CD19 composition and method for immunotherapy

Tunable biological circuit systems with SREs and DDs address the challenges of cancer immunotherapy by precisely regulating immunotherapeutic agents, enhancing tumor targeting and reducing toxicity, thus improving treatment efficacy.

JP2025185029APending Publication Date: 2025-12-18OBSIDIAN THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025165390
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2017-04-11
Filing Date
2025-10-01
Publication Date
2025-12-18

AI Technical Summary

Technical Problem

Cancer immunotherapy is hindered by low numbers of tumor antigen-specific T cells, insufficient activation of innate immune cells, accumulation of tolerogenic antigen-presenting cells, and the formation of an immunosuppressive tumor microenvironment, leading to immune tolerance and potential toxicity from modified T cell administration.

Method used

Development of tunable biological circuit systems with stimulus response elements (SREs) and effector modules, including destabilization domains (DDs), to control the expression of immunotherapeutic agents like chimeric antigen receptors (CARs) and antibodies, allowing flexible adjustment and safety switches to manage toxicity and enhance therapeutic efficacy.

Benefits of technology

The systems enable precise regulation of immune responses, reducing toxicity and enhancing cancer treatment efficacy by modulating the expression of immunotherapeutic agents, thereby overcoming immunosuppression and improving tumor targeting.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025185029000137
    Figure 2025185029000137
  • Figure 2025185029000138
    Figure 2025185029000138
  • Figure 2025185029000139
    Figure 2025185029000139
Patent Text Reader

Abstract

To provide a CD19 composition and method for immunotherapy.SOLUTION: The invention provides a biocircuit system, an effector module, and a composition for cancer immunotherapy. The invention also provides a method for inducing an anticancer immune response in a subject.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 466,601, filed March 3, 2017, entitled "Compositions and Methods for Immunotherapy," and U.S. Provisional Patent Application No. 62 / 484,052, filed April 11, 2017, entitled "Anti CD19 compositions and methods for immunotherapy," the contents of each of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing

[0001] This application is submitted with an electronic Sequence Listing, which is provided in a file named 2095_1201PCT_SL.txt, created on March 2, 2018, with a file size of 2,116,001 bytes. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0003] The present invention relates to compositions and methods for immunotherapy. The present invention provides biological circuits, effector modules, stimulus response elements (SREs), and immunotherapeutic polypeptides, polynucleotides encoding the same, and vectors and cells containing the polypeptides and / or polynucleotides for use in cancer immunotherapy. In one embodiment, the composition comprises a destabilization domain (DD) that modulates protein stability. [Background technology]

[0004] Cancer immunotherapy aims to eradicate cancer cells by rejuvenating the tumoricidal function of tumor-reactive immune cells, primarily T cells. Cancer immunotherapy strategies, including checkpoint blockade, adoptive cell transfer (ACT), and the recent development of cancer vaccines, which can expand antitumor immune effector cells, have produced remarkable results in several tumors.

[0005] Host antitumor immunity and the impact of cancer immunotherapy are hindered by three major hurdles: 1) low numbers of tumor antigen-specific T cells due to clonal deletion; 2) insufficient activation of innate immune cells and the accumulation of tolerogenic antigen-presenting cells in the tumor microenvironment; and 3) the formation of an immunosuppressive tumor microenvironment. In particular, in solid tumors, the therapeutic efficacy of immunotherapy regimens remains insufficient due to the lack of effective antitumor responses in the immunosuppressive tumor microenvironment. In many cases, such immune tolerance is acquired because tumor cells induce immune tolerance or immunosuppression, leading to immune tolerance even to truly foreign tumor antigens. Because cancer vaccines and adoptive transfer of preactivated immune effector cells (e.g., T cells) are suppressed by inhibitors in the tumor microenvironment (TME), such immune tolerance is also active and dominant.

[0006] Furthermore, administration of modified T cells can lead to on-target / off-target toxicity and cytokine release syndrome (reviewed in Tey Clin. Transl. Immunol., 2014, 3:e17 10.1038).

[0007] The development of tunable switches that can turn on or off the expression of transgenic immunotherapeutic drugs in the event of adverse events is necessary. For example, the half-life of adoptive cell therapy can be very long and uncertain. Because toxicity can be progressive, a safety switch to remove infused cells is desirable. Systems and methods that allow for flexible adjustment of transgenic protein levels and expression windows could enhance therapeutic efficacy and reduce potential side effects. To develop tunable therapeutic agents for disease treatment, particularly cancer immunotherapy, the present invention provides a biological circuit system that controls the expression of an immunotherapeutic agent. The biological circuit system includes a stimulus and at least one effector module that responds to the stimulus. The effector module may include a stimulus response element (SRE) that binds to and responds to the stimulus, and an immunotherapeutic agent operably linked to the SRE. In one embodiment, the SRE is a destabilization domain (DD) that is destabilized in the absence of its specific ligand and can be stabilized by binding to its specific ligand. [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Tey Clin. Transl. Immunol.,2014,3:e17 10.1038 Summary of the Invention [Means for solving the problem]

[0009] The present invention provides compositions and methods for immunotherapy. The compositions relate to tunable systems and agents that induce anti-cancer immune responses in cells or in a subject. The tunable systems and agents may be biological circuit systems comprising at least one effector module responsive to at least one stimulus. The biological circuit systems may be, but are not limited to, destabilization domain (DD) biological circuit systems, dimerization biological circuit systems, receptor biological circuit systems, and cell biological circuit systems. These systems are further taught in co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, U.S. Provisional Patent Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO 2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0010] In some embodiments, the composition for inducing an immune response may include an effector module. In some embodiments, the effector module may comprise a stimulus response element (SRE) operably linked to at least one payload. In one aspect, the payload may be an immunotherapeutic drug.

[0011] In some embodiments, the immunotherapeutic agent may be selected from, but is not limited to, a chimeric antigen receptor (CAR) and an antibody.

[0012] In one embodiment, the SRE of the composition is capable of responding to or interacting with at least one stimulus.

[0013] In some embodiments, the SRE may include a destabilization domain (DD). The DD may be derived from a parent protein or a mutant protein having one, two, three, or more amino acid mutations compared to the parent protein. In some embodiments, the parent protein may be selected from, but is not limited to, the human protein FKBP having the amino acid sequence of SEQ ID NO: 3; human DHFR (hDHFR) having the amino acid sequence of SEQ ID NO: 2; E. coli DHFR having the amino acid sequence of SEQ ID NO: 1; PDE5 having the amino acid sequence of SEQ ID NO: 4; PPARγ having the amino acid sequence of SEQ ID NO: 5; CA2 having the amino acid sequence of SEQ ID NO: 6; or NQO2 having the amino acid sequence of SEQ ID NO: 7.

[0014] In one embodiment, the parent protein is hDHFR and DD comprises a mutant protein. The mutant protein may comprise a single mutation and may be selected from, but is not limited to, hDHFR(I17V), hDHFR(F59S), hDHFR(N65D), hDHFR(K81R), hDHFR(A107V), hDHFR(Y122I), hDHFR(N127Y), hDHFR(M140I), hDHFR(K185E), hDHFR(N186D), and hDHFR(M140I), hDHFR(amino acids 2-187 of the wild type; N127Y), hDHFR(amino acids 2-187 of the wild type; I17V), hDHFR(amino acids 2-187 of the wild type; Y122I), and hDHFR(amino acids 2-187 of the wild type; K185E). In some embodiments, the mutein may contain two mutations and is selected from the group consisting of hDHFR(C7R, Y163C), hDHFR(A10V, H88Y), hDHFR(Q36K, Y122I), hDHFR(M53T, R138I), hDHFR(T57A, I72A), hDHFR(E63G, I176F), hDHFR(G21T, Y122I), hDHFR(L74N, Y122I), and hDHFR(R74N, Y122I). I), hDHFR(V75F, Y122I), hDHFR(L94A, T147A), DHFR(V121A, Y22I), hDHFR(Y122I, A125F), hDHFR(H131 R, E144G), hDHFR(T137R, F143L), hDHFR(Y178H, E18IG), and hDHFR(Y183H, K185E), hDHFR(E162G, I176F) The mutants may be selected from, but are not limited to, hDHFR(wild-type amino acids 2-187; I17V, Y122I), hDHFR(wild-type amino acids 2-187; Y122I, M140I), hDHFR(wild-type amino acids 2-187; N127Y, Y122I), hDHFR(wild-type amino acids 2-187; E162G, I176F), and hDHFR(wild-type amino acids 2-187; H131R, E144G), and hDHFR(wild-type amino acids 2-187; Y122I, A125F). In some embodiments, the mutants comprise three mutations, and the mutants are selected from hDHFR(V9A, S93R, P150L), hDHFR(I8V, K133E, Y163C), hDHFR(L23S, V121A, Y157C),hDHFR(K19E, F89L, E181G), hDHFR(Q36F, N65F, Y122I), hDHFR(G54R, M140V, S168C), hDHFR(V110A, V136M, K177R), hDHFR(Q36F, Y122I, A125F), hDHFR(N49D, F59S, D153G), and hDHFR(G21E, I72V, I176T), hDH The amino acid sequence may be selected from, but is not limited to, hDHFR (wild-type amino acids 2 to 187; Q36F, Y122I, A125F), hDHFR (wild-type amino acids 2 to 187; Y122I, H131R, E144G), hDHFR (wild-type amino acids 2 to 187; E31D, F32M, V116I), and hDHFR (wild-type amino acids 2 to 187; Q36F, N65F, Y122I). In some embodiments, the variants may comprise four or more mutations, and the variants may include hDHFR(V2A, R33G, Q36R, L100P, K185R), hDHFR(amino acids 2-187 of wild type; D22S, F32M, R33S, Q36S, N65S), hDHFR(I17N, L98S, K99R, M112T, E151G, E162G, E172G), hD HFR(G16S, I17V, F89L, D96G, K123E, M140V, D146G, K156R), hDHFR(K81R, K99R, L100P, E102G, N108 D, K123R, H128R, D142G, F180L, K185E), hDHFR(R138G, D142G, F143S, K156R, K158E, E162G, V166A, K 177E, Y178C, K185E, N186S), hDHFR(N14S, P24S, F35L, M53T, K56E, R92G, S93G, N127S, H128Y, F135 L, F143S, L159P, L160P, E173A, F180L), hDHFR(F35L, R37G, N65A, L68S, K69E, R71G, L80P, K99G, G11 7D, L132P, I139V, M140I, D142G, D146G, E173G, D187G), hDHFR(L28P, N30H, M38V, V44A, L68S, N73G, R78G, A97T, K99R, A107T, K109R, D111N, L134P, F135V, T147A, I152V, K158R, E172G, V182A, E184R),hDHFR(V2A, I17V, N30D, E31G, Q36R, F59S, K69E, I72T, H88Y, F89L, N108D, K109E , V110A, I115V, Y122D, L132P, F135S, M140V, E144G, T147A, Y157C, V170A, K174R , N186S), hDHFR(L100P, E102G, Q103R, P104S, E105G, N108D, V113A, W114R, Y122 C, M126I, N127R, H128Y, L132P, F135P, I139T, F148S, F149L, I152V, D153A, D169G , V170A, I176A, K177R, V182A, K185R, N186S), and hDHFR (A10T, Q13R, N14S, N20D, P24S, N30S, M38T, T40A, K47R, N49S, K56R, I61T, K64R, K69R, I72A, R78G, E82G, F8 9L, D96G, N108D, M112V, W114R, Y122D, K123E, I139V, Q141R, D142G, F148L, E151G, E155G, Y157R, Q171R, Y183C, E184G, K185del, D187N).

[0015] In one embodiment, the stimulus for the SRE may be trimethoprim or methotrexate.

[0016] In some embodiments, the effector module immunotherapeutic is a chimeric antigen receptor (CAR). A chimeric antigen may have an extracellular targeting moiety, a transmembrane domain, an intracellular signaling domain, and, optionally, one or more costimulatory domains.

[0017] In one embodiment, the CAR may be selected from, but is not limited to, a standard CAR, a split CAR, an off-switch CAR, an on-switch CAR, a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation CAR.

[0018] In some embodiments, the extracellular targeting portion of the CAR can be selected from, but is not limited to, an Ig NAR, a Fab fragment, a Fab' fragment, a F(ab)'2 fragment, a F(ab)'3 fragment, an Fv, a single-chain variable fragment (scFv), a bis-scFv, an (scFv)2, a minibody, a diabody, a triabody, a tetrabody, an intrabody, a disulfide-stabilized Fv protein (dsFv), a unibody, a nanobody, and an antigen-binding region derived from an antibody that can specifically bind to either a protein, ligand, receptor, receptor fragment, or peptide aptamer of interest.

[0019] In one embodiment, the extracellular targeting moiety may be an scFv derived from an antibody. In one embodiment, the scFv is capable of specifically binding to the CD19 antigen.

[0020] In one aspect, the scFv of the CAR may be a CD19 scFv. In some embodiments, the CD19 scFv may comprise a heavy chain variable region having an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 49 to 80 and a light chain variable region having an amino acid sequence independently selected from the group consisting of SEQ ID NOs: 81 to 122. In some embodiments, the CD19 scFv may have an amino acid sequence selected from the group consisting of SEQ ID NOs: 123 to 267 and 624.

[0021] In some embodiments, the intracellular signaling domain of the CAR can be a signaling domain derived from the T cell receptor CD3ζ. In some embodiments, the intracellular signaling domain can be selected from a cell surface molecule selected from the group consisting of FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In one aspect, the CAR can comprise a costimulatory domain. In some embodiments, the costimulatory domain can be selected from the group consisting of 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.

[0022] (b) a costimulatory domain is present and is selected from the group consisting of 2B4, HVEM, ICOS, LAG3, DAP10, DAP12, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), glucocorticoid-induced tumor necrosis factor receptor (GITR), lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.

[0023] In some embodiments, the intracellular signaling domain of the CAR can be a T cell receptor CD3ζ signaling domain, which can have the amino acid sequence of SEQ ID NO: 339.

[0024] In some embodiments, the T cell receptor CD3 zeta signaling domain of a CAR having the amino acid sequence of SEQ ID NO: 626 can further comprise at least one costimulatory domain. The costimulatory domain can have the amino acid sequence of SEQ ID NOs: 268-374.

[0025] In one embodiment, the transmembrane domain of the CAR can be derived from the transmembrane region of the α, β, or ζ chain of the T cell receptor. In one aspect, the transmembrane domain can be derived from the CD3ε chain of the T cell receptor. In one embodiment, the transmembrane domain can be derived from a molecule selected from CD4, CD5, CD8, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD45, CD64, CD80, CD86, CD148, DAP10, EpoRI, GITR, LAG3, ICOS, Her2, OX40 (CD134), 4-1BB (CD137), CD152, CD154, PD-1, or CTLA-4. In another embodiment, the transmembrane domain can be derived from an immunoglobulin selected from IgG1, IgD, IgG4, and an IgG4 Fc region. In one aspect, the transmembrane domain may have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 375-425 and 897-907.

[0026] In some embodiments, the CAR of the effector module may further comprise a hinge region near the transmembrane domain. In one aspect, the hinge region may have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 426-504.

[0027] In some embodiments, the immunotherapeutic may be an antibody that is specifically immunoreactive with an antigen selected from a tumor-specific antigen (TSA), a tumor-associated antigen (TAA), or an antigenic epitope.

[0028] In one aspect, the antigen can be an antigenic epitope. In some embodiments, the antigenic epitope can be CD19.

[0029] In some embodiments, the antibody may comprise a heavy chain variable region having an amino acid sequence independently selected from the group consisting of any of SEQ ID NOs: 49 to 80, and a light chain variable region having an amino acid sequence independently selected from the group consisting of any of SEQ ID NOs: 81 to 122. In one aspect, the antibody may have an amino acid sequence selected from the group consisting of any of SEQ ID NOs: 123 to 267 and 624.

[0030] In one aspect, the first effector module may have the amino acid sequence of any one of SEQ ID NOs: 635-649, 1005-1010, 1015-1018, and 1215-1231.

[0031] In some embodiments, the first SRE of the effector module may stabilize the immunotherapeutic agent at a stabilization ratio of 1 or greater, which may comprise the ratio of expression, function, or level of the immunotherapeutic agent in the presence of a stimulus to the expression, function, or level of the immunotherapeutic agent in the absence of the stimulus.

