chemical 29】

113. The conjugated linker has a structure selected from the following: 【Chemistry 30】 n is 1 to 20; The compound according to any one of claims 82 to 110.

114. The conjugated linker according to any one of claims 82 to 110, wherein the conjugated linker has a structure selected from the following:

1. A compound according to any one of claims 1 to 9, wherein: 【Chemical 31】

115. The conjugated linker has a structure selected from the following: 【Chemical Formula 32】 wherein each n is independently 0, 1, 2, 3, 4, 5, 6, or 7; The compound according to any one of claims 82 to 110.

116. The compound of any one of claims 82 to 110, wherein the conjugated linker has the following structure: 【Chemical 33】

117. The branched group has one of the following structures: 【Chemical 34】 Here, each A １ are independently O, S, C═O, or NH; each n is independently 1 to 20; A compound according to any one of claims 82 to 116.

118. The branched group has one of the following structures: 【Chemical 35】 Each A １ are independently O, S, C═O, or NH; each n is independently 1 to 20; A compound according to any one of claims 82 to 116.

119. The compound of any one of claims 82 to 116, wherein the branching group has the following structure: 【Chemical 36】

120. The compound of any one of claims 82 to 116, wherein the branching group has the structure: 【Chemical 37】

121. The compound of any one of claims 82 to 116, wherein the branching group has the following structure: 【Chemical 38】

122. The compound of any one of claims 82 to 116, wherein the branching group has the following structure: 【Chemical Formula 39】

123. The compound of any one of claims 82 to 116, wherein the branching group comprises an ether.

124. The branched group has the structure: 【Chemistry 40】 wherein each n is independently 1 to 20; m is 2 to 6; A compound according to any one of claims 82 to 116.

125. The compound of any one of claims 82 to 116, wherein the branching group has the following structure: 【Chemistry 41】

126. The compound of any one of claims 82 to 116, wherein the branching group has the following structure: 【Chemistry 42】

127. The branching groups include: 【Chemistry 43】 where each j is an integer from 1 to 3; Each n is an integer from 1 to 20; A compound according to any one of claims 82 to 116.

128. The compound of any one of claims 82 to 116, wherein the branching group comprises: 【Chemical 44】

129. Each tether is selected from the following: 【Chemistry 45】 wherein L is selected from phosphorus conjugated groups and neutral conjugated groups; Z １ is C(=O) OR ２ and Z ２ is H, C １ -C ６ Alkyl or substituted C １ -C ６ is alkyl, R ２ is H, C １ -C ６ Alkyl or substituted C １ -C ６ is alkyl, each m １ are independently 0 to 20, and at least one m １ is greater than 0 for each tether, A compound according to any one of claims 82 to 128.

130. Each tether is selected from the following: 【Chemistry 46】 Z ２ is H or CH ３ and each m ２ are independently 0 to 20, and at least one m ２ is greater than 0 for each tether, A compound according to any one of claims 82 to 128.

131. Each tether is selected from the following: 【Chemistry 47】 n is 1 to 12; m is 1 to 12; A compound according to any one of claims 82 to 128.

132. The compound of any one of claims 82 to 128, wherein at least one tether comprises ethylene glycol.

133. 131. The compound of any of claims 82-128 or 130, wherein at least one tether comprises an amide.

134. 131. The compound of any of claims 82-128 or 130, wherein at least one tether comprises a polyamide.

135. 131. The compound of any of claims 82-128 or 130, wherein at least one tether comprises an amine.

136. 131. The compound of any of claims 82-128 or 130, wherein at least two tethers are different from each other.

137. 131. The compound of any of claims 82-128 or 130, wherein all of the tethers are the same as each other.

138. Each tether is selected from the following: 【Chemistry 48】 wherein each n is independently 1 to 20; each p is 1 to about 6; A compound according to any one of claims 82 to 128.

139. 129. The compound of any one of claims 82-128, wherein each tether is selected from the following: 【Chemistry 49】

140. Each tether has the following structure: 【Chemistry 50】 each n is independently 1 to 20; A compound according to any one of claims 82 to 128.

141. 129. The compound of any of claims 82-128, wherein each tether has the following structure: 【Chemistry 51】

142. The tether has a structure selected from the following: 【Chemistry 52】 each n is independently 0, 1, 2, 3, 4, 5, 6, or 7; A compound according to any one of claims 82 to 128.

143. 129. The compound of any one of claims 82-128, wherein the tether has a structure selected from the following: 【Chemistry 53】

144. 144. The compound of any one of claims 140 to 143, wherein the ligand is galactose.

145. The compound of any one of claims 140 to 143, wherein the ligand is mannose-6-phosphate.

146. Each ligand is selected from: 【Chemical 54】 Each R １ is selected from OH and NHCOOH; A compound according to any one of claims 140 to 143.

147. The compound of any one of claims 140 to 143, wherein each ligand is selected from the following: 【Chemistry 55】

148. The compound of any one of claims 140 to 143, wherein each ligand has the following structure: 【Chemical 56】

149. 144. The conjugated antisense compound of any of claims 140-143, wherein each ligand has the structure: 【Chemical 57】

150. 10. The compound of claim 1, wherein the conjugate group comprises a cell targeting moiety.

151. The conjugate group comprises a cell targeting moiety having the structure: 【Chemistry 58】 each n is independently 1 to 20; The compound of claim 150.

152. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemical Formula 59】

153. The cell targeting moiety has the structure: 【Chemistry 60】 each n is independently 1 to 20; The compound of claim 150.

154. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Hua 61】

155. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Hua 62】

156. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemistry 63】

157. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Hua 64】

158. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemistry 65】

159. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Hua 66】

160. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Hua 67】

161. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemistry 68】

162. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemical Formula 69】

163. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemistry 70】

164. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemical 71】

165. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemical Formula 72】

166. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemical 73】

167. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemical 74】

168. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemistry 75】

169. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemical 76】

170. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemical Formula 77】

171. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemical 78】

172. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemical 79】

173. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemistry 80】

174. 151. The compound of claim 150, wherein said cell targeting moiety comprises: 【Chemistry 81】

175. 151. The compound of claim 150, wherein said cell targeting moiety has the structure: 【Chemistry 82】

176. said cell targeting moiety comprising: 【Chemistry 83】 Each Y is O, S, substituted or unsubstituted C １ -C １０ 151. The compound of claim 150, wherein the compound is selected from alkyl, amino, substituted amino, azido, alkenyl, or alkynyl.

177. The conjugated group comprises: 【Chemistry 84】 ； Each Y is O, S, substituted or unsubstituted C １ -C １０ 151. The compound of claim 150, wherein the compound is selected from alkyl, amino, substituted amino, azido, alkenyl, or alkynyl.

178. The cell targeting moiety has the structure: 【Chemistry 85】 ； Each Y is O, S, substituted or unsubstituted C １ -C １０ 151. The compound of claim 150, wherein the compound is selected from alkyl, amino, substituted amino, azido, alkenyl, or alkynyl.

179. The compound of any preceding claim, wherein the conjugated group comprises: 【Chemistry 86】

180. The compound of any preceding claim, wherein the conjugated group comprises: 【Hua 87】

181. The compound of any preceding claim, wherein the conjugated group comprises: 【Hua 88】

182. The compound of any preceding claim, wherein the conjugated group comprises: 【Chemistry 89】

183. 10. The compound of claim 1, wherein the conjugate group comprises a cleavable moiety selected from among a phosphodiester, an amide, or an ester.

184. 10. The compound of claim 1, wherein the conjugate group comprises a phosphodiester cleavable moiety.

185. The conjugate group does not include a cleavable moiety, and the conjugate group is a cleavable moiety that is capable of reacting with the conjugate group and the oligonucleotide.

10. A compound according to any preceding claim, comprising phosphorothioate bonds between the nucleotides.

186. 10. The compound of claim 1, wherein the conjugate group comprises an amide cleavable moiety.

187. 10. The compound of claim 1, wherein the conjugate group comprises an ester cleavable moiety.

188. having the following structure: 【Chemistry 90】 each n is independently 1 to 20; Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

189. having the following structure: 【Chemistry 91】 each n is independently 1 to 20; Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

190. having the following structure: 【Chemistry 92】 each n is independently 1 to 20; Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Z is H or a linked solid support; Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

191. having the following structure: 【Chemistry 93】 each n is independently 1 to 20; Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Z is H or a linked solid support; Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

192. having the following structure: 【Chemistry 94】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

193. having the following structure: 【Chemistry 95】 、 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

194. having the following structure: 【Chemistry 96】 、 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

195. having the following structure: 【Chemistry 97】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

196. having the following structure: 【Chemistry 98】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

197. having the following structure: 【Hua99】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

198. having the following structure: 【Chemistry 100】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

199. having the following structure: 【Chemistry 101】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

200. having the following structure: 【Chemistry 102】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

201. having the following structure: 【Chemistry 103】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

202. having the following structure: 【Chemistry 104】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

203. The conjugated group comprises: 【Chemistry 105】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

204. The conjugated group comprises: 【Chemistry 106】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

205. The conjugated group comprises: 【Chemistry 107】 Q １３ is H or O(CH ２ ) ２ -OCH ３ and A is a modified oligonucleotide, Bx is a heterocyclic base moiety; A compound according to any of the preceding claims.

206. B ｘ A compound according to any preceding claim, wherein is selected from among adenine, guanine, thymine, uracil, or cytosine or 5-methylcytosine.

207. B ｘ is adenine.

208. B ｘ is thymine.

209. Q １３ is O(CH ２ ) ２ -OCH ３ 10. The compound of any preceding claim, wherein

210. Q １３ is H.

211. A compound consisting of a modified oligonucleotide as described below: 【Chemistry 108】

212. 10. A composition comprising a compound according to any preceding claim, or a salt thereof, and at least one pharmaceutically acceptable carrier or diluent.

213. A prodrug comprising a compound of any one of claims 1 to 212.

214. 10. A composition comprising a compound according to any preceding claim, or a salt thereof, and at least one pharmaceutically acceptable carrier or diluent.

215. 10. A method comprising administering to an animal a compound or composition according to any preceding claim.

216. 216. The method of claim 215, wherein the animal is a human.

217. 217. The method of claim 215 or 216, wherein administering the compound prevents, treats, or ameliorates a PKK-associated disease, disorder, or condition.

218. 218. The method of claim 217, wherein the PKK-associated disease, disorder, or condition is hereditary angioedema (HAE), edema, angioedema, swelling, eyelid angioedema, ocular edema, macular edema, cerebral edema, thrombosis, embolism, thromboembolism, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, or infarction.

219. 10. Use of a compound or composition according to any preceding claim for the manufacture of a medicament for the treatment of an inflammatory or thromboembolic disease.

Images