Rna-guided eradication of herpes simplex virus type i and other related human herpesviruses

Abstract

To provide compositions and methods for the inhibition of the infectivity of a herpesvirus.SOLUTION: A composition comprises: a) a CRISPR-associated (Cas) peptide or an isolated nucleic acid encoding the Cas peptide; and b) an isolated guide nucleic acid or an isolated nucleic acid encoding the guide nucleic acid, the guide nucleic acid comprising a nucleotide sequence substantially complementary to a target sequence in a herpesvirus genome.SELECTED DRAWING: Figure 1A-1

Description

[Technical Field]

[0001] The present disclosure relates generally to compositions and methods for treating or eradicating herpes simplex virus infection, and in particular to targeting herpes simplex virus genes with gene editing complexes.

[0002] (CROSS-REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Provisional Application No. 63 / 086,648, filed October 2, 2020, and U.S. Provisional Application No. 63 / 109,511, filed November 4, 2020, each of which is incorporated herein by reference. [Background technology]

[0003] Pharmacological treatment with nucleoside analogs is the mainstay of treatment for primary HSV1 infection and viral reactivation events. These agents can effectively limit the damage caused by the spread of HSV1 infection to other cells, but do not affect the establishment of latent HSV1 reactivation or future HSV1 reactivation events. Given the limitations of current treatments, there is a need in the art for compositions and methods for the treatment and prevention of both lytic and latent HSV1 infections. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] U.S. Provisional Application No. 63 / 086,648 [Patent Document 2] U.S. Provisional Application No. 63 / 109,511 Summary of the Invention

[0005] In one aspect, the present disclosure provides a composition for treating or preventing a herpesvirus infection, the composition comprising: a) a CRISPR-associated (Cas) peptide or an isolated nucleic acid encoding a Cas peptide; and b) an isolated guide nucleic acid or an isolated nucleic acid encoding a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence substantially complementary to a target sequence in a herpesvirus genome. In certain embodiments, the pharmaceutical composition comprises: a) a CRISPR-associated (Cas) peptide or an isolated nucleic acid encoding a Cas peptide, and b) an isolated guide nucleic acid or an isolated nucleic acid encoding a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence substantially complementary to a target sequence in a herpesvirus genome.

[0006] In certain embodiments, the composition comprises an expression vector encoding a CRISPR-associated (Cas) peptide and a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence substantially complementary to a target sequence in a herpesvirus genome. In some embodiments, the disclosure provides a host cell comprising the expression vector.

[0007] In certain embodiments, a method of treating or preventing a herpesvirus infection or herpesvirus-related disorder in a subject comprises: a) a CRISPR-associated (Cas) peptide, or an isolated nucleic acid encoding a Cas peptide; and b) an isolated guide nucleic acid, or an isolated nucleic acid encoding a guide nucleic acid, wherein the guide nucleic acid comprises a nucleotide sequence substantially complementary to a target sequence in a herpesvirus genome.

[0008] In certain embodiments, the composition comprises a plurality of isolated guide nucleic acids, each guide nucleic acid comprising a nucleotide sequence substantially complementary to a different target sequence in the herpesvirus genome. In certain embodiments, the composition comprises one or more isolated nucleic acids, the one or more isolated nucleic acids encoding a plurality of guide nucleic acids, each guide nucleic acid comprising a nucleotide sequence substantially complementary to a different target sequence in the herpesvirus genome.

[0009] In certain embodiments, the Cas peptide is Cas9 or a mutant thereof. In certain embodiments, the Cas9 mutant comprises one or more point mutations compared to wild-type Streptococcus pyogenes Cas9 (spCas9) selected from the group consisting of R780A, K810A, K848A, K855A, H982A, KI003A, R1060A, D1135E, N497A, R661A, Q695A, Q926A, L169A, Y450A, M495A, M694A, and M698A. In some embodiments, the Cas peptide is Cpf1 or a mutant thereof.

[0010] In some embodiments, the isolated nucleic acid encoding the Cas peptide is optimized for expression in a human cell. In some embodiments, the target sequence comprises a sequence within the ICP0 domain of a herpesvirus genome. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises a crRNA and a tracrRNA. In certain embodiments, the target sequence to which the gRNA is substantially complementary is within the UL56, ICP0, ICP4, or ICP27 gene. In certain embodiments, the HSV target sequence is within the ICP0 gene, the UL56 gene, or a combination thereof. In certain embodiments, the gRNA comprises a nucleic acid sequence having at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NOs: 1-96, 194-212, and 356-371.

[0011] In certain embodiments, the gRNA comprises a nucleic acid sequence comprising SEQ ID NOs: 1-96, 194-212, and 356-371. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more gRNAs comprising nucleic acid sequences including SEQ ID NOs: 1-96, 194-212, and 356-371. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of two or more gRNAs comprising nucleic acid sequences comprising SEQ ID NOs: 1-96, 194-212, and 356-371. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of three or more gRNAs comprising nucleic acid sequences including SEQ ID NOs: 1-96, 194-212, and 356-371. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of four or more gRNAs comprising nucleic acid sequences including SEQ ID NOs: 1-96, 194-212, and 356-371.

[0012] In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of 5 or 6 or 7 or 8 or 9 or 10 or more gRNAs comprising nucleic acid sequences including SEQ ID NOs: 1-96, 194-212, and 356-371. In some embodiments, the PAM sequence comprises a nucleic acid sequence having at least about 70% (e.g., at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more) sequence identity to SEQ ID NOs: 97-193, 213-231, or a combination thereof. In some embodiments, the PAM sequence comprises a nucleic acid sequence comprising SEQ ID NOs: 97-193, 213-231, or a combination thereof. In certain embodiments, herpes viruses include herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpes virus 3 (HHV-3; varicella-zoster virus (VZV)), human herpes virus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpes virus 5 (HHV-5; cytomegalovirus (CMV)), human herpes virus 6 (HHV-6; roseolovirus), human herpes virus 7 (HHV-7), and human herpes virus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

[0013] In certain embodiments, disclosed herein are compositions comprising a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease or a nucleic acid sequence encoding a CRISPR-associated endonuclease; a first guide nucleic acid, or a nucleic acid sequence encoding a first guide nucleic acid, wherein the first guide nucleic acid is complementary to a first target nucleic acid sequence located within or near the ICP0 gene of a herpesvirus genome; a second guide nucleic acid, or a nucleic acid sequence encoding a second guide nucleic acid, wherein the second guide nucleic acid is complementary to a second target nucleic acid sequence located within or near the ICP0 gene of a herpesvirus genome; or a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence located within or near the ICP27 gene of a herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

[0014] In some embodiments, the composition further comprises a fourth guide nucleic acid or a nucleic acid sequence encoding a fourth guide nucleic acid, wherein the fourth guide nucleic acid is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome. In some embodiments, the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence. In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasO endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a Staphylococcus aureus Cas9 nuclease. In some embodiments, the CRISPR-associated endonuclease is optimized for expression in human cells. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises crRNA and tracrRNA.

[0015] In some embodiments, the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96, 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96, 372-375, or the complement of any one of SEQ ID NOs: 1-96, 372-375. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375.

[0016] In some embodiments, the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377.

[0017] In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 7 or its complement, and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 7 or its complement, the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement, and the fourth target nucleic acid sequence comprises a sequence according to SEQ ID NO: 377 or its complement. In some embodiments, the herpesvirus is selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

[0018] In certain embodiments, compositions are disclosed comprising a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease or a nucleic acid sequence encoding a CRISPR-associated endonuclease; a first guide nucleic acid, or a nucleic acid sequence encoding a first guide nucleic acid, wherein the first guide nucleic acid is complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; a second guide nucleic acid, or a nucleic acid sequence encoding a second guide nucleic acid, wherein the second guide nucleic acid is complementary to a second target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome; and a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

[0019] In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasI endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a Staphylococcus aureus Cas9 nuclease. In some embodiments, the CRISPR-associated endonuclease is optimized for expression in human cells. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises a crRNA and a tracrRNA. In some embodiments, the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375.

[0020] In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or a complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or a complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or a complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377.

[0021] In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or 7 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement, and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 377 or its complement. In some embodiments, the herpesvirus is selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

[0022] As used herein, in certain embodiments, a CRISPR-Cas system comprises: a CRISPR-associated endonuclease; a first guide nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2 or 7, or a complement thereof; and a second guide nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376 or 377, or a complement thereof. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 7.

[0023] In some embodiments, the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376. In some embodiments, the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 377. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 377.

[0024] In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:7, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:376. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:7, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO:377.

[0025] In certain embodiments, nucleic acids encoding the CRISPR-Cas systems described herein are disclosed.

[0026] In certain embodiments, the present disclosure provides an adeno-associated virus (AAV) vector comprising a nucleic acid encoding a CRISPR-associated endonuclease: a first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; a second guide nucleic acid complementary to a second target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; or a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

[0027] In some embodiments, the vector further comprises a fourth guide nucleic acid, wherein the fourth guide nucleic acid is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome. In some embodiments, the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence. In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasΦ endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a Staphylococcus aureus Cas9 nuclease.

[0028] In some embodiments, the CRISPR-associated endonuclease is optimized for expression in human cells. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid includes crRNA and tracrRNA. In some embodiments, the first target nucleic acid sequence includes a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or a complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the first target nucleic acid sequence includes a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or a complement of any one of SEQ ID NOs: 1-96 or 372-375.

[0029] In some embodiments, the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377.

[0030] In some embodiments, the fourth target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 7 or its complement, and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2. wherein the second target nucleic acid sequence comprises the sequence according to SEQ ID NO: 7 or its complement, the third target nucleic acid sequence comprises the sequence according to SEQ ID NO: 376 or its complement, and the fourth target nucleic acid sequence comprises the sequence according to SEQ ID NO: 377 or its complement. In some embodiments, the nucleic acid further comprises a promoter.

[0031] In some embodiments, the promoter is a ubiquitous promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a human cytomegalovirus promoter. In some embodiments, the nucleic acid further comprises an enhancer element. In some embodiments, the enhancer element is a human cytomegalovirus enhancer element. In some embodiments, the nucleic acid further comprises a 5' ITR element and a 3' ITR element. In some embodiments, the adeno-associated viral (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, the adeno-associated viral (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ / 8. In some embodiments, the herpesvirus is selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

[0032] In certain embodiments, disclosed herein are adeno-associated virus (AAV) vectors comprising a nucleic acid encoding a CRISPR-associated endonuclease: a first guide nucleic acid that is complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; a second guide nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome; and a third guide nucleic acid that is complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

[0033] In some embodiments, the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasI endonuclease. In some embodiments, the CRISPR-associated endonuclease is a Cas9 nuclease. In some embodiments, the Cas9 nuclease is a Staphylococcus aureus Cas9 nuclease. In some embodiments, the CRISPR-associated endonuclease is optimized for expression in human cells. In some embodiments, the guide nucleic acid is RNA. In some embodiments, the guide nucleic acid comprises a crRNA and a tracrRNA. In some embodiments, the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375.

[0034] In some embodiments, the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377.

[0035] In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or 7 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement, and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 377 or its complement. In some embodiments, the herpesvirus is selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

[0036] In some embodiments, the nucleic acid further comprises a promoter. In some embodiments, the promoter is a ubiquitous promoter. In some embodiments, the promoter is a tissue-specific promoter. In some embodiments, the promoter is a constitutive promoter. In some embodiments, the promoter is a human cytomegalovirus promoter. In some embodiments, the nucleic acid further comprises an enhancer element. In some embodiments, the enhancer element is a human cytomegalovirus enhancer element. In some embodiments, the nucleic acid further comprises a 5' ITR element and a 3' ITR element. In some embodiments, the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ / 8.

[0037] In certain embodiments, disclosed herein are methods for excising some or all of a herpesvirus sequence from a cell, the method comprising providing to the cell a composition described herein, a CRISPR-Cas system described herein, or an AAV vector described herein.

[0038] In certain embodiments, disclosed herein are methods for inhibiting or reducing herpesvirus replication in a cell, the methods comprising providing the cell with a composition described herein, a CRISPR-Cas system described herein, or an AAV vector described herein. In some embodiments, the cell is in a subject. In some embodiments, the subject is human. [Brief explanation of the drawings]

[0039] [Figure 1A-1] FIG. 1 is a schematic diagram of the herpesvirus genome and the gene editing vector used in targeting the herpesvirus genome. [Figure 1A-2] FIG. 1 is a schematic diagram of the herpesvirus genome and the gene editing vector used in targeting the herpesvirus genome. [Figure 1B] FIG. 1 is a schematic diagram of the herpesvirus genome and the gene editing vector used in targeting the herpesvirus genome. [Figure 2] FIG. 1 shows data showing the delivery and expression of gene editing vectors in cells. [Figure 3-1] FIG. 1 shows data demonstrating a DNA excision assay in cells. [Figure 3-2] FIG. 1 shows data demonstrating a DNA excision assay in cells. [Figure 4] FIG. 1 shows data demonstrating intracellular HSV replication. [Figure 5-1] FIG. 1 shows data showing gRNA expression in cells. [Figure 5-2] FIG. 1 shows data showing gRNA expression in cells. [Figure 6] FIG. 1 shows data from an intracellular herpesvirus model. [Figure 7-1] FIG. 1 shows data demonstrating a DNA excision assay in cells. [Figure 7-2] FIG. 1 shows data demonstrating a DNA excision assay in cells. [Figure 8] FIG. 1 shows data demonstrating the reduction of target gene expression in infected cells. DETAILED DESCRIPTION OF THE INVENTION

[0040] (definition) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, the preferred methods and materials are described herein.

[0041] As used herein, each of the following terms has the meaning associated with it in this section.

[0042] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0043] As used herein, "about," when referring to a measurable value such as an amount, duration, etc., is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, or ±0.1% from the specified value, such variations being appropriate for practicing the disclosed methods.

[0044] The term "abnormal," when used in reference to organisms, tissues, cells, or components thereof, refers to organisms, tissues, cells, or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time, etc.) from those organisms, tissues, cells, or components thereof that exhibit the "normal" (expected) respective characteristic. A characteristic that is normal or expected in one cell or tissue type may be abnormal in another cell or tissue type.

[0045] As used herein, the term "comprises," and variations thereof, in connection with defined or described elements of an article, composition, apparatus, method, process, system, etc., means: inclusive or open-ended, allowing for additional elements, whereby the defined or described item, composition, apparatus, method, process, system, etc. includes the specified elements, or their equivalents where appropriate, and that other elements may be included but still fall within the scope / definition of the defined item, composition, apparatus, method, process, system, etc.

[0046] A "disease" is a state of health in which an animal is unable to maintain homeostasis, and if the disease is not ameliorated, the animal's health will continue to deteriorate.

[0047] In contrast, an animal "disorder" is a state of health in which the animal is able to maintain homeostasis, but the animal's health is less favorable than it would be in the absence of the disorder. Left untreated, the illness does not necessarily lead to further deterioration of the animal's health.

[0048] A disease or disorder is "alleviated" if the severity of a symptom of the disease or disorder, the frequency with which the patient experiences such symptoms, or both, are reduced.

[0049] "Encoding" refers to the inherent property that a particular sequence of nucleotides within a polynucleotide, such as a gene, cDNA, or mRNA, serves in biological processes as a template for the synthesis of other polymers and macromolecules having either a defined sequence of nucleotides (i.e., rRNA, tRNA, and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein when transcription and translation of the mRNA corresponding to the gene produces that protein in a cell or other biological system. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and typically listed in a sequence listing; and the non-coding strand, which is used as a template for transcription of the gene or cDNA; can be said to encode the protein or other product of that gene or cDNA.

[0050] An "effective amount" or "therapeutically effective amount" of a compound is the amount of the compound sufficient to confer a beneficial effect on the subject to which the compound is administered. An "effective amount" of a delivery vehicle is an amount sufficient to effectively bind or deliver the compound.

[0051] An "expression vector" refers to a vector containing a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression. Other elements for expression can be supplied by the host cell or in an in vitro expression system. Expression vectors include all vectors known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) that incorporate a recombinant polynucleotide.

[0052] "Homologous" refers to sequence similarity or sequence identity between two polypeptides or two nucleic acid molecules. If both positions in two compared sequences are occupied by the same base or amino acid monomer subunit, e.g., if each position in two DNA molecules is occupied by adenine, the molecules are homologous at that position. The percent homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared × 100. For example, if 6 out of 10 positions in two sequences are matching or homologous, then the two sequences are 60% homologous. As an example, the DNA sequences ATTGCC and TATGGC share 50% homology. Generally, comparisons are performed by aligning the two sequences to maximize homology.

[0053] "Isolated" means altered or removed from its natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide is "isolated" if it is partially or completely separated from the coexisting materials in its natural state. An isolated nucleic acid or protein can exist in a substantially purified form, or it can exist in a non-native environment, such as a host cell.

[0054] In the context of the present disclosure, the following abbreviations for commonly occurring nucleobases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0055] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA can also include introns, to the extent that some versions of a nucleotide sequence that encodes a protein may contain introns.

[0056] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal or cells thereof described in the methods described herein, whether in vitro or in situ. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0057] "Parenteral" administration of the compositions includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection or infusion techniques.

[0058] The term "polynucleotide," as used herein, is defined as a chain of nucleotides. Furthermore, a nucleic acid is a polymer of nucleotides. Therefore, as used herein, nucleic acid and polynucleotide are interchangeable. Those skilled in the art have the general knowledge that nucleic acids are polynucleotides and can be hydrolyzed into monomeric "nucleotides." The monomeric nucleotides are hydrolyzed into nucleosides. As used herein, polynucleotide includes, but is not limited to, all nucleic acid sequences obtained by any means available in the art, including, but not limited to, recombinant means, i.e., cloning nucleic acid sequences from recombinant libraries or cells using conventional cloning techniques and PCR®, and by synthetic means.

[0059] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence encoding a protein or RNA can also include introns, to the extent that some versions of a nucleotide sequence that encodes a protein may contain introns.

[0060] The term "pharmaceutically acceptable" (or "pharmacologically acceptable") refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to animals or humans, as appropriate. As used herein, the term "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial agents, isotonic agents, absorption delaying agents, buffers, excipients, binders, lubricants, gels, surfactants, and the like that can be used as a vehicle for a pharmaceutically acceptable substance.

[0061] As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a protein or peptide sequence. A polypeptide includes any peptide or protein containing two or more amino acids linked to each other by peptide bonds. As used herein, the term refers to both short chains, e.g., commonly referred to in the art as peptides, oligopeptides, and oligomers, and longer chains, which are commonly referred to in the art as proteins and come in many varieties. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. A polypeptide includes natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0062] The term "promoter" as used herein is defined as a DNA sequence recognized by the synthetic machinery of a cell or introduced synthetic machinery necessary to initiate the specific transcription of a polynucleotide sequence.

[0063] As used herein, the term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some cases, this sequence is the core promoter sequence, and in other cases, this sequence may also include an enhancer sequence and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be one that expresses the gene product in a tissue-specific manner.

[0064] A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes a gene product to be produced in a cell under most or all physiological conditions of the cell.

[0065] An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell substantially only when an inducer corresponding to the promoter is present in the cell.

[0066] As used in this specification and the appended claims, the term "or" is generally used in its sense including "and / or" unless the content clearly dictates otherwise.

[0067] A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes a gene product to be produced in a cell substantially only if the cell is a cell of the corresponding tissue type.

[0068] A "therapeutic" treatment is a treatment administered to a subject exhibiting pathological symptoms with the intent of reducing or eliminating those symptoms.

[0069] As used herein, "treating a disease or disorder" means reducing the frequency with which a patient experiences symptoms of the disease or disorder. Disease and disorder are used interchangeably herein.

[0070] As used herein, the phrase "therapeutically effective amount" refers to an amount sufficient or effective to prevent or treat (delay or prevent the onset of, prevent, inhibit, reduce or reverse the progression of) a disease or condition, including alleviating the symptoms of such illness.

[0071] The term "treating" a disease, as used herein, means reducing the frequency or severity of at least one sign or symptom of the disease or disorder experienced by a subject.

[0072] As used herein, the term "variant" refers to a nucleic acid or peptide sequence that differs in sequence from a reference nucleic acid or peptide sequence, respectively, but retains essential properties of the reference molecule. Sequence changes in a nucleic acid variant may not alter the amino acid sequence of the peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions, and truncations. Sequence changes in peptide variants are usually limited or conservative, so that the sequences of the reference peptide and variant are closely similar overall and, in many regions, identical. A variant and reference peptide may differ in amino acid sequence by any combination of one or more substitutions, additions, or deletions. Nucleic acid or peptide variants may be naturally occurring, such as allelic variants, or may be variants that are not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be generated by mutagenesis techniques or direct synthesis.

[0073] A "vector" is a composition of matter that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid into a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides bound to ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "vector" includes autonomously replicating plasmids or viruses. This term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds and liposomes. Examples of viral vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, etc.

[0074] Ranges: Throughout this disclosure, various aspects of the disclosure may be expressed in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the disclosure. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges and individual numerical values ​​within that range. For example, a description of a range such as 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values ​​within that range (e.g., 1, 2, 2.7, 3, 4, 5, 5.3, 6, etc.). This applies regardless of the broadness of the range.

[0075] (Detailed explanation) (Herpes virus targeting) Embodiments include compositions and methods for treating and preventing herpesvirus infection in a subject in need thereof. For example, in certain embodiments, the present disclosure provides compositions that specifically cleave a target sequence within the viral genome of a herpesvirus, thereby preventing or reducing the virus's ability to replicate and thus inhibiting herpesvirus infectivity.

[0076] In certain embodiments, gene editing complexes, such as single and multiple CRISPR-Cas systems specific to human herpes simplex virus, compromise the integrity of viral DNA sequences, resulting in the excision of the HSV genome between targeted HSV regions. For example, the CRISPR-Cas molecules described herein can remove large segments of the HSV genome, disabling the virus's ability to replicate in infected cells. Thus, the present disclosure provides compositions and methods for targeting the HSV genome in infected cells, for disrupting the viral genome in acute or latent HSV1 infections, as a novel therapeutic and preventative strategy.

[0077] In certain embodiments, compositions and methods related to targeting the HSV genome are described herein. In some embodiments, the compositions and methods include a CRISPR / Cas system for targeting the HSV genome. In some embodiments, the compositions and methods result in the excision of part or all of the HSV genome. In some embodiments, the compositions and methods result in the excision of part or all of the sequence within the HSV genome in 1, 2, 3, 4, 5, or 6 different genes of the HSV genome. In some embodiments, the compositions and methods result in the excision of at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or 9000 genes.