[0032] In some embodiments, an SRE may destabilize an immunotherapeutic agent by a destabilization ratio of 0 to 0.09, which may include the ratio of expression, function, or level of an immunotherapeutic agent in the absence of a stimulus specific for the SRE to the expression, function, or level of an immunotherapeutic agent that is constitutively expressed in the absence of a stimulus specific for the SRE.

[0033] The present invention also provides a polynucleotide comprising a composition of the present invention.

[0034] In one aspect, the polynucleotide may be a DNA or RNA molecule. In one aspect, the polynucleotide may contain spatiotemporally selected codons. In one aspect, the polynucleotide of the present invention may be a DNA molecule. In some embodiments, the polynucleotide may be an RNA molecule. In one aspect, the RNA molecule may be a messenger molecule. In some embodiments, the RNA molecule may be chemically modified.

[0035] In some embodiments, the polynucleotide may further comprise at least one additional feature selected from, but not limited to, a promoter, a linker, a signal peptide, a tag, a cleavage site, and a targeting peptide.

[0036] The present invention also provides a vector comprising the polynucleotide described herein. In one aspect, the vector may be a viral vector. In some embodiments, the viral vector may be a retroviral vector, a lentiviral vector, a gammaretroviral vector, a recombinant AAV vector, an adenoviral vector, or an oncolytic viral vector.

[0037] The present invention also provides compositions of the present invention, immune cells for adoptive cell transfer (ACT) capable of expressing the polynucleotides described herein. In one embodiment, the immune cells may be infected or transfected with the vectors described herein. The immune cells for ACT may be selected from, but are not limited to, CD8+ T cells, CD4+ T cells, helper T cells, natural killer (NK) cells, NKT cells, cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), memory T cells, regulatory T (Treg) cells, cytokine-induced killer (CIK) cells, dendritic cells, human embryonic stem cells, mesenchymal stem cells, hematopoietic stem cells, or a mixture thereof.

[0038] In some embodiments, immune cells may be autologous, allogeneic, syngeneic, or xenogeneic with respect to a particular individual subject.

[0039] In some embodiments, the immune cell may further express a composition comprising a second effector module, wherein the second effector module comprises a second SRE linked to a second immunotherapeutic agent. In one aspect, the second immunotherapeutic agent may be selected from a cytokine and a cytokine-cytokine receptor fusion.

[0040] In one embodiment, the second immunotherapeutic agent may be a cytokine, hi one embodiment, the cytokine may be IL12 or IL15.

[0041] In one embodiment, the second immunotherapeutic agent may be a cytokine-cytokine receptor fusion polypeptide.

[0042] In some embodiments, the cytokine-cytokine receptor fusion polypeptide can be selected from, but is not limited to, an IL12-IL12 receptor fusion polypeptide, an IL15-IL15 receptor fusion polypeptide, and an IL15-IL15 receptor sushi domain fusion polypeptide.

[0043] The present invention provides a method for reducing tumor volume or tumor burden in a subject, comprising contacting the subject with an immune cell of the present invention. Also provided herein is a method for inducing an anti-tumor immune response in a subject, comprising administering immune cells of the system to the subject.

[0044] The present invention also provides a method for enhancing the proliferation and / or survival of an immune cell, comprising contacting the immune cell with a composition of the present invention, a polynucleotide of the present invention, and / or a vector of the present invention.

[0045] Also provided herein are methods for inducing an immune response in a subject, administering to the subject a composition of the invention, a polynucleotide of the invention, and / or an immune cell of the invention.

[0046] The present invention also provides methods for identifying domains of the CD19 antigen that do not bind to the FMC63 antibody (CD19-binding domains distinct from FMC63). The methods may include: (a) preparing a composition comprising the CD19 antigen; (b) contacting the composition of (a) with saturating levels of the FMC63 antibody; (c) contacting the composition of step (b) with one or more selected members of a library of potential CD19-binding agents; and (d) identifying binding domains on the CD19 antigen based on differential binding of the selected members of the library of CD19-binding agents compared to binding of FMC63. In some embodiments, the binding domains of the library may be generated using phage display technology using the CD19 antigen as a seed sequence. In one embodiment, the binding domain may be selected from a Fab fragment, a Fab' fragment, a F(ab)'2 fragment, a F(ab)'3 fragment, an Fv, a single-chain variable fragment (scFv), a bis-scFv, an (scFv)2, a minibody, a diabody, a triabody, a tetrabody, a disulfide-stabilized Fv protein (dsFv), a unibody, a nanobody, or an antigen-binding region of an antibody, and an antibody fragment. In one embodiment, the CD19 antigen may be selected from all or a portion of human CD19 antigen and all or a portion of rhesus monkey CD19 antigen.

[0047] The present invention also provides a chimeric antigen receptor that may comprise a CD19-binding domain distinct from FMC63 obtained according to the methods described herein. Also provided herein is a stimulus response element (SRE) operably linked to a chimeric antigen receptor that comprises a CD19-binding domain distinct from FMC63.

[0048] In some embodiments, the effector module comprises a stimulus response element (SRE) and at least one payload comprising a protein of interest (POI).

[0049] In some embodiments, the SRE can be a destabilizing domain (DD). In some examples, the DD is a mutant domain derived from a protein, such as FKBP (FK506 binding protein), E. coli DHFR (dihydrofolate reductase) (ecDHFR), human DHFR (hDHFR), or any protein of interest. In this context, the biological circuit is a DD biological circuit.

[0050] The payload can be any immunotherapeutic agent used in cancer immunotherapy, for example, any molecule, antibody, antigen-binding domain, or combination of antigen-binding domains targeting tumor cells, a chimeric drug receptor (CAR) such as a CD19 CAR, a cytokine such as IL12, IL15, or an IL15 / IL15Ra fusion, or any agent capable of inducing an immune response. The SRE and payload can be operably linked via one or more linkers, and the location of the components can vary within the effector module.

[0051] In some embodiments, the effector module may further comprise one or more additional features, such as a linker sequence (with a particular sequence and length), a cleavage site, a regulatory element (which regulates expression of a protein of interest, such as a microRNA target site), a signal sequence that directs the effector module to a particular cellular or subcellular location, a penetration sequence, or tags and biomarkers for tracking the effector module.

[0052] In some embodiments, the DD may stabilize the immunotherapeutic in the presence of a stimulus with a stabilization ratio of at least 1. In accordance with the present invention, the DD may destabilize the immunotherapeutic in the absence of a ligand with a destabilization ratio of 0 to 0.99.

[0053] The present invention provides isolated biological circuit polypeptides, effector modules, stimulus response elements (SREs), and payloads, as well as polynucleotides encoding any of the foregoing; vectors comprising the polynucleotides of the invention; and cells expressing the polypeptides, polynucleotides, and vectors of the invention. The polypeptides, polynucleotides, viral vectors, and cells are useful for inducing anti-tumor immune responses in a subject.

[0054] In some embodiments, the vectors of the present invention are viral vectors, which may include, but are not limited to, retroviral vectors, adenoviral vectors, adeno-associated viral vectors, or lentiviral vectors.

[0055] In some embodiments, the vectors of the present invention may be non-viral vectors, such as nanoparticles and liposomes.

[0056] The present invention also provides immune cells modified to contain one or more polypeptides, polynucleotides, or vectors of the present invention. The cells may be immune effector cells, including T cells such as cytotoxic T cells, helper T cells, memory T cells, regulatory T cells, natural killer (NK) cells, NK T cells, cytokine-induced killer (CIK) cells, cytotoxic T lymphocytes (CTLs), and tumor-infiltrating lymphocytes (TILs). The modified cells may be used in adoptive cell transfer to treat diseases (e.g., cancer).

[0057] The present invention also provides methods of inducing an immune response in a subject using the compositions of the present invention, and methods of reducing tumor burden in a subject using the compositions of the present invention.

[0058] Also provided herein are methods for identifying binding domains distinct from FMC63 and using CD19 antigens in which the FMC63-binding epitope is masked or absent. In some embodiments, FMC63-binding domains can be included in payloads and effector modules of the invention. [Brief explanation of the drawings]

[0059] [Figure 1] 1 shows a schematic diagram of a biological circuit system of the present invention. The biological circuit comprises a stimulus and at least one effector module that responds to the stimulus, producing a signal or result. The effector module includes at least one stimulus response element (SRE) and a payload. [Figure 2] A representative effector module carrying one payload is shown. The signal sequence (SS), SRE, and payload may be positioned or arranged in various configurations, without (A-F) or with (G-Z and AA-DD) cleavage sites. Optional linkers may be inserted between each component of the effector module. [Figure 3] A representative effector module carrying two payloads and no cleavage site is shown. The two payloads can be directly linked to each other or can be separate. [Figure 4] A representative effector module carrying two payloads and having a cleavage site is shown. In one embodiment, the SS is located at the N-terminus of the construct, while the other components: the SRE, two payloads, and the cleavage site may be located at different positions (A-L). In another embodiment, the cleavage site is located at the N-terminus of the construct (M-X). Optional linkers may be inserted between each component of the effector module. [Figure 5]An effector module of the invention carrying two payloads is shown, with the SRE located at the N-terminus of the construct (A-L), while the SS, two payloads, and cleavage site can be configured in any manner. Optional linkers may be inserted between each component of the effector module. [Figure 6] The effector module of the present invention, which carries two payloads, is shown. Either two payloads (A-F) or one of two payloads (G-X) is placed at the N-terminus of the construct (A-L), while the SS, SRE, and cleavage site can be configured in any way. An optional linker may be inserted between each component of the effector module. [Figure 7] A representative configuration of stimulus and effector modules within a biological circuit is shown. A free stimulus (Figure 7A) or membrane-bound stimulus (Figure 7B) that binds to an SRE activates a transmembrane effector module. In response to the stimulus, the intracellular signal / payload is cleaved, activating the downstream effector / payload. [Figure 8] This shows a dual-stimulus-dual-presenter biological circuit system in which two binding stimuli (A and B) from two different presenters (e.g., different cells) simultaneously bind to two different effector modules on a single receiver (e.g., another single cell), generating dual signals to downstream payloads. [Figure 9] This shows a dual-stimulus-single-presenter biological circuit system in which two binding stimuli (A and B) from the same presenter (e.g., a single cell) simultaneously bind to two different effector modules on another single cell, generating dual signals. [Figure 10] A single-stimulus-bridged-receiver biological circuit system is shown, in which a binding stimulus (A) binds to an effector module on a bridge cell, generating a signal to activate a payload, which then becomes a stimulus (B) for another effector module on a final receiver (e.g., another cell). [Figure 11]This shows a single-stimulus-single-receiver type biological circuit system, in which a single receiver contains two effector modules, which are sequentially activated by a single stimulus. [Figure 12] (B) A biological circuit system requiring dual activation. In this embodiment, one stimulus must first bind to the transmembrane effector module and prime the receiver cell, which is then activated by the other stimulus. The receiver is activated only if it senses both stimuli (C). [Figure 13] 1 shows a canonical effector module of a chimeric antigen receptor (CAR) system, comprising an antigen-binding domain as the SRE and signaling domain(s) as the payload. [Figure 14] The structural design of a tunable CAR system is shown, in which the transmembrane effector module comprises an antigen-binding domain and a first switch domain that senses an antigen, and the intracellular module comprises a second switch domain and a signaling domain. A stimulus (e.g., a dimerizing small molecule) can dimerize the first and second switch domains to assemble an activated CAR system. [Figure 15] Schematic diagram of a CAR system with one (A) or two (B and C) SREs integrated into the effector module. [Figure 16] Split CAR designs are shown for controlling T cell activation by dual stimuli (e.g., antigen and small molecule). Figure 16A shows normal T cell activation with dual activation of TCR and costimulatory receptors. The conventional CAR design (Figure 16B) combines an antigen recognition domain with a TCR signaling motif and a costimulatory motif into a single molecule. The split CAR system separates the components of a conventional CAR into two distinct effector modules, which can be reassembled in the presence of a heterodimerizing small molecule (stimulus). [Figure 17] Negative or positive regulation of CAR-modified T cell activation. T cell activation can be negatively (A) or positively (B) regulated with or without a second stimulus. [Figure 18]A schematic diagram of gated activation of CAR-modified T cells is shown. In the case of normal cells that have received no stimulus (e.g., antigen) (Figure 18A), have an antigen that cannot bind to the transmembrane effector module (Figure 18B), or have only an antigen that activates the transmembrane effector module and primes the receiver T cell to express a second effector (Figure 18C), the receiver T cell remains inactive. When both stimuli (e.g., two antigens) that bind to the transmembrane effector module and the primed effector are present on the presenter cell (e.g., cancer cell), the T cell is activated (Figure 18D). [Figure 19A] 1 is a bar graph showing IL12 levels in various dilutions of media from cells expressing DD-IL12. [Figure 19B] 1 is a bar graph showing DD-IL12 dose-responsive induction of Shield-1. [Figure 19C] 1 shows plasma IL12 levels in mice transplanted with SKOV3 cells. [Figure 19D] Plasma IL12 levels in mice in response to different Shield-1 dosing regimens are shown. [Figure 20A] Western blot of IL15 protein levels in 293 cells. [Figure 20B] 1 is a histogram showing surface expression of IL15. [Figure 20C] 1 is a histogram showing surface expression of IL15Ra. [Figure 20D] Western blot of IL15 and hDHFR in HCT116 cells. [Figure 21-1] Figures 21A and 21B are Western blots showing CD3ζ and actin protein levels of DD-CD19 CAR constructs. Figure 21C shows CD19 chimeric antigen receptor expression in a Western blot using the 4-1BB antibody. Figure 21D is a bar graph showing surface expression of CD19 CAR. [Figure 21-2] Same as above. [Figure 22] The frequency of IFNγ-positive T cells is shown. [Figure 23-1] Figure 23A shows IFNγ production in T cells. Figure 23B shows T cell proliferation in the presence of IL15 / IL15Ra treatment. Figure 23C is a dot plot showing the percentage of human cells after in vivo cell transfer. Figure 23D is a scatter plot showing CD4+ / CD8+ T cells. [Figure 23-2] Same as above. [Figure 24] Figure 24A shows the T cell subpopulation expressing CD19 CAR, and Figure 24B shows cell death caused by CD19 CAR-expressing T cells. [Figure 25-1] Figure 25A is a bar graph showing IL15Ra-positive cells in the presence of TMP treatment for 24 hours, Figure 25B is a bar graph showing IL15Ra-positive cells in the presence of TMP treatment for 48 hours, and Figure 25C is a bar graph showing IL15Ra-positive cells in response to various concentrations of TMP. [Figure 25-2] Same as above. [Figure 26] Western blot of IL15Ra protein levels in HCT116 cells. [Figure 27-1] Figure 27A shows the ratio of human T cells to mouse T cells in the blood. Figure 27B shows the number of T cells in the blood. Figure 27C shows the ratio of CD4 cells to CD8 cells in the blood. Figure 27D shows the percentage of IL15Ra-positive CD4 and CD8 T cells in the blood. [Figure 27-2] Same as above. [Figure 28-1] Figure 28A shows T cell proliferation in response to cytokine treatment, and Figures 28B, 28C, and 28D show the frequency of IFNγ-positive cells in the presence of IL12 treatment. [Figure 28-2] Same as above. [Figure 28-3] Same as above. [Figure 29] 1 is a bar graph depicting the effect of promoters on transgene expression. [Figure 30A] Expression of CD19 in parental K562 cells and K562-CD19 cells is shown. [Figure 30B]Proliferation of K562 cells co-cultured with T cells expressing DD-regulated CAR constructs in the presence or absence of ligand is shown. [Figure 30C] The area of ​​target cells killed by T cells expressing a CAR construct under DD regulation in the presence of ligand is shown. [Figure 31] Figure 31A shows IFNγ concentrations, and Figure 31B shows IL2 concentrations. [Figure 32A] Final IL12 concentrations for each of the four groups tested are shown. [Figure 32B] IL12 is detectable in the kidney. [Figure 32C] We show that IL12 is detectable in tumors. [Figure 33A] Regulation of IL12 over a 24 hour period is shown. [Figure 33B] The regulation in plasma is shown. [Figure 33C] 1 shows the detection of flexi-IL12 in the kidney. [Figure 34A] This shows that restimulation increased IL12 expression. [Figure 34B] This shows that the ligand increased IL12 production. [Figure 34C] This shows that the ligand increased IL12 production. [Figure 35A] 1 shows concentration-dependent induction of IL12 secretion from human primary T cells. [Figure 35B] Figure 1 shows the time course induction of IL12 secretion from human primary T cells. [Figure 36] Figure 36A shows the dose response of Aquashield-induced DD-IL12 modulation in vivo, and Figure 36B shows that plasma levels of IL12 remain elevated in animals transferred with constitutive IL12-transduced T cells. [Figure 37-1]Figures 37A and 37B show IL12 expression in vivo over 7 days. Figures 37C and 37D show IL12 expression in vivo over 11 days. Figure 37E shows the geometric MFI (GeoMFI) of granzyme B (GrB) in CD8+ T cells after 7 days. Figure 37F shows the GeoMFI of perforin in CD8+ T cells after 7 days. [Figure 37-2] Same as above. [Figure 38A] PGK and EF1a promoters and regulation of IL12 in the presence of the FKBP domain. [Figure 38B] The relative expression of IL12 is shown. [Figure 39] Figure 1 shows the kinetics of IL15Ra surface expression on CD4 T cells after TMP treatment. [Figure 40] 1 depicts a Western blot of IL15-IL15Ra protein in HCT116 tumors derived from mice treated with TMP for 17 days in a xenograft assay. [Figure 41] 1 is a graph of the results of an MSD assay of IL15 protein levels in HEK293 cells. [Figure 42A] 1 provides a FACS plot showing the expression of membrane-bound IL15 after a dose-response study of TMP. [Figure 42B] 1 is two graphs showing that dose and time of exposure to TMP in vitro affect the expression of membrane-bound IL15. [Figure 43-1] Figures 43A-C show modulation of membrane-bound IL15 using IL15 (Figure 43A), IL15Ra (Figure 43B), or IL15 / IL15Ra double staining (Figure 43C). Figure 43D shows a FACS plot of IL15 expression. Figure 43E is a graph of modulation of circulating IL15. Figure 43F is a graph of plasma TMP levels. [Figure 43-2] Same as above. [Figure 43-3] Same as above. [Figure 43-4] Same as above. [Figure 44]1 shows the regulation of membrane-bound IL15 by oral or intraperitoneal administration of TMP. DETAILED DESCRIPTION OF THE INVENTION