[0078] In some embodiments, methods and compositions are provided herein that include a CRISPR-associated (Cas) peptide or a nucleic acid sequence encoding a CRISPR-associated (Cas) peptide and multiple guide nucleic acids or nucleic acid sequences encoding multiple guide nucleic acids. In some embodiments, the compositions and methods described herein include one, two, three, four, five, six, or more gRNAs. In some embodiments, the compositions and methods described herein include one, two, three, four, five, six, or more than six different gRNAs. In some embodiments, the compositions and methods described herein include four or at least four different gRNAs. In certain embodiments, one or more gRNAs target one or more different regions or sequences in the HSV genome (e.g., ICP0 and ICP27).

[0079] In some embodiments, different gRNAs target different sequences within the HSV genome. In some embodiments, different gRNAs are complementary to different target sequences within the HSV genome. In some embodiments, the target sequences are within or near the UL56, ICP0, ICP4, or ICP27 gene of the HSV genome. In certain embodiments, gRNAs targeting the UL56, ICP0, ICP4, or ICP27 gene hybridize to a region within or near the UL56, ICP0, ICP4, or ICP27 gene. In some embodiments, the region within the UL56, ICP0, ICP4, or ICP27 gene comprises at least one nucleotide within the UL56, ICP0, ICP4, or ICP27 gene. In some embodiments, the region near the UL56, ICP0, ICP4, or ICP27 gene includes 5, 10, 15, 20, 25, 30, or 35 base positions surrounding the UL56, ICP0, ICP4, or ICP27 gene.

[0080] In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that target (e.g., hybridize or anneal to) or are complementary to regions within the UL56, ICP0, ICP4, ICP27, or a combination thereof, of the HSV genome. In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that target the UL56 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that target the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that target the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that target the ICP27 gene of the HSV genome.

[0081] In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that hybridize to the UL56 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that hybridize to the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two, three, four, five, six, or more than six different gRNAs that hybridize to the ICP27 gene of the HSV genome.

[0082] In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP0 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP4 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs targeting the ICP27 gene of the HSV genome.

[0083] In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the UL56 gene of the HSV genome and one gRNA targeting the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the UL56 gene of the HSV genome and two different gRNAs targeting the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA targeting the UL56 gene of the HSV genome and two different gRNAs targeting the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the UL56 gene of the HSV genome and one gRNA targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the UL56 gene of the HSV genome and two different gRNAs targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA targeting the UL56 gene of the HSV genome and two different gRNAs targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the UL56 gene of the HSV genome and one gRNA targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the UL56 gene of the HSV genome and two different gRNAs targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA targeting the UL56 gene of the HSV genome and two different gRNAs targeting the ICP27 gene of the HSV genome.

[0084] In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the ICP0 gene of the HSV genome and one gRNA targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the ICP0 gene of the HSV genome and two different gRNAs targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA targeting the ICP0 gene of the HSV genome and two different gRNAs targeting the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the ICP0 gene of the HSV genome and one gRNA targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs targeting the ICP0 gene of the HSV genome and two different gRNAs targeting the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that targets the ICP0 gene of the HSV genome and two different gRNAs that target the ICP27 gene of the HSV genome.

[0085] In some embodiments, the compositions and methods described herein comprise two different gRNAs that target the ICP4 gene of the HSV genome and one gRNA that targets the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that target the ICP4 gene of the HSV genome and two different gRNAs that target the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that targets the ICP4 gene of the HSV genome and two different gRNAs that target the ICP27 gene of the HSV genome.

[0086] In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the UL56 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP0 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP0 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP4 gene of the HSV genome and 1, 2, 3, 4, 5, 6, or more than 6 different gRNAs that hybridize to the ICP27 gene of the HSV genome.

[0087] In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the UL56 gene of the HSV genome and one gRNA that hybridizes to the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the UL56 gene of the HSV genome and two different gRNAs that hybridize to the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that hybridizes to the UL56 gene of the HSV genome and two different gRNAs that hybridize to the ICP0 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the UL56 gene of the HSV genome and one gRNA that hybridizes to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the UL56 gene of the HSV genome and two different gRNAs that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that hybridizes to the UL56 gene of the HSV genome and two different gRNAs that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the UL56 gene of the HSV genome and one gRNA that hybridizes to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the UL56 gene of the HSV genome and two different gRNAs that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that hybridizes to the UL56 gene of the HSV genome and two different gRNAs that hybridize to the ICP27 gene of the HSV genome.

[0088] In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the ICP0 gene of the HSV genome and one gRNA that hybridizes to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the ICP0 gene of the HSV genome and two different gRNAs that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that hybridizes to the ICP0 gene of the HSV genome and two different gRNAs that hybridize to the ICP4 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the ICP0 gene of the HSV genome and one gRNA that hybridizes to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the ICP0 gene of the HSV genome and two different gRNAs that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that hybridizes to the ICP0 gene of the HSV genome and two different gRNAs that hybridize to the ICP27 gene of the HSV genome.

[0089] In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the ICP4 gene of the HSV genome and one gRNA that hybridizes to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise two different gRNAs that hybridize to the ICP4 gene of the HSV genome and two different gRNAs that hybridize to the ICP27 gene of the HSV genome. In some embodiments, the compositions and methods described herein comprise one gRNA that hybridizes to the ICP4 gene of the HSV genome and two different gRNAs that hybridize to the ICP27 gene of the HSV genome.

[0090] In certain embodiments, provided herein are methods and compositions for targeting the HSV genome using four guide nucleic acids.In some embodiments, the first guide nucleic acid of the plurality of guide nucleic acids is complementary to the first target sequence in the HSV genome.In some embodiments, the second guide nucleic acid of the plurality of guide nucleic acids is complementary to the second target sequence in the HSV genome.In some embodiments, the third guide nucleic acid of the plurality of guide nucleic acids is complementary to the third target sequence in the HSV genome.In some embodiments, the fourth guide nucleic acid of the plurality of guide nucleic acids is complementary to the fourth target sequence in the HSV genome.In some embodiments, the first target sequence, the second target sequence, the third target sequence, and the fourth target sequence are different.

[0091] In some embodiments, the ICP sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to one of the sequences set forth in Table 4, any one of SEQ ID NOS: 1-96 or 372-373. In some embodiments, the ICP sequence targeted by the gRNA comprises a sequence complementary to any one of SEQ ID NOS: 1-96 or 372-373 or a sequence set forth in Table 4, any one of SEQ ID NOS: 1-96 or 372-373. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs: 1-96 or 372-373, or a sequence set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence at least or about 95% homologous to a sequence complementary to any one of SEQ ID NOs: 1-96 or 372-373, or one of the sequences set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence at least or about 97% homologous to a sequence complementary to any one of SEQ ID NOs: 1-96 or 372-373, or one of the sequences set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence at least or about 97% homologous to a sequence complementary to any one of SEQ ID NOs: 1-96 or 372-373, or one of the sequences set forth in Table 4.

[0092] In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence at least or about 99% homologous to any one of SEQ ID NOs: 1-96 or 372-373, or a sequence set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence complementary to any one of SEQ ID NOs: 1-96 or 372-373, or a sequence set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence at least or about 100% homologous to any one of SEQ ID NOs: 1-96 or 372-373, or a sequence set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises a sequence at least or about 100% homologous to any one of SEQ ID NOs: 1-96 or 372-373, or a sequence complementary to a sequence set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs: 1-96, or a sequence set forth in Table 4. In some cases, the ICP0 sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of a sequence complementary to any one of SEQ ID NOs: 1-96 or 372-373, or a sequence set forth in Table 4.

[0093] In some embodiments, the ICP27 sequence targeted by the gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the ICP27 sequence targeted by the gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to a sequence complementary to any one of SEQ ID NOs: 363, 371, or 374-377. In some examples, the ICP27 sequence targeted by the gRNA comprises a sequence at least or about 95% homologous to any one of SEQ ID NOs: 363, 371, or 374-377. In some cases, the ICP27 sequence targeted by the gRNA comprises a sequence at least or about 95% homologous to a sequence complementary to any one of SEQ ID NOs: 363, 371, or 374-377. In some examples, the ICP27 sequence targeted by the gRNA comprises a sequence at least or about 97% homologous to a sequence complementary to any one of SEQ ID NOs: 363, 371, or 374-377. In some examples, the ICP27 sequence targeted by the gRNA comprises a sequence at least or about 97% homologous to a sequence complementary to any one of SEQ ID NOs: 363, 371, or 374-377. In some examples, the ICP27 sequence targeted by the gRNA comprises a sequence at least or about 99% homologous to any one of SEQ ID NOs: 363, 371, or 374-377.

[0094] In some instances, the ICP27 sequence targeted by the gRNA comprises a sequence that is at least or about 99% homologous to the sequence complementary to any one of SEQ ID NOs: 363, 371, or 374-377. In some instances, the ICP27 sequence targeted by the gRNA comprises a sequence that is at least or about 100% homologous to the sequence complementary to any one of SEQ ID NOs: 363, 371, or 374-377. In some instances, the ICP27 sequence targeted by the gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs: 363, 371, or 374-377. In some examples, the ICP27 sequence targeted by the gRNA comprises a sequence of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20 or more nucleotides of a sequence complementary to any one of SEQ ID NOs: 363, 371, or 374-377.

[0095] In some embodiments, the ICP0 sequence targeted by the first gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 372 or 373, and the ICP27 sequence targeted by the second gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 372 or 373.

[0096] In some embodiments, the sequence targeted by the gRNA comprises a sequence set forth in any one of SEQ ID NOs: 372-375. In some embodiments, the sequence targeted by the first gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 372; and the sequence targeted by the second gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 373; The sequence targeted by the third gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 374, and the sequence targeted by the fourth gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 375.

[0097] In some embodiments, the sequence targeted by the gRNA comprises the sequence set forth in any one of SEQ ID NOs: 2, 7, 376, or 377. In some embodiments, the sequence targeted by the first gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2 or its complement; the sequence targeted by the second gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 7 or its complement; The sequence targeted by the third gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 376 or its complement; and the sequence targeted by the fourth gRNA comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 377 or its complement.

[0098] In some embodiments, compositions and methods are described herein that include a PAM sequence comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 97-193, or a sequence set forth in Table 4. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs: 97-193, or a sequence set forth in Table 4. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs: 97-193, or a sequence set forth in Table 4. In some cases, the PAM sequence comprises a sequence at least or about 100% homology to any one of SEQ ID NOs: 97-193, or a sequence set forth in Table 4. In some cases, the PAM sequence comprises a sequence of 1, 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs: 97-193 or the sequences set forth in Table 4. In some embodiments, a PAM sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 97-193 is used in conjunction with a gRNA targeting a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375.

[0099] In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 194-212, or a sequence set forth in Table 1. In some embodiments, the sequence targeted by the gRNA comprises at least or about 95% sequence identity to any one of SEQ ID NOs: 194-212, or a sequence set forth in Table 1. In some embodiments, the sequence targeted by the gRNA comprises a sequence that is at least or about 97% homologous to any one of SEQ ID NOs: 194-212, or a sequence set forth in Table 1. In some embodiments, the sequence targeted by the gRNA comprises a sequence that is at least or about 99% homologous to any one of SEQ ID NOs: 194-212, or a sequence set forth in Table 1. In some cases, the sequence targeted by the gRNA comprises a sequence at least or about 100% homologous to any one of SEQ ID NOs: 194-212, or a sequence set forth in Table 1. The gRNA comprises at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs: 194-212, or a sequence set forth in Table 1.

[0100] In some embodiments, compositions and methods are described herein that include a PAM sequence comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 213-231, or a sequence set forth in Table 1. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs: 213-231, or a sequence set forth in Table 1. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs: 213-231, or a sequence set forth in Table 1. In some cases, the PAM sequence comprises a sequence having at least or about 100% homology to any one of SEQ ID NOs: 213-231, or a sequence set forth in Table 1. In some cases, the PAM sequence comprises a sequence of 1, 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs:213-231, or a sequence set forth in Table 1. In some embodiments, a PAM sequence having 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs:213-231 is used with a gRNA targeting a sequence comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs:194-212.

[0101] In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 232-243 or a sequence set forth in Table 2. In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs: 232-243 or a sequence set forth in Table 2. In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to any one of SEQ ID NOs: 232-243 or a sequence set forth in Table 2. In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs: 232-243 or a sequence set forth in Table 2. In some cases, the sequence targeted by the gRNA comprises a sequence at least or about 100% homologous to any one of SEQ ID NOs: 232-243, or a sequence set forth in Table 2. In some examples, the sequence targeted by the gRNA comprises a sequence of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs: 232-243, or a sequence set forth in Table 2.

[0102] In some embodiments, compositions and methods are described herein that include a PAM sequence comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 244-255, or a sequence set forth in Table 2. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs: 244-255, or a sequence set forth in Table 2. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs: 244-255, or a sequence set forth in Table 2. In some cases, the PAM sequence comprises a sequence having at least or about 100% homology to any one of SEQ ID NOs: 244-255, or a sequence set forth in Table 2. In some cases, the sequence targeted by the gRNA comprises a sequence of 1, 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs:244-255 or the sequences set forth in Table 2. In some embodiments, a PAM sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs:244-255 is used in conjunction with a gRNA targeting a sequence comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs:232-243.

[0103] In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 256-305, or a sequence set forth in Table 3. In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs: 256-305, or a sequence set forth in Table 3. In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 97% homology to any one of SEQ ID NOs: 256-305, or a sequence set forth in Table 3. In some embodiments, the sequence targeted by the gRNA comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs: 256-305, or a sequence set forth in Table 3. In some cases, the sequence targeted by the gRNA comprises a sequence at least or about 100% homologous to any one of SEQ ID NOs: 256-305, or a sequence set forth in Table 3. In some cases, the sequence targeted by the gRNA comprises a sequence of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 17, 18, 19, 20, or more than 20 nucleotides of any one of SEQ ID NOs: 256-305, or a sequence set forth in Table 3.

[0104] In some embodiments, compositions and methods are described herein that include a PAM sequence comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 306-355, or a sequence set forth in Table 3. In some cases, the PAM sequence comprises a sequence having at least or about 95% homology to any one of SEQ ID NOs: 306-355, or a sequence set forth in Table 3. In some cases, the PAM sequence comprises a sequence having at least or about 99% homology to any one of SEQ ID NOs: 306-355, or a sequence set forth in Table 3. In some cases, the PAM sequence comprises a sequence that is at least or about 100% homologous to any one of SEQ ID NOs: 306-355, or a sequence set forth in Table 3. In some cases, the PAM sequence comprises a sequence having at least or about 100% homology to any one of SEQ ID NOs: 306-355, or a sequence set forth in Table 3. In some cases, the PAM sequence comprises a sequence of 1, 2, 3, 4, 5, 6, or more than 6 nucleotides of any one of SEQ ID NOs: 306-355, or a sequence set forth in Table 3. In some embodiments, a PAM sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 306-355, or a sequence set forth in Table 3, is used in conjunction with a gRNA targeting a sequence comprising a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 256-305.

[0105] In certain embodiments, compositions and methods for targeting sequences within the HSV genome are described herein. In some embodiments, constructs or vectors are used with the compositions and methods described herein. In some embodiments, the construct or vector comprises a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 380. In some cases, the construct or vector comprises a sequence with at least or about 95% homology to SEQ ID NO: 380. In some cases, the construct or vector comprises a sequence with at least or about 97% homology to SEQ ID NO: 380. In some examples, the construct or vector comprises a sequence with at least or about 100% homology to SEQ ID NO: 380. In some examples, the construct or vector comprises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4500, 4600, 4700, 4800, 4900, 5000, 5100, 5200, 5300, 5400, 5500, 5600, 5700, 5800, 5900, 6000, 6100, 6200, 6300, 6400, 6500, 6600, 6700, 6800, 6900, 7000, 7100, 7200, 7300, 7400, 7500, 7600, 7700, 7800, 7900, 8000, 8100, 8200, 8300, 8400, 8500, 8600, 8700, 8800, 8900, 9000, 9100, 9200, 9300, 9400, 9500, 9600, 9700, 9800, 9900, 1000, 1000, 11 The construct or vector may comprise a sequence of more than 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, or 8400 nucleotides. In certain embodiments, the construct or vector comprises a CRISPR-Cas enzyme sequence and a gRNA sequence of SEQ ID NO: 380. In certain embodiments, the construct or vector comprises a CRISPR-Cas enzyme sequence and a gRNA sequence having 70%, 80%, 85%, 90%, 95% sequence identity to the CRISPR-Cas enzyme sequence and gRNA sequence of SEQ ID NO: 380.

[0106] In certain embodiments, compositions and methods for targeting sequences within the HSV genome are described herein. In some embodiments, nucleic acid constructs or vectors are used with the compositions and methods described herein. In some embodiments, the construct or vector comprises a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98% homology to SEQ ID NO: 381. In some cases, the construct or vector comprises a sequence having at least or about 95% homology to SEQ ID NO: 381. In some cases, the construct or vector comprises a sequence having at least or about 97% homology to SEQ ID NO: 381. In some cases, the construct or vector comprises a sequence having at least or about 99% homology to SEQ ID NO: 381. In some cases, the construct or vector comprises a sequence having at least or about 100% homology to SEQ ID NO: 381. In some cases, the construct or vector comprises a sequence of at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, or 5000 nucleotides of SEQ ID NO:381.

[0107] Further provided are nucleic acids comprising a sequence encoding one or more gRNAs that hybridize to one or more target sequences of the ICP0 gene and / or one or more gRNAs that hybridize to one or more target sequences of the ICP27 gene. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs according to SEQ ID NO:2 and / or SEQ ID NO:7. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs according to SEQ ID NO:376 and / or SEQ ID NO:377. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs according to any one of SEQ ID NOs:2, 7, 376, and 377. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs having about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs:2, 7, 376, and 377.

[0108] Further, in certain embodiments, a nucleic acid is provided comprising a sequence encoding one or more gRNAs that hybridize to one or more target sequences in the ICP0 gene and / or one or more gRNAs that hybridize to one or more target sequences in the ICP27 gene. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs according to any one of SEQ ID NOS: 1-377. In some embodiments, the nucleic acid comprises a sequence encoding one or more gRNAs having about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOS: 1-377. In some embodiments, the nucleic acid further comprises a 5' ITR element and a 3' ITR element. In some embodiments, the nucleic acid is configured to be packaged into an adeno-associated virus (AAV) vector. In some embodiments, the adeno-associated viral (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9. In some embodiments, the adeno-associated viral (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ / 8.

[0109] In some embodiments, the CRISPR endonuclease is Cas9 endonuclease, Cas12 endonuclease, CasX endonuclease, or CasI endonuclease. In some embodiments, the CRISPR endonuclease is Cas9 nuclease. In some embodiments, the Cas9 nuclease is Staphylococcus aureus Cas9 nuclease.

[0110] In some embodiments, the present disclosure provides compositions for treating or preventing a herpesvirus infection in a subject in need thereof. In some embodiments, the composition comprises at least one isolated guide nucleic acid comprising a nucleotide sequence complementary to a target region in the herpesvirus genome. In some embodiments, the composition comprises a CRISPR-associated (Cas) peptide, or a functional fragment or derivative thereof. The isolated nucleic acid guide molecule and the CRISPR-associated (Cas) peptide function together to introduce one or more mutations at a target site in the herpesvirus genome, thereby inhibiting viral infectivity.

[0111] The compositions also include isolated nucleic acids encoding one or more elements of the CRISPR-Cas system. For example, in some embodiments, the compositions include a guide nucleic acid and an isolated nucleic acid encoding at least one of a CRISPR-associated (Cas) peptide, or a functional fragment or derivative thereof.

[0112] In some embodiments, the present disclosure provides methods for treating or preventing a herpesvirus infection in a subject in need thereof. In some embodiments, the method comprises administering to the subject an effective amount of a composition comprising a guide nucleic acid and at least one of a CRISPR-associated (Cas) peptide, or a functional fragment or derivative thereof. In certain cases, the method comprises administering a composition comprising an isolated nucleic acid encoding at least one of a guide nucleic acid and a CRISPR-associated (Cas) peptide, or a functional fragment or derivative thereof. In certain embodiments, the method comprises administering a composition described herein to a subject diagnosed with a herpesvirus infection who is at risk of developing a herpesvirus infection.

[0113] In some embodiments, the method is used to treat or prevent herpesvirus infections, including, but not limited to, herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

[0114] (Herpes virus) The herpesvirus genus is divided into three genera: alphaherpesviruses (e.g., herpes simplex virus type 2, which causes HSV1 and genital herpes virus, and varicella-zoster virus, which causes chickenpox and shingles); betaherpesviruses (e.g., HHV-6, which causes sixth disease, and HHV-7, which causes infantile roseola); and gammaherpesviruses (e.g., Epstein-Barr virus, which causes mononucleosis and other diseases, and HHV-8, which causes Kaposi's sarcoma). Alphaherpesviruses not only share a similar life cycle, but also possess DNA sequences homologous to many of the viral proteins essential for viral replication and reactivation.

[0115] Herpes simplex virus type 1 (HSV1) is a 153-kilobase (kB) encapsulated double-stranded DNA virus and a nearly ubiquitous human pathogen. Up to 60% of the U.S. population is infected with HSV1 by their 40s. Primary infection typically occurs during early childhood and is characterized by fever and buccal and gingival lesions, although subclinical infections frequently occur. Primary HSV1 infection can also occur through sexual contact, and HSV1 has been identified as an increasing cause of genital herpesviruses. While primary infection is usually fairly mild, life-threatening infections can occur, especially in neonatal infections and in immunocompromised individuals.

[0116] After primary infection, the HSV1 genome can remain dormant for long periods within sensory neurons. During this stage of the viral life cycle, the HSV1 genome resides in a supercoiled episomal state within the nuclei of latently infected neurons. In this state, no viral proteins are produced, and only a single viral transcript, the latency-associated transcript (LAT), is produced. Various stimuli, including stress and UV light, can trigger reactivation of the virus from latently infected neurons. Reactivation can occur repeatedly, even years after the initial infection. Symptoms caused by HSV1 reactivation vary depending on the site of initial infection and the severity of the reactivation. The most commonly recognized form of HSV1 reactivation is herpes labialis. These typically appear at the vermilion border of the mouth after various stimuli, including UV light exposure. Reactivation of the virus stored in dorsal root ganglion neurons innervating the genital tract results in recurrent genital herpesvirus. Oral and anogenital symptoms of HSV1 reactivation are characterized by an initial prodromal tingling sensation in the area, followed by the appearance of painful blisters containing infectious virus, which ulcerate and eventually heal. Other, more rare, symptoms of HSV1 reactivation include Bell's palsy, delayed facial nerve palsy after ear surgery, and vestibular neuritis. HSV1 reactivation can also lead to more serious conditions, such as herpesvirus encephalitis and disseminated herpesvirus.