[0060] The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred materials and methods are described herein. Other features, objects, and advantages of the invention will become apparent from the description. In the description, the singular also includes the plural unless the context clearly dictates otherwise. Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present description shall control.

[0061] I. Introduction Cancer immunotherapy aims to induce or restore immune system responsiveness against cancer. Significant advances in immunotherapy research have led to the development of various strategies that can be broadly classified as active and passive immunotherapy. Generally, these strategies can be utilized to directly kill cancer cells or to counteract the immunosuppressive tumor microenvironment. Active immunotherapy aims to induce an endogenous, long-lasting tumor antigen-specific immune response. Responses can be further enhanced by nonspecific stimulation of immune response modifiers such as cytokines. In contrast, passive immunotherapy involves administering immune effector molecules, such as tumor antigen-specific cytotoxic T cells or antibodies, to the host. This approach is temporary and requires multiple treatments.

[0062] Despite significant advances, the efficacy of current immunotherapy strategies is limited by associated toxicities. These are often related to the narrow treatment window associated with immunotherapy and, in part, stem from the need to push therapeutic doses to the limits of potentially fatal toxicity in order to achieve clinically meaningful therapeutic effects. Furthermore, adoptively transferred immune cells often continue to expand unpredictably within patients, resulting in in vivo dose escalation.

[0063] A major risk associated with immunotherapy is on-target but off-tumor side effects resulting from T cell activation in response to normal tissue expression of tumor-associated antigens (TAA). Clinical trials utilizing T cells expressing T cell receptors against specific TAAs have reported skin rash, colitis, and hearing loss in response to immunotherapy.

[0064] Immunotherapy can also cause on-target, on-tumor toxicity, which occurs when tumor cells are killed in response to immunotherapy.Adverse effects include tumor lysis syndrome, cytokine release syndrome, and related macrophage activation syndrome.Importantly, these adverse effects may occur during tumor destruction, and therefore, even if on-tumor immunotherapy is successful, toxicity may occur.Therefore, the approach of regulating immunotherapy is highly desirable, as it may reduce toxicity and maximize efficacy.

[0065] The present invention provides systems, compositions, immunotherapeutic agents, and methods for cancer immunotherapy. These compositions provide tunable regulation of gene expression and function in immunotherapy. The present invention also provides biological circuit systems, effector modules, stimulus response elements (SREs), and payloads, as well as polynucleotides encoding any of the foregoing. In one aspect, the systems, compositions, immunotherapeutic agents, and other components of the present invention can be controlled by separately applied stimuli, thereby providing great flexibility for modulating cancer immunotherapy. Furthermore, the systems, compositions, and methods of the present invention may be combined with therapeutic agents such as chemotherapeutic agents, small molecules, gene therapies, and antibodies.

[0066] The tunable nature of the systems and compositions of the present invention has the potential to improve the efficacy and duration of efficacy of immunotherapies. By using the compositions of the present invention to reversibly silence the biological activity of adoptively transferred cells, the potential of cell therapy can be maximized without irreversibly killing them and terminating the treatment.

[0067] The present invention provides a method for fine-tuning immunotherapy after administration to a patient, thereby improving the safety and efficacy of immunotherapy and expanding the subject population that can benefit from immunotherapy.

[0068] II. Compositions of the Invention The present invention provides a biological circuit system comprising at least one effector module system at its core. Such an effector module system includes at least one effector module associated with or integrated with one or more stimulus response elements (SREs). The overall architecture of the biological circuit system of the present invention is shown in Figure 1. Generally, the stimulus response element (SRE) may be operably linked to a payload construct, which may be any protein of interest (POI) (e.g., an immunotherapeutic drug), to form an effector module. When activated by a specific stimulus, such as a small molecule, the SRE generates a signal or result that can up- or down-regulate the transcription and / or protein levels of the linked payload by perpetuating a stabilizing or destabilizing signal, or any other type of regulation. Detailed descriptions of biological circuit systems can be found in U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Patent Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety. In accordance with the present invention, biological circuit systems, effector modules, SREs, and components are provided that modulate the expression levels and activity of any agent used in immunotherapy.

[0069] As used herein, a "biological circuit" or "biological circuit system" is defined as a circuit within or useful within a biological system that includes a stimulus and at least one effector module responsive to the stimulus, where the response to the stimulus produces at least one signal or result within, between, as an indicator of, or on the biological system. A biological system is generally understood to be any cell, tissue, organ, organ system, or organism, such as an animal, plant, fungus, bacterium, or virus. It is also understood that a biological circuit may be an artificial circuit that uses a stimulus or effector module as described herein to provide a signal or result in a cell-free environment, such as a diagnostic, reporter system, device, assay, or kit. The artificial circuit may also be associated with one or more electronic, magnetic, or radioactive components or components.

[0070] According to the present invention, the biological circuitry may be a destabilization domain (DD) biological circuitry, a dimerization biological circuitry, a receptor biological circuitry, and a cell biological circuitry, any of which may act as a signal to any other of these biological circuits.

[0071] Effector modules and SREs for immunotherapy The present invention provides biological circuits, effector modules, SREs, and components that modulate the expression level and activity of any agent used in immunotherapy. By way of non-limiting example, immunotherapeutic agents may be antibodies and their fragments and variants, cancer-specific T cell receptors (TCRs) and their variants, anti-tumor-specific chimeric antigen receptors (CARs), chimeric switch receptors, inhibitors of co-inhibitory receptors or ligands, agonists of co-stimulatory receptors and ligands, cytokines, chemokines, cytokine receptors, chemokine receptors, soluble growth factors, metabolic factors, suicide genes, homing receptors, or any agent that elicits an immune response in cells and subjects.

[0072] As described above, the biological circuits of the present invention include at least one effector module as a component of the effector module system. As used herein, an "effector module" is a single- or multi-component construct or complex that includes at least (a) one or more stimulus response elements (i.e., proteins of interest (POIs)). As used herein, a "stimulus response element (SRE)" is a component of an effector module that binds, connects, links, or associates with one or more payloads of the effector module and, in some cases, is responsible for the responsiveness of the effector module to one or more stimuli. As used herein, the nature of the "responsiveness" of an SRE to a stimulus can be characterized by covalent or non-covalent interactions, direct or indirect associations, or structural or chemical responses to the stimulus. Furthermore, the response of any SRE to a stimulus can be a matter of degree or type. The response may be a partial response. The response may be a reversible response. The response may ultimately result in a regulated signal or output. Such output signals may be relative in nature to the stimulus, for example, a modulation effect between 1% and 100%, or a factorial increase or decrease such as 2-fold, 3-fold, 4-fold, 5-fold, 10-fold or more.

[0073] In some embodiments, the present invention provides methods for modulating protein expression, function, or levels. In some aspects, modulation of protein expression, function, or levels means modulation of protein expression, function, or levels by at least about 20%, e.g., at least about 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 100%, or at least 20-30%, 20-40%, 20-50%, 20-60%, 20-70%, 20-80%, 20-90%, 20-95%, 20-100%, 30-40%, 30-50%, 30-60%, 30-70%, 30-80%, 30-90%, 30-95%, 30-100%, This refers to modulation of expression, function or levels by 40-50%, 40-60%, 40-70%, 40-80%, 40-90%, 40-95%, 40-100%, 50-60%, 50-70%, 50-80%, 50-90%, 50-95%, 50-100%, 60-70%, 60-80%, 60-90%, 60-95%, 60-100%, 70-80%, 70-90%, 70-95%, 70-100%, 80-90%, 80-95%, 80-100%, 90-95%, 90-100% or 95-100%.

[0074] In some embodiments, the present invention provides methods for modulating protein expression, function, or levels by measuring stabilization and destabilization ratios. As used herein, a stabilization ratio can be defined as the ratio of the expression, function, or level of a protein of interest in response to a stimulus to the expression, function, or level of the protein of interest in the absence of the SRE-specific stimulus. In some aspects, the stabilization ratio is at least 1, e.g., at least 1-10, 1-20, 1-30, 1-40, 1-50, 1-60, 1-70, 1-80, 1-90, 1-100, 20-30, 20-40, 20-50, 20-60, 20-70, 20-80, 20-90, 20-95, 20-100, 30-40, 30-50, 30-60, 30-70, 30-80, 30-90, 30-95, 30- 100, 40-50, 40-60, 40-70, 40-80, 40-90, 40-95, 40-100, 50-60, 50-70, 50-80, 50-90, 50-95, 50-100, 60-70, 60-80, 60-90, 60-95, 60-100, 70-80, 70-90, 70-95, 70-100, 80-90, 80-95, 80-100, 90-95, 90-100, or 95-100. As used herein, a destabilization ratio may be defined as the ratio of expression, function, or levels of a protein of interest in the absence of a stimulus specific for the effector module to the expression, function, or levels of a protein of interest constitutively expressed and in the absence of a stimulus specific for the SRE. As used herein, "constitutively" refers to the expression, function or level of a protein of interest that is not linked to an SRE and is therefore expressed in both the presence and absence of a stimulus.In some embodiments, the destabilization rate is at least 0, e.g., at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or at least 0-0.1, 0-0.2, 0-0.3, 0-0.4, 0-0.5, 0-0.6, 0-0.7, 0-0.8, 0-0.9, 0.1-0.2, 0.1-0.3, 0.1-0.4, 0.1-0.5, 0.1-0.6, 0.1-0.7, 0.1-0.8, 0.1-0.9, 0.2-0.3, 0.2-0.4, 0 0.2-0.5, 0.2-0.6, 0.2-0.7, 0.2-0.8, 0.2-0.9, 0.3-0.4, 0.3-0.5, 0.3-0.6, 0.3-0.7, 0.3-0.8, 0.3-0.9, 0.4-0.5, 0.4-0.6, 0.4-0.7, 0.4-0.8, 0.4-0.9, 0.5-0.6, 0.5-0.7, 0.5-0.8, 0.5-0.9, 0.6-0.7, 0.6-0.8, 0.6-0.9, 0.7-0.8, 0.7-0.9 or 0.8-0.9.

[0075] In some embodiments, the stimulus of the present invention may be an ultrasound stimulus. In some embodiments, the SRE of the present invention may be derived from a mechanosensitive protein. In one embodiment, the SRE of the present invention may be the mechanosensitive ion channel, Piezo1.

[0076] In such cases, expression of the target payload is regulated by providing focused ultrasound stimulation. In other embodiments, the SRE of the present invention may be derived from a calcium biosensor, and the stimulus of the present invention may be calcium. Calcium may be generated by ultrasound-induced mechanical stimulation of a mechanosensitive ion channel. Ultrasound activation of the ion channel causes calcium influx, thereby generating the stimulus. In one embodiment, the mechanosensitive ion channel is Piezo1. Mechanosensors can be advantageously used because they provide spatial control over specific locations within the body.

[0077] The SRE of the effector module can be selected from, but not limited to, a peptide, a peptide complex, a peptide-protein complex, a protein, a fusion protein, a protein complex, and a protein-protein complex. The SRE can comprise one or more regions derived from any native or mutant protein or antibody. In this embodiment, the SRE is an element that responds to a stimulus and can regulate the intracellular localization, intramolecular activation, and / or degradation of the payload.

[0078] In some embodiments, effector modules of the present invention may contain additional features that facilitate expression and regulation of the effector module, such as one or more signal sequences (SS), one or more cleavage and / or processing sites, one or more targeting and / or penetrating peptides, one or more tags, and / or one or more linkers. Furthermore, effector modules of the present invention may further contain other regulatory moieties, such as an inducible promoter, an enhancer sequence, a microRNA site, and / or a microRNA targeting site. Each aspect or modality may confer differentially tailored properties to the effector module or biological circuit. For example, an SRE may represent a destabilization domain, while mutation of the protein payload may alter its cleavage site, dimerization properties, or half-life, and the inclusion of one or more microRNAs or microRNA-binding sites may confer cellular detargeting or trafficking properties. Consequently, the present invention encompasses biological circuits that are multifactorial in their sustainability. Such biological circuits may be designed to contain one, two, three, four, or more tailored properties.

[0079] In some embodiments, the effector module of the present invention may contain one or more degrons to modulate expression. As used herein, "degron" refers to the minimal sequence within a protein sufficient for recognition and degradation by a proteolytic system. An important property of a degron is that it is transposable; that is, adding a degron to a sequence results in degradation of that sequence. In some embodiments, a degron may be added to a destabilization domain, a payload, or both. Incorporation of a degron into an effector module of the present invention may confer additional protein instability to the effector module, which may be used to minimize basal expression. In some embodiments, the degron may be an N-degron, a phosphodegron, a heat-inducible degron, a light-sensitive degron, or an oxygen-dependent degron. As a non-limiting example, the degron may be the ornithine decarboxylase degron described by Takeuchi et al. (Takeuchi J et al. (2008). Biochem J. 2008 Mar 1;410(2):401-7; the contents of which are incorporated by reference in their entirety.) Other examples of degrons useful in the present invention include those described in International Patent Publication Nos. WO2017004022, WO2016210343, and WO2011062962; the contents of each are incorporated by reference in their entirety.

[0080] As shown in Figure 2, a representative effector module embodiment containing one payload, i.e., one immunotherapeutic agent, is shown. The components of the effector module may be positioned or arranged in various configurations, without (A-F) or with (G-Z and AA-DD) cleavage sites. Optional linkers may be inserted between the components of the effector module.

[0081] Figures 3-6 show exemplary effector module embodiments containing two payloads, i.e., two immunotherapeutic agents. In some embodiments, an effector module may contain three or more immunotherapeutic agents (payloads) under the control of the same SRE (e.g., the same DD). The two or more agents may be directly linked to each other or may be separate (Figure 3). The SRE may be located at the N-terminus of the construct, the C-terminus of the construct, or an internal location.

[0082] In some embodiments, the two or more immunotherapeutic agents may be of the same type, e.g., two antibodies, or of different types, e.g., a CAR construct and the cytokine IL12. Biological circuits and components utilizing such effector molecules are shown in Figures 7-12.

[0083] In some embodiments, the biological circuits of the present invention may be modified to reduce their immunogenicity. Immunogenicity is the result of a complex series of reactions to substances recognized as foreign, which may include the production of neutralizing and non-neutralizing antibodies, immune complex formation, complement activation, mast cell activation, inflammation, hypersensitivity reactions, and anaphylaxis. Several factors, including but not limited to the protein sequence, route and frequency of administration, and patient population, may contribute to the immunogenicity of a protein. In preferred embodiments, protein engineering may be used to reduce the immunogenicity of the compositions of the present invention. In some embodiments, modifications to reduce immunogenicity may include modifications that reduce binding of processed peptides derived from the parent sequence to MHC proteins. For example, amino acid modifications may be designed to eliminate or minimize the number of immune epitopes predicted to bind with high affinity to any common MHC allele. Several methods for identifying MHC-binding epitopes in known protein sequences are known in the art and may be used to score epitopes in the compositions of the present invention. Such methods are disclosed in U.S. Patent Publication Nos. US20020119492, US20040230380, and US20060148009; the contents of each are incorporated by reference in their entirety.

[0084] Epitope identification and subsequent sequence modification may be applied to reduce immunogenicity. Identification of immunogenic epitopes may be achieved physically or computationally. Physical methods of epitope identification may include, for example, mass spectrometry and tissue culture / cell techniques. Computational approaches may also be used that utilize information obtained from antigen processing, antigen loading and presentation, structural data, and / or proteomic data to identify potential non-self peptides with good binding properties in the MHC groove, which may result from antigen processing. One or more mutations that direct protein expression may be introduced into the biological circuit of the present invention to maintain its function while simultaneously making the identified epitope less immunogenic or abolishing it.

[0085] In some embodiments, protein modifications incorporated into the structure of the compositions of the present invention to interfere with antigen processing and peptide loading, such as glycosylation and PEGylation, may also be useful in the present invention. The compositions of the present invention may also be designed to contain non-classical amino acid side chains to design compositions with reduced immunogenicity. Any of the methods discussed in International Patent Publication No. WO2005051975 for reducing immunogenicity may be useful in the present invention (the contents of which are incorporated by reference in their entirety).

[0086] In one embodiment, patients may be stratified according to the immunogenic peptides presented by their immune cells, which may be used as a parameter to determine appropriate patient cohorts that may benefit therapeutically from the compositions of the invention.

[0087] In some embodiments, reduced immunogenicity can be achieved by limiting immunoproteasome processing. The proteasome is an important cellular protease found in two forms: the constitutive proteasome, which is expressed in all cell types and contains an active, e.g., catalytic, subunit, and the immunoproteasome, which is expressed in cells of the hematopoietic system and contains distinct active subunits called low molecular weight proteins (LMPs), namely LMP-2, LMP-7, and LMP-10. The immunoproteasome exhibits altered peptidase activity and cleavage site preferences, resulting in more efficient release of many MHC class I epitopes. A well-described function of the immunoproteasome is to generate peptides with hydrophobic C-termini that can be processed to fit into the groove of MHC class I molecules. Deol P et al. showed that the immunoproteasome leads to frequent cleavage of specific peptide bonds, thereby allowing specific peptides to appear more quickly on the surface of antigen-presenting cells and increasing peptide abundance (Deol P et al. (2007) J Immunol 178(12)7557-7562; the contents of which are incorporated herein by reference in their entirety). This study indicates that reduced immunoproteasome processing may be accompanied by reduced immunogenicity. In some embodiments, the immunogenicity of the compositions of the present invention may be reduced by modifying the sequences encoding the compositions of the present invention to prevent immunoproteasome processing. The biological circuit of the present invention may also be used in combination with immunoproteasome-selective inhibitors to achieve the same effect. Examples of inhibitors useful in the present invention include UK-101 (a Bli-selective compound), IPSI-001, ONX0914 (PR-957), and PR-924 (IPSI).

[0088] 1. Destabilization domain (DD) In some embodiments, the biological circuit systems, effector modules, and compositions of the present invention relate to post-translational modulation of protein (payload) function in anti-tumor immune responses of immunotherapeutics. In one embodiment, the SRE is a stabilizing / destabilizing domain (DD). The presence, absence, or amount of a small molecule ligand that binds to or interacts with the DD can modulate the stability of the payload(s) and, therefore, the function of the payload, due to such binding or interaction. Depending on the degree of binding and / or interaction, the altered function of the payload may vary, thus providing "tuning" of payload function.

[0089] In some embodiments, destabilization domains described herein or known in the art may be used as SREs in the biological circuit systems of the present invention in conjunction with any of the immunotherapeutic drugs (payloads) described herein. A destabilization domain (DD) is a small protein domain that can be added to a target protein of interest. The DD destabilizes the attached protein of interest in the absence of a DD-binding ligand, so that the protein is rapidly degraded by the cellular ubiquitin-proteasome system (reviewed in Stankunas, K., et al., Mol. Cell, 2003, 12:1615-1624; Banaszynski, et al., Cell; 2006, 126(5):995-1004; Banaszynski, L.A., and Wandless, T.J. Chem. Biol.; 2006, 13:11-21; and Rakhit R. et al., Chem. Biol. 2014, 21(9):1238-1252). However, upon binding of a specific small molecule ligand to the intended DD as a ligand-binding partner, the instability is reversed and protein function is restored. The conditional nature of DD stability allows for rapid, non-perturbative switching from a stable protein to a substrate unstable to degradation. Furthermore, its ligand concentration dependence further provides tunable control of the degradation rate.

[0090] In some embodiments, desirable properties of a DD may include, but are not limited to, low protein levels in the absence of the DD's ligand (i.e., low basal stability), a large dynamic range, robust and predictable dose-response behavior, and rapid degradation rates. A DD that binds to a desired ligand but not endogenous molecules may be preferred.

[0091] Several protein domains with destabilizing properties and their paired small molecules have been identified and used to control protein expression, including the FKBP / shield-1 system (Egeler et al., J. Biol. Chem. 2011, 286(36):32328-31336; the contents of which are incorporated herein by reference in their entirety), ecDHFR and its ligand trimethoprim (TMP); estrogen receptor domains that can be regulated by several estrogen receptor antagonists (Miyazaki et al., J. Am. Chem. Soc., 2012, 134(9):3942-3945; the contents of which are incorporated herein by reference in their entirety); and the fluorescence destabilizing domain (FDD) derived from the bilirubin-inducible fluorescent protein UnaG and its cognate ligand bilirubin (BR) (Navarro et al., ACS Chem Biol., 2016, June 6; the contents of which are incorporated herein by reference in their entirety).

[0092] Known DDs also include those described in US Pat. No. 8,173,792 and US Pat. No. 8,530,636, the contents of which are incorporated herein by reference in their entirety.

[0093] In some embodiments, the DD of the present invention can be derived from several known sequences recognized to be capable of post-translational protein regulation. For example, Xiong et al. showed that the non-catalytic N-terminal domain (54 residues) of Arabidopsis ACS7 (1-aminocyclopropane-1-carboxylic acid synthase) can significantly reduce the accumulation of GUS fusion proteins when fused to a β-glucuronidase (GUS) reporter (Xiong et al., J. Exp. Bot., 2014, 65(15):4397-4408). Xiong et al. further showed that both exogenous 1-aminocyclopropane-1-carboxylic acid (ACC) treatment and salt can rescue the N-terminus of ACS and the accumulation level of GUS fusion proteins. The N-terminus of ACS mediates the regulation of ACS7 stability via the ubiquitin-26S proteasome pathway.

[0094] Another non-limiting example is the stability control region (SCR, residues 97-118) of tropomyosin (Tm), which controls protein stability. The destabilizing mutation L110A and the stabilizing mutation A109L dramatically affect the dynamics of tropomyosin protein (Kirwan and Hodges, J. Biol. Chem., 2014, 289:4356-4366). Such sequences can be screened for ligands that bind to them and modulate their stability. Identified sequence and ligand pairs may be used as building blocks of the present invention.

[0095] In some embodiments, the DDs of the present invention may be developed from known proteins. Regions, portions, or domains of wild-type proteins may be utilized, in whole or in part, as SREs / DDs. These may be combined or rearranged to create novel peptides, proteins, regions, or domains, any of which may be used as SREs / DDs or as starting points for the design of additional SREs and / or DDs.

[0096] Ligands, such as small molecules known to bind to candidate proteins, can be tested for their modulation of protein responses. The small molecules may be clinically approved for safety and have suitable pharmacokinetics and distribution. In some embodiments, the stimulus is a ligand of a destabilization domain (DD), e.g., a small molecule that binds to a destabilization domain and stabilizes a POI fused to the destabilization domain. In some embodiments, the ligands, DDs, and SREs of the present invention include, but are not limited to, any of those set forth in Tables 2-4 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Patent Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO 2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety. Some examples of proteins that can be used to develop DDs and their ligands are listed in Table 1. [Table 1-1] [Table 1-2] [Table 1-3]

[0097] In some embodiments, a DD of the present invention can be an FKBP DD or an ecDHFR DD as listed in Table 2. The positions of the mutant amino acids listed in Table 2 are relative to ecDHFR (Uniprot ID: P0ABQ4) of SEQ ID NO: 1 for ecDHFR DD, and relative to FKBP (Uniprot ID: P62942) of SEQ ID NO: 3 for FKBP DD. [Table 2-1] [Table 2-2]

[0098] The present inventors have tested and identified several candidate human proteins that can be used to develop destabilization domains. As shown in Table 2, these candidates include human DHFR (hDHFR), PDE5 (phosphodiesterase 5), PPARγ (peroxisome proliferator-activated receptor γ), CA2 (carbohydrate anhydrase II), and NQO2 (NRH:quinone oxidoreductase 2). Destabilization domain sequences identified from the protein domains of these proteins (as templates) can be mutagenized to generate mutant libraries based on the template candidate domain sequences. Mutagenesis strategies used to generate DD libraries can include, for example, site-directed mutagenesis using structure-guided information; or random mutagenesis using, for example, error-prone PCR, or a combination of both. In some embodiments, destabilization domains identified using random mutagenesis can be used to identify structural features of candidate DDs that may be required for destabilization, which can then be used to generate further mutant libraries using site-directed mutagenesis.

[0099] In some embodiments, the novel DD derived from E. coli DHFR (ecDHFR) can include amino acids 2-159 of the wild-type ecDHFR sequence, which may be referred to as the M1del mutation.

[0100] In some embodiments, the novel DD derived from ecDHFR may include amino acids 2-159 of the wild-type ecDHFR sequence (also referred to as the M1del mutation) and may contain one, two, three, four, five or more mutations, including, but not limited to, M1del, R12Y, R12H, Y100I, and E129K.

[0101] In some embodiments, the novel DD from FKBP may have amino acids 2-107 of the wild-type FKBP sequence, which may be referred to as the M1del mutation.

[0102] In some embodiments, the novel DD derived from FKBP may have amino acids 2-107 of the wild-type FKBP sequence (also referred to as the M1del mutation) and may contain one, two, three, four, five or more mutations, including, but not limited to, M1del, E31G, F36V, R71G, K105E, and L106P.

[0103] In some embodiments, a DD mutant library can be screened for mutations that have altered, preferably higher, binding affinity for a ligand compared to the wild-type protein. The DD library can be screened using two or more ligands to preferentially select DD mutations that stabilize with some ligands but not others. DD mutations that bind preferentially to a ligand compared to the native protein can also be selected. Such methods can be used to optimize the ligand selectivity and ligand-binding affinity of the DD. Furthermore, such an approach can be used to minimize adverse effects caused by off-target ligand binding.

[0104] In some embodiments, suitable DDs may be identified by screening a mutant library using barcodes. Such methods may be used to detect, identify, and quantify individual mutant clones within a heterogeneous mutant library. Each DD mutant within a library may have a different barcode sequence (relative to each other). In other examples, polynucleotides may also have barcode sequences that differ by 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleobases. Each DD mutant within a library may have multiple barcode sequences. When multiple barcodes are used, each barcode may be unique relative to any other barcode. Alternatively, each barcode used may not be unique, but the combination of barcodes used may create unique sequences that can be individually tracked. The barcode sequence may be located upstream of the SRE, downstream of the SRE, or, in some instances, within the SRE. DD mutants may be identified by barcodes using sequencing approaches such as Sanger sequencing or next-generation sequencing, but may also be identified by polymerase chain reaction or quantitative polymerase chain reaction. In some embodiments, each barcode may be identified on an agarose gel using polymerase chain reaction primers that amplify a different size product for each barcode. In other examples, each barcode may have a unique quantitative polymerase chain reaction probe sequence that allows for targeted amplification of each barcode.

[0105] In some embodiments, the DD of the present invention can be derived from human dihydrofolate reductase (hDHFR). hDHFR is a small (18 kDa) enzyme that catalyzes the reduction of dihydrofolate and plays a key role in various anabolic pathways. Dihydrofolate reductase (DHFR) is an essential enzyme that converts 7,8-dihydrofolate (DHF) to 5,6,7,8-tetrahydrofolate (THF) in the presence of nicotinamide adenine dihydrogen phosphate (NADPH). Antifolate drugs, such as methotrexate (MTX), a structural analog of folic acid, bind more tightly to DHFR than to the natural substrate DHF, interfering with folate metabolism primarily through inhibition of dihydrofolate reductase and suppressing the synthesis of purine and pyrimidine precursors. Other inhibitors of hDHFR, such as folic acid, TQD, trimethoprim (TMP), epigallocatechin gallate (EGCG) and ECG (epicatechin gallate), can also bind to hDHFR mutants and modulate their stability.In one aspect of the present invention, the DD of the present invention comprises the single mutations hDHFR(Y122I), hDHFR(K81R), hDHFR(F59S), hDHFR(I17V), hDHFR(N65D), hDHFR(A107V), hDHFR(N127Y), hDHFR(K185E), hDHFR(N186D), and hDHFR(M140I); double mutations: hDHFR(M53T, R138I ), hDHFR(V75F, Y122I), hDHFR(A125F, Y122I), hDHFR(L74N, Y122I), hDHFR(L94A, T147A), hDHFR(G21T, Y122I), hDHFR(V121A, Y122I), hDHFR(Q36K, Y122I), hDHFR(C7R, Y163C), hDHFR(Y178H, E18IG), hDHFR( A10V, H88Y), hDHFR(T137R, F143L), hDHFR(E63G, I176F), hDHFR(T57A, I72A), hDHFR(H131R, E144G), and hDHFR(Y183H, K185E); and triple mutations: hDHFR(Q36F, N65F, Y122I), hDHFR(G21E, I72V, I176T), hDHFR(I8V, K185E). hDHFR variants may be included, including hDHFR(V9A, S93R, P150L), hDHFR(K19E, F89L, E181G), hDHFR(G54R, M140V, S168C), hDHFR(L23S, V121A, Y157C), hDHFR(V110A, V136M, K177R), and hDHFR(N49D, F59S, D153G).

[0106] In one embodiment, the stimulus is a small molecule that binds to the SRE and regulates post-translational protein levels. In one aspect, the DHFR ligands: trimethoprim (TMP) and methotrexate (MTX) are used to stabilize hDHFR variants. Destabilization domains based on hDHFR are listed in Table 3. The positions of the mutated amino acids listed in Table 3, for human DHFR, are relative to human DHFR of SEQ ID NO: 2 (Uniprot ID: P00374). In Table 3, "del" means that the mutation at that position compared to the wild-type sequence is a deletion of the amino acid. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5] [Table 3-6] [Table 3-7] [Table 3-8] [Table 3-9]

[0107] In some embodiments, DD mutations that do not inhibit ligand binding may be preferentially selected. In some embodiments, DHFR residues may be mutated to improve ligand binding. Amino acid positions selected for mutation include aspartic acid at position 22 of SEQ ID NO:2, glutamic acid at position 31 of SEQ ID NO:2; phenylalanine at position 32 of SEQ ID NO:2; arginine at position 33 of SEQ ID NO:2; glutamine at position 36 of SEQ ID NO:2; asparagine at position 65 of SEQ ID NO:2; and valine at position 115 of SEQ ID NO:2. In some embodiments, one or more mutations, including but not limited to the following, may be utilized in the DD of the present invention to improve TMP binding. The mutated amino acid positions are relative to the wild-type human DHFR of SEQ ID NO:2 (Uniprot ID: P00374).