[0117] During primary infection, a defined series of protein expression occurs. During primary infection, when the virus enters a cell, the viral capsid is released into the cytoplasm, and host protein synthesis is halted by the tegument protein VHS / UL41. A second tegument protein, VP16, forms a complex with the host proteins Oct1 and HCF to induce immediate-early HSV1 transcription. These immediate-early genes induce the expression of HSV1-encoded enzymes required for viral DNA replication, such as thymidine kinase (TK) and viral DNA polymerase (UL30). As viral DNA production progresses, late viral proteins, such as capsid proteins, tegument proteins, and glycoproteins, required for viral entry into cells, are produced. Virus particles assemble, and viral DNA is packaged into the capsid. Ultimately, infectious virus particles are produced, causing infection of surrounding cells and enabling the transmission of infection to others.

[0118] The sequence of early steps in viral reactivation is thought to be mirrored during the reactivation of HSV1 in latently infected neurons during the later stages of reactivation. Proteins that play a key role in lytic infection, such as VP16, are thought to play a similarly important role in reactivation. As the HSV1 reactivation process progresses, early gene expression immediately follows, followed by early and late protein production. Ultimately, infectious virus particles are produced, leading to the spread of infection to neighboring cells and uninfected individuals.

[0119] In recent years, several systems have been developed to target endogenous genes, including homing endonucleases (HEs) or meganucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and more recently, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated system 9 (Cas9) protein, which utilizes site-specific double-strand DNA break (DSB)-mediated DNA repair mechanisms. These enzymes induce precise and efficient genome breaks via the DSB-mediated DNS repair mechanism. These DSB-mediated genome editing techniques enable targeted gene deletion, insertion, or modification.

[0120] In recent years, ZFNs and TALENs have revolutionized genome editing. However, the main drawbacks of ZFNs and TALENs are uncontrollable off-target effects and the tedious and expensive engineering of custom DNA-binding fusion proteins tailored to each target site, which limit their universal applicability and clinical safety.

[0121] RNA-guided Cas9 biotechnology induces genome editing without detectable off-target effects. This technology utilizes bacterial genome defense mechanisms in which CRISPR / Cas loci encode an RNA-guided adaptive immune system against mobile genetic elements (viruses, transposable elements, and conjugative plasmids). Three types of CRISPR systems (types I to III) have been identified. CRISPR clusters contain a spacer, a sequence complementary to the preceding mobile element. CRISPR clusters are transcribed and processed into mature CRISPR (Clustered Regularly Interspaced Short Palindromic repeats) RNA (crRNA). Cas9 belongs to the type II CRISPR / Cas system and possesses potent endonuclease activity to cleave target DNA.

[0122] Cas9 is guided by a mature crRNA, which contains a unique target sequence of approximately 20 base pairs (called the spacer) and a trans-activating small RNA (tracrRNA) that serves as a guide for RNase III-mediated processing of the pre-crRNA. The crRNA:tracrRNA duplex guides Cas9 to the target DNA through complementary base pairing between the spacer on the crRNA and a complementary sequence on the target DNA (tDNA) called the protospacer. Cas9 recognizes a trinucleotide (NGG) protospacer-adjacent motif (PAM) to designate the cleavage site (the third nucleotide from the PAM). The crRNA and tracrRNA can be expressed separately or engineered into an artificial fusion small guide RNA (gRNA) via a synthetic stem-loop (AGAAAU) to mimic the natural crRNA / tracrRNA duplex. Similar to shRNAs, such gRNAs can be synthesized or in vitro transcribed for direct RNA transfection, or expressed from RNA expression vectors (e.g., U6 or H1 promoter-driven vectors). Therefore, Cas9 gRNA technology requires the expression of the Cas9 protein and gRNA, which then forms a gene editing complex at a specific target DNA binding site within the target genome, causing cleavage / mutation of the target DNA.

[0123] However, the present disclosure is not limited to the use of Cas9-mediated gene editing.Rather, the present disclosure encompasses the use of other CRISPR-associated peptides, which can be used to target target sequence using gRNA and can be edited at the target site of interest.For example, in some embodiments, the present disclosure utilizes Cpf1 to edit the target site of subject.

[0124] As described herein, in some embodiments, the present disclosure employs a genetic strategy that uses novel RNA-guided CRISPR technology to target the HSV1 genome and disable expression of the HSV1 immediate-early gene, infected cell protein 0 (ICP0), by editing a specific domain of the gene.

[0125] However, the present disclosure is not limited to the prevention or treatment of HSV1. Rather, the present disclosure can be used to treat or prevent other herpes viruses. For example, because the HSV2 genome is similar to the HSV1 genome, the strategies described herein may be effective in treating or preventing HSV2.

[0126] (nuclease) Engineered CRISPR systems typically contain two components: a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein). In nature, the CRISPR / CRISPR-associated (Cas) system provides bacteria and archaea with adaptive immunity against viruses and plasmids by using CRISPR RNA (crRNA) to induce silencing of invading nucleic acids. CRISPR-Cas is an RNA-mediated adaptive defense system that relies on small RNA molecules for sequence-specific detection and silencing of foreign nucleic acids. The CRISPR / Cas system consists of a CRISPR array, which consists of an operon of cas genes and a genome-targeting sequence (called a spacer). Herein, we provide an engineered CRISPR system that detects and silences HSV DNA in cells.

[0127] As described herein, a CRISPR-Cas system generally refers to an enzyme system comprising a guide RNA sequence containing a nucleotide sequence complementary or substantially complementary to a region of a target polynucleotide and a protein with nuclease activity. CRISPR-Cas systems include Type I CRISPR-Cas systems, Type II CRISPR-Cas systems, Type III CRISPR-Cas systems, and their derivatives. CRISPR-Cas systems include engineered and / or programmed nuclease systems derived from naturally occurring CRISPR-Cas systems. In certain embodiments, a CRISPR-Cas system comprises an engineered and / or mutated Cas protein. In some embodiments, a nuclease generally refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of a nucleic acid. In some embodiments, an endonuclease generally refers to an endonuclease capable of cleaving phosphodiester bonds within a polynucleotide strand. A nickase generally refers to an endonuclease that cleaves only one strand of a DNA duplex.

[0128] In some embodiments, the CRISPR / Cas system used herein can be a Type I, Type II, or Type III system. Non-limiting examples of suitable CRISPR / Cas proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9, Cas10, Cas10d, CasF, CasG, CasH, CasX, CasΦ, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or Ca sB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx16, CsaX, Csx3, Csz1, Csxl5, Csf1, Csf2, Csf3, Csf4, and Cu1966. By way of further example, in some embodiments, the CRISPR-Cas protein is selected from the group consisting of Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cash, Cas7, Cas8, Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl6, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, Cas9, Cas12 (e.g., In some embodiments, the CRISPR / Cas protein or endonuclease is Cas9. In some embodiments, the CRISPR / Cas protein or endonuclease is Cas12.In certain embodiments, the Cas12 polypeptide is Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas12g, Cas12h, Cas12i, Cas12L, or Cas12J. In some embodiments, the CRISPR / Cas protein or endonuclease is CasX. In some embodiments, the CRISPR / Cas protein or endonuclease is CasY. In some embodiments, the CRISPR / Cas protein or endonuclease is CasΦ.

[0129] In some embodiments, the Cas9 protein is capable of inhibiting Staphylococcus aureus, Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus spp., Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporans, Ium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycois, Bacillus spp., Bacillus subtilis ... Serenity reducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderial bacteria, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanotheces sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicellulosyloptor vexii, Candidatus desulfordis , Clostridium botulinum, Clostridium difficile, Fine goldia magna, Natlanerobius thermophilus, Perotomacrum theromopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter spp., Nitrosococcus halophilus, Nitrosococcus watsonii, Pseudoalteromonas haloplanktis, Ctedonobacter racemophilus, Methanohalobium evenstigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga It may be from or derived from Moblis, Thermosipho africanus, or Acaryochromis marina.

[0130] In some embodiments, the composition comprises a CRISPR-associated (Cas) protein, or a functional fragment or derivative thereof. In some embodiments, the Cas protein is an endonuclease, including, but not limited to, a Cas9 nuclease. In some embodiments, the Cas9 protein comprises an amino acid sequence identical to the Cas9 amino acid sequence of wild-type Streptococcus pyogenes or Staphylococcus aureus. In some embodiments, the Cas protein comprises the amino acid sequence of a Cas protein from another streptococcal species, such as Thermophilus, Pseudomonas aeruginosa, Escherichia coli, or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. Other Cas proteins useful in the present disclosure are known or can be identified using methods known in the art (see, e.g., Esvelt et al., 2013, Nature Methods, 10:1116-1121). In some embodiments, the Cas protein comprises a modified amino acid sequence compared to its native source. The CRISPR / Cas protein comprises at least one RNA recognition domain and / or RNA binding domain. The RNA recognition domain and / or RNA binding domain interacts with the guide RNA (gRNA). CRISPR / Cas proteins can also include nuclease domains (i.e., DNase or RNase domains), DNA binding domains, helicase domains, RNAse domains, protein-protein interaction domains, dimerization domains, and other domains.

[0131] CRISPR / Cas-like proteins can be wild-type CRISPR / Cas proteins, modified CRISPR / Cas proteins, or fragments of wild-type or modified CRISPR / Cas proteins. CRISPR / Cas-like proteins can be modified to increase nucleic acid binding affinity and / or specificity, alter enzymatic activity, and / or change another property of the protein. For example, the nuclease (i.e., DNase, RNase) domain of a CRISPR / Cas-like protein can be modified, deleted, or inactivated. Alternatively, CRISPR / Cas-like proteins can be truncated to remove domains that are not essential for the function of the Cas protein. CRISPR / Cas-like proteins can be truncated or modified to optimize the activity of the effector domain of the Cas protein.

[0132] In some embodiments, the CRISPR / Cas-like protein can be derived from a wild-type Cas protein or a fragment thereof. In some embodiments, the CRISPR / Cas-like protein is a modified Cas9 protein. For example, the amino acid sequence of the Cas9 protein can be modified to change one or more properties of the protein (e.g., nuclease activity, affinity, stability, etc.) compared to the wild-type or another Cas protein. Alternatively, domains of the Cas9 protein that are not involved in RNA-guided cleavage can be removed from the protein so that the modified Cas9 protein is smaller than the wild-type Cas9 protein.

[0133] The disclosed CRISPR-Cas compositions should also be construed to include any form of protein having substantial homology to the Cas proteins disclosed herein (e.g., Cas9, saCas9, Cas9 proteins). In some embodiments, a protein that is "substantially homologous" is about 50% homologous, about 70% homologous, about 80% homologous, about 90% homologous, about 95% homologous, or about 99% homologous to the amino acid sequence of a Cas protein disclosed herein.

[0134] In some embodiments, the composition comprises a CRISPR-associated (Cas) peptide, or a functional fragment or derivative thereof. In certain embodiments, the Cas peptide is an endonuclease, including, but not limited to, a Cas9 nuclease. In some embodiments, the Cas9 peptide comprises an amino acid sequence identical to the wild-type Streptococcus pyogenes Cas9 amino acid sequence. In some embodiments, the Cas peptide may comprise the amino acid sequence of a Cas protein from other species, e.g., other streptococcal species such as Thermophilus, Pseudomonas aeruginosa, Escherichia coli, or other sequenced bacterial genomes and archaea, or other prokaryotic microorganisms. Other Cas peptides useful in the present disclosure are known or can be identified using methods known in the art (see, e.g., Esvelt et al., 2013, Nature Methods, 10:1116-1121). In certain embodiments, the Cas peptide may comprise a modified amino acid sequence compared to its native source. For example, in some embodiments, the wild-type Streptococcus pyogenes Cas9 sequence may be modified. In certain embodiments, the amino acid sequence can be codon-optimized for efficient expression in human cells (i.e., "humanized") or the target species. The humanized Cas9 nuclease sequence can be, for example, a Cas9 nuclease sequence encoded by any of the expression vectors listed in GenBank accession numbers KM099231.1 GL669193757; KM099232.1 GL669193761; or KM099233.1 GL669193765. Alternatively, the Cas9 nuclease sequence can be a sequence contained within a commercially available vector, such as, for example, PX330 or PX260 from Addgene (Cambridge, Massachusetts).In some embodiments, the Cas9 endonuclease can have an amino acid sequence that is a variant or fragment of any of the Cas9 endonuclease sequences of Genbank Accession Nos. KM099231.1 GL669193757; KM099232.1 GL669193761; or KM099233.1 GL669193765, or the Cas9 amino acid sequences of PX330 or PX260 (Addgene, Cambridge, MA).

[0135] The Cas9 nucleotide sequence can be modified to encode biologically active variants of Cas9, which can have an amino acid sequence that differs from wild-type Cas9 due to, for example, one or more mutations (e.g., addition, deletion, substitution mutations, or a combination of such mutations). The one or more substitution mutations can be substitutions (e.g., conservative amino acid substitutions).

[0136] In certain embodiments, the Cas peptide is a mutant Cas9, which has reduced off-target effects compared to wild-type Cas9. In some embodiments, the mutant Cas9 is a Streptococcus pyogenes Cas9 (SpCas9) mutant.

[0137] In some embodiments, the SpCas9 mutant comprises one or more point mutations, including but not limited to R780A, K810A, K848A, K855A, H982A, KI003A, and R1060A (Slaymaker et al., 2016, Science, 351(6268):84-88). In some embodiments, the SpCas9 mutant comprises a DI135E point mutation (Kleinstiver et al., 2015, Nature, 523(7561):481-485). In some embodiments, the SpCas9 mutant comprises an N497A, R661A, Q695A, Q926A, D1135E, L169A, and Y450A point mutation (Kleinstiver et al., 2016, Nature, doi:10.1038 / naturel6526). In some embodiments, the SpCas9 mutant contains one or more point mutations, including, but not limited to, M495A, M694A, and M698A. Y450 is involved in hydrophobic base stacking. N497, R661, Q695, and Q926 are involved in hydrogen bonding between bases and residues that contribute to off-target effects. N497 is involved in hydrogen bonding via the peptide backbone. L169A is involved in hydrophobic base stacking. M495A, M694A, and H698A are involved in hydrophobic base stacking.

[0138] In some embodiments, the SpCas9 mutant comprises one or more point mutations at one or more of the following residues: R780, K810, K848, K855, H982, KI003, R1060, DI135, N497, R661, Q695, Q926, L169, Y450, M495, M694, M698. In some embodiments, the SpCas9 mutant comprises one or more point mutations selected from the group consisting of R780A, K810A, K848A, K855A, H982A, K1003A, R1060A, D1135E, N497A, R661A, Q695A, Q926A, L169A, Y450A, M495A, M694A, and M698A.

[0139] In some embodiments, the SpCas9 mutant comprises point mutations N497A, R661A, Q695A, and Q926A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations N497A, R661A, Q695A, Q926A, and D1135E compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations N497A, R661A, Q695A, Q926A, and L169A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations N497A, R661A, Q695A, Q926A, and Y450A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: N497A, R661A, Q695A, Q926A, and M495A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: N497A, R661A, Q695A, Q926A, and M694A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: N497A, R661A, Q695A, Q926A, and H698A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: N497A, R661A, Q695A, Q926A, DI135E, and L169A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: N497A, R661A, Q695A, Q926A, D1135E, and Y450A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: N497A, R661A, Q695A, Q926A, D1135E, and M495A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: N497A, R661A, Q695A, Q926A, D1135E, and M694A. In some embodiments, the SpCas9 mutant comprises the following point mutations compared to wild-type SpCas9: N497A, R661A, Q695A, Q926A, D1135E, and M698A.

[0140] In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, and Q926A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, and DI135E compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, and L169A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, and Y450A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, and M495A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, and M694A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, and H698A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, DI135E, and L169A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises point mutations R661A, Q695A, Q926A, D1135E, and Y450A compared to wild-type SpCas9. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: R661A, Q695A, Q926A, D1135E, and M495A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: R661A, Q695A, Q926A, D1135E, and M694A. In some embodiments, the SpCas9 mutant comprises the following point mutations relative to wild-type SpCas9: R661A, Q695A, Q926A, D1135E, and M698A.

[0141] In some embodiments, mutant Cas9s contain one or more mutations that alter PAM specificity (Kleinstiver et al., 2015, Nature, 523(7561):481-485; Kleinstiver et al., 2015, Nat Biotechnol,33(12):1293-1298). In some embodiments, mutant Cas9s contain one or more mutations that alter the catalytic activity of Cas9, including, but not limited to, D10A in RuvC and H840A in HNH (Cong et al., 2013; Science 339:919-823; Gasiubas et al., 2012; PNAS 109:E2579-2586; Jinek et al., 2012; Science 337:816-821).

[0142] However, the present disclosure is not limited to the use of Cas9-mediated gene editing. Rather, the present disclosure encompasses the use of other CRISPR-associated peptides that can be targeted to a target sequence using a gRNA and can edit a desired target site. For example, in some embodiments, the present disclosure utilizes Cpfl to edit a target site in a subject. Cpfl is a single crRNA-guided class 2 CRISPR effector protein that can effectively edit target DNA sequences in human cells. Exemplary Cpfls include, but are not limited to, Acidaminococcus species Cpfl (AsCpfl) and Lachnospiraceae bacteria Cpfl (LbCpfl).

[0143] The present disclosure should also be construed to include any form of peptide having substantial homology to the Cas peptides disclosed herein (e.g., Cas9). Preferably, a "substantially homologous" peptide is about 50% homologous to the amino acid sequence of a Cas peptide disclosed herein, more preferably about 70% homologous, even more preferably about 80% homologous, more preferably about 90% homologous, even more preferably about 95% homologous, and even more preferably about 99% homologous.

[0144] Alternatively, the peptide may be produced by recombinant means or by cleavage from a longer polypeptide. The composition of the peptide can be confirmed by amino acid analysis or sequencing.

[0145] Variants of peptides according to the present disclosure include: (i) those in which one or more amino acid residues are substituted with conserved or non-conserved amino acid residues (preferably conserved amino acid residues), and such amino acid residues may or may not be those encoded by the genetic code; (ii) those in which one or more modified amino acid residues are present, e.g., residues modified by the attachment of a substituent; (iii) those in which the peptide is an alternative splice variant of a peptide of the present disclosure; (iv) fragments of the peptide; and / or (v) those in which the peptide is fused to another peptide, such as a leader sequence or secretory sequence or a sequence used for purification (e.g., a His tag) or detection (e.g., an Sv5 epitope tag). Fragments include peptides generated by proteolytic cleavage (including multiple proteolysis) of the original sequence. Variants may be subject to post-translational or chemical modifications. Such variations are considered to be within the scope of one skilled in the art given the teachings herein.

[0146] As known in the art, "similarity" between two peptides is determined by comparing the amino acid sequence of one polypeptide and its conserved amino acid substitutions with the sequence of a second polypeptide. A variant is defined to include a peptide sequence that differs from the original sequence, preferably by less than 40% of the residues per segment, more preferably by less than 25% of the residues per segment. More preferably, it differs by less than 10% of the residues per segment, and most preferably by only a few residues per segment, while remaining sufficiently homologous to the original sequence to preserve its function. The present disclosure includes amino acid sequences that are at least 60%, 65%, 70%, 72%, 74%, 76%, 78%, 80%, 90%, or 95% similar or identical to the original amino acid sequence. The degree of identity between two peptides can be determined using computer algorithms and methods well known to those skilled in the art. Identity between two amino acid sequences is preferably determined using the BLASTP algorithm (BLAST Manual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894; Altschul, S. et al., J. Mol. Biol. 215:403-410 (1990)).

[0147] The peptides of the present disclosure can be post-translationally modified. For example, post-translational modifications within the scope of the present disclosure include signal peptide cleavage, glycosylation, acetylation, isoprenylation, proteolysis, myristoylation, protein folding, and proteolytic processing. Some modifications or processing events require the introduction of additional biological mechanisms. For example, processing events such as signal peptide cleavage and core glycosylation can be examined by adding dog microsomal membranes or Xenopus egg extract (U.S. Patent No. 6,103,489) to a standard translation reaction.

[0148] The peptides of the present disclosure can include unnatural amino acids formed by post-translational modification or by introducing unnatural amino acids during translation. A variety of approaches are available for introducing unnatural amino acids during protein translation.

[0149] The peptides or proteins of the present disclosure can be conjugated to other molecules, such as proteins, to prepare fusion proteins, which can be achieved, for example, by synthesis of N- or C-terminal fusion proteins, provided that the resulting fusion protein retains the function of the Cas peptide.

[0150] A peptide or protein of the present disclosure can be phosphorylated using conventional methods, such as those described in Reedijk et al. (EMBO Journal 11(4):1365, 1992).

[0151] Cyclic derivatives of the peptides of the present disclosure are also part of the present disclosure. Cyclization may allow peptides to adopt a more favorable conformation for conjugation with other molecules. Cyclization can be achieved using techniques known in the art. For example, a disulfide bond can be formed between two appropriately spaced components with free sulfhydryl groups, or an amide bond can be formed between the amino group of one component and the carboxyl group of another component. Cyclization can also be formed using azobenzene-containing amino acids, as described in Ulysse, L. et al., J. Am. Chem. Soc. 1995, 117, 8466-8467. The bond-forming component can be an amino acid side chain, a non-amino acid component, or a combination of the two. In one embodiment of the present disclosure, a cyclic peptide can include a beta turn at the correct position. A beta turn can be introduced into a peptide of the present disclosure by adding the amino acids Pro-Gly at the correct position.

[0152] It may be desirable to generate cyclic peptides that are more flexible than those containing the peptide bonds described above. More flexible peptides can be prepared by introducing cysteines at the right and left positions of the peptide and forming a disulfide bridge between the two cysteines. The two cysteines are positioned to prevent deformation and rotation of the beta sheet. This peptide is more flexible due to the length of the disulfide bond and the fewer hydrogen bonds in the beta sheet portion. The relative flexibility of cyclic peptides can be determined by molecular dynamics simulations.