[0108] In some embodiments, the novel DDs from human DHFR are M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K64R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I7 2T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G , S93G, S93R, L94A, D96G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P10 4S, E105G, A107T, A107V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K1 23R, K123E, A125F, M126I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132 P, K133E, L134P, F135P, F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M140V, Q141R, D142G, F143S, F143L, E144G, D146G, T14 7A, F148S, F148L, F149L, P150L, ​​E151G, I152V, D153A, D153G, E155G, K156R , Y157R, Y157C, K158E, K158R, L159P, L160P, E162G, Y163C, V166A, S168C, D 169G, V170A, Q171R, E172G, E173G, E173A, K174R, I176A, I176F, I176T, K17 7E, K177R, Y178C, Y178H, F180L, E181G, V182A, Y183C, Y183H, E184R, E184G,It may contain one, two, three, four, five or more mutations, including, but not limited to, K185R, K185del, K185E, N186S, N186D, D187G, and D187N.

[0109] In some embodiments, the novel DD derived from human DHFR may comprise amino acids 2-187 of the wild-type human DHFR sequence, which may be referred to as the M1del mutation.

[0110] In some embodiments, the novel DD derived from human DHFR may have amino acids 2-187 of the wild-type human DHFR sequence (also referred to as the M1del mutation), and may be any of the following: M1del, V2A, C7R, I8V, V9A, A10T, A10V, Q13R, N14S, G16S, I17N, I17V, K19E, N20D, G21T, G21E, D22S, L23S, P24S, L28P, N30D, N30H, N30S, E31G, E31D, F32M, R33G, R33S, F35L, Q36R, Q36S, Q36K, Q36F, R37G, M38V, M38T, T40A, V44A, K47R, N49S, N49D, M53T, G54R, K56E, K56R, T57A, F59S, I61T, K6 4R, N65A, N65S, N65D, N65F, L68S, K69E, K69R, R71G, I72T, I72A, I72V, N73G, L74N, V75F, R78G, L80P, K81R, E82G, H88Y, F89L, R92G, S93G, S93R, L94A, D9 6G, A97T, L98S, K99G, K99R, L100P, E102G, Q103R, P104S, E105G, A107T, A107 V, N108D, K109E, K109R, V110A, D111N, M112T, M112V, V113A, W114R, I115V, I115L, V116I, G117D, V121A, Y122C, Y122D, Y122I, K123R, K123E, A125F, M12 6I, N127R, N127S, N127Y, H128R, H128Y, H131R, L132P, K133E, L134P, F135P , F135L, F135S, F135V, V136M, T137R, R138G, R138I, I139T, I139V, M140I, M1 40V, Q141R, D142G, F143S, F143L, E144G, D146G, T147A, F148S, F148L, F149 L, P150L, ​​E151G, I152V, D153A, D153G, E155G, K156R, Y157R, Y157C, K158E, K 158R, L159P, L160P, E162G, Y163C, V166A, S168C, D169G, V170A, Q171R, E17 2G, E173G, E173A, K174R, I176A, I176F, I176T, K177E, K177R, Y178C, Y178H,The mutations may include one, two, three, four, five or more mutations, including, but not limited to, F180L, E181G, V182A, Y183C, Y183H, E184R, E184G, K185R, K185del, K185E, N186S, N186D, D187G, and D187N.

[0111] 2. Payload: Immunotherapy drug In some embodiments, the payload of the present invention may be an immunotherapeutic agent that induces an immune response in an organism. The immunotherapeutic agent may be, but is not limited to, an antibody and its fragments and variants, a chimeric antigen receptor (CAR), a chimeric switch receptor, a cytokine, a chemokine, a cytokine receptor, a chemokine receptor, a cytokine-cytokine receptor fusion polypeptide, or any agent that induces an immune response. In one embodiment, the immunotherapeutic agent induces an anti-cancer immune response in a cell or a subject.

[0112] antibody In some embodiments, antibodies, fragments and variants thereof are payloads of the present invention.

[0113] In some embodiments, antibodies of the present invention include, but are not limited to, any of those set forth in Table 5 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Patent Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0114] Antibody Fragments and Variants In some embodiments, antibody fragments and variants may comprise antigen-binding regions derived from intact antibodies. Examples of antibody fragments and variants include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules such as single-chain variable fragments (scFv); and multispecific antibodies formed from antibody fragments. Papain digestion of antibodies produces two identical antigen-binding fragments called "Fab" fragments, each with a single antigen-binding site. A residual "Fc" fragment is also produced, the name of which reflects its ability to readily crystallize. Pepsin treatment produces an F(ab')2 fragment with two antigen-binding sites that is still capable of cross-linking antigen. The pharmaceutical compositions, biological circuits, biological circuit components, SREs, or effector modules containing payloads of the present invention may comprise one or more of these fragments.

[0115] For purposes of this specification, an "antibody" may include heavy and light chain variable domains as well as an Fc region. As used herein, the term "native antibody" typically refers to a heterotetrameric glycoprotein of approximately 150,000 daltons, consisting of two identical light (L) chains and two identical heavy (H) chains. The genes encoding antibody heavy and light chains are known, and the constituent segments of each have been well characterized and described (Matsuda et al., The Journal of Experimental Medicine. 1998, 188(11):2151-62 and Li et al., Blood, 2004, 103(12):4602-4609; the contents of each are incorporated herein by reference in their entirety). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also has regularly spaced intrachain disulfide bridges. Each heavy chain has at one end a variable domain (VH) followed by several constant domains. Each light chain has at one end a variable domain (VL) and at its other end a constant domain. The constant domain of the light chain aligns with the first constant domain of the heavy chain, and the variable domain of the light chain aligns with the variable domain of the heavy chain.

[0116] As used herein, the term "variable domain" refers to specific antibody domains found in both antibody heavy and light chains that vary significantly in sequence between antibodies and are responsible for the binding and specificity of each particular antibody for a particular antigen. Variable domains include hypervariable regions. As used herein, the term "hypervariable region" refers to the region within a variable domain that contains amino acid residues involved in antigen binding. The amino acids present within the hypervariable region determine the structure of the complementarity-determining region (CDR), which becomes part of the antigen-binding site of the antibody. As used herein, the term "CDR" refers to the region of an antibody that contains the structure complementary to the target antigen or epitope. The other part of the variable domain that does not interact with the antigen is called the framework (FW) region. The antigen-binding site (also known as the antigen-binding site or paratope) contains the amino acid residues necessary to interact with a specific antigen. The exact residues that comprise the antigen-binding site are usually elucidated by co-crystallography with bound antigen, although computational assessment based on comparison with other antibodies can also be used (Strohl, WR Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p47-54, the contents of which are incorporated herein by reference in their entirety). The residues that constitute the CDRs have been determined according to the methods of Kabat (Wu et al., JEM, 1970, 132(2):211-250 and Johnson et al., Nucleic Acids Res. 2000, 28(1):214-218, the contents of each of which are incorporated herein by reference in their entirety), Chothia (Chothia and Lesk, J. Mol. Biol. 1987, 196, 901, Chothia et al., Nature, 1989, 342, 877, and Al-Lazikani et al., J. Mol. Biol. 1997, 273(4):927-948, the contents of each of which are incorporated herein by reference in their entirety), Lefranc (Lefranc et al., Immunome Res. 2005, 1:3), and Honegger (Honegger and Pluckthun, J. Mol. Biol. 2001, 309(3):657-70, the contents of which are incorporated herein by reference in their entirety.

[0117] Each VH and VL domain has three CDRs. Herein, the VL CDRs are referred to as CDR-L1, CDR-L2, and CDR-L3, in order of appearance when moving from N-terminus to C-terminus along the variable domain polypeptide. Herein, the VH CDRs are referred to as CDR-H1, CDR-H2, and CDR-H3, in order of appearance when moving from N-terminus to C-terminus along the variable domain polypeptide. Each of the CDRs prefers a canonical structure, except for CDR-H3, which has an amino acid sequence that is highly variable in sequence and length between antibodies and can confer different three-dimensional structures to the antigen-binding domain (Nikoloudis, et al., Peer J. 2014, 2:e456). In some cases, CDR-H3 may be analyzed across a panel of related antibodies to assess antibody diversity. Various methods of determining CDR sequences are known in the art and may be applied to known antibody sequences (Strohl, WR Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia PA. 2012. Ch. 3, p47-54, the contents of which are incorporated herein by reference in their entirety).

[0118] As used herein, the term "Fv" refers to an antibody fragment that contains the minimum fragment of an antibody required to form a complete antigen-binding site. This region consists of a dimer of one heavy chain and one light chain variable domain tightly bound by non-covalent bonds. Fv fragments can be generated by proteolysis, but most are unstable. Recombinant methods for generating stable Fv fragments are known in the art, usually by inserting a flexible linker between the light and heavy chain variable domains (to form single-chain Fvs (scFvs)) or by introducing disulfide bridges between the heavy and light chain variable domains (Strohl, W. R. Therapeutic Antibody Engineering. Woodhead Publishing, Philadelphia, PA. 2012. Ch. 3, p. 46-47, the contents of which are incorporated herein by reference in their entirety).

[0119] As used herein, the term "light chain" refers to a component of an antibody from any vertebrate species that is assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequence of its constant domain. Depending on the amino acid sequence of the constant domain of its heavy chain, antibodies can be assigned to different classes. There are five major classes of intact antibodies: IgA, IgD, IgE, IgG, and IgM, some of which can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA, and IgA2.

[0120] As used herein, the term "single-chain Fv" or "scFv" refers to a fusion protein of VH and VL antibody domains, which are linked into a single polypeptide chain by a flexible peptide linker. In some embodiments, the Fv polypeptide linker allows the scFv to form the desired structure for antigen binding. In some embodiments, scFvs are utilized in conjunction with phage, yeast, or other display methods, where the scFv is expressed in association with a surface member (e.g., a phage coat protein) and can be used to identify high-affinity peptides against a predetermined antigen.

[0121] Using molecular genetics, two scFvs can be engineered in tandem into a single polypeptide separated by a linker domain, termed a "tandem scFv" (tascFv). Constructing a tascFv containing the genes for two different scFvs generates a "bispecific single-chain variable fragment" (bis-scFv). Only two tascFvs are in clinical development by commercial companies; both are bispecific agents in active early-stage development by Micromet for oncology indications and are described as "bispecific T-cell engagers (BiTEs)." Blinatumomab is an anti-CD19 / anti-CD3 bispecific tascFv in Phase 2 that enhances T-cell responses against B-cell non-Hodgkin's lymphoma. MT110 is an anti-EP-CAM / anti-CD3 bispecific tascFv in Phase 1 that enhances T-cell responses against solid tumors. Bispecific, tetravalent "TandAbs" have also been investigated by Affimed (Nelson, AL, MAbs., 2010, Jan-Feb;2(1):77-83). Maxibodies (bivalent scFvs fused to the amino terminus of the Fc (CH2-CH3 domains) of IgG) may also be included.

[0122] As used herein, the term "bispecific antibody" refers to an antibody that can bind to two different antigens. Such antibodies usually contain regions from at least two different antibodies. Bispecific antibodies are described in Riethmuller, G. Cancer Immunity. 2012, 12:12-18, Marvin et al., 2005. Acta Pharmacologica Sinica. 2005, 26(6):649-658, and Schaefer et al., PNAS. 2011, 108(27):11187-11192, the contents of each of which are incorporated herein by reference in their entirety.

[0123] As used herein, the term "diabody" refers to a small antibody fragment having two antigen-binding sites. Diabodies are functional bispecific single-chain antibodies (bscAbs). Diabodies contain a heavy chain variable domain, VH, connected to a light chain variable domain, VL, in the same polypeptide chain. By using a linker that is too short to allow pairing of the two domains on the same chain, the domains are forced to pair with complementary domains on another chain, generating two antigen-binding sites. Diabodies have been described, for example, in EP 404,097; WO 93 / 11161; and Hollinger et al. (Hollinger, P. et al. al., "Diabodies": Small bivalent and bispecific antibody fragments. PNAS, 1993. 90:6444-6448), the contents of each of which are incorporated herein by reference in their entirety.

[0124] The term "intrabody" refers to a form of antibody that is not secreted from the cell in which it is produced, but instead targets one or more intracellular proteins. Intrabodies may be used to affect numerous cellular processes, including, but not limited to, intracellular trafficking, transcription, translation, metabolic processes, growth signaling, and cell division. In some embodiments, the methods of the invention may involve intrabody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein may be incorporated into one or more constructs for intrabody-based therapy.

[0125] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a population of substantially homogeneous cells (or clones), i.e., apart from possible variants that arise during monoclonal antibody production (such variants are generally present in small amounts), the individual antibodies within the population are identical and / or bind to the same epitope. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen.

[0126] The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. Monoclonal antibodies herein include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and / or light chains are identical to or homologous to corresponding sequences in antibodies from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) are identical to or homologous to corresponding sequences in antibodies from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies.

[0127] As used herein, the term "humanized antibody" refers to a chimeric antibody containing minimal portions derived from one or more non-human (e.g., murine) antibody source(s) and residual portions derived from one or more human immunoglobulin sources. In most cases, a humanized antibody is a human immunoglobulin (recipient antibody) in which hypervariable region residues from the recipient antibody are replaced with hypervariable region residues from a non-human species antibody (donor antibody), such as mouse, rat, rabbit, or non-human primate, possessing the desired specificity, affinity, and / or performance. In one embodiment, the antibody may be a humanized full-length antibody. As a non-limiting example, antibodies may be humanized using the methods set forth in U.S. Patent Publication No. US20130303399, the contents of which are incorporated herein by reference in their entirety.

[0128] As used herein, the term "antibody variant" refers to an engineered antibody (relative to a natural or starting antibody) or a biomolecule (e.g., an antibody mimetic) that resembles a natural or starting antibody in structure and / or function. Antibody variants may have altered amino acid sequence, composition, or structure compared to a natural antibody. Antibody variants include, but are not limited to, antibodies with altered isotypes (e.g., IgA, IgD, IgE, IgG1, IgG2, IgG3, IgG4, or IgM), humanized variants, optimized variants, multispecific antibody variants (e.g., bispecific variants), and antibody fragments.

[0129] In some embodiments, the pharmaceutical compositions, biological circuits, biological circuit components, SREs, or effector modules containing payloads of the present invention may be antibody mimics. As used herein, the term "antibody mimic" refers to any molecule that mimics the function or effect of an antibody and binds specifically and with high affinity to its molecular target. In some embodiments, the antibody mimic may be a monobody designed to incorporate a fibronectin type III domain (Fn3) as a protein scaffold (US Pat. No. 6,673,901; US ​​Pat. No. 6,348,584). In some embodiments, the antibody mimic may be any antibody mimic known in the art, including, but not limited to, affibody molecules, affilins, affitins, anticalins, avimers, centyrins, DARPINST™, Fynomers, and Kunitz domain peptides. In other embodiments, the antibody mimic may include one or more non-peptide regions.

[0130] In one embodiment, the antibody may comprise a modified Fc region. By way of non-limiting example, the modified Fc region may be produced by the methods described in U.S. Patent Publication No. US20150065690, or may be any region described therein, the contents of which are incorporated by reference in their entirety.

[0131] In some embodiments, the payload of the invention may encode a multispecific antibody that binds to two or more epitopes. As used herein, the term "multibody" or "multispecific antibody" refers to an antibody in which two or more variable regions bind to different epitopes. The epitopes may be on the same or different targets. In one embodiment, multispecific antibodies may be generated and optimized by the methods described in International Patent Publication No. WO2011109726 and U.S. Patent Publication No. US20150252119, the contents of which are incorporated herein by reference in their entireties. These antibodies are capable of binding to multiple antigens with high specificity and high affinity.