[0153] The present disclosure also relates to Cas peptides fused or integrated into targeting proteins and / or peptides containing targeting domains that can direct the chimeric proteins to desired cellular components or cell types or tissues. Chimeric proteins may also contain additional amino acid sequences or domains. Chimeric proteins are recombinant in the sense that the various components are derived from different sources and are not found together in nature (i.e., are heterologous).

[0154] In some embodiments, the targeting domain can be a transmembrane domain, a membrane-binding domain, or a sequence that binds the protein to, for example, a vesicle or the nucleus. In some embodiments, the targeting domain can target the peptide to a specific cell type or tissue. For example, the targeting domain can be a cell surface ligand or an antibody against a cell surface antigen of the target tissue (e.g., cancerous tissue). The targeting domain can target the peptide of the present disclosure to a cellular component. In certain embodiments, the targeting domain targets a tumor-specific antigen or a tumor-associated antigen.

[0155] N- or C-terminal fusion proteins comprising the peptides or chimeric proteins of the present disclosure linked to other molecules can be obtained by recombinantly fusing the N- or C-terminus of the peptide or chimeric protein with the sequence of a selected protein or selectable marker having a desired biological function. The resulting fusion protein contains a Cas peptide or chimeric protein fused to the selected protein or marker protein, as described herein. Examples of proteins that can be used to prepare fusion proteins include immunoglobulins, glutathione-S-transferase (GST), hemagglutinin (HA), and truncated myc.

[0156] The peptides of the present disclosure can be synthesized by conventional techniques. For example, the peptides of the present disclosure can be synthesized by chemical synthesis using solid-phase peptide synthesis. These methods use either solid-phase or liquid-phase synthesis methods (for example, for solid-phase synthesis techniques, see JM Stewart and JD Young, "Solid-Phase Peptide Synthesis", 2nd Edition, Pierce Chemical Co, Rockford IL (1984) and G. Barany and RB Merrifield, "Peptides: Analysis and Synthesis", Biology, Editors, Gross and J. Meienhofer, Vol. 2, Academic Press, New York, 1980, pp. 3-254; and for classical liquid-phase synthesis, see M Bodansky, "Principles of Peptide Synthesis", Springer-Verlag, Berlin, 1984, and E. Gross and J. Meienhofer, eds., "Peptides: Analysis and Synthesis", Biology, Vol. 1).

[0157] The peptides of the present disclosure can be prepared by standard chemical or biological means of peptide synthesis, including, but not limited to, expression of a nucleic acid encoding the peptide in a host cell or in an in vitro translation system. Biological preparation of the peptides of the present disclosure includes expression of nucleic acids encoding the desired peptides. Expression cassettes containing such coding sequences can be used to produce the desired peptides. For example, subclones of nucleic acid sequences encoding the peptides of the present disclosure can be generated using conventional molecular genetic engineering to subclone gene fragments, as described in Sambrook et al., "Molecular Cloning: A Laboratory Manual," Cold Springs Laboratory, Cold Springs Harbor, New York (2012), and Ausubel et al., "Current Protocols in Molecular Biology," John Wiley & Sons (New York, NY) (1999 and earlier editions), each of which is incorporated herein by reference in its entirety. The subclones are then expressed in bacterial cells in vitro or in vivo to produce smaller proteins or polypeptides that can be tested for specific activity.

[0158] Regarding expression vectors, vectors can be easily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method known in the art. The coding sequence of the desired peptide of the present disclosure can be codon-optimized based on the codon usage of the intended host cell to improve expression efficiency, as demonstrated herein. Codon usage patterns can be found in the literature (Nakamura et al., 2000, Nucleic Acids Res. 28:292). Representative examples of suitable hosts include bacterial cells such as Streptococcus, Staphylococcus, Escherichia coli, Streptomyces, and Bacillus subtilis cells; fungal cells such as yeast and Aspergillus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK293, and Bowes melanoma cells; and plant cells.

[0159] Many vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides bound to ionic or amphiphilic compounds, plasmids, and viruses.Therefore, the term "vector" includes autonomously replicating plasmids or viruses.This term should also be interpreted as including non-plasmid and non-viral compounds that facilitate the introduction of nucleic acid into cells, such as polylysine compounds, liposomes, etc.Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retrovirus vectors, etc.

[0160] The expression vector can be transferred into a host cell by physical, biological or chemical means, as discussed in detail elsewhere herein.

[0161] To confirm that peptides obtained from either chemical or biological synthesis techniques are the desired peptides, analysis of the peptide composition can be performed. Such amino acid composition analysis can be performed using high-resolution mass spectrometry to determine the molecular weight of the peptide. Alternatively, or in addition, the amino acid content of a peptide can be confirmed by hydrolyzing the peptide in aqueous acid and using HPLC or an amino acid analyzer to separate, identify, and quantify the components of the mixture. Protein sequenators, which sequentially degrade peptides to identify the amino acids in order, can also be used to unambiguously determine the sequence of a peptide.

[0162] The peptides and chimeric proteins of the present disclosure can be converted into pharmaceutical salts by reaction with inorganic acids such as hydrochloric acid, sulfuric acid, hydrobromic acid, phosphoric acid, and the like, or organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, succinic acid, malic acid, tartaric acid, citric acid, benzoic acid, salicylic acid, benzenesulfonic acid, toluenesulfonic acid, and the like.

[0163] In certain embodiments, gene editing systems described herein include meganucleases. In some embodiments, the gene editing system includes zinc finger nucleases (ZFNs). In some embodiments, the gene editing system includes transcription activator-like effector nucleases (TALENs). These gene editing systems can be broadly classified into two categories based on the mode of DNA recognition: ZFNs, TALENs, and meganucleases achieve specific DNA binding through protein-DNA interactions, while CRISPR-Cas systems target specific DNA sequences through short RNA guide molecules that directly base pair with the target DNA and through protein-DNA interactions. Therefore, protein targeting or nucleic acid targeting can be used to target the HSV genome described herein.

[0164] (Guide nucleic acid) In some embodiments, the composition comprises at least one isolated guide nucleic acid or fragment thereof, wherein the guide nucleic acid comprises a nucleotide sequence complementary to one or more target sequences in a herpesvirus genome. In some embodiments, the guide nucleic acid is a guide RNA (gRNA).

[0165] In some embodiments, the gRNA comprises a crRNA:tracrRNA duplex. In some embodiments, the gRNA comprises a stem-loop that mimics the natural duplex between the crRNA and tracrRNA. In some embodiments, the stem-loop comprises a nucleotide sequence comprising AGAAAU. For example, in some embodiments, the composition comprises a synthetic or chimeric guide RNA comprising a crRNA, a stem, and a tracrRNA.

[0166] In certain embodiments, the composition comprises an isolated crRNA and / or an isolated tracrRNA that hybridizes to form a natural duplex. For example, in some embodiments, the gRNA comprises a crRNA or a crRNA precursor (pre-crRNA) that includes a targeting sequence.

[0167] In some embodiments, the gRNA comprises a nucleotide sequence that is substantially complementary to a target sequence within the herpesvirus genome. The target sequence within the herpesvirus genome can be any sequence in a coding or non-coding region where CRISPR / Cas-mediated gene editing results in a mutation of the genome and an inhibition of viral infectivity. In certain embodiments, the target sequence to which the gRNA is substantially complementary is within the UL56, ICP0, ICP4, or ICP27 gene.

[0168] Exemplary gRNA nucleotide sequences targeting the ICP0 gene are: ccatggagccccgccccgga (SEQ ID NO: 1); gtacccgacggcccccgcgt (SEQ ID NO: 2); gacacgggcaccacacacca (SEQ ID NO: 3); tcccgcgtcaatcagcaccc (SEQ ID NO: 4); tcacttttcccctccccgac (SEQ ID NO: 5); ccttactcacacgcatctag (SEQ ID NO: 6); ctcaggccgcgaaccaagaa (SEQ ID NO: 7); gttcgcggcctgagccaggg (SEQ ID NO: 8); gctaaggggaaaaaggggg (SEQ ID NO: 9); tttgactcagacgcagggcc (SEQ ID NO: 10); ttttttccccttagcccgcc (SEQ ID NO: 11); caacagacagcaaaaaatccc (SEQ ID NO: 12); tcgaacagcatgttccccac (SEQ ID NO: 13); gaccctatatacagggac (SEQ ID NO: 14); gcgggagaagagggaagaag (SEQ ID NO: 15); cctggctgctgcgtctcgct (SEQ ID NO: 16); ccccacttcggtctccgcct (SEQ ID NO: 17); ggtgcgtccgaggaagaggc (SEQ ID NO: 18); gcgtcggagtggaacagcct (SEQ ID NO: 19); ggtctgcaaccaaaggtggt (SEQ ID NO: 20); ggtctgtatatataaagtca (SEQ ID NO: 21); ctcccgccctccagacgcac (SEQ ID NO: 22); gtgtctctgtgtatgagtca (SEQ ID NO: 23); tgcatcccgtgcatgaaaac (SEQ ID NO: 24); gggtaaccacgtgatgcccc (SEQ ID NO: 25); tgatgcggagagggggcggc (SEQ ID NO: 26); cgtgctgtccgcctcggagg (SEQ ID NO: 27); gaggccgccgaggacgtcag (SEQ ID NO: 28); ttacccgcggtctcggggag (SEQ ID NO: 29); ccccaccccccctagatgcgt (SEQ ID NO: 30); ctctgttgtttgcaaggggg (SEQ ID NO: 31);gaagagggaagaagaggggt (SEQ ID NO: 32); gggggagtcgctgatcacta (SEQ ID NO: 33); gcaccctgctccccgagacc (SEQ ID NO: 34); cggaagtccagggcgccccac (SEQ ID NO: 35); gatagtgggcgtgacgccca (SEQ ID NO: 36); ggcgaccccgggccctgcgt (SEQ ID NO: 37); gtctgggggtcgttcacgat (SEQ ID NO: 38); tgcatccaggttttcatgca (SEQ ID NO: 39); tcgtccgtggtgggctccgg (SEQ ID NO: 40); tccctgtatatatagtgtca (SEQ ID NO: 41); cacaacaaacacacagggac (SEQ ID NO: 42); gggaaaaaaggggggcgggt (SEQ ID NO: 43); ggggcgtctggcccctccgg (SEQ ID NO: 44); gggacgcgtggactgggggg (SEQ ID NO: 45); acccggagcccaccacggac (SEQ ID NO: 46); ccctaataaaaaaaactca (SEQ ID NO: 47); tgggggcggccctcaggccg (SEQ ID NO: 48); ccccggccctgagtcggagg (SEQ ID NO: 49); tccctgtatatatagggtca (SEQ ID NO: 50); gccctcaccgtgtgcccccc (SEQ ID NO: 51); ccactccgacgcgggggccg (SEQ ID NO: 52); acggcctcctcggcctccat (SEQ ID NO: 53); atgttccccgtctccatgtc (SEQ ID NO: 54); cccggctcccgtgtatgagt (SEQ ID NO: 55); gcgacgtgtgcgccgtgtgc (SEQ ID NO: 56); atggcgcccggctcccgtgt (SEQ ID NO: 57); gggggcgcccccgcaactgc (SEQ ID NO: 58); atgggggtcgtatgcggctg (SEQ ID NO: 59); ccctectcctcctcctcccc (SEQ ID NO: 60); gtggggcgtgtctctgtgt (SEQ ID NO: 61); ccggggaccgcggcccgcag (SEQ ID NO: 62); gtcgcggacggagggtccct (SEQ ID NO: 63);gggggcgggtaagaatgggg (SEQ ID NO: 64); cctgtggggagaggccgggg (SEQ ID NO: 65); ccttagcccgccccggatgt (SEQ ID NO: 66); aggggccatgtgtatgtgtt (SEQ ID NO: 67); atggcggccggttccagtgt (SEQ ID NO: 68); cggctggagggtcgcggacg (SEQ ID NO: 69); aggtggtctgggtccgtcct (SEQ ID NO: 70); cctatgttttccctcgtc (SEQ ID NO: 71); ccggttccagtgtaagggtc (SEQ ID NO: 72); gctccggggcggggctccat (SEQ ID NO: 73); cctcggaagaggggggagaa (SEQ ID NO: 74); gaccccggtccctgtatata (SEQ ID NO: 75); ctggccgcgccccccccggcc (SEQ ID NO: 76); ggggggttggggttggggt (SEQ ID NO: 77); ggggagggggggtcgggcg (SEQ ID NO: 78); gggggggagagggggaactc (SEQ ID NO: 79); gcggaagaggcggcccccgc (SEQ ID NO: 80); acgcgctacctgcccatctc (SEQ ID NO: 81); tgagtaaggggggcctgcgt (SEQ ID NO: 82); ggaccgggggcgccatgtta (SEQ ID NO: 83); ccccgtgtttgtggggaggg (SEQ ID NO: 84); atcctcgtccgtggtgggct (SEQ ID NO: 85); tctggcccctccggggggt (SEQ ID NO: 86); aggaggagggggggggaggg (SEQ ID NO: 87); ccacggccgcgcgggggcgc (SEQ ID NO: 88); gctcgggggggccgggcgtg (SEQ ID NO: 89); cctccagacgcaccggagtc (SEQ ID NO: 90); cgccccctgctccccggacc (SEQ ID NO: 91); ctcggcctccatgcgggtct (SEQ ID NO: 92); gggaccggggtcgccctgtt (SEQ ID NO: 93); ccctccggggggggttggggt (SEQ ID NO: 94); ggctgctggggccgcagggc (SEQ ID NO: 95);cagggccggggggggcgcggc (SEQ ID NO: 96). ;

[0169] Exemplary PAM sequences for use with gRNAs are: SEQ ID NOs: 1-96; gcgagt (SEQ ID NO: 97); cggagt (SEQ ID NO: 98); gcgggt (SEQ ID NO: 99); acgagt (SEQ ID NO: 100); acggat (SEQ ID NO: 101); gggggt (SEQ ID NO: 102); cagagt (SEQ ID NO: 103); acgagt (SEQ ID NO: 104); gcgggt (SEQ ID NO: 105); cggggt (SEQ ID NO: 106); ccggat (SEQ ID NO: 107); ctgagt (SEQ ID NO: 108); gggggt (SEQ ID NO: 109); cggggt (SEQ ID NO: 110); aggggt (SEQ ID NO: 111); ccgagt (SEQ ID NO: 112); cagagt (SEQ ID NO: 113); gcgggt (SEQ ID NO: 114); ctggat (SEQ ID NO: 115); ctgggt (SEQ ID NO: 116); gggggt (SEQ ID NO: 117); cggagt (SEQ ID NO: 118); gggggt (SEQ ID NO: 119); ctggat (SEQ ID NO: 120); ccgagt (SEQ ID NO:121); ccgagt (SEQ ID NO:122); cggagt (SEQ ID NO:123); gggggt (SEQ ID NO:124); cagggt (SEQ ID NO:125); gtgagt (SEQ ID NO:126); gcgggt (SEQ ID NO:127); cgggat (SEQ ID NO:128); tggggt (SEQ ID NO:129); gcgggt (SEQ ID NO:130); tagggt (SEQ ID NO:131); gcgggt (SEQ ID NO:132); ctgagt (SEQ ID NO:133); cgggat (SEQ ID NO:134); cgggat (SEQ ID NO:135); gtgggt (SEQ ID NO:136); cggggt (SEQ ID NO:137); cggggt (SEQ ID NO:138); aagaat (SEQ ID NO:139); gggggt (SEQ ID NO:140); aggggt (SEQ ID NO:141); gaggat (SEQ ID NO:142); ggggat (SEQ ID NO:143); gcgggt (SEQ ID NO: 144); gggggt (SEQ ID NO: 145); gggggt (SEQ ID NO: 146); cagggt (SEQ ID NO: 147); tcgggt (SEQ ID NO: 148); gcgggt (SEQ ID NO: 149); caggat (SEQ ID NO: 150); gggggt (SEQ ID NO: 151); acggat (SEQ ID NO: 152);atgagt (SEQ ID NO: 153); cggggt (SEQ ID NO: 154); gagggt (SEQ ID NO: 155); cagggt (SEQ ID NO: 156); atgagt (SEQ ID NO: 157); ccgggt (SEQ ID NO: 158); gggggt (SEQ ID NO: 159); ggggat (SEQ ID NO: 160); gggagt (SEQ ID NO: 161); ctgggt (SEQ ID NO: 162); gggggt (SEQ ID NO: 163); aaggt (SEQ ID NO: 164); gagggt (SEQ ID NO: 165); ttggat (SEQ ID NO: 166); ccgggt (SEQ ID NO: 167); gggggt (SEQ ID NO: 168); gggggt (SEQ ID NO: 169); aggggt (SEQ ID NO: 170); tagggt (SEQ ID NO: 171); ctgagt (SEQ ID NO: 172); tggggt (SEQ ID NO: 173); ctgggt (SEQ ID NO: 174); gtgggt (SEQ ID NO: 175); gggggt (SEQ ID NO: 176); gggggt (SEQ ID NO: 177); atgagt (SEQ ID NO: 178); gggggt (SEQ ID NO: 179); gggggt (SEQ ID NO: 180); ccgggt (SEQ ID NO: 181); tggggt (SEQ ID NO: 182); aggaat (SEQ ID NO: 183); gcgggt (SEQ ID NO: 184); gagggt (SEQ ID NO: 185); gggggt (SEQ ID NO: 186); SEQ ID NO: 187); acgggt (SEQ ID NO: 188); gggggt (SEQ ID NO: 189); gggggt (SEQ ID NO: 190); tggggt (SEQ ID NO: 191); gtggat (SEQ ID NO: 192); cagggt (SEQ ID NO: 193).

[0170] Exemplary gRNA nucleotide sequences for targeting the UL56 gene are: ccgcgctccataaacccgcg (SEQ ID NO: 194); ctggtttccggaagaaacag (SEQ ID NO: 195); cacggacaacaggggcccag (SEQ ID NO: 196); gcttaccgccacaggaatac (SEQ ID NO: 197); ccctctccggaggaggttgg (SEQ ID NO: 198); ttgggccctgtacagctcgc (SEQ ID NO: 199); acaagaggtcccttgtgatg (SEQ ID NO: 200); caagctatcgtagggggcg (SEQ ID NO: 201); ccgaacgacgtgcgcagcgc (SEQ ID NO: 202); cacgacagtggcataggttg (SEQ ID NO: 203); acaggggcgctttaccgccac (SEQ ID NO: 204); ctgtggcggtaagcgcccct (SEQ ID NO: 205); gcgccggagttttggccctg (SEQ ID NO: 206); cccagcagagtacggtggag (SEQ ID NO: 207); cctaggaggccgccacgcgc (SEQ ID NO: 208); tacggtggaggtgggtccgt (SEQ ID NO: 209); cggaggcggcgcaacccgac (SEQ ID NO: 210); gtgtggcgccatgctgtatt (SEQ ID NO: 211); tcgggcgcgtggcggcctcc (SEQ ID NO: 212).

[0171] PAM sequences for use with SEQ ID NOs: 194-212 include: tcgggt (SEQ ID NO: 213); gggggt (SEQ ID NO: 214); cagagt (SEQ ID NO: 215); cagaat (SEQ ID NO: 216); cggaat (SEQ ID NO: 217); gcgaat (SEQ ID NO: 218); tcgggt (SEQ ID NO: 219); ggggat (SEQ ID NO: 220); cggagt (SEQ ID NO: 221); gggggt (SEQ ID NO: 222); aggaat (SEQ ID NO: 223); gtgagt (SEQ ID NO: 224); gcgggt (SEQ ID NO: 225); gtgggt (SEQ ID NO: 226); ccgagt (SEQ ID NO: 227); gggggt (SEQ ID NO: 228); gcgggt (SEQ ID NO: 229); tggggt (SEQ ID NO: 230); tagggt (SEQ ID NO: 231).

[0172] 110 off-target gRNA sequences: cagcactgcataaaccctcg (SEQ ID NO: 232); ccgctttccgtaaacccggg (SEQ ID NO: 233); ccgcggttcctaaaaccgcg (SEQ ID NO: 234); ccgggctccctgaactcgcg (SEQ ID NO: 235); gcgggctccataaagccccg (SEQ ID NO: 236); ccggggtccataaaccctct (SEQ ID NO: 237); ccacgctccatcaaccctcc (SEQ ID NO: 238); ccgagctccatctacccacg (SEQ ID NO: 239); ccgccctccacagacacgcg (SEQ ID NO: 240); ccgcactccatgcacgcgcg (SEQ ID NO: 241); ccgccctccagaaagccccg (SEQ ID NO: 242); ccgcgctcccaaaagccccg (SEQ ID NO: 243).

[0173] PAM sequences for use in SEQ ID NOs: 232-231 include: cagga (SEQ ID NO: 244); ccggg (SEQ ID NO: 245); gtgaa (SEQ ID NO: 246); ccggg (SEQ ID NO: 247); ctgga (SEQ ID NO: 248); gggaa (SEQ ID NO: 249); ctgaa (SEQ ID NO: 250); ccgag (SEQ ID NO: 251); cgggg (SEQ ID NO: 252); atggg (SEQ ID NO: 253); cgggg (SEQ ID NO: 254); gcggg (SEQ ID NO: 255).