[0132] In certain embodiments, a multispecific antibody is a "bispecific antibody" that recognizes two different epitopes on the same or different antigens. In one aspect, a bispecific antibody can bind to two different antigens. Such antibodies typically contain antigen-binding regions from at least two different antibodies. For example, a bispecific monoclonal antibody (BsMAb, BsAb) is an artificial protein composed of fragments of two different monoclonal antibodies, so that a BsAb can bind to two different types of antigens. Bispecific antibody frameworks may include any of those described in Riethmuller, G., 2012. Cancer Immunity, 2012, 12:12-18; Marvin et al., Acta Pharmacologica Sinica. 2005, 26(6):649-658; and Schaefer et al., PNAS. 2011, 108(27):11187-11192, the contents of each of which are incorporated herein by reference in their entirety. A new generation of BsMAbs, called "trifunctional bispecific" antibodies, has been developed. They consist of two heavy and two light chains, each derived from two different antibodies, with two Fab regions (arms) directed against two antigens and an Fc region (legs) containing two heavy chains and forming a third binding site.

[0133] In some embodiments, the payload may encode an antibody containing a single antigen-binding domain. These molecules are very small, approximately one-tenth the molecular weight observed in full-sized mAbs. Additional antibodies may include "nanobodies," which are derived from the antigen-binding variable heavy chain regions (VHHs) of heavy-chain antibodies lacking light chains found in camels and llamas (Nelson, AL, MAbs. 2010. Jan-Feb;2(1):77-83).

[0134] In some embodiments, antibodies may be "miniaturized." The best example of mAb miniaturization is Trubion Pharmaceuticals' small modular immunopharmaceuticals (SMIPs). These molecules, which can be monovalent or bivalent, are recombinant single-chain molecules containing one VL, one VH antigen-binding domain, and one or two constant "effector" domains, all connected by a linker domain. Potentially, such molecules could offer the advantage of increased tissue or tumor penetration acquired by the fragments while retaining the immune effector function conferred by the constant domains. At least three "miniaturized" SMIPs have entered clinical development. TRU-015, an anti-CD20 SMIP developed in collaboration with Wyeth, is the most advanced project, progressing to Phase 2 for rheumatoid arthritis (RA). Previous attempts for systemic lupus erythematosus (SLE) and B-cell lymphoma were ultimately discontinued. Trubion and Facet Biotechnology are collaborating to develop TRU-016, an anti-CD37 SMIP, for the treatment of CLL and other lymphoid malignancies, a project that has reached Phase 2. Wyeth has licensed SBI-087, an anti-CD20 SMIP, for the treatment of autoimmune diseases such as RA, SLE, and possibly multiple sclerosis, but these projects remain in early clinical trials (Nelson, AL, MAbs, 2010. Jan-Feb;2(1):77-83).

[0135] One example of a miniaturized antibody, called a "unibody," is an IgG4 molecule with the hinge region removed. While IgG4 molecules are unstable and capable of interchanging light-heavy chain heterodimers, the deletion of the hinge region completely prevents heavy-chain pairing, maintaining a highly specific monovalent light / heavy chain heterodimer while retaining the Fc region to ensure in vivo stability and half-life. This configuration may minimize the risk of immune activation or oncogenic proliferation due to insufficient IgG4-FcR interaction and the inability of monovalent unibodies to promote the formation of intracellular signaling complexes (see, e.g., Nelson, AL, MAbs, 2010. Jan-Feb;2(1):77-83).

[0136] In some embodiments, the payload of the present invention may encode a single-domain antibody (sdAb, or nanobody), an antibody fragment consisting of a single monomeric variable antibody domain. Like whole antibodies, it can selectively bind to a specific antigen. In one aspect, the sdAb may be a "camelid Ig" or "camelid VHH." As used herein, the term "camelid Ig" refers to the smallest known antigen-binding unit of a heavy-chain antibody (Koch-Nolté, et al., FASEB J., 2007, 21:3490-3498). A "heavy-chain antibody" or "camelid antibody" refers to an antibody that contains two VH domains and no light chains (Riechmann L. et al., J. Immunol. Methods, 1999, 231:25-38; International Patent Publication Nos. WO1994 / 04678 and WO1994 / 025591; and U.S. Patent No. 6,005,079). In another embodiment, the sdAb may be an "immunoglobulin novel antigen receptor" (Ig NAR). As used herein, the term "immunoglobulin novel antigen receptor" refers to a class of antibodies derived from the shark immune repertoire consisting of a homodimer of one variable novel antigen receptor (VNAR) domain and five constant novel antigen receptor (CNAR) domains. Ig NARs represent some of the smallest known immunoglobulin-based protein scaffolds and possess highly stable and efficient binding properties. Their inherent stability is due to both (i) the underlying Ig scaffold, which displays a significant number of charged and hydrophilic surface-exposed residues compared to traditional antibody VH and VL domains found in murine antibodies; and (ii) stabilizing structural features of the complementarity-determining region (CDR) loops, including inter-loop disulfide bridges and intra-loop hydrogen-bonding patterns.

[0137] In some embodiments, the payload of the invention may encode an intracellular antibody. Intracellular antibodies are a type of antibody that are not secreted from the cell that produces the antibody but rather target one or more intracellular proteins. Intracellular antibodies are expressed and function within the cell and may be used to affect numerous cellular processes, including, but not limited to, intracellular trafficking, transcription, translation, metabolic processes, growth signaling, and cell division. In some embodiments, the methods described herein include intracellular antibody-based therapy. In some such embodiments, the variable domain sequences and / or CDR sequences disclosed herein are incorporated into one or more constructs for intracellular antibody-based therapy. For example, an intracellular antibody may target one or more glycosylated intracellular proteins or modulate the interaction between one or more glycosylated intracellular proteins and alternative proteins.

[0138] Intracellular expression of intracellular antibodies in different compartments of mammalian cells allows them to block or modulate the function of endogenous molecules (Biocca, et al., EMBO J. 1990, 9:101-108; Colby et al., Proc. Natl. Acad. Sci. USA 2004, 101:17616-17621). Intracellular antibodies can alter protein folding, protein-protein interactions, protein-DNA interactions, protein-RNA interactions, and protein modifications. Intracellular antibodies can induce phenotypic knockouts and function as neutralizing agents by directly binding to target antigens, bypassing intracellular transport, or inhibiting binding with binding partners. Due to their high specificity and affinity for target antigens, intracellular antibodies have the advantage of blocking specific binding interactions of specific target molecules while sparing other molecules.

[0139] Intrabodies may be developed using sequences derived from donor antibodies. Intrabodies are often recombinantly expressed as single domain fragments, such as isolated VH and VL domains, or as intracellular single-chain variable fragment (scFv) antibodies. For example, intrabodies are often expressed as a single polypeptide to form a single-chain antibody comprising the variable domains of the heavy and light chains connected by a flexible linker polypeptide. Intrabodies typically lack disulfide bonds and can regulate target gene expression or activity through their specific binding activity. Single-chain intrabodies are often expressed from recombinant nucleic acid molecules and engineered to be retained intracellularly (e.g., in the cytoplasm, endoplasmic reticulum, or periplasm). Intracellular antibodies are: (Marasco et al.,PNAS,1993,90:7889-7893;Chen et al.,Hum.Gene Ther.1994,5:595-601;Chen et al.,1994,PNAS,91:5932-5936;Maciejewski et al.,1995,Nature Med.,1:667-673;Marasco,1995,Immunotech,1:1-19;Mhashilkar,et al.,1995,EMBO J.14:1542-51;Chen et al.,1996,Hum.Gene Therap.,7:1515-1525;Marasco,Gene Ther.4:11-15,1997;Rondon and Marasco,1997,Annu.Rev.Microbiol.51:257-283;Cohen,et al.,1998,Oncogene 17:2445-56;Proba et al.,1998,J.Mol.Biol.275:245-253;Cohen et al.,1998,Oncogene 17:2445-2456;Hassanzadeh,et al.,1998,FEBS Lett.437:81-6;Richardson et al.,1998,Gene Ther.5:635-44;Ohage and Steipe,1999,J.Mol.Biol.291:1119-1128;Ohage et al. al.,1999,J.Mol.Biol.291:1129-1134;Wirtz and Steipe,1999,Protein Sci.8:2245-2250;Zhu et al.,1999,J.Immunol.Methods 231:207-222;Arafat et al.,2000,Cancer Gene Ther.7:1250-6;der Maur et al., 2002, J. Biol. Chem. 277:45075-85; Mhashilkar et al., 2002, Gene Ther. 9:307-19; and Wheeler et al., 2003, FASEB J. 17:1733-5; and references cited therein).

[0140] In some embodiments, the payloads of the invention may encode biosynthetic antibodies, as described in U.S. Patent No. 5,091,513, the contents of which are incorporated herein by reference in their entirety. Such antibodies may contain one or more sequences of amino acids that constitute a region that acts as a biosynthetic antibody binding site (BABS). This site may include: 1) noncovalently or disulfide-linked synthetic VH and VL dimers; 2) VH-VL or VL-VH single chains in which the VH and VL are linked by a polypeptide linker; or 3) individual VH or VL domains. The binding domain comprises linked CDR and FR regions that may be derived from separate immunoglobulins. Biosynthetic antibodies may also contain other polypeptide sequences that function, for example, as enzymes, toxins, binding sites, or attachment sites for immobilization media or radioactive atoms. Methods for producing biosynthetic antibodies, designing BABS with any specificity that can be elicited by in vivo antibody generation, and producing analogs thereof are disclosed.

[0141] In some embodiments, the payload may encode an antibody with an antibody acceptor framework as shown in U.S. Patent No. 8,399,625, which may be particularly suitable for accepting CDRs from an antibody of interest.

[0142] In one embodiment, the antibody may be a conditionally active biological protein. The antibody may be used to generate a conditionally active biological protein that is reversibly or irreversibly inactivated under normal wild-type physiological conditions, and provides methods and uses for such conditionally active biological proteins. Such methods and conditionally active proteins are described, for example, in International Publication Nos. WO2015175375 and WO2016036916 and U.S. Patent Publication No. US20140378660, the contents of each of which are incorporated herein by reference in their entirety.

[0143] Antibody preparation The preparation of antibodies, whether monoclonal or polyclonal, is known in the art. Antibody production techniques are well known in the art and are described, for example, in Harlow and Lane "Antibodies, A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1988; Harlow and Lane "Using Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1999; and "Therapeutic Antibodies: A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1999. Engineering:Current and Future Advances Driving the Strongest Growth Area in the Pharmaceutical Industry,” Woodhead Publishing, 2012.

[0144] The antibodies and fragments and variants thereof described herein can be produced using recombinant polynucleotides. In one embodiment, the polynucleotide has a modular design encoding at least one antibody, fragment, or variant thereof. As non-limiting examples, a polynucleotide construct may encode any of the following designs: (1) an antibody heavy chain, (2) an antibody light chain, (3) an antibody heavy and light chain, (4) a heavy and light chain separated by a linker, (5) a VH1, CH1, CH2, CH3 domain, a linker, and a light chain, or (6) a VH1, CH1, CH2, CH3 domain, a VL region, and a light chain. Any of these designs may include optional linkers between any of the domains and / or regions. Polynucleotides of the invention may be designed to produce standard classes of immunoglobulins using any of the antibodies or component parts thereof described herein as starting molecules.

[0145] Recombinant antibody fragments may also be isolated from phage antibody libraries using techniques well known in the art and described, for example, in Clackson et al., 1991, Nature 352:624-628; Marks et al., 1991, J. Mol. Biol. 222:581-597. Recombinant antibody fragments may also be derived from large phage antibody libraries produced by recombination in bacteria (Sblattero and Bradbury, 2000, Nature Biotechnology 18:75-80; the contents of which are incorporated herein by reference in their entirety).

[0146] Antibodies used in immunotherapy In some embodiments, the payload of the present invention may be an antibody, fragment, or variant thereof specific for a tumor-specific antigen (TSA) or tumor-associated antigen (TAA). The antibody circulates in the body until it finds and binds to the TSA / TAA. Once bound, the antibody recruits other parts of the immune system and enhances ADCC (antibody-dependent cellular cytotoxicity) and ADCP (antibody-dependent cellular phagocytosis) to destroy tumor cells. As used herein, the term "tumor-specific antigen (TSA)" refers to an antigenic substance produced by tumor cells that can induce an anti-tumor immune response in the host organism. In one embodiment, the TSA may be a tumor neoantigen. Tumor antigen-specific antibodies mediate complement-dependent cytotoxicity against tumor cells expressing the same antigen.

[0147] In some embodiments, the tumor-specific antigen (TSA), tumor-associated antigen (TAA), pathogen-associated antigen, or fragment thereof can be expressed as a peptide or intact protein or a portion thereof. The intact protein or a portion thereof can be natural or mutagenized. Antigens associated with cancer or virus-induced cancer described herein are known in the art. Such TSA or TAA may already be associated with cancer or may be identified by any method known in the art.

[0148] In one embodiment, the antigen is CD19, a B cell surface protein expressed throughout B cell development. CD19 is a well-known B cell surface molecule that, upon activation of the B cell receptor, promotes B cell antigen receptor-induced signaling and proliferation of the B cell population. CD19 is widely expressed on both normal and neoplastic B cells. B cell-derived malignancies, such as chronic lymphocytic leukemia, acute lymphocytic leukemia, and many non-Hodgkin's lymphomas, often retain CD19 expression. This near-ubiquitous expression and single-cell lineage specificity make CD19 an attractive target for immunotherapy. Human CD19 contains 14 exons, with exons 1-4 encoding the extracellular portion of CD19, exon 5 encoding the transmembrane portion of CD19, and exons 6-14 encoding the cytoplasmic tail.

[0149] In one embodiment, the payload of the present invention may be an antibody, fragment or variant thereof specific for the CD19 antigen.

[0150] In one embodiment, the payload of the present invention may be an antibody fragment of the FMC63 antibody or variant. FMC63 is an IgG2a mouse monoclonal antibody clone specific for the CD19 antigen that reacts with the CD19 antigen on cells of the B cell lineage. The CD19 epitope recognized by the FMC63 antibody is present in exon 2 (Sotillo et al. (2015) Cancer Discov;5(12):1282-95; the contents of which are incorporated by reference in their entirety). In some embodiments, the payload of the present invention may be other CD19 monoclonal antibody clones, including, but not limited to, 4G7, SJ25C1, CVID3 / 429, CVID3 / 155, HIB19, and J3-119.

[0151] In some embodiments, the payload of the invention may comprise a variable heavy chain and a variable light chain having an amino acid sequence selected from the sequences in Table 4. [Table 4-1] [Table 4-2]

[0152] The tumor-specific antigen (TSA) may be a tumor neoantigen. Neoantigens are mutant antigens expressed only in tumor cells due to genetic mutations or transcriptional changes that alter the protein's coding sequence, thus creating a novel foreign antigen. Genetic changes can result from gene substitutions, insertions, deletions, or any other genetic alterations of the native cognate protein (i.e., a molecule expressed in normal cells). For CD19, neoantigens such as CD19 transcriptional variants lacking exon 2, exons 5-6, or both have been described (see International Patent Publication No. WO2016061368, the contents of which are incorporated herein by reference in their entirety). Because the FMC63-binding epitope is located in exon 2, CD19 neoantigens lacking exon 2 are not recognized by the FMC63 antibody. Thus, in some embodiments, the payload of the present invention may comprise an antibody distinct from FMC63, or a fragment thereof. As used herein, "distinct from FMC63" refers to an antibody or fragment thereof that is immunologically specific and binds to an epitope of the CD19 antigen that is different from or dissimilar to the epitope of the CD19 antigen bound by FMC63. In some examples, antibodies of the invention can include CD19 antibodies, antibody fragments, or variants that recognize CD19 neoantigens, including CD19 neoantigens lacking exon 2. In one embodiment, the antibody or fragment thereof is immunologically specific for CD19 encoded by exons 1, 3, and / or 4. In one example, the antibody or fragment thereof is specific for an epitope spanning the portion of CD19 encoded by exon 1 and the portion of CD19 encoded by exon 3.

[0153] Chimeric antigen receptor (CAR)

[0154] In some embodiments, the payload of the invention may be a chimeric antigen receptor (CAR), which, when transduced into immune cells (e.g., T cells and NK cells), can redirect the immune cells against targets (e.g., tumor cells) that express a molecule recognized by the extracellular targeting portion of the CAR.