[0174] 417 off-target gRNA sequences: ctcctttccagaagaaacag (SEQ ID NO: 256); ctggtttctgtaagaaacag (SEQ ID NO: 257); ctcctttctggaagaaacag (SEQ ID NO: 258); gtggtttccaaaagaaacag (SEQ ID NO: 259); taagtttcctgaagaaacag (SEQ ID NO: 260); gttttttcctgaagaaacag (SEQ ID NO: 261); ctgtatttcagaagaaacag (SEQ ID NO: 262); atgtttcccagaagaaacag (SEQ ID NO: 263); gttgtttgaggaagaaacag (SEQ ID NO: 264); aagatttcaggaagaaacag (SEQ ID NO: 265); ctcgctacctgaagaaacag (SEQ ID NO: 266); attctttctggaagaaacag (SEQ ID NO: 267); ctggcttcggcaagaaacag (SEQ ID NO: 268); caggtttctggaagaatcag (SEQ ID NO: 269); ctggcttctggaagaagcag (SEQ ID NO: 270); ctggattcctgaaggaacag (SEQ ID NO: 271); ttggtttgctgaagaaacgg (SEQ ID NO: 272); ctgtttaagggaagaaacag (SEQ ID NO: 273); gtgatttctgcaagaaacag (SEQ ID NO: 274); ctagcagccggaagaaacag (SEQ ID NO: 275); atagtttctgaaagaaacag (SEQ ID NO: 276); ttggtttatgaaagaaacag (SEQ ID NO: 277); cttgtatggggaagaaacag (SEQ ID NO: 278); cttttgtcaggaagaaacag (SEQ ID NO: 279); ctgccctctggaagaaacag (SEQ ID NO: 280); ctcatttctggaagaaaacaa (SEQ ID NO: 281); ctggttaggagaagaaacag (SEQ ID NO: 282); ctgccttctggaagaaaacaa (SEQ ID NO: 283); ctgatttaggaaagaaacag (SEQ ID NO: 284); cttgtttttgggagaaacag (SEQ ID NO: 285); cttgttttggggagaaacag (SEQ ID NO: 286);ctgctttgagggaagaaacag (SEQ ID NO: 287); atggtttcatgtagaaacag (SEQ ID NO: 288); catgtttcaggaagaatcag (SEQ ID NO: 289); ttggtttacagaaggaacag (SEQ ID NO: 290); ctggtgtcccgaagtaacag (SEQ ID NO: 291); ctggtttgtaaaagaaacag (SEQ ID NO: 292); ttgttttcaggaggaaacag (SEQ ID NO: 293); ctggcttcccctaagaaacaa (SEQ ID NO: 294); caggtttgaggacgaaacag (SEQ ID NO: 295); gtggattcctgaagaaaaag (SEQ ID NO: 296); ctgcttttaggaggaaacag (SEQ ID NO: 297); cgggcttcctgaagaaagag (SEQ ID NO: 298); ctggtgcgaggaagaaacag (SEQ ID NO: 299); ctgcattccagaagaaaaag (SEQ ID NO: 300); atggtttcctgaagaatcaa (SEQ ID NO: 301); ctgatttacagaagaaaaag (SEQ ID NO: 302); ctgttttactgaagaaagag (SEQ ID NO: 303); gtgatttccagaagacacag (SEQ ID NO: 304); gtggtgtctggcagaaacag (SEQ ID NO: 305).

[0175] PAM sequences for use in SEQ ID NOs: 256-305 include: tagaa (SEQ ID NO:306); cagga (SEQ ID NO:307); tggga (SEQ ID NO:308); atgag (SEQ ID NO:309); taggg (SEQ ID NO:310); caggg (SEQ ID NO:311); tcgaa (SEQ ID NO:312); aagag (SEQ ID NO:313); aagga (SEQ ID NO:314); aagga (SEQ ID NO:315); gaga (SEQ ID NO:316); caggg (SEQ ID NO:317); gagag (SEQ ID NO:318); aagaa (SEQ ID NO:319); agggg (SEQ ID NO:320); tagga (SEQ ID NO:321); tggaa (SEQ ID NO:322); caggg (SEQ ID NO:323); ctgaa (SEQ ID NO:324); ttgaa (SEQ ID NO:325); aagaa (SEQ ID NO:326); cggag (SEQ ID NO:327); tagaa (SEQ ID NO:328); ctgaa (SEQ ID NO:329); aagag (SEQ ID NO:330); gaggg (SEQ ID NO:331); gaga (SEQ ID NO:332); aagaa (SEQ ID NO:333); gaga (SEQ ID NO:334); aaggg (SEQ ID NO:335); cagga (SEQ ID NO:336); ttgaa (SEQ ID NO:337); tagaa (SEQ ID NO:338); ttggg (SEQ ID NO:339); aagaa (SEQ ID NO:340); cagag (SEQ ID NO:341); cagga (SEQ ID NO:342); tggga (SEQ ID NO:343); tggaa (SEQ ID NO:344); ctggg (SEQ ID NO:345); ctggg (SEQ ID NO:346); cagga (SEQ ID NO:347); gaga (SEQ ID NO:348); gggag (SEQ ID NO:349); aagga (SEQ ID NO:350); tagaa (SEQ ID NO:351); aagga (SEQ ID NO:352); aaggg (SEQ ID NO:353); aggga (SEQ ID NO:354); caggg (SEQ ID NO:355).

[0176] In certain embodiments, the sequence of the gRNA that is substantially complementary to the target is about 10-30 nucleotides in length. In certain embodiments, the gRNA comprises a nucleotide sequence that binds to a target sequence in the HSV genome. For example, in certain embodiments, the gRNA comprises a nucleotide sequence that is substantially complementary to the target sequence and thus binds to the target sequence. For example, in certain embodiments, the gRNA is substantially complementary to a target sequence in the HSV genome selected from the group consisting of: TCTGGGTGTTTCCCTGCGACCGAGACCTGC (SEQ ID NO: 356, "2A"); GGACAGCACGGACACGGAACTGTTCGAGACG (SEQ ID NO: 357, "2B"); GCATCCCGTGCATGAAAAC (SEQ ID NO: 358, "2C"); TGTGCAACGCCAAGCTGGTGTACCTGATAG-3′ (SEQ ID NO: 359, “2D”); GCGAGTACCCGCCGGCCTGA (SEQ ID NO: 360, "1"); GCGAGCCGCGGCGCCGCGGG (SEQ ID NO: 361, "3"); TTCTACGCGCGCTATCGCGA (SEQ ID NO: 362, "ICP4 ml"); GGAGTGTTCCTCGTCGGACG (SEQ ID NO: 363, "ICP27ml")

[0177] In certain embodiments, the target sequence precedes the PAM sequence. For example, in some embodiments, the target sequence precedes the NGG PAM sequence. An exemplary target sequence + PAM sequence (PAM sequence is underlined) is as follows: TCTGGGTGTTTCCCTGCGACCGAGACCTGCCGG (SEQ ID NO: 364, "2A"); GGACAGCACGGACACGGAACTGTTCGAGACGGGG (SEQ ID NO: 365, "2B") GCATCCCGTGCATGAAAACCTGG (SEQ ID NO: 366, "2C"); TGTGCAACGCCAAGCTGGTGTACCTGATAGTGG (SEQ ID NO: 367, "2D"); GCGAGTACCCGCCGGCCTGAGGG (SEQ ID NO: 368, "1"); GCGAGCCGCGGCGCCGCGGGGGG (SEQ ID NO: 369, "3"); TTCTACGCGCGCTATCGCGACGG (SEQ ID NO: 370, "ICP4ml"); GGAGTGTTCCTCGTCGGACGAGG (SEQ ID NO: 371, "ICP27ml"); GTACCCGACGGCCCCCGCGTCGGAGT (SEQ ID NO: 372, "ICP0-M1"); CTCAGGCCGCGAACCAAGAACAGAGT (SEQ ID NO: 373, "ICP0-M2"); AATCCTAGACACGCACCGCCAGGAGT (SEQ ID NO: 374, "ICP27-M1"); TCGCCAGCGTCATTAGCGGGGGGGGT (SEQ ID NO: 375, "ICP27-M2"); AATCCTAGACACGCACCGCC (SEQ ID NO: 376, "ICP27-M1"); TCGCCAGCGTCATTAGCGGG (SEQ ID NO: 377, "ICP27-M2")

[0178] Additionally, the present disclosure encompasses isolated nucleic acids (e.g., gRNAs) having substantial homology to the nucleic acids disclosed herein. In certain embodiments, the isolated nucleic acids have at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence homology to the nucleotide sequences of gRNAs described elsewhere herein.

[0179] Guide RNA sequences can be sense or antisense. In the CRISPR-Cas system from P. pyogenes, the target DNA typically precedes a 5´-NGG protospacer adjacent motif (PAM). Other Cas9 orthologs may have different PAM specificities. For example, Cas9 from S. thermophilus requires 5´-NNAGAA for CRISPR1 and 5´-NGGNG for CRISPR3, while Neisseria meningitidis requires 5´-NNNNGATT. While the specific sequence of the guide RNA varies, regardless of the sequence, a useful guide RNA sequence will achieve highly efficient mutation of the herpesvirus target sequence while minimizing off-target effects. While the specific sequence of the guide RNA varies, regardless of the sequence, a useful guide RNA sequence will achieve highly efficient editing of the HSV genome while minimizing off-target effects. The length of the guide RNA sequence can vary from about 20 nucleotides to about 60 nucleotides or more, for example, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40, about 45, about 50, about 55, about 60 or more nucleotides. Useful selection methods identify regions of very low homology between the foreign viral genome and the host cell genome, including bioinformatics screening using target sequence + NGG target selection criteria to exclude off-target human transcriptome or (rarely) untranslated genomic sites, as well as WGS, Sanger sequencing, and SURVEYOR assays to identify and exclude potential off-target effects. Algorithms such as the CRISPR Design Tool (CRISPR Genome Engineering Resources; Broad Institute) can be used to identify the essential PAM sequence or a target sequence close to it, as defined by the type of Cas peptide used (i.e., Cas9, Cas9 variant, Cpfl).

[0180] In certain embodiments, compositions comprise multiple different gRNAs, each targeting a different target sequence. In certain embodiments, this multiplexing strategy results in improved efficacy. In some embodiments, compositions described herein utilize from about 1 gRNA to about 6 gRNAs. In some embodiments, compositions described herein utilize at least about 1 gRNA. In some embodiments, compositions described herein utilize up to about 6 gRNAs. In some embodiments, compositions described herein utilize from about 1 gRNA to about 2 gRNAs, from about 1 gRNA to about 3 gRNAs, from about 1 gRNA to about 4 gRNAs, from about 1 gRNA to about 5 gRNAs, from about 1 gRNA to about 6 gRNAs, from about 2 gRNA to about 3 gRNAs, from about 2 gRNA to about 4 gRNAs, from about 2 gRNA to about 5 gRNAs, from about 2 gRNA to about 6 gRNAs, from about 3 gRNA to about 4 gRNAs, from about 3 gRNA to about 5 gRNAs, from about 3 gRNA to about 6 gRNAs, from about 4 gRNA to about 5 gRNAs, from about 4 gRNA to about 6 gRNAs, or from about 5 gRNA to about 6 gRNAs. In some embodiments, the compositions described herein utilize about 1 gRNA, about 2 gRNA, about 3 gRNA, about 4 gRNA, about 5 gRNA, or about 6 gRNA.

[0181] In certain embodiments, RNA (e.g., crRNA, tracrRNA, gRNA) can be engineered to contain one or more modified nucleobases. For example, known modifications of RNA can be found, for example, in Genes VI, Chapter 9, "Interpreting the Genetic Code," edited by Lewis (1997, Oxford University Press, New York) and "Revising and Editing RNA," edited by Grosjean and Benne (1998, ASM Press, Washington, DC). Modified RNA components include: N4-methylcytidine; N4-2´-O-dimethylcytidine; N4-acetylcytidine; 5-methylcytidine; 5,2´-O-dimethylcytidine; 5-hydroxymethylcytidine; 5-formylcytidine; 2´-O-methyl-5-formylcytidine; 3-methylcytidine; 2-thiocytidine; lysidine; 2´-O-methyluridine; 2-thiouridine; 2-thio-2´-O-methyluridine; 3,2´-O-dimethyluridine; 3-(3-amino-3-carboxypropyl)uridine; 4-thiouridine; ribosylthymine; 5,2´-O-dimethyluridine; 5-methyl-2-thiouridine; 5-hydroxyuridine; 5-methoxyuridine; uridine 5-hydroxyacetic acid; uridine 5-hydroxyacetic acid methyl ester; 5-Carboxymethyluridine; 5-Methoxycarbonylmethyluridine; 5-Methoxycarbonylmethyl-2´-O-methyluridine; 5-Methoxycarbonylmethyl-2´-thiouridine; 5-Carbamoylmethyluridine; 5-Carbamoylmethyl-2´-O-methyluridine; 5-(Carboxyhydroxymethyl)uridine; 5-(Carboxyhydroxymethyl)uridine methyl ester; 5-Aminomethyl-2-thiouridine; 5-Methylaminomethyluridine; 5-Methylaminomethyl-2-thiouridine; 5-Methylaminomethyl-2-selenouridine; 5-Carboxymethylaminomethyluridine; 5-Carboxymethylaminomethyl-2´-O-methyluridine; 5-Carboxymethylaminomethyl-2-thiouridine; Dihydrouridine; Dihydroribosylthymine; 2´-Methyladenosine; 2-Methyladenosine; N6N-MethyladenosineN6,N6-Dimethyladenosine; N6,2´-O-Trimethyladenosine; 2-Methylthio-N6N-isopentenyladenosine; N6-(cis-Hydroxyisopentenyl)-adenosine; 2-Methylthio-N6-(cis-Hydroxyisopentenyl)-adenosine; N6-Glycinylcarbamoyladenosine; N6-Threonylcarbamoyl adenosine; N6-Methyl-N6-threonylcarbamoyl adenosine; 2-Methylthio-N6-methyl-N6-threonylcarbamoyl adenosine; N6-Hydroxynorvalylcarbamoyl adenosine; 2-Methylthio-N6-hydroxynorvalylcarbamoyl adenosine; 2´-O-Ribosyladenosine (phosphate); Inosine; 2´O-Methylinosine; 1-Methylinosine; 1;2´-O-Dimethylinosine; 2´-O-Methylguanosine; 1-Methylguanosine; N2-Methylguanosine; N2,N2-Dimethylguanosine; N2,2´-O-Dimethylguanosine; N2,N2,2´-O-Trimethylguanosine; 2´-O-Ribosylguanosine(phosphate); 7-Methylguanosine; N2;7-Dimethylguanosine; N2; N2;7-Trimethylguanosine; Wyosine; Methylwosine; Undermodified Hydroxywybutosine; Wybutosine; Hydroxywybutosine; Peroxywybutosine; Queuosine; Epoxyqueousine; Galactosyl-queousine; Mannosyl-queousine; 7-Cyano-7-deazaguanosine; Aracheeosine [also known as 7-formamido-7-deazaguanosine]; and 7-aminomethyl-7-deazaguanosine. Additional modified RNAs can be identified using the methods of this disclosure or other methods in the art.

[0182] In some embodiments, the gRNA is a synthetic oligonucleotide. In some embodiments, the synthetic nucleotides include modified nucleotides. Internucleoside linker (i.e., backbone) modifications can be used to improve stability or pharmacodynamic properties. For example, internucleoside linker modifications prevent or reduce degradation by cellular nucleases, thereby increasing the pharmacokinetics and bioavailability of the gRNA. Generally, modified internucleoside linkers include any linker other than a phosphodiester (PO) liner that covalently links two nucleosides. In some embodiments, modified internucleoside linkers increase the nuclease resistance of the gRNA compared to phosphodiester linkers. In naturally occurring oligonucleotides, the internucleoside linker includes a phosphate group that forms a phosphodiester bond between adjacent nucleosides. In some embodiments, the gRNA includes one or more internucleoside linkers modified from natural phosphodiester. In some embodiments, the internucleoside linker of the gRNA, or all of its contiguous nucleotide sequence, is modified. For example, in some embodiments, the internucleoside linkages include sulfur (S), such as phosphorothioate internucleoside linkages.

[0183] Modifications to the ribose sugar or nucleobases can also be utilized in the present invention. Generally, modified nucleosides involve the introduction of one or more modifications to the sugar or nucleobase moieties. In some embodiments, gRNAs comprise one or more nucleosides containing a modified sugar moiety, as described herein, where the modified sugar moiety is a modification of the sugar moiety compared to the ribose sugar moiety found in deoxyribose nucleic acids (DNA) and RNA. Numerous nucleosides with modifications to the ribose sugar moiety are available, primarily for the purpose of improving specific properties of the oligonucleotide, such as affinity and / or stability. These modifications include modifications to the ribose ring structure. These modifications include substitution with a hexose ring (HNA), a bicyclic ring with a biradical bridge between the C2 and C4 carbons of the ribose ring (e.g., locked nucleic acids (LNA)), or an unlinked ribose ring, which typically lacks a bond between the C2 and C3 carbons (e.g., UNA). Other sugar-modified nucleosides include, for example, bicyclohexose or tricyclic nucleic acids. Modified nucleosides also include nucleosides in which a sugar moiety is replaced with a non-sugar moiety, for example, in the case of peptide nucleic acids (PNAs) or morpholino nucleic acids.

[0184] Sugar modifications include those made by changing the substituent on the ribose ring to a group other than hydrogen or to a group other than the 2'-OH group naturally found in DNA and RNA nucleosides. Substituents can be introduced, for example, at the 2', 3', 4', or 5' positions. Nucleosides with modified sugar moieties also include 2'-modified nucleosides, such as 2'-substituted nucleosides. Indeed, much effort has been expended in the development of 2'-substituted nucleosides, and many 2'-substituted nucleosides have been found to possess beneficial properties when incorporated into oligonucleotides, such as improved nucleoside tolerance and affinity. 2'-sugar-modified nucleosides are nucleosides with a substituent other than H or -OH at the 2' position (2'-substituted nucleosides) or nucleosides containing a 2'-linked biradical, including 2'-substituted nucleosides and LNA (2'-4' biradical bridge) nucleosides. Examples of 2'-substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA, and 2'-F-ANA nucleosides. By way of further example, in some embodiments, the modification in the ribose group comprises a modification at the 2' position of the ribose group. In some embodiments, the modification at the 2' position of the ribose group is selected from the group consisting of 2'-O-methyl, 2'-fluoro, 2'-deoxy, and 2'-O-(2-methoxyethyl).

[0185] In some embodiments, the gRNA comprises one or more modified sugars. In some embodiments, the gRNA comprises only modified sugars. In specific embodiments, the gRNA comprises more than 10%, 25%, 50%, 75%, or 90% modified sugars. In some embodiments, the modified sugar is a bicyclic sugar. In some embodiments, the modified sugar comprises a 2'-O-methoxyethyl group. In some embodiments, the gRNA comprises both an internucleoside linker modification and a nucleoside modification.

[0186] Target specificity can be used in reference to a guide RNA or crRNA that is specific for a target polynucleotide sequence or region (e.g., the ICP0 or ICP27 gene of a herpesvirus genome) and further comprises a sequence of nucleotides that can selectively anneal / hybridize to a target polynucleotide (e.g., corresponding to a target), e.g., a target (sequence or region) of a target DNA. In some embodiments, the crRNA or derivative thereof comprises a target-specific nucleotide region that is complementary to a region of the target DNA sequence. In some embodiments, the crRNA or derivative thereof comprises other nucleotide sequences other than the target-specific nucleotide region. In some embodiments, the other nucleotide sequence is derived from the tracrRNA sequence.

[0187] A gRNA is generally supported by a scaffold, where a scaffold refers to a portion of a gRNA or crRNA molecule that contains a sequence that is substantially identical or highly conserved (e.g., does not confer target specificity) across naturally occurring biological species. A scaffold includes the tracrRNA segment and portions of the crRNA segment other than the polynucleotide targeting guide sequence at or near the 5' end of the crRNA segment, excluding any unnatural portions containing sequences that are not conserved in naturally occurring crRNAs and tracrRNAs. In some embodiments, the crRNA or tracrRNA contains modified sequences. In certain embodiments, the crRNA or tracrRNA contains at least 1, 2, 3, 4, 5, 10, or 15 modified bases (e.g., modified naturally occurring base sequences).

[0188] As used herein, "complementary" generally refers to a polynucleotide containing a nucleotide sequence that can selectively anneal to a discriminator region of a target polynucleotide under specific conditions. As used herein, the term "substantially complementary" and grammatical equivalents are intended to refer to a polynucleotide containing a nucleotide sequence that can specifically anneal to a discriminator region of a target polynucleotide under specific conditions. Annealing refers to the nucleotide base-pairing interaction of one nucleic acid with another, resulting in the formation of a duplex, triplex, or other higher-order structure. Primary interactions are typically nucleotide base-specific (A:T, A:U, G:C, etc.) through Watson-Crick and Hoogsteen hydrogen bonding. In some embodiments, base stacking and hydrophobic interactions may also contribute to duplex stability. Conditions under which a polynucleotide anneals to a complementary or substantially complementary region of a target nucleic acid are described, for example, in "Nucleic Acid Hybridization, A Practical Approach," edited by Hames and Higgins, IRL Press, Washington, DC (1985) and Wetmur and Davidson, Molecular Biology 31:349 (1968). Annealing conditions depend on the specific application and can be routinely determined by one of ordinary skill in the art without undue experimentation. Hybridization generally refers to the process by which two single-stranded polynucleotides non-covalently bind to form a stable double-stranded polynucleotide. The resulting double-stranded polynucleotide is a "hybrid" or "duplex." In certain instances, hybridization does not require 100% sequence identity; in certain embodiments, hybridization occurs at greater than about 70%, 75%, 80%, 85%, 90%, or 95% sequence identity. In certain embodiments, sequence identity includes sequences containing insertions and / or deletions in addition to non-identical nucleobases.

[0189] Nucleic acids of the present disclosure, including RNA (e.g., crRNA, tracrRNA, gRNA) or nucleic acids encoding RNA, can be generated by standard techniques. For example, polymerase chain reaction (PCR) techniques can be used to obtain isolated nucleic acids containing the nucleotide sequences described herein, including nucleotide sequences encoding the polypeptides described herein. PCR can be used to amplify specific sequences from DNA and RNA, including sequences from total genomic DNA or total cellular RNA. Various PCR methods are described, for example, in PCR Primer: A Laboratory Manual, 2nd Edition, edited by Dieffenbach and Dveksler, Cold Spring Harbor Laboratory Press, 2003. Oligonucleotide primers are used to design sequences identical or similar to opposite strands of the template to be amplified. Various PCR strategies are also available that can introduce site-specific nucleotide sequence modifications into a template nucleic acid.

[0190] Isolated nucleic acids can be chemically synthesized as single nucleic acids (e.g., using automated 3' to 5' DNA synthesis using phosphoramidite technology) or as a series of oligonucleotides. Isolated nucleic acids of the present disclosure can also be obtained, for example, by mutagenesis of naturally occurring partial crRNA, tracrRNA, DNA encoding RNA, or DNA encoding Cas9.

[0191] In certain embodiments, the isolated RNA is synthesized from an expression vector encoding the RNA molecule, as described in detail elsewhere herein.

[0192] (Nucleic Acids and Vectors) In some embodiments, a composition of the present disclosure comprises an isolated nucleic acid encoding one or more elements of a CRISPR-Cas system described herein. For example, in some embodiments, a composition comprises an isolated nucleic acid encoding at least one guide nucleic acid (e.g., gRNA). In some embodiments, a composition comprises an isolated nucleic acid encoding a Cas peptide, or a functional fragment or derivative thereof. In some embodiments, a composition comprises an isolated nucleic acid encoding at least one guide nucleic acid (e.g., gRNA) and encoding a Cas peptide, or a functional fragment or derivative thereof. In some embodiments, a composition comprises an isolated nucleic acid encoding at least one guide nucleic acid (e.g., gRNA) and further comprising an isolated nucleic acid encoding a Cas peptide, or a functional fragment or derivative thereof.

[0193] In some embodiments, the composition comprises at least one isolated nucleic acid encoding a gRNA, as described elsewhere herein, wherein the gRNA is substantially complementary to a target sequence in the HSV genome. In some embodiments, the composition comprises at least one isolated nucleic acid encoding a gRNA, wherein the gRNA has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence identity to a target sequence described herein.

[0194] In some embodiments, the compositions comprise at least one isolated nucleic acid encoding a Cas peptide described elsewhere herein, or a functional fragment or derivative thereof, hi some embodiments, the compositions comprise at least one isolated nucleic acid encoding a Cas peptide having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% amino acid sequence homology to a Cas peptide described elsewhere herein.

[0195] The isolated nucleic acid can comprise any type of nucleic acid, including but not limited to DNA and RNA.For example, in some embodiments, the composition comprises an isolated DNA, including, for example, an isolated cDNA encoding the gRNA or peptide of the present disclosure, or a functional fragment thereof.In some embodiments, the composition comprises an isolated RNA encoding the peptide of the present disclosure, or a functional fragment thereof.The isolated nucleic acid can be synthesized using any method known in the art.

[0196] The present disclosure can include the use of vectors into which the isolated nucleic acids described herein are inserted. The art is replete with suitable vectors useful in the present disclosure. Vectors include, for example, viral vectors (such as adenoviruses ("Ad"), adeno-associated viruses (AAV), vesicular stomatitis viruses (VSV), and retroviruses), liposomes and other lipid-containing complexes, and other macromolecular complexes capable of mediating delivery of polynucleotides to host cells. Vectors can also contain other components or functions that further regulate gene delivery and / or gene expression or provide beneficial properties to target cells. Such other components include, for example, components that affect cell binding or targeting (including components that mediate cell-type or tissue-specific binding); components that affect cellular uptake of vector nucleic acid; components that affect intracellular localization of the polynucleotide after uptake (such as agents that mediate nuclear localization); and components that affect polynucleotide expression. Such components can also include markers, such as detectable and / or selectable markers, that can be used to detect or select cells that have taken up and are expressing the nucleic acid delivered by the vector. Such components may be provided as natural features of the vector (such as the use of certain viral vectors that have components or functions that mediate binding and uptake), or the vector may be modified to provide such functions. Other vectors include those described in Chen et al., BioTechniques, 34: 167-171 (2003); A wide variety of such vectors are known in the art and are generally available.

[0197] Briefly, the expression of natural or synthetic nucleic acids encoding RNA and / or peptides is typically achieved by operably linking the nucleic acid encoding the RNA and / or peptide or a portion thereof to a promoter and incorporating the construct into an expression vector. The vector used is suitable for replication in eukaryotic cells and, in some cases, for integration. Typical vectors include transcription and translation terminators, initiation sequences, and promoters useful for regulating the expression of the desired nucleic acid sequence.

[0198] The vector of the present disclosure can also be used for nucleic acid immunization and gene therapy using standard gene delivery protocols.Gene delivery methods are known in the art.See, for example, U.S. Patent Nos. 5,399,346, 5,580,859, and 5,589,466, the entire contents of which are incorporated herein by reference.In another embodiment, the present disclosure provides a gene therapy vector.

[0199] The isolated nucleic acids of the present disclosure can be cloned into many types of vectors. For example, the nucleic acids can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0200] Furthermore, vectors can be provided to cells in the form of viral vectors.Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals.Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, and lentiviruses.In general, suitable vectors contain a replication origin that functions in at least one organism, a promoter sequence, a convenient restriction endonuclease site, and one or more selection markers (e.g., WO01 / 96584, WO01 / 29058, and U.S. Patent No. 6,326,193).

[0201] Many virus-based systems have been developed for gene transfer into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. A selected gene can be inserted into a vector using techniques known in the art and packaged into retroviral particles. The recombinant virus can then be isolated and delivered to cells of a subject in vivo or ex vivo. Many retroviral systems are known in the art. In some embodiments, adenoviral vectors are used. Many adenoviral vectors are known in the art. In some embodiments, lentiviral vectors are used.

[0202] For example, vectors derived from retroviruses, such as lentiviruses, are suitable tools for achieving long-term gene transfer because they allow long-term stable integration of the transgene and its propagation in daughter cells. Lentiviral vectors have an additional advantage over vectors derived from oncoretroviruses, such as murine leukemia viruses, in that they can transduce non-proliferating cells, such as hepatocytes. They also have the added benefit of low immunogenicity. In some embodiments, the composition comprises a vector derived from an adeno-associated virus (AAV). Adeno-associated virus (AAV) vectors have become powerful gene delivery tools for the treatment of various diseases. AAV vectors possess many characteristics that make them ideally suited for gene therapy, including lack of pathogenicity, minimal immunogenicity, and the ability to transduce post-mitotic cells in a stable and efficient manner. By selecting the appropriate combination of AAV serotype, promoter, and delivery method, expression of a specific gene contained within the AAV vector can be specifically targeted to one or more cell types.

[0203] Further provided herein are nucleic acids encoding the CRISPR-Cas systems described herein. Provided herein are adeno-associated virus (AAV) vectors comprising nucleic acids encoding the CRISPR-Cas systems described herein. In particular examples, AAV vectors include any vector that contains or is derived from AAV components and is suitable for infecting mammalian cells (including human cells) of any of a number of tissue types, such as brain, heart, lung, skeletal muscle, liver, kidney, spleen, or pancreas, in vitro or in vivo. In particular examples, AAV vectors comprise AAV-type virus particles (or virions) that contain a nucleic acid encoding a protein of interest (e.g., a CRISPR-Cas system described herein). In some embodiments, as further described herein, the AAV disclosed herein are derived from various serotypes, including combinations of serotypes (e.g., "pseudotyped" AAV), or from various genomes (e.g., single-stranded or self-complementary). In some embodiments, the AAV vector is a human serotype AAV vector. In such embodiments, the human AAV serotype is derived from any known serotype, for example, AAV1, AAV2, AAV4, AAV6, or AAV9. In some embodiments, the serotype is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ / 8.

[0204] In some embodiments, the composition comprises a vector derived from an adeno-associated virus (AAV). AAV vectors possess many characteristics that make them ideally suited for gene therapy, including lack of pathogenicity, minimal immunogenicity, and the ability to transduce post-mitotic cells in a stable and efficient manner. By selecting the appropriate combination of AAV serotype, promoter, and delivery method, expression of a particular gene contained within the AAV vector can be specifically targeted to one or more cell types. Although various different AAV capsids have been described and can be used, AAV that preferentially targets liver and / or delivers genes with high efficiency is particularly desirable.The sequence of AAV8 can be obtained from various databases.In the embodiment, the AAV vector with the same capsid is used, and the capsid of gene editing vector and the capsid of AAV targeting vector are the same AAV capsid.Another suitable AAV is, for example, rhl0 (see WO2003 / 042397). Still other AAV sources include, for example, AAV9 (see, e.g., U.S. Patent No. 7,906,111; U.S. Patent Application Publication No. 2011-0236353-A1), and / or hu37 (see, e.g., U.S. Patent No. 7,906,111; U.S. Patent Application Publication No. 2011-0236353-A1), AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV6.2, AAV7, and AAV8 (see, U.S. Patent No. 7,790,449; U.S. Patent No. 7,282,199; WO2003 / 042397; WO2005 / 033321; WO2006 / 110689; U.S. Patent No. 7,790,449; U.S. Patent No. 7,282,199; U.S. Patent No. 7,588,772). Additionally, alternatively, other AAVs can be selected taking into account the tissue preference of the selected AAV capsid.

[0205] In some embodiments, the AAV vectors disclosed herein comprise a nucleic acid encoding the CRISPR-Cas system described herein. In some embodiments, the nucleic acid also comprises one or more regulatory sequences that enable expression, and in some embodiments, secretion, of a protein of interest, such as, for example, a promoter, an enhancer, a polyadenylation signal, an internal ribosome entry site ("IRES"), or a sequence encoding a protein transduction domain ("PTD"). Thus, in some embodiments, the nucleic acid comprises a promoter region operably linked to a coding sequence to cause or improve expression of the protein of interest in infected cells. Such promoters can be ubiquitous, cell- or tissue-specific, strong, weak, regulated, chimeric, etc., to enable efficient and stable production of the protein in infected tissues, for example. In certain embodiments, the promoter is homologous or heterologous to the encoded protein, although generally, promoters used in the disclosed methods function in human cells. Examples of regulated promoters include, but are not limited to, Tet on / off element-containing promoters, rapamycin-inducible promoters, tamoxifen-inducible promoters, and metallothionein promoters. In certain embodiments, other promoters used include promoters specific to tissues such as kidney, spleen, and pancreas. Examples of ubiquitous promoters include viral promoters, particularly the CMV promoter, RSV promoter, SV40 promoter, and the like, and cellular promoters such as the phosphoglycerate kinase (PGK) promoter and the β-actin promoter.

[0206] In some embodiments, a recombinant AAV vector comprises a nucleic acid packaged within an AAV capsid, generally comprising a 5' AAV ITR, an expression cassette as described herein, and a 3' AAV ITR. As described herein, in some embodiments, the expression cassette comprises regulatory elements for the open reading frames within each expression cassette, and the nucleic acid optionally comprises additional regulatory elements. In some embodiments, the AAV vector comprises a full-length AAV 5' inverted terminal repeat (ITR) and a full-length 3' ITR. An improved version of the 5' ITR, termed the short AITR, in which the D sequence and terminal resolution sites (trs) have been deleted has been described. The abbreviation "sc" stands for self-complementary. "Self-complementary AAV" refers to a construct designed such that the coding region carried by the recombinant AAV nucleic acid sequence forms an intramolecular double-stranded DNA template. Upon infection, rather than waiting for cell-mediated synthesis of a second strand, the two complementary halves of the scAAV associate to form a single double-stranded DNA (dsDNA) unit that is ready for replication and transcription (e.g., D. M. McCarty et al., "Self-complementary recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independent of DNA synthesis," Gene Therapy, (August 2001); see also, e.g., U.S. Pat. Nos. 6,596,535, 7,125,717, and 7,456,683). When pseudotyped AAV is generated, the ITRs are selected from a source different from the AAV source of the capsid. For example, in some embodiments, AAV2 ITRs are selected for use with AAV capsids that have particular efficacy for a selected cellular receptor, target tissue, or viral target. In some embodiments, ITR sequences from AAV2, or deleted versions thereof (AITRs), are used for convenience and to facilitate regulatory approval (i.e., pseudotyping). In some embodiments, single-stranded AAV viral vectors are used.

[0207] Methods for generating and isolating AAV viral vectors suitable for delivery to a subject are known in the art (e.g., U.S. Pat. No. 7,790,449; U.S. Pat. No. 7,282,199; WO2003 / 042397; WO2005 / 033321, WO2006 / 110689, and U.S. Pat. No. 7,588,772 B2, U.S. Pat. Nos. 5,139,941, 5,741,683, 6,057,152, 6,204,059, 6,268,213, 6,491,907, 6,660,514, 6,660,514, 6,951,753; 7,094,604; 7,172,893; 7,201,898; (See US Pat. Nos. 7,229,823; and 7,439,065). In one system, a producer cell line is transiently transfected with a construct encoding a transgene flanked by ITRs and a construct encoding rep and cap. In a second system, a packaging cell line that stably supplies rep and cap is transfected (either transiently or stably) with a construct encoding a transgene flanked by ITRs. In each of these systems, AAV virions are produced in response to infection with a helper adenovirus or herpesvirus, necessitating the isolation of rAAV from contaminating virus. More recently, systems have been developed that do not require infection with a helper virus to restore AAV, i.e., the necessary helper functions (i.e., adenovirus E1, E2a, VA, and E4, or herpesvirus UL5, UL8, UL52, and UL29, and herpesvirus polymerase) are also supplied in trans by the system. In these new systems, helper functions can be supplied by transiently transfecting cells with constructs encoding the necessary helper functions, or cells can be engineered to stably contain genes encoding the helper functions, the expression of which can be controlled at the transcriptional or post-transcriptional level. In yet another system, a transgene flanked by ITRs and rep / cap genes is introduced into insect cells by infection with a baculovirus-based vector.

[0208] The CRISPR-Cas system, e.g., Cas9, and / or any of the RNAs, e.g., guide RNAs, can be delivered using adeno-associated virus (AAV), lentivirus, adenovirus, or other viral vector types, or combinations thereof. Cas9 and one or more guide RNAs can be packaged into one or more viral vectors. In some embodiments, the viral vector is delivered to the tissue of interest, e.g., by intramuscular injection; in other cases, viral delivery is intravenous, transdermal, intranasal, oral, mucosal, or via other delivery methods. Such delivery can be via either a single administration or multiple administrations. Those skilled in the art will understand that the actual dose delivered herein can vary greatly depending on a variety of factors, including the selected vector, target cell, organism, or tissue, the general condition of the subject being treated, the degree of transformation / modification desired, the route and method of administration, and the type of transformation / modification desired.

[0209] Poxvirus vectors deliver genes into the cytoplasm of cells. Avipox virus vectors express nucleic acids for only a short period of time. Adenovirus vectors, adeno-associated virus vectors, and herpes simplex virus (HSV) vectors may be used in some embodiments. Adenovirus vectors provide shorter-term expression than adeno-associated virus (e.g., less than about one month), but in some embodiments, can exhibit much longer-term expression. The particular vector selected depends on the target cell and the condition being treated.

[0210] In certain embodiments, the vector also contains conventional control elements operably linked to the transgene in a manner that allows its transcription, translation, and / or expression in cells transfected with the plasmid vector or infected with a virus produced by the present disclosure. As used herein, "operably linked" sequences include both expression control sequences adjacent to the gene of interest and expression control sequences that act in trans or remotely to regulate the gene of interest. Expression control sequences include appropriate transcription initiation, transcription termination, promoter, and enhancer sequences; efficient RNA processing signals, such as splicing and polyadenylation (polyA) signals; sequences that stabilize cytoplasmic mRNA; sequences that increase translation efficiency (i.e., Kozak consensus sequences); sequences that increase protein stability; and, optionally, sequences that enhance secretion of the encoded product. Numerous expression control sequences, including natural, constitutive, inducible, and / or tissue-specific promoters, are known in the art and may be utilized.

[0211] Additional promoter elements, such as enhancers, regulate the frequency of transcription initiation. These are typically located 30–110 bp upstream of the start site, although recent studies have shown that many promoters also contain functional elements downstream of the start site. Spacing between promoter elements is often flexible, allowing promoter function to be maintained even when elements are inverted or moved relative to one another. In the thymidine kinase (TK) promoter, spacing between SPA promoter elements can be increased to 50 bp before activity begins to decline. Depending on the promoter, individual elements can function cooperatively or independently to activate transcription.

[0212] Selection of an appropriate promoter can be readily accomplished. In certain embodiments, a high-expression promoter will be used. One example of a suitable promoter is the immediate-early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operably linked to it. The Rous sarcoma virus (RSV) and MMT promoters can also be used. Specific proteins can be expressed using their native promoters. Other elements that can enhance expression, such as enhancers or systems that confer high levels of expression, such as the tat gene or tar element, can also be included. This cassette can then be inserted into a vector, such as a plasmid vector, e.g., pUC19, pUC118, pBR322, or other known plasmid vectors containing, for example, an E. coli origin of replication.

[0213] Another example of a suitable promoter is elongation growth factor-1a (EF-1a). However, other constitutive promoter sequences can also be used, including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters such as the actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Furthermore, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of an inducible promoter provides a molecular switch that can turn on expression of an operably linked polynucleotide sequence when expression is desired and turn off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, the metallothionine promoter, glucocorticoid promoter, progesterone promoter, and tetracycline promoter.

[0214] Enhancer sequences found on vectors also regulate the expression of genes contained in the vector. Typically, enhancers bind to protein factors to enhance gene transcription. Enhancers may be located upstream or downstream of the gene they regulate. Enhancers may also be tissue-specific to enhance transcription in specific cell or tissue types. In some embodiments, the vectors of the present disclosure contain one or more enhancers to promote the transcription of genes present in the vector.

[0215] To assess nucleic acid and / or peptide expression, the expression vector introduced into cells can also contain a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a population of cells to be transfected or infected via a viral vector. In other embodiments, the selectable marker can be carried on a separate piece of DNA and used in a cotransfection procedure. Both the selectable marker and the reporter gene can be flanked by appropriate regulatory sequences that enable expression in the host cell. Useful selectable markers include, for example, antibiotic resistance genes, such as neo.

[0216] Reporter genes are used to identify potentially transfected cells or evaluate the function of regulatory sequences. Generally, reporter genes encode polypeptides that are not present or expressed in the recipient organism or tissue and whose expression is manifested by some easily detectable property, such as enzymatic activity. Expression of the reporter gene is assayed at an appropriate time after DNA is introduced into the recipient cells. Suitable reporter genes may include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein (e.g., Ui-Tei et al., 2000 FEBS Letters 479:79-82). Suitable expression systems are well known and can be prepared using known techniques or purchased commercially. Generally, the construct with the smallest 5' flanking region that exhibits the highest level of reporter gene expression is identified as the promoter. Such promoter regions can be linked to reporter genes and used to evaluate drugs for their ability to modulate promoter-driven transcription.

[0217] Methods for introducing and expressing genes into cells are known in the art.In the case of expression vectors, the vector can be easily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method known in the art.For example, the expression vector can be introduced into host cells by physical, chemical, or biological means.

[0218] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. (See, e.g., Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York.) A preferred method for introducing polynucleotides into host cells is calcium phosphate transfection.

[0219] Biological methods for introducing target polynucleotides into host cells include the use of DNA and RNA vectors.Viral vectors, especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, for example, human cells.Other viral vectors can be derived from lentivirus, poxvirus, herpes simplex virus I, adenovirus and adeno-associated virus, etc.See, for example, U.S. Patent No. 5,611,112, U.S. Patent No. 5,350,674 and U.S. Patent No. 5,585,362.

[0220] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system used as a delivery vehicle in vitro and in vivo is a liposome (e.g., artificial membrane vesicle).

[0221] When a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. The use of lipid formulations is contemplated for the introduction of nucleic acids into host cells (in vitro, ex vivo, or in vivo). In another embodiment, the nucleic acid may be associated with a lipid. Lipid-associated nucleic acids may be encapsulated within the aqueous interior of a liposome, interspersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule that binds both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing lipids, mixed with a lipid, associated with a lipid, contained in a lipid as a suspension, contained in or complexed with a micelle, or otherwise associated with a lipid. Lipid, lipid / DNA, or lipid / expression vector-related compositions are not limited to any particular structure in solution. For example, they may exist in a bilayer structure, as micelles, or in a "collapsed" structure. They may also simply be dispersed in a solution or form aggregates that are not uniform in size or shape. Lipids are fatty substances, and may be naturally occurring or synthetic. For example, lipids include the naturally occurring lipid droplets in the cytoplasm as well as a class of compounds containing long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, aminoalcohols, and aldehydes.

[0222] Suitable lipids for use are available from commercial sources. For example, dimyristyl phosphatidylcholine (DMPC) is available from Sigma, St. Louis, Missouri. Dicetyl phosphate (DCP) is available from K&K Laboratories (Plainview, NY). Cholesterol (Choi) is available from Calbiochem-Behring. Dimyristyl phosphatidylglycerol (DMPG) and other lipids are available from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at approximately -20°C. Chloroform is used as the sole solvent because it evaporates more readily than methanol. "Liposome" is a generic term that encompasses a variety of unilamellar and multilamellar lipid vesicles formed by the formation of enclosed lipid bilayers or aggregates. Liposomes are characterized as having a vesicular structure with a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes contain multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in excess aqueous solution. The lipid components undergo self-rearrangement before forming a closed structure, trapping water and dissolved solutes between the lipid bilayers (Ghosh et al., 1991 Glycobiology 5: 505-10). However, compositions with structures in solution that differ from the typical vesicular structure are also encompassed. For example, lipids may adopt a micellar structure or simply exist as a heterogeneous aggregate of lipid molecules. Lipofectamine-nucleic acid complexes are also contemplated.

[0223] Regardless of the method used to introduce exogenous nucleic acid into host cells, various assays can be carried out to confirm the presence of recombinant nucleic acid sequences in host cells. Such assays include "molecular biological" assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical" assays, such as detecting the presence or absence of specific peptides by immunological means (ELISA and Western blot) or by the assays described herein to identify agents within the scope of the present disclosure;

[0224] In certain embodiments, the compositions include cells genetically modified to express one or more isolated nucleic acids and / or peptides described herein. For example, the cells can be transfected or transformed with one or more vectors containing isolated nucleic acid sequences encoding gRNAs and / or Cas peptides. The cells can be the subject's own cells or haploidentical cells or cell lines. The cells can be irradiated to prevent replication. In some embodiments, the cells are human leukocyte antigen (HLA)-matched cell lines, autologous cell lines, or combinations thereof. In other embodiments, the cells can be stem cells, such as embryonic stem cells or induced pluripotent stem cells (iPS cells). Embryonic stem cells (ES cells) and induced pluripotent stem cells (iPS cells) have been established from many animal species, including humans. These types of pluripotent stem cells are considered the most useful cell source for regenerative medicine because they can differentiate into almost any organ with appropriate differentiation guidance while maintaining pluripotency and retaining the ability to actively divide. In particular, iPS cells are less likely to pose ethical and social problems than ES cells, which are generated by the destruction of embryos, because they can be established from autologous somatic cells. Furthermore, because iPS cells are autologous, they can avoid rejection, which is the biggest obstacle to regenerative medicine and transplantation therapy.

[0225] (Pharmaceutical composition) The compositions described herein are suitable for use in the various drug delivery systems mentioned above. Furthermore, to extend the in vivo serum half-life of the administered compound, the composition can be encapsulated, introduced into the lumen of liposomes, prepared as a colloid, or other conventional techniques for extending serum half-life can be used. For example, various methods are available for preparing liposomes, as described in U.S. Patent No. 5,611,008 to Szoka et al. Each of these is incorporated herein by reference. Furthermore, drugs can be administered in targeted drug delivery systems, such as liposomes coated with tissue-specific antibodies. Liposomes are targeted to organs and selectively taken up.