[0155] As used herein, the term "chimeric antigen receptor (CAR)" refers to a synthetic receptor that mimics the TCR on the surface of a T cell. Generally, a CAR consists of an extracellular targeting domain, a transmembrane domain / region, and an intracellular signaling / activation domain. In a standard CAR receptor, the components: the extracellular targeting domain, the transmembrane domain, and the intracellular signaling / activation domain are linearly assembled into a single fusion protein. The extracellular domain contains a targeting domain / moiety (e.g., scFv) that recognizes a specific tumor antigen or other tumor cell surface molecule. The intracellular domain may contain the signaling domain of the TCR complex (e.g., the signaling region of CD3ζ) and / or one or more costimulatory signaling domains, such as those derived from CD28, 4-1BB (CD137), and OX-40 (CD134). For example, "first-generation CARs" have only the CD3ζ signaling domain. To enhance T cell persistence and proliferation, costimulatory intracellular domains have been added, resulting in second-generation CARs, which have one costimulatory signaling domain in addition to the CD3ζ signaling domain, and third-generation CARs, which have two or more costimulatory signaling domains in addition to the CD3ζ signaling domain. When expressed in T cells, CARs confer antigen specificity to T cells, determined by the extracellular targeting portion of the CAR. Recently, there has been a desire to develop a more suitable and safer CAR architecture, known as fourth-generation CARs, by adding one or more elements, such as a homing gene or suicide gene.

[0156] In some embodiments, the extracellular targeting domain is linked to the intracellular signaling domain via a hinge (also called a cleft domain or spacer) and a transmembrane region. The hinge connects the extracellular targeting domain to the transmembrane domain, which traverses the cell membrane and connects to the intracellular signaling domain. Depending on the size of the target protein to which the targeting moiety binds, and the size and affinity of the targeting domain itself, the hinge may need to be altered to optimize the efficacy of the CAR-transformed cell against cancer cells. Upon recognition and binding of the targeting moiety to the target cell, the intracellular signaling domain directs an activation signal to the CAR T cell, which is further amplified by a "second signal" from one or more intracellular costimulatory domains. Once activated, the CAR T cell can destroy the target cell.

[0157] In some embodiments, the CARs of the invention may be divided into two parts, each linked to a dimerization domain, such that a dimerization trigger promotes assembly of an intact, functional receptor. Wu and Lim recently separated the extracellular CD19-binding domain and the intracellular signaling elements, and isolated the FKBP domain and FRB domain. * reported a split CAR in which the FKBP-rapamycin binding domain (T2089L mutant) was linked to the rapamycin-binding domain, which heterodimerized in the presence of the rapamycin analog AP21967. The split receptor assembled in the presence of AP21967 and activated T cells upon specific antigen binding (Wu et al., Science, 2015, 625(6258):aab4077).

[0158] In some embodiments, the CAR of the present invention may be designed as an inducible CAR. Sakemura et al. recently reported the incorporation of a Tet-On inducible system into a CD19 CAR construct. The CD19 CAR is activated only in the presence of doxycycline (Dox). Sakemura reported that Tet-CD19CAR T cells in the presence of Dox exhibited a significantly reduced CD19 activation compared to conventional CD19CAR T cells. +reported that the Tet-CARs are equally cytotoxic to cell lines and have equivalent cytokine production and proliferation upon CD19 stimulation (Sakemura et al., Cancer Immuno. Res., 2016, June 21, online edition). In one example, this Tet-CAR may be a payload for an effector module under the control of an SRE (e.g., DD) of the present invention. The dual system provides greater flexibility in turning on / off CAR expression in transduced T cells.

[0159] According to the present invention, the payload of the present invention may be a first-generation CAR, a second-generation CAR, a third-generation CAR, or a fourth-generation CAR. Representative effector module embodiments comprising a CAR construct are shown in Figures 13-18. In some embodiments, the payload of the present invention may be a complete CAR construct consisting of an extracellular domain, a hinge and transmembrane domain, and an intracellular signaling region. In other embodiments, the payload of the present invention may be a component of a complete CAR construct, including an extracellular targeting moiety, a hinge region, a transmembrane domain, an intracellular signaling domain, one or more costimulatory domains, and other additional elements that improve CAR architecture and function, including, but not limited to, a leader sequence, a homing element, and a safety switch, or a combination of such components.

[0160] CARs regulated by the biological circuits and compositions of the present invention are tunable, thereby offering several advantages. A reversible on / off switch mechanism allows for the management of acute toxicity caused by excessive proliferation of CAR-T cells. Pulsed CAR expression using the SREs of the present invention can be achieved by cycling ligand levels. Ligand-mediated CAR regulation may be effective in counteracting tumor escape induced by antigen loss, avoiding functional attrition caused by persistent signaling due to chronic antigen exposure, and improving the in vivo persistence of CAR-expressing cells.

[0161] In some embodiments, the biological circuits and compositions of the present invention may be used to downregulate CAR expression to limit on-target, on-tissue toxicity caused by tumor lysis syndrome. Downregulation of CAR expression of the present invention following an antitumor effect may prevent (1) on-target, off-tumor toxicity caused by antigen expression in normal tissues and (2) antigen-independent activation in vivo.

[0162] In one embodiment, selection of a CAR with a lower affinity may provide more T cell signaling and less toxicity.

[0163] Extracellular targeting domains / moieties According to the present invention, the extracellular targeting moiety of the CAR may be any agent that recognizes and binds with high specificity and affinity to a predetermined target molecule, such as a neoantigen on a tumor cell. The targeting moiety may be an antibody and variants thereof that specifically bind to a target molecule on a tumor cell, or a peptide aptamer selected from a random sequence pool based on its ability to bind to a target molecule on a tumor cell, or a variant or fragment thereof that can bind to a target molecule on a tumor cell, or an exogenous recognition component such as an antigen recognition domain from a natural T cell receptor (TCR) (e.g., the CD4 extracellular domain that recognizes HIV-infected cells), or a bound cytokine that induces recognition of a target cell bearing a cytokine receptor, or a natural ligand of the receptor.

[0164] In some embodiments, the targeting domain of the CAR can be an Ig NAR, a Fab fragment, a Fab' fragment, a F(ab)'2 fragment, a F(ab)'3 fragment, an Fv, a single-chain variable fragment (scFv), a bis-scFv, an (scFv)2, a minibody, a diabody, a triabody, a tetrabody, a disulfide-stabilized Fv protein (dsFv), a unit body, a nanobody, or an antigen-binding region derived from an antibody that specifically recognizes a target molecule, e.g., a tumor-specific antigen (TSA). In one embodiment, the targeting moiety is an scFv antibody. The scFv domain is expressed on the surface of the CAR T cell and, upon subsequent binding to a target protein on the cancer cell, activates the CAR They can maintain T cells in the vicinity of cancer cells and cause T cell activation. scFvs can be produced using conventional recombinant DNA techniques and are contemplated in the present invention.

[0165] In one embodiment, the targeting moiety of the CAR can recognize CD19. CD19 is a well-known B cell surface molecule that, upon activation of the B cell receptor, promotes B cell antigen receptor-induced signaling and proliferation of B cell populations. CD19 is widely expressed on both normal and neoplastic B cells. B cell-derived malignancies, such as chronic lymphocytic leukemia, acute lymphocytic leukemia, and many non-Hodgkin's lymphomas, often retain CD19 expression. This near-ubiquitous expression and specificity for a single cell lineage make CD19 an attractive target for immunotherapy. Human CD19 contains 14 exons, with exons 1-4 encoding the extracellular portion of CD19, exon 5 encoding the transmembrane portion of CD19, and exons 6-14 encoding the cytoplasmic tail. In one embodiment, the targeting moiety can comprise an scFv derived from the variable region of the FMC63 antibody. FMC63 is an IgG2a mouse monoclonal antibody clone specific for the CD19 antigen that reacts with the CD19 antigen on cells of the B lineage. The CD19 epitope recognized by the FMC63 antibody is located in exon 2 (Sotillo et al (2015) Cancer Discov;5(12):1282-95; the contents of which are incorporated by reference in their entirety). In some embodiments, the targeting moiety of the CAR may be derived from the variable regions of other CD19 monoclonal antibody clones, including, but not limited to, 4G7, SJ25C1, CVID3 / 429, CVID3 / 155, HIB19, and J3-119.

[0166] In some embodiments, the targeting portion of the CAR may recognize tumor-specific antigens (TSAs), such as cancer neoantigens expressed only in tumor cells due to genetic mutations or transcriptional changes that alter the protein coding sequence, thus creating a novel foreign antigen. Genetic alterations can result from genetic substitutions, insertions, deletions, or any other genetic alterations of the native cognate protein (i.e., a molecule expressed in normal cells). With regard to CD19, TSAs can include transcriptional variants of human CD19 that lack exon 2, exons 5-6, or both (see International Patent Publication No. WO2016061368, the contents of which are incorporated herein by reference in their entirety). Because the FMC63-binding epitope is located in exon 2, CD19 lacking exon 2 is not recognized by the FMC63 antibody. Thus, in some embodiments, the targeting portion of the CAR may be a scFV distinct from FMC63. As used herein, "distinct from FMC63" refers to an antibody, scFv, or fragment thereof that is immunologically specific and binds to an epitope of the CD19 antigen that is different from or dissimilar to the epitope of the CD19 antigen bound by FMC63. In some examples, the targeting moiety may recognize a CD19 antigen lacking exon 2. In one embodiment, the targeting moiety recognizes a fragment of CD19 encoded by exons 1, 3, and / or 4. In one example, the targeting moiety recognizes an epitope that bridges the portion of CD19 encoded by exon 1 and the portion of CD19 encoded by exon 3.

[0167] In some embodiments, a targeting moiety of the invention may be an scFv having the amino acid sequence of Table 5. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4]

[0168] Intracellular signaling domains After binding to its target molecule, the intracellular domain of the CAR fusion polypeptide transmits a signal to the immune effector cell and activates at least one of the normal effector functions of the immune effector cell, including cytolytic activity (e.g., cytokine secretion) or helper activity. Thus, the intracellular domain comprises the "intracellular signaling domain" of the T cell receptor (TCR).

[0169] In some embodiments, the entire intracellular signaling domain can be used, while in other embodiments, a truncated portion of the intracellular signaling domain can be used in place of the intact chain, so long as the domain transduces the effector function signal.

[0170] In some embodiments, intracellular signaling domains of the invention can contain signaling motifs known as immunoreceptor tyrosine-based activation motifs (ITAMs). Examples of ITAMs containing cytoplasmic signaling sequences include ITAMs derived from TCR CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. In one example implementation, the intracellular signaling domain is a CD3 zeta (CD3ζ) signaling domain.

[0171] In some embodiments, the intracellular region of the present invention further comprises one or more costimulatory signaling domains that provide additional signals to immune effector cells. These costimulatory signaling domains can be used in combination with signaling domains to further improve the proliferation, activation, memory, persistence, and tumor eradication efficiency of CAR-modified immune cells (such as CAR T cells). In some cases, the costimulatory signaling region comprises one or more intracellular signaling molecules and / or one, two, three, or four cytoplasmic domains of costimulatory molecules. The costimulatory signaling domain may be the intracellular / cytoplasmic domain of a costimulatory molecule, including, but not limited to, CD2, CD7, CD27, CD28, 4-1BB (CD137), OX40 (CD134), CD30, CD40, ICOS (CD278), GITR (glucocorticoid-induced tumor necrosis factor receptor), LFA-1 (lymphocyte function-associated antigen-1), LIGHT, NKG2C, and B7-H3. In one example, the costimulatory signaling domain is derived from the cytoplasmic domain of CD28. In another example, the costimulatory signaling domain is derived from the cytoplasmic domain of 4-1BB (CD137). In another example, the costimulatory signaling domain may be the intracellular domain of GITR as set forth in U.S. Patent No. 9,175,308, the contents of which are incorporated herein by reference in their entirety.

[0172] In some embodiments, the intracellular domain of the invention is selected from the group consisting of an MHC class I molecule, a TNF receptor protein, an immunoglobulin-like protein, a cytokine receptor, an integrin, a signaling lymphocyte activation protein (SLAM), e.g., CD48, CD229, 2B4, CD84, NTB-A, CRACC, BLAME, CD2F-10, SLAMF6, SLAMF7, an activating NK cell receptor, BTLA, a Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), 4-1BB (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM(LIGHTR), SLAMF7, NKp80(KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, IL15Ra, ITGA4, VLA1, CD49a, ITGA4, VLA1, CD49a, IT GA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, NKD2CSLP76, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD229), CD160(BY55), PSGL1, CD100(SEMA 4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, CD270 (HVEM), GADS, SLP-76, PAG / Cbp, CD19a, The ligand that specifically binds to CD83 may comprise a functional signaling domain derived from a protein selected from the group consisting of DAP10, TRIM, ZAP70, killer cell immunoglobulin receptors (KIRs), such as KIR2DL1, KIR2DL2 / L3, KIR2DL4, KIR2DL5A, KIR2DL5B, KIR2DS1, KIR2DS2, KIR2DS3, KIR2DS4, KIR2DS5, KIR3DL1 / S1, KIR3DL2, KIR3DL3, and KIR2DP1; and lectin-associated NK cell receptors, such as Ly49, Ly49A, and Ly49C.

[0173] In some embodiments, the intracellular signaling domain of the present invention may comprise a signaling domain derived from JAK-STAT. In other embodiments, the intracellular signaling domain of the present invention may comprise a signaling domain derived from DAP-12 (cell death-associated protein 12) (Topfer et al., Immunol., 2015, 194:3201-3212; and Wang et al., Cancer Immunol., 2015, 3:815-826). DAP-12 is an important signaling receptor for NK cells. Activation signals mediated by DAP-12 play an important role in inducing NK cell cytotoxic responses against certain tumor cells and virus-infected cells. The cytoplasmic domain of DAP12 contains an immunoreceptor tyrosine-based activation motif (ITAM). Therefore, CARs comprising a signaling domain derived from DAP12 may be used for adoptive transfer of NK cells.

[0174] In some embodiments, T cells engineered with two or more CARs incorporating distinct costimulatory domains and regulated by distinct DDs may be used to provide rate control of downstream signaling.

[0175] In some embodiments, the intracellular domain of the invention may comprise an amino acid sequence in Table 6. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9]

[0176] Transmembrane domain In some embodiments, the CAR of the present invention can comprise a transmembrane domain. As used herein, the term "transmembrane domain (TM)" broadly refers to an amino acid sequence of about 15 residues in length that spans the plasma membrane. More preferably, the transmembrane domain comprises at least 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 amino acid residues and spans the plasma membrane. In some embodiments, the transmembrane domain of the present invention can be derived from either natural or synthetic sources. The transmembrane domain of CAR can be derived from any natural membrane-bound or transmembrane protein. For example, the transmembrane region may be derived from (i.e., include at least the transmembrane region(s) of) the α, β, or ζ chain of the T cell receptor, CD3ε, CD4, CD5, CD8, CD8α, CD9, CD16, CD22, CD33, CD28, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD152, or CD154.

[0177] Alternatively, the transmembrane domains of the invention may be synthetic. In some aspects, the synthetic sequences may comprise primarily hydrophobic residues such as leucine and valine.

[0178] In some embodiments, the transmembrane domains of the present invention include a CD8α transmembrane domain, a CD4 transmembrane domain, a CD28 transmembrane domain, a CTLA-4 transmembrane domain, a PD-1 transmembrane domain, and a human Ig G4 The Fc region may be selected from the group consisting of: a CTLA-4 transmembrane domain having the amino acid sequences of SEQ ID NOS: 1-5 in International Patent Publication No. WO2014 / 100385; and a PD-1 transmembrane domain having the amino acid sequences of SEQ ID NOS: 6-8 in International Patent Publication No. WO2014100385; the contents of each of which are incorporated herein by reference in their entirety.