[0226] The present disclosure also provides pharmaceutical compositions comprising one or more of the compositions described herein. The formulations can be used in combination with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for administration to a wound or treatment site. The pharmaceutical compositions can be sterilized and, if desired, can be mixed with auxiliary agents, such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for affecting osmotic buffers, coloring agents, and / or aromatic substances. They can also be combined with other active agents, such as other analgesics, if desired.

[0227] The administration of the composition of the present disclosure can be carried out, for example, by parenteral, intravenous, intratumoral, subcutaneous, intramuscular or intraperitoneal injection, or by infusion, or by any other acceptable systemic method.The formulation for administering the composition includes those suitable for rectal, nasal, oral, topical (including buccal and sublingual), vaginal or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration.Preparation can conveniently be provided in unit dosage form, for example, unit dosage form.Includes tablets and sustained-release capsules, and can be prepared by any method well known in the field of pharmacy.

[0228] As used herein, "additional ingredients" includes, but is not limited to, one or more of the following: surfactants; dispersing agents; inert diluents; granulating and disintegrating agents; binders; lubricants; coloring agents; preservatives; physiologically degradable compositions such as gelatin; aqueous vehicles and solvents; oily vehicles and solvents; suspending agents; dispersing or wetting agents; emulsifying agents; demulcents; buffers; salts; thickening agents; fillers; emulsifiers; antioxidants; antibiotics; antifungal agents; stabilizers; and pharmaceutically acceptable polymers or hydrophobic materials. Other "additional ingredients" that can be included in the pharmaceutical compositions of the present disclosure are known in the art and are described, for example, in Genaro, ed. (1985, Remingtons Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania), which is incorporated herein by reference.

[0229] The compositions of the present disclosure may contain a preservative in an amount of about 0.005% to 2.0% by weight of the total composition. Preservatives are used to prevent spoilage when exposed to environmental contaminants. Examples of preservatives useful in accordance with the present disclosure include, but are not limited to, preservatives selected from the group consisting of benzyl alcohol, sorbic acid, parabens, imidulea, and combinations thereof. A particularly preferred preservative is a combination of about 0.5% to 2.0% benzyl alcohol and 0.05% to 0.5% sorbic acid.

[0230] In one embodiment, the composition comprises an antioxidant and a chelating agent that inhibits degradation of one or more components of the composition. Preferred antioxidants for some compounds are BHT, BHA, alpha-tocopherol, and ascorbic acid in a preferred range of about 0.01% to 0.3% by weight, more preferably BHT in the range of 0.03% to 0.1% by weight, based on the total weight of the composition. Preferably, the chelating agent is present in an amount of 0.01% to 0.5% by weight, based on the total weight of the composition. Particularly preferred chelating agents include edetate (e.g., edetate disodium) and citric acid in a range of about 0.01% to 0.20% by weight, more preferably 0.02% to 0.10% by weight, based on the total weight of the composition. Chelating agents are useful for chelating metal ions in the composition that may adversely affect the shelf life of the formulation. BHT and edetate disodium are particularly preferred antioxidants and chelating agents, respectively, for some compounds, although other suitable and equivalent antioxidants and chelating agents may be substituted, as would be known to one skilled in the art.

[0231] Liquid suspensions can be prepared using conventional methods to suspend the compositions of the present disclosure in aqueous or oily vehicles. Aqueous vehicles include, for example, water and isotonic saline. Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as peanut oil, olive oil, sesame oil, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. Liquid suspensions may further contain one or more additional ingredients, including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, colorings, and sweeteners. Oily suspensions may also contain thickeners. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, and hydroxypropylmethylcellulose. Known dispersing or wetting agents include natural phospholipids such as lecithin, condensation products of alkylene oxides with fatty acids, long-chain aliphatic alcohols, partial esters derived from fatty acids, and hexitols or partial esters derived from fatty acids and hexitol anhydrides (e.g., polyoxyethylene stearate, heptadecaethyleneoxycetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifying agents include, but are not limited to, lecithin and acacia. Known preservatives include, but are not limited to, methyl, ethyl, or n-propyl para-hydroxybenzoates, ascorbic acid, and sorbic acid.

[0232] (Treatment method) The present disclosure provides methods for treating or preventing herpesvirus-mediated infection. In some embodiments, the method comprises administering to a subject in need thereof an effective amount of a composition comprising a guide nucleic acid and at least one of a Cas peptide, or a functional fragment or derivative thereof. In some embodiments, the method comprises administering a composition comprising an isolated nucleic acid encoding at least one of a guide nucleic acid and a Cas peptide, or a functional fragment or derivative thereof. In certain embodiments, the method comprises administering a composition described herein to a subject diagnosed with a herpesvirus infection, a subject at risk of developing a herpesvirus infection, a subject with a latent herpesvirus infection, or the like.

[0233] Provided herein, in certain embodiments, are methods for modifying and / or editing a herpesvirus sequence in the genome of a cell (e.g., a host cell) using a CRISPR-Cas system or composition described herein. Generally, modifying and / or editing a herpesvirus sequence in the genome of a cell (e.g., a host cell) involves contacting or providing the cell with a CRISPR-Cas system or composition that targets one or more regions in the UL56, ICP0, ICP4, or ICP27 gene. In some embodiments, the method involves removing or excising a sequence from the genome of the cell. In some embodiments, the method excises at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 9000 base pairs or more of the HSV genome.

[0234] Provided herein, in certain embodiments, are methods comprising administering a composition comprising: a) a CRISPR-associated endonuclease or a nucleic acid sequence encoding a CRISPR-associated endonuclease; b) a first guide nucleic acid, or a nucleic acid sequence encoding a first guide nucleic acid, wherein the first guide nucleic acid is complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; c) a second guide nucleic acid, or a nucleic acid sequence encoding a second guide nucleic acid, wherein the second guide nucleic acid is complementary to a second target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; or d) a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. In some embodiments, the method further comprises administering a fourth guide nucleic acid, or a nucleic acid sequence encoding a fourth guide nucleic acid, wherein the fourth guide nucleic acid is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome. In some embodiments, the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence.

[0235] Provided herein, in certain embodiments, are methods comprising administering a composition comprising: a) a CRISPR-associated endonuclease or a nucleic acid sequence encoding a CRISPR-associated endonuclease; b) a first guide nucleic acid, or a nucleic acid sequence encoding a first guide nucleic acid, wherein the first guide nucleic acid is complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; c) a second guide nucleic acid, or a nucleic acid sequence encoding a second guide nucleic acid, wherein the second guide nucleic acid is complementary to a second target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome; and d) a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

[0236] Provided herein, in certain embodiments, are methods comprising administering a CRISPR-Cas system comprising: a) a CRISPR-associated endonuclease; b) a first guide nucleic acid, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2 or 7, or a complement thereof; c) a second guide nucleic acid, wherein the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376 or 377, or a complement thereof. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 7. In some embodiments, the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376. In some embodiments, the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 377. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2, and the second guide nucleic acid comprises a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: 376. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 377. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 7, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376. In some embodiments, the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:7, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:377.

[0237] Provided herein, in certain embodiments, are methods comprising administering an adeno-associated virus (AAV) vector comprising a nucleic acid encoding: a) a CRISPR-associated endonuclease; b) a first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; c) a second guide nucleic acid, the second guide nucleic acid complementary to a second target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; d) a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, the third guide nucleic acid complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. In some embodiments, the method further comprises administering a fourth guide nucleic acid complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome.

[0238] Certain embodiments provided herein are methods comprising administering an adeno-associated virus (AAV) vector comprising nucleic acids encoding: a) a CRISPR-associated endonuclease; b) a first guide nucleic acid that is complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) a second guide nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and d) a third guide nucleic acid that is complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

[0239] In some embodiments, the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375. In some embodiments, the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 7 or its complement, and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 378 or its complement.In some embodiments, the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 7 or its complement, the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement, and the fourth target nucleic acid sequence comprises a sequence according to SEQ ID NO: 377 or its complement.

[0240] In some embodiments, the method is used to treat or prevent herpesvirus infections, including, but not limited to, herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

[0241] In some embodiments, the methods of the present disclosure are used to treat or prevent diseases and disorders associated with herpes virus infections, including, but not limited to, herpes labialis, herpes genitalis, herpes virus encephalitis, chickenpox, shingles, Bell's palsy, vestibular neuritis, and herpes zoster neuralgia.

[0242] Subjects to which the pharmaceutical compositions of the present disclosure are intended to be administered include, but are not limited to, humans and other primates, non-human primates, mammals, including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs. Therapeutic agents can be administered according to a metronomic regimen. As used herein, "metronomic" therapy refers to the continuous administration of low doses of therapeutic agents.

[0243] The compositions can be administered in conjunction with (e.g., before, simultaneously with, or after) one or more other treatments. For example, in certain embodiments, the methods include administering a composition of the present disclosure in combination with an additional anti-herpes virus therapy, including, but not limited to, a TK inhibitor, a UL30 inhibitor, acyclovir, foscamet, cidofovir, and derivatives thereof.

[0244] The dosage, toxicity, and therapeutic efficacy of the compositions of the invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, by determining the LD50 (the dose lethal to 50% of a population) and ED50 (the dose therapeutically effective in 50% of a population). The dose ratio between toxic and therapeutic effects is the therapeutic index, which can be expressed as the ratio LD50 / ED50. Cas9 / gRNA compositions that exhibit a high therapeutic index are preferred. While Cas9 / gRNA compositions that exhibit toxic side effects may be used, care must be taken to design delivery systems that target such compositions to affected tissues to minimize potential damage to unaffected cells, thereby reducing side effects.

[0245] Data obtained from cell culture assays and animal studies can be used to formulate a dosage range for use in humans. The dosage of such compositions preferably lies within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending on the dosage form used and the route of administration utilized. For any composition used in the methods of the disclosure, a therapeutically effective dose can be initially estimated from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Plasma levels can be measured, for example, by high-performance liquid chromatography.

[0246] As defined herein, a therapeutically effective amount (i.e., effective dose) of a composition means an amount sufficient to produce a therapeutically (e.g., clinically) desired result. The composition can be administered from one or more times per day, including every other day, to one or more times per week. One skilled in the art will understand that certain factors can affect the dosage and timing required to effectively treat a subject, including, but not limited to, the severity of the disease or disorder, previous treatments, the general health and / or age of the subject, and other factors.

[0247] Furthermore, treatment of a subject with a therapeutically effective amount of the disclosed composition can include a single treatment or a series of treatments. The gRNA expression cassette can be delivered to a subject by methods known in the art. In some embodiments, the Cas can be a fragment that includes the active domain of the Cas molecule, thereby reducing the size of the molecule. Thus, the Cas / gRNA molecule can be used clinically, similar to the approach currently used in gene therapy.

[0248] In some embodiments, the method comprises genetically modifying the cell to express a guide nucleic acid and / or a Cas peptide. For example, in some embodiments, the method comprises contacting the cell with an isolated nucleic acid encoding the guide nucleic acid and / or the Cas peptide.

[0249] In some embodiments, for viral vector-mediated delivery, the dose is at least 1 x 10 5 particles to about 1 × 10 15 In some embodiments, delivery comprises at least 1 x 10 particles of the adenoviral vector. 5 In some embodiments, the dose is at least about 1 x 10 6 particles (e.g., about 1 × 10 6 ~1×10 12 particles), at least about 1 × 10 7particles, at least about 1 x 10 8 particles (e.g., about 1 × 10 8 ~1×10 11 particles or approximately 1 x 10 8 ~1×10 12 particles), at least about 1 × 10 9 particles (e.g., about 1 × 10 9 ~1×10 10 particles or approximately 1 x 10 9 ~1×10 12 particles), or at least about 1 × 10 10 particles (e.g., about 1 × 10 10 ~1×10 12 particles) of adenoviral vector. Alternatively, the dose is about 1 x 10 14 particles, approximately 1 × 10 13 particles, approximately 1 × 10 12 particles, approximately 1 × 10 11 particles or less, and approximately 1 × 10 10 containing less than 1 x 10 particles (e.g., about 1 x 10 9 (more than 10 particles). Thus, in some embodiments, the dose may be, for example: Approximately 1×10 6 Particle unit (pu), approximately 2 x 10 6 pu, approx. 4×10 6 pu, Approximately 1×10 7 pu, approx. 2×10 7 pu, approx. 4×10 7 pu, Approximately 1×10 8 pu, approx. 2×10 8 pu, approx. 4×10 8 pu, Approximately 1×10 9 pu, approx. 2×10 9 pu, approx. 4×10 9 pu, Approximately 1×10 10 pu, approx. 2×10 10 pu, approx. 4×10 10 pu, Approximately 1×10 11 pu, approx. 2×10 11 pu, approx. 4×10 11 pu, Approximately 1×1012 pu, approx. 2×10 12 pu, or approximately 4 × 10 12 In some embodiments, the adenovirus is delivered in multiple doses.

[0250] In some embodiments, delivery is via AAV. A therapeutically effective dose for in vivo delivery of AAV to humans is about 1 x 10 10 ~Approx. 1×10 10 The dosage is expected to be in the range of about 20 to about 50 ml of saline containing 100 mg of functional AAV / ml solution. The dosage can be adjusted to balance therapeutic benefit against side effects. In some embodiments, the AAV dose is generally about 1 x 10 5 ~1×10 50 Genomic AAV, approximately 1 × 10 8 ~1×10 20 Genomic AAV, approximately 1 × 10 10 ~Approx. 1×10 16 Genomic AAV, or approximately 1 × 10 11 to approximately 1 x 10 16 In some embodiments, the human dose is about 1 x 10 13 The AAV is a genomic AAV. In some embodiments, such concentrations are delivered in about 0.001 ml to about 100 ml, about 0.05 ml to about 50 ml, or about 10 ml to about 25 ml of carrier solution. Other effective doses can be readily determined by those skilled in the art through routine testing to establish dose-response curves (see, e.g., U.S. Patent No. 8,404,658).

[0251] In some embodiments, cells are genetically modified in vivo in the intended subject. In certain aspects, for in vivo delivery, the nucleic acid is directly injected into the subject. For example, in some embodiments, the nucleic acid is delivered to the site where the composition is needed. In vivo nucleic acid transfer techniques include, but are not limited to, transfection with viral vectors such as adenovirus, herpes simplex virus I, and adeno-associated virus; lipid-based systems (lipids useful for lipid-mediated gene transfer include DOTMA, DOPE, and DC-Chol); naked DNA; and transposon-based expression systems. For exemplary gene therapy protocols, see Anderson et al., Science 256:808-813 (1992). See also WO93 / 25673 and the references cited therein. In certain embodiments, the method involves directly administering RNA, e.g., mRNA, to the subject (see, e.g., Zangi et al., 2013 Nature Biotechnology, 31:898-907).

[0252] For ex vivo therapy, isolated cells are modified in an ex vivo or in vitro environment. In some embodiments, the cells are autologous to the subject for whom the therapy is intended. Alternatively, the cells can be allogeneic, syngeneic, or xenogeneic with respect to the subject. The modified cells can then be administered directly to the subject.

[0253] Those skilled in the art will recognize that different delivery methods can be used to administer isolated nucleic acids to cells, including (1) methods that utilize physical means such as electroporation (electricity), gene guns (physical force), and large volumes of liquid (pressure), and (2) methods in which the nucleic acid or vector is complexed with another entity such as a liposome, an aggregation protein, or a transporter molecule.

[0254] The amount of vector added per cell is likely to vary depending on the length and stability of the therapeutic gene inserted into the vector, as well as the nature of the sequence, and is a parameter that must be determined empirically. It may also be subject to changes due to factors not specific to the method of the present disclosure (e.g., costs associated with synthesis). Those skilled in the art can easily make necessary adjustments according to the exigencies of a particular situation.

[0255] Genetically modified cells may also contain a suicide gene, i.e., a gene encoding a product that can be used to destroy the cell. In many gene therapy situations, it is desirable not only to be able to express a gene in a host cell for therapeutic purposes, but also to be able to destroy the host cell at will. A therapeutic drug can be bound to the suicide gene, whose expression is not activated in the absence of an activator compound. When it is desired to kill cells into which both the drug and the suicide gene have been introduced, an activator compound is administered to the cells, thereby activating expression of the suicide gene and causing cell death. Examples of suicide gene / prodrug combinations that can be used include herpes simplex virus thymidine kinase (HSV-tk) and ganciclovir or acyclovir; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase, thymidylate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside.

[0256] The present invention will be described in more detail with reference to the following experimental examples. These examples are provided for illustrative purposes only and are not intended to be limiting unless otherwise specified. Therefore, the present disclosure should not be construed as being limited to the following examples in any way, but rather as encompassing any variations that become apparent as a result of the teachings provided herein.

[0257] (Example) Embodiment 1 includes a composition comprising: a) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease or a nucleic acid sequence encoding a CRISPR-associated endonuclease; b) a first guide nucleic acid, or a nucleic acid sequence encoding a first guide nucleic acid, wherein the first guide nucleic acid is complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; c) a second guide nucleic acid, or a nucleic acid sequence encoding a second guide nucleic acid, wherein the second guide nucleic acid is complementary to a second target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; d) a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different.

[0258] Embodiment 2 includes the composition of Embodiment 1, further comprising a fourth guide nucleic acid. The fourth guide nucleic acid comprises a fourth guide nucleic acid, or a nucleic acid sequence encoding a fourth guide nucleic acid, that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome. Embodiment 3 includes the composition of any one of Embodiments 1-2, wherein the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence. Embodiment 4 includes the composition of any one of Embodiments 1-3, wherein the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. Embodiment 5 includes the composition of any one of Embodiments 1-4, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease. Embodiment 6 includes the composition of any one of Embodiments 1-5, wherein the CRISPR-associated endonuclease is a Cas9 nuclease. Embodiment 7 includes the composition of any one of Embodiments 1-6, wherein the Cas9 nuclease is a Staphylococcus aureus Cas9 nuclease. Embodiment 8 includes the composition of any one of Embodiments 1-7, wherein the CRISPR-associated endonuclease is optimized for expression in human cells. Embodiment 9 includes the composition of any one of Embodiments 1-8, wherein the guide nucleic acid is RNA. Embodiment 10 includes the composition of any one of Embodiments 1-9, wherein the guide nucleic acid comprises a crRNA and a tracrRNA.

[0259] Embodiment 11 includes the composition of any one of Embodiments 1-10, wherein the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOS: 1-96 or 372-375, or a complement of any one of SEQ ID NOS: 1-96 or 372-375. Embodiment 12 includes the composition of any one of Embodiments 1-11, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS: 1-96, 372-375, or a complement of any one of SEQ ID NOS: 1-96, 372-375. Embodiment 13 includes the composition of any one of Embodiments 1-12, wherein the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOS: 1-96, 372-375, or a complement of any one of SEQ ID NOS: 1-96 or 372-375. Embodiment 14 includes the composition of any one of Embodiments 1-13, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96, or 372-375, or the complement of any one of SEQ ID NOs: 1-96, or 372-375. Embodiment 15 includes the composition of any one of Embodiments 1-14, wherein the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377.

[0260] Embodiment 16 includes the composition of any one of Embodiments 1-15, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. Embodiment 17 includes the composition of any one of Embodiments 1-16, wherein the fourth target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. Embodiment 18 includes the composition of any one of Embodiments 1-17, wherein the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. Embodiment 19 includes the composition of any one of embodiments 1 to 18, wherein the first target nucleic acid sequence comprises the sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises the sequence according to SEQ ID NO: 7 or its complement, and the third target nucleic acid sequence comprises the sequence according to SEQ ID NO: 376 or its complement. Embodiment 20 includes the composition of any one of embodiments 1 to 19, wherein the first target nucleic acid sequence comprises the sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises the sequence according to SEQ ID NO: 7 or its complement, the third target nucleic acid sequence comprises the sequence according to SEQ ID NO: 376 or its complement, and the fourth target nucleic acid sequence comprises the sequence according to SEQ ID NO: 377 or its complement.

[0261] Embodiment 21 includes the composition of any one of Embodiments 1-20, wherein the herpesvirus is selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)). Embodiment 22 includes a composition comprising: a) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease, or a nucleic acid sequence encoding a CRISPR-associated endonuclease; b) a first guide nucleic acid, or a nucleic acid sequence encoding a first guide nucleic acid, wherein the first guide nucleic acid is complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; c) a second guide nucleic acid, or a nucleic acid sequence encoding a second guide nucleic acid, wherein the second guide nucleic acid is complementary to a second target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome; and d) a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. Embodiment 23 includes the composition of any one of Embodiments 1-22, wherein the CRISPR-associated endonuclease is a Type I, Type II, or Type III Cas endonuclease.Embodiment 24 includes the composition of any one of Embodiments 1-23, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasQ endonuclease.Embodiment 25 includes the composition of any one of Embodiments 1-24, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

[0262] Embodiment 26 includes the composition of any one of Embodiments 1-25, wherein the Cas9 nuclease is Staphylococcus aureus Cas9 nuclease. Embodiment 27 includes the composition of any one of Embodiments 1-26, wherein the CRISPR-associated endonuclease is optimized for expression in human cells. Embodiment 28 includes the composition of any one of Embodiments 1-27, wherein the guide nucleic acid is RNA. Embodiment 29 includes the composition of any one of Embodiments 1-28, wherein the guide nucleic acid comprises crRNA and tracrRNA. Embodiment 30 includes the composition of any one of Embodiments 1-29, wherein the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or the complement of any one of SEQ ID NOs: 1-96 or 372-375.

[0263] Embodiment 31 includes the composition of any one of Embodiments 1-30, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS: 1-96, or 372-375, or a complement of any one of SEQ ID NOS: 1-96, or 372-375. Embodiment 32 includes the composition of any one of Embodiments 1-31, wherein the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOS: 363, 371, or 374-377, or a complement of any one of SEQ ID NOS: 363, 371, or 374-377. Embodiment 33 includes the composition of any one of Embodiments 1-32, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOS: 363, 371, or 374-377, or a complement of any one of SEQ ID NOS: 363, 371, or 374-377. Embodiment 34 includes the composition of any one of embodiments 1-33, wherein the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. Embodiment 35 includes the composition of any one of embodiments 1-34, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377.

[0264] Embodiment 36 includes the composition of any one of embodiments 1 to 35, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or 7, or a complement thereof; the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376, or a complement thereof; and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 377, or a complement thereof. Embodiment 37 includes the composition of any one of Embodiments 1-36, wherein the herpesvirus is selected from the group consisting of herpes simplex type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)). Embodiment 38 includes a CRISPR-Cas system comprising: a) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease; b) a first guide nucleic acid, the first guide nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2 or 7, or a complement thereof; and c) a second guide nucleic acid, the second guide nucleic acid comprising a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376 or 377, or a complement thereof. Embodiment 39 includes the CRISPR-Cas system of any one of Embodiments 1 to 38, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2. Embodiment 40 includes the CRISPR-Cas system of any one of Embodiments 1 to 39, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 7.

[0265] Embodiment 41 comprises the CRISPR-Cas system of any one of Embodiments 1 to 40, wherein the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376. Embodiment 42 comprises the CRISPR-Cas system of any one of Embodiments 1 to 41, wherein the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 377. Embodiment 43 comprises the CRISPR-Cas system of any one of Embodiments 1 to 42, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 2, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO: 376. Embodiment 44 comprises the CRISPR-Cas system of any one of Embodiments 1 to 43, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:2, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:377. Embodiment 45 comprises the CRISPR-Cas system of any one of Embodiments 1 to 44, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:7, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:376.

[0266] Embodiment 46 includes the CRISPR-Cas system of any one of Embodiments 1 to 45, wherein the first guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:7, and the second guide nucleic acid comprises a nucleic acid sequence complementary to a sequence having at least 90% sequence identity to SEQ ID NO:377. Embodiment 47 includes a nucleic acid encoding the CRISPR-Cas system of any one of Embodiments 1 to 46. Embodiment 48 includes an adeno-associated virus (AAV) vector comprising a nucleic acid encoding: a) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease; b) a first guide nucleic acid complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome; and c) a second guide nucleic acid, wherein the second guide nucleic acid is complementary to a second target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome. d) a third guide nucleic acid, or a nucleic acid sequence encoding a third guide nucleic acid, wherein the third guide nucleic acid is complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome, wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. Embodiment 49 includes the AAV vector of any one of embodiments 1-48, further comprising a fourth guide nucleic acid that is complementary to a fourth target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome. Embodiment 50 includes the AAV vector of any one of embodiments 1-49, wherein the fourth target nucleic acid sequence is different from the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence.

[0267] Embodiment 51 includes the AAV vector of any one of embodiments 1 to 50, wherein the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease. Embodiment 52 includes the AAV vector of any one of embodiments 1 to 51, wherein the CRISPR-associated endonuclease is a Cas9 endonuclease, a Cas12 endonuclease, a CasX endonuclease, or a CasΦ endonuclease. Embodiment 53 includes the AAV vector of any one of embodiments 1 to 52, wherein the CRISPR-associated endonuclease is a Cas9 nuclease. Embodiment 54 includes the AAV vector of any one of embodiments 1 to 53, wherein the Cas9 nuclease is a Staphylococcus aureus Cas9 nuclease. Embodiment 55 includes the AAV vector of any one of embodiments 1 to 54, wherein the CRISPR-associated endonuclease is optimized for expression in human cells.

[0268] Embodiment 56 includes the AAV vector of any one of Embodiments 1 to 55, wherein the guide nucleic acid is RNA. Embodiment 57 includes the AAV vector of any one of Embodiments 1 to 56, wherein the guide nucleic acid comprises crRNA and tracrRNA. Embodiment 58 includes the AAV vector of any one of Embodiments 1 to 57, wherein the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs: 1 to 96 or 372 to 375. Embodiment 59 includes the AAV vector of any one of Embodiments 1 to 58, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1 to 96 or 372 to 375, or a complement of any one of SEQ ID NOs: 1 to 96 or 372 to 375. Embodiment 60 includes the AAV vector of any one of embodiments 1 to 59, wherein the second target nucleic acid sequence includes a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1 to 96 or 372 to 375, or the complement of any one of SEQ ID NOs: 1 to 96 or 372 to 375.

[0269] Embodiment 61 includes the AAV vector of any one of embodiments 1-60, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96, or 372-375, or a complement of any one of SEQ ID NOs: 1-96, or 372-375. Embodiment 62 includes the AAV vector of any one of embodiments 1-61, wherein the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or a complement of any one of SEQ ID NOs: 363, 371, or 374-377. Embodiment 63 includes the AAV vector of any one of embodiments 1-62, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or a complement of any one of SEQ ID NOs: 363, 371, or 374-377. Embodiment 64 includes the AAV vector of any one of embodiments 1-63, wherein the fourth target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377. Embodiment 65 includes the AAV vector of any one of embodiments 1-64, wherein the fourth target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374-377, or the complement of any one of SEQ ID NOs: 363, 371, or 374-377.

[0270] Embodiment 66 comprises the AAV vector of any one of embodiments 1 to 65, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 7 or its complement, and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement. Embodiment 67 comprises the AAV vector of any one of embodiments 1 to 66, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or its complement, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 7, the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376 or its complement, and the fourth target nucleic acid sequence comprises a sequence according to SEQ ID NO: 377 or its complement. Embodiment 68 comprises the AAV vector of any one of embodiments 1 to 67, wherein the nucleic acid further comprises a promoter. Embodiment 69 comprises the AAV vector of any one of embodiments 1 to 68, wherein the promoter is a ubiquitous promoter. Embodiment 70 comprises the AAV vector of any one of embodiments 1 to 69, wherein the promoter is a tissue-specific promoter.

[0271] Embodiment 71 comprises the AAV vector of any one of embodiments 1 to 70, wherein the promoter is a constitutive promoter.Embodiment 72 comprises the AAV vector of any one of embodiments 1 to 71, wherein the promoter is a human cytomegalovirus promoter.Embodiment 73 comprises the AAV vector of any one of embodiments 1 to 72, wherein the nucleic acid further comprises an enhancer element.Embodiment 74 comprises the AAV vector of any one of embodiments 1 to 73, wherein the enhancer element is a human cytomegalovirus enhancer element.Embodiment 75 comprises the AAV vector of any one of embodiments 1 to 74, wherein the nucleic acid further comprises a 5' ITR element and a 3' ITR element.

[0272] Embodiment 76 includes the AAV vector of any one of embodiments 1 to 75, wherein the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9. Embodiment 77 includes the AAV vector of any one of embodiments 1 to 76, wherein the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ / 8. Embodiment 78 includes the AAV vector of any one of embodiments 1 to 77, wherein the herpesvirus is selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)). Embodiment 79 includes an adeno-associated virus (AAV) vector comprising a nucleic acid encoding: a) a CRISPR-associated endonuclease. b) a first guide nucleic acid that is complementary to a first target nucleic acid sequence within or near the ICP0 gene of the herpesvirus genome; c) a second guide nucleic acid that is complementary to a second target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; and d) a third guide nucleic acid that is complementary to a third target nucleic acid sequence within or near the ICP27 gene of the herpesvirus genome; wherein the first target nucleic acid sequence, the second target nucleic acid sequence, and the third target nucleic acid sequence are different. Embodiment 80 comprises the AAV vector of any one of embodiments 1 to 79, wherein the CRISPR-associated endonuclease is a type I, type II, or type III Cas endonuclease.

[0273] Embodiment 81 comprises the AAV vector of any one of embodiments 1 to 80, wherein the CRISPR-associated endonuclease is Cas9 endonuclease, Cas12 endonuclease, CasX endonuclease, or CasΦ endonuclease. Embodiment 82 comprises the AAV vector of any one of embodiments 1 to 81, wherein the CRISPR-associated endonuclease is Cas9 nuclease. Embodiment 83 comprises the AAV vector of any one of embodiments 1 to 82, wherein the Cas9 nuclease is Staphylococcus aureus Cas9 nuclease. Embodiment 84 comprises the AAV vector of any one of embodiments 1 to 83, wherein the CRISPR-associated endonuclease is optimized for expression in human cells. Embodiment 85 comprises the AAV vector of any one of embodiments 1 to 84, wherein the guide nucleic acid is RNA.

[0274] Embodiment 86 includes the AAV vector of any one of Embodiments 1 to 85, wherein the guide nucleic acid comprises crRNA and tracrRNA. Embodiment 87 includes the AAV vector of any one of Embodiments 1 to 86, wherein the first target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 1-96 or 372-375, or a complement of any one of SEQ ID NOs: 1-96 or 372-375. Embodiment 88 includes the AAV vector of any one of Embodiments 1 to 87, wherein the first target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 1-96 or 372-375, or a complement of any one of SEQ ID NOs: 1-96 or 372-375. Embodiment 89 comprises the AAV vector of any one of embodiments 1 to 88, wherein the second target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374 to 377, or the complement of any one of SEQ ID NOs: 363, 371, or 374 to 377. Embodiment 90 comprises the AAV vector of any one of embodiments 1 to 89, wherein the second target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374 to 377, or the complement of any one of SEQ ID NOs: 363, 371, or 374 to 377.

[0275] Embodiment 91 comprises the AAV vector of any one of embodiments 1 to 90, wherein the third target nucleic acid sequence comprises a sequence comprising at least about 90% sequence identity to any one of SEQ ID NOs: 363, 371, or 374 to 377, or the complement of any one of SEQ ID NOs: 363, 371, or 374 to 377. Embodiment 92 comprises the AAV vector of any one of embodiments 1 to 91, wherein the third target nucleic acid sequence comprises a sequence according to any one of SEQ ID NOs: 363, 371, or 374 to 377, or the complement of any one of SEQ ID NOs: 363, 371, or 374 to 377. Embodiment 93 comprises the AAV vector of any one of embodiments 1 to 92, wherein the first target nucleic acid sequence comprises a sequence according to SEQ ID NO: 2 or 7, or a complement thereof, the second target nucleic acid sequence comprises a sequence according to SEQ ID NO: 376, or a complement thereof, and the third target nucleic acid sequence comprises a sequence according to SEQ ID NO: 377, or a complement thereof. Embodiment 94 comprises the AAV vector of any one of embodiments 1-93, wherein the herpesvirus is selected from the group consisting of herpes simplex type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), and human herpesvirus 6 (HHV-6; roseolovirus). Embodiment 95 comprises the AAV vector of any one of embodiments 1-94, wherein the nucleic acid further comprises a promoter.

[0276] Embodiment 96 comprises the AAV vector of any one of embodiments 1 to 95, wherein the promoter is a ubiquitous promoter. Embodiment 97 comprises the AAV vector of any one of embodiments 1 to 96, wherein the promoter is a tissue-specific promoter. Embodiment 98 comprises the AAV vector of any one of embodiments 1 to 97, wherein the promoter is a constitutive promoter. Embodiment 99 comprises the AAV vector of any one of embodiments 1 to 98, wherein the promoter is a human cytomegalovirus promoter. Embodiment 100 comprises the AAV vector of any one of embodiments 1 to 99, wherein the nucleic acid further comprises an enhancer element.

[0277] Embodiment 101 comprises the AAV vector of any one of embodiments 1 to 100, wherein the enhancer element is a human cytomegalovirus enhancer element.Embodiment 102 comprises the AAV vector of any one of embodiments 1 to 101, wherein the nucleic acid further comprises a 5' ITR element and a 3' ITR element.Embodiment 103 comprises the AAV vector of any one of embodiments 1 to 102, wherein the adeno-associated virus (AAV) vector is AAV2, AAV5, AAV6, AAV7, AAV8, or AAV9.Embodiment 104 comprises the AAV vector of any one of embodiments 1 to 103, wherein the adeno-associated virus (AAV) vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVDJ, or AAVDJ / 8. Embodiment 105 includes a method of excising some or all herpesvirus sequences from a cell, the method comprising providing to the cell the composition of any one of embodiments 1-104, the CRISPR-Cas system of any one of embodiments 1-104, or the AAV vector of any one of embodiments 1-104. Embodiment 106 includes a method of inhibiting or reducing herpesvirus replication in a cell, the method comprising providing to the cell the composition of any one of embodiments 1-104, the CRISPR-Cas system of any one of embodiments 1-104, or the AAV vector of any one of embodiments 1-104. Embodiment 107 includes the method of any one of embodiments 1-106, wherein the cell is in a subject. Embodiment 108 includes the method of any one of embodiments 1-107, wherein the subject is a human.

[0278] (Example) Example 1 [Table 1]

[0279] [Table 2]

[0280] [Table 3] TIFF2025148442000005.tif224146

[0281] [Table 4] TIFF2025148442000007.tif227162TIFF2025148442000008.tif227161TIFF2025148442000009.tif39165

[0282] [Table 5] TIFF2025148442000011.tif228155TIFF2025148442000012.tif228157TIFF2025148442000013.tif230158TIFF2025148442000014.tif229158 TIFF2025148442000015.tif230157TIFF2025148442000016.tif46156

[0283] Example 2 - Inhibition of HSV-1 Replication In Vitro by Gene Editing Herpes simplex virus type 1 (HSV-1) is a human neurotropic virus that infects a large proportion of the world's population, with a seroprevalence of 90% in asymptomatic normal individuals. Current treatments for primary HSV-1 infection and disease reactivation are nonselective, fail to prevent the establishment of latent infection or viral reactivation, and have harmful side effects. Environmental factors, such as ultraviolet light exposure, hyperthermia, social stress, and medications, can trigger reactivation of the latent HSV-1 genome, leading to disease progression. Current anti-HSV drugs can limit the spread of HSV-1 infection but cannot inhibit the establishment of latency or HSV reactivation.

[0284] Given the limitations of current treatments, new therapeutic approaches are needed that not only effectively suppress viral replication but also eradicate latent viral genomes. Therefore, as described herein, HSV-1 replication can be inhibited by utilizing the CRISPR / Cas9 system to specifically target the HSV-1 genome to create indel mutations or remove large segments of viral DNA sequences critical for viral replication. In particular, targeting the HSV-1 ICP0 and ICP27 genes significantly reduces their expression levels, leading to the suppression of HSV-1 infection. As provided herein, the specificity of targeted strategies for gene mutation / removal within the HSV-1 genome (e.g., ICP0 and ICP27) has been verified by genetic analysis in in vitro cell culture models. Furthermore, expression of HSV-1-directed Cas9 / gRNA in cells protected cells from HSV-1 infection.

[0285] Figure 1A shows a schematic diagram of the HSV-1 genome, ICP0, and ICP27 genes. In the described study, the viral genes ICP0 and ICP27 were targeted using the CRISPR-Cas9 gene editing system. The location and nucleotide composition of the gRNAs, including the PAM, are shown (SEQ ID NOs: 372-375). Nucleotide positions are referenced in RefSeq NC_001806.2. Figure 1B provides a graphical representation of plasmid P31. The plasmid contains four gRNAs: two gRNAs targeting ICP0 (m1 and m2) and two gRNAs targeting ICP27 (m1 and m2) cloned downstream of the U6 promoter, and one copy of the SaCas9 gene. P31 was packaged into AAV2 particles, resulting in the AAV2-HSV construct. px601 ("px601" or "px601saCas9"), which does not contain the ICP0 and ICP27 gRNAs, was also used as a control.

[0286] Targeting ICP0 and ICP27 effectively inhibits HSV-1 replication. Figure 2 shows a schematic diagram of px601 P31 transient transfection of TC620 cell lines infected with the clinical strain HSV-1 NS1 and the HSV-1 GFP-Patton strain to confirm the expression of SaCas9 and ICP0- and ICP27-related gRNAs and their excision activity against the genes ICP0 and ICP27. Furthermore, Western blot analysis for the detection of ICP0 and ICP27 in TC620 human oligodendroglioma infected with the clinical strains HSV-1 NS1 (left panel) and HSV-1 GFP (right panel) demonstrated the reduction of ICP0 and ICP27. The TC620 human oligodendroglioma cell line was transiently transfected with the P31 plasmid. Expression of SaCas9 and the housekeeping GAPDH protein is also shown. Targeting ICP0 and ICP27 effectively edits ICP0 and ICP27. Fig. 3 shows data from a DNA excision assay on an agarose gel showing amplicons obtained with ICP0- and ICP27-specific primers in TC620 cell lines infected with HSV-1 NS1 (left panel) and HSV-1 GFP (right panel) after transient transfection with the P31 plasmid. DNA sequencing identified the specific excisions induced by specific gRNAs and SaCas9 for each target gene (bottom panel).

[0287] Figure 4 shows data from immunofluorescence assessment of HSV-1 GFP replication in TC620 cell lines transiently transfected with the P31 plasmid. Representative plaque assays using supernatants from TC620 cell lines infected with HSV-1 NS1 and HSV-1 GFP demonstrate a significant reduction in plaque numbers as a result of suppression of ICP0 and ICP27 by SaCas9 and gRNA editing in infected cells. A reverse transcriptase (RT) assay (Figure 5) was used to confirm gRNA expression after transient transfection of the TC620 cell line with the P31 plasmid and infection with HSV-1 NS1 (right panel) and HSV-1 GFP (left panel).

[0288] Inhibition of HSV-1 replication by targeting ICP0 and ICP27 was further demonstrated in VERO (African green monkey kidney) cells. Fig. 1 shows a schematic diagram of AAV2-HSV construct transduction of VERO cell lines infected with the HSV-1 NS1 clinical strain and the HSV-1 GFP-Patton strain to confirm the expression of SaCas9 and ICP0- and ICP27-related gRNAs. Excision activity against the genes ICP0 and ICP27. ICP0 and ICP27 are effectively suppressed, as demonstrated by Western blot analysis of ICP0 and ICP27 in VERO human cell lines infected with clinical HSV-1 NS1 (left panel) and HSV-1 GFP (right panel) transduced with the AAV2-HSV construct. Expression of SaCas9 and the housekeeping GAPDH protein is also shown. Targeting ICP0 and ICP27 effectively edits ICP0 and ICP27 in VERO cells. Figure 7 shows data from a DNA excision assay on an agarose gel showing amplicons obtained with ICP0- and ICP27-specific primers in a VERO cell line infected with HSV-1 NS1 and HSV-1 GFP after transduction with an AAV2-HSV construct. A reverse transcriptase (RT) assay was performed to confirm gRNA expression after transduction of the VERO cell line with an AAV2-HSV construct (right panel). DNA sequencing identified the specific gRNA and SaCas9-induced excision of each target gene (bottom). Figure 8 shows data from plaque assays using supernatants from VERO cell lines infected with HSV-1 NS1 (left panel) and HSV-1 GFP (right panel), demonstrating that the number of plaques was dramatically reduced as a result of SaCas9 and gRNA editing in infected cells, resulting in the repression of ICP0 and ICP27.

Claims

1. 1. A composition comprising: a) a clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease, or a nucleic acid sequence encoding a CRISPR-associated endonuclease; b) a first guide nucleic acid, or a nucleic acid sequence encoding said first guide nucleic acid, wherein said first guide nucleic acid is complementary to a first target nucleic acid sequence within or near the ICP0 gene of a herpesvirus genome, said first guide nucleic acid having a spacer sequence that hybridizes to said first target nucleic acid sequence or its complement, and said first target nucleic acid sequence having a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: (SEQ ID) 7 or its complement; and c) a second guide nucleic acid, or a nucleic acid sequence encoding said second guide nucleic acid, wherein said second guide nucleic acid is complementary to a second target nucleic acid sequence within or near the ICP27 gene of a herpesvirus genome, said second guide nucleic acid having a spacer sequence that hybridizes to said 27 target nucleic acid sequence or its complement, and said second target nucleic acid sequence having a nucleic acid sequence having at least 90% sequence identity to SEQ ID NO: (SEQ ID) 376 or its complement; A composition comprising:

2. 2. The composition of claim 1, wherein the first target nucleic acid sequence has a nucleic acid sequence having at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: (SEQ ID) 7 or its complement.

3. 3. The composition of claim 1 or 2, wherein the first target nucleic acid sequence has a nucleic acid sequence having SEQ ID NO: (SEQ ID) 7 or its complement.

4. 2. The composition of claim 1, wherein the second target nucleic acid sequence has a nucleic acid sequence having at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: (SEQ ID) 376 or its complement.

5. 10. The composition of claim 1 or 4, wherein the second target nucleic acid sequence has a nucleic acid sequence having SEQ ID NO: (SEQ ID) 376 or its complement.

6. 2. The composition of claim 1, wherein the first target nucleic acid sequence has a nucleic acid sequence having SEQ ID NO: (SEQ ID) 7 or its complement, and the second target nucleic acid sequence has a nucleic acid sequence having SEQ ID NO: (SEQ ID) 376 or its complement.

7. The composition of any one of claims 1 to 6, wherein the spacer sequence has about 20 nucleic acids.

8. 8. The composition of any one of claims 1-7, wherein the CRISPR-associated endonuclease is a Type I, Type II, or Type III Cas endonuclease.

9. 9. The composition of any one of 1-8, wherein the CRISPR-associated endonuclease is Cas9 endonuclease, Cas12 endonuclease, CasX endonuclease, or CasΦ endonuclease.

10. The composition of any one of claims 1 to 9, wherein the CRISPR-associated endonuclease is a Cas9 nuclease.

11. 11. The composition of claim 10, wherein the Cas9 nuclease is Staphylococcus aureus Cas9 (SaCas9) nuclease.

12. The composition of any one of claims 1 to 11, wherein the CRISPR-associated endonuclease is optimized for expression in human cells.

13. 13. The composition of claim 1, wherein the herpesvirus is selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

14. 14. Use of a composition according to any one of claims 1 to 13 in the manufacture of a medicament for treating a disease or condition in a subject in need thereof.

15. 15. The use of claim 14, wherein the disease or condition is a herpes virus infection in the subject.

16. 16. The use of claim 15, wherein the herpesvirus infection comprises an infection with a herpesvirus selected from the group consisting of herpes simplex virus type 1 (HSV1), herpes simplex virus type 2 (HSV2), human herpesvirus 3 (HHV-3; varicella-zoster virus (VZV)), human herpesvirus 4 (HHV-4; Epstein-Barr virus (EBV)), human herpesvirus 5 (HHV-5; cytomegalovirus (CMV)), human herpesvirus 6 (HHV-6; roseolovirus), human herpesvirus 7 (HHV-7), and human herpesvirus 8 (HHV-8; Karposi's sarcoma-associated herpesvirus (KSHV)).

17. 15. The use according to claim 14, wherein the disease or condition is selected from the group consisting of genital herpes, chickenpox, shingles, herpes zoster, exanthema subitum, mononucleosis, and Kaposi's sarcoma.

18. 15. The use according to claim 14, wherein the disease or condition comprises a lesion of the buccal or gingival mucosa.

19. The use according to any one of claims 14 to 18, characterized in that the subject is a human.

20. 20. The use according to claim 19, wherein the subject is a newborn.

21. 20. The use of claim 19, wherein the subject is immunocompromised.

Images