[0179] In some embodiments, the CAR of the present invention may comprise an optional hinge region (also called a spacer). A hinge sequence is a short amino acid sequence that promotes flexibility of the extracellular targeting region, distancing the target binding domain from the effector cell surface to allow proper cell-cell contact, target binding, and effector cell activation (Patel et al., Gene Therapy, 1999;6:412-419). The hinge sequence may be positioned between the targeting moiety and the transmembrane domain. The hinge sequence may be any suitable sequence derived from or obtained from any suitable molecule. The hinge sequence may be derived from all or part of the hinge region of an immunoglobulin (e.g., IgG1, IgG2, IgG3, IgG4), i.e., the sequence between the CH1 and CH2 domains of an immunoglobulin, e.g., the IgG4 Fc hinge, or the extracellular region of a type 1 membrane protein, e.g., CD8α, CD4, CD28, and CD7 (which may be a wild-type sequence or a derivative). Some hinge regions include an immunoglobulin CH3 domain or both a CH3 domain and a CH2 domain. In certain embodiments, the hinge region may be modified from IgG1, IgG2, IgG3, or IgG4 and include one or more, for example, 1, 2, 3, 4, or 5, amino acid residues substituted with amino acid residues different from those present in the unmodified hinge. Table 7 lists various transmembrane regions that can be used in the CARs described herein. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6]

[0180] Hinge region sequences useful in the present invention are provided in Table 8A. [Table 8A-1] [Table 8A-2] [Table 8A-3] [Table 8A-4] [Table 8A-5] [Table 8A-6] [Table 8A-7]

[0181] Hinge and transmembrane region sequences useful in the present invention are provided in Table 8B. [Table 8B-1]

[0182] In some embodiments, the CARs of the present invention may include one or more linkers between any domains of the CAR. The linker may be 1 to 30 amino acids in length. In this regard, the linker may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids in length. In other embodiments, the linker may be flexible.

[0183] In some embodiments, components comprising a targeting moiety, a transmembrane domain, and an intracellular signaling domain of the invention may be assembled into a single fusion polypeptide. The fusion polypeptide may be the payload of an effector module of the invention. In some embodiments, two or more CAR fusion polypeptides may be included in an effector module, e.g., two, three, or more CARs under the control of a single SRE (e.g., DD). Exemplary effector modules comprising a CAR payload are shown in Figures 2-6.

[0184] In some embodiments, the CAR sequence may be selected from Table 9. [Table 9-1] [Table 9-2] [Table 9-3]

[0185] In one embodiment of the present invention, the payload of the present invention is a CD19-specific CAR that targets different B cells. In the context of the present invention, the effector module is hDHFR DD, ecDHFR DD, or FKBP operably linked to the CD19 CAR fusion construct. DD. In some examples, the promoter utilized to drive expression of the effector module in the vector may be a CMV promoter or EF1a. The efficiency of promoters in driving expression of the same construct may be compared. For example, two constructs may be compared that differ only in the promoter, CMV (OT-CD19N-001) or EF1a promoter (OT-CD19N-017). The amino acid sequences of the CD19 CAR constructs and their components are shown in Tables 10a and 10b. The amino acid sequences in Table 10a and / or Table 10b may be identified by the following at the end of the amino acid sequence: * " may contain the stop codon indicated in the table.

Table 10A-1

Table 10A-2

Table 10A-3

Table 10A-4

Table 10A-5

Table 10A-6

Table 10B-11

Table 10B-12

Table 10B-13

[0186] In some examples, constructs disclosed in Table 10 that are transcriptionally controlled by the CMV promoter may be placed under the transcriptional control of a different promoter to test the role of the promoter in CD19 CAR expression. In one embodiment, the CMV promoter may be replaced with the EF1a promoter. In one embodiment, the CMV promoter of the OT-CD19-001 construct may be replaced with the EF1a promoter to generate the OT-CD19N-017 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-002 construct may be replaced with the EF1a promoter to generate the OT-CD19N-018 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-003 construct may be replaced with the EF1a promoter to generate the OT-CD19N-019 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-004 construct may be replaced with the EF1a promoter to generate the OT-CD19N-020 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-005 construct may be replaced with the EF1a promoter to generate the OT-CD19N-021 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-006 construct may be replaced with the EF1a promoter to generate the OT-CD19N-022 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-007 construct may be replaced with the EF1a promoter to generate the OT-CD19N-023 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-008 construct may be replaced with the EF1a promoter to generate the OT-CD19N-024 construct. In another embodiment, the CMV promoter of the CD19 CAR OT-CD19 CAR-009 construct may be replaced with the EF1a promoter to generate the OT-CD19N-025 construct.

[0187] In one embodiment, the CAR construct comprises a CD19 scFV (e.g., CAT13.1E10 or FMC63), a CD8α spacer or transmembrane domain, and 4-1BB and CD3ζ endodomains. These constructs with CAT13.1E10 exhibit increased proliferation after in vitro stimulation, increased cytotoxicity against CD19+ targets, and increased effector-target interaction compared to constructs with FMC63.

[0188] In some embodiments, the payloads of the present invention may be prepared using the catalytic domain of an E3 ubiquitin ligase. The catalytic domain of the E3 ligase may be fused to an antibody or antibody fragment. The payload is fused to an antigen recognized by the antibody or antibody fragment fused to the E3 ligase catalytic domain. E3 ligases useful in the present invention include, but are not limited to, Ring E3 ligase, HECT E3 ligase, and RBR E3 ligase. Any of the methods described by Kanner SA et al. (2017) eLife;6:e29744 (the contents of which are incorporated by reference in their entirety) may be useful in the present invention.

[0189] In some embodiments, the payloads described herein may be regulated by an E3 ubiquitin ligase construct. The E3 ligase construct may include an SRE and the catalytic domain of an E3 ligase fused to an antibody or antibody fragment. The payload is fused to an antigen recognized by the antibody or antibody fragment attached to the catalytic domain of the E3 ligase. In the absence of a stimulus corresponding to the SRE, the E3 ubiquitin ligase construct is destabilized, allowing the payload fused to the antigen to be expressed. In the presence of a ligand corresponding to the SRE, the E3 ubiquitin ligase construct is stabilized and capable of binding to the antigen fused to the payload. Binding of the E3 ligase construct to the antigen targets the protein for degradation. Any payload described herein may be regulated using an E3 ubiquitin ligase construct, so long as the payload is fused to an antigen recognized by the antibody or antibody fragment in the E3 ubiquitin ligase construct. In some embodiments, the payload is a chimeric antigen receptor. The E3 ubiquitin ligase construct may also be used to design logic gates. In one embodiment, an E3 ubiquitin ligase construct may be used to create a NOT gate, where one ligand induces expression of the payload and another ligand inhibits expression of the payload, hi some embodiments, an E3 ubiquitin ligase construct may be used to create a NOT gate by fusing the payload-antigen fusion protein to a second SRE that is distinct from the SRE of the E3 ubiquitin ligase construct.

[0190] In some embodiments, the payload of the present invention may be any of the costimulatory molecules and / or intracellular domains described herein. In some embodiments, one or more costimulatory molecules, each under the control of a different SRE, may be used in the present invention. SRE-regulated costimulatory molecules may also be expressed with first-generation CARs, second-generation CARs, third-generation CARs, fourth-generation CARs, or any other CAR design described herein.

[0191] Tandem Car (TanCAR) In some embodiments, the CAR of the present invention may be a tandem chimeric antigen receptor (TanCAR) that can target two, three, four, or more tumor-specific antigens. In some aspects, the CAR is a bispecific TanCAR that contains two targeting domains that recognize two different TSAs on tumor cells. A bispecific CAR can be further defined as having an extracellular region that contains a targeting domain (e.g., an antigen recognition domain) specific to a first tumor antigen and a targeting domain (e.g., an antigen recognition domain) specific to a second tumor antigen. In other aspects, the CAR is a multispecific TanCAR that contains three or more targeting domains configured in a tandem arrangement. The spaces between the targeting domains of TanCAR can be between about 5 and about 30 amino acids in length, for example, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 amino acids.

[0192] Split CAR In some embodiments, components comprising the targeting moiety, transmembrane domain, and intracellular signaling domain of the present invention may be split into two or more parts, relying on multiple inputs to promote assembly of an intact, functional receptor. In one embodiment, a split synthetic CAR system can be constructed in which assembly of an activated CAR receptor depends on binding of a ligand to an SRE (e.g., a small molecule) and binding of a specific antigen to the targeting moiety. As a non-limiting example, a split CAR consists of two parts that assemble in a small molecule-dependent manner, with one part of the receptor featuring an extracellular antigen-binding domain (e.g., scFv) and the other part carrying an intracellular signaling domain, such as the CD3ζ intracellular domain.

[0193] In other embodiments, the split portion of the CAR system can be further modified to increase signaling. In one example, the second portion of the cytoplasmic fragment can be anchored to the plasma membrane by incorporating a transmembrane domain (e.g., a CD8α transmembrane domain) into the construct. Additionally, an additional extracellular domain, such as an extracellular domain that mediates homodimerization, can be added to the second portion of the CAR system. These modifications can enhance receptor output activity, i.e., T cell activation.

[0194] In some embodiments, the two parts of the split CAR system contain heterodimerization domains that conditionally interact upon binding of a heterodimerization small molecule. Thus, the receptor components assemble in the presence of the small molecule to form an intact system, which is then activated by antigen engagement. Any known heterodimerization component can be incorporated into the split CAR system. Other small molecule-dependent heterodimerization domains may also be used, including, but not limited to, the gibberellin-induced dimerization system (GID1-GAI), trimethoprim-SLF-induced ecDHFR and FKBP dimerization (Czlapinski et al., J Am Chem Soc., 2008, 130(40):13186-13187), and ABA (abscisic acid)-induced dimerization of PP2C and PYL domains (Cutler et al., Annu Rev Plant Biol. 2010, 61:651-679). Dual regulation of the split CAR system using inducible assembly (e.g., ligand-dependent dimerization) and degradation (e.g., destabilization domain-induced CAR degradation) may provide more flexible control over the activity of CAR-modified T cells.

[0195] Switchable Car In some embodiments, the CAR of the present invention may be a switchable CAR. Juillerat et al. (Juilerat et al., Sci. Rep., 2016, 6:18950; the contents of which are incorporated herein by reference in their entirety) recently reported a controllable CAR that can be temporarily switched on in response to a stimulus (e.g., a small molecule). In this CAR design, a system is directly integrated into the hinge domain that separates the scFv domain from the CAR's plasma membrane domain. Such a system can separate or combine different important functions of the CAR, such as activation and costimulation within different chains of the receptor complex, mimicking the complexity of the TCR's natural architecture. This integrated system can switch the interaction between the scFv and antigen between on and off states, controlled by the presence or absence of a stimulus.

[0196] Reversible CAR In another embodiment, the CAR of the present invention may be a reversible CAR system. In this CAR architecture, a LID domain (ligand-induced degradation) is incorporated into the CAR system. By adding a ligand for the LID domain, the CAR can be temporarily downregulated. The combination of LID and DD regulation provides adjustable control of continuously activated CAR T cells, thereby reducing CAR-mediated tissue toxicity.

[0197] activation conditional CAR In some embodiments, the payload of the present invention may be an activation-conditional chimeric antigen receptor (CAR) that is expressed only in activated immune cells. Expression of the CAR may be combined with an activation-conditional control region, which refers to one or more nucleic acid sequences that induce transcription and / or expression of a sequence, such as a CAR, under its control. Such an activation-conditional control region may be a promoter of a gene that is upregulated during activation of immune effector cells, such as an IL2 promoter or an NFAT binding site. In some embodiments, immune cell activation may be achieved by a constitutively expressed CAR (International Publication No. WO2016126608, the contents of which are incorporated herein by reference in their entirety).

[0198] Cytokines, chemokines, and other soluble factors According to the present invention, the CARs of the present invention may be used in conjunction with other payloads of the present invention, which may be cytokines, chemokines, growth factors, and soluble proteins produced by immune cells, cancer cells, and other cell types, which act as chemical messengers between cells and tissues in the body. These proteins mediate a wide range of physiological functions, from influencing cell proliferation, differentiation, migration, and survival to numerous effector activities. For example, activated T cells produce various cytokines for cytotoxic function and to eliminate tumor cells.

[0199] In some embodiments, the payload of the present invention may be a cytokine, including but not limited to interleukins, tumor necrosis factors (TNFs), interferons (IFNs), TGFβ, and chemokines, as well as fragments, variants, analogs, and derivatives thereof. In some embodiments, the payload of the present invention may be a cytokine that stimulates an immune response. In other embodiments, the payload of the present invention may be a cytokine antagonist that negatively impacts anti-cancer immune responses.

[0200] In some embodiments, the payload of the present invention may be a cytokine receptor, a recombinant receptor, variants, analogs, and derivatives thereof; or a signaling component of a cytokine.

[0201] In some embodiments, cytokines of the present invention are utilized to induce CD8+ T cell proliferation for use in immunotherapy. EMThe proliferation, survival, persistence, and efficacy of immune cells, such as thymocytes, natural killer cells, and tumor-infiltrating lymphocyte (TIL) cells, may be improved. In other embodiments, T cells engineered with two or more DD-regulating cytokines are utilized to provide rate control of T cell activation and tumor microenvironment remodeling. In one aspect, the present invention provides biological circuits and compositions for minimizing the toxicity associated with cytokine therapy. Despite successful reduction in tumor burden, systemic cytokine therapy often produces severe, dose-limiting side effects. Two factors contribute to the observed toxicity: (a) pleiotropy, in which cytokines affect different cell types and may produce opposing effects on the same cells depending on the context; and (b) cytokines have short serum half-lives, necessitating administration at high doses to achieve therapeutic efficacy, which exacerbates the pleiotropic effect. In one aspect, cytokines of the present invention may be utilized to regulate cytokine expression in the event of adverse effects. In some embodiments, cytokines of the present invention may be engineered to extend longevity or enhance specificity to minimize toxicity.

[0202] In some embodiments, the payload of the present invention may be an interleukin (IL) cytokine. Interleukins (IL) are a class of glycoproteins produced by white blood cells to regulate immune responses. As used herein, the term "interleukin (IL)" refers to an interleukin polypeptide from any species or source, including full-length proteins as well as fragments or portions of proteins. In some embodiments, the interleukin payload is selected from the group consisting of IL1, IL1α (also known as hematopoietin-1), IL1β (catabolin), IL1δ, IL1ε, IL1η, IL1ζ, interleukin-1 family members 1-11 (IL1F1-IL1F11), interleukin-1 homologs 1-4 (IL1H1-IL1H4), IL1-related proteins 1-3 (IL1RP1-IL1RP3), IL2, IL3, IL4, IL5, IL6, IL7, IL8, IL9, IL10, IL10C, IL10D, IL11, IL11a, IL11b, IL12, IL13, The antibody is selected from IL14, IL15, IL16, IL17, IL17A, IL17B, IL17C, IL17E, IL17F, IL18, IL19, IL20, IL20-like (IL20L), IL21, IL22, IL23, IL23A, IL23-p19, IL23-p40, IL24, IL25, IL26, IL27, IL28A, IL28B, IL29, IL30, IL31, IL32, IL33, IL34, IL35, IL36α, IL36β, IL36γ, IL36RN, IL37, IL37a, IL37b, IL37c, IL37d, IL37e, and IL38. In another aspect, the payload of the invention may be an interleukin receptor selected from CD121a, CDw121b, IL2Rα / CD25, IL2Rβ / CD122, IL2Rγ / CD132, CDw131, CD124, CD131, CDw125, CD126, CD130, CD127, CDw210, IL8RA, IL11Rα, CD212, CD213α1, CD213α2, IL14R, IL15Rα, CDw217, IL18Rα, IL18Rβ, IL20Rα, and IL20Rβ.

[0203] In one embodiment, the payload of the present invention may comprise IL12. IL12 is a heterodimeric protein of two subunits (p35, p40) secreted by antigen-presenting cells such as macrophages and dendritic cells. IL12 is expressed in natural killer (NK) cells, macrophages, and CD8 cells via the STAT4 pathway. + Cytotoxic T cells and CD4 + It is a type 1 cytokine that acts on T helper cells and induces IFN-γ production in these effector immune cells (reviewed in Trinchieri G, Nat Rev Immunol. 2003;3(2):133-146). IL-12 is a cytokine that stimulates NK cells and CD8 + It can promote the cytotoxic activity of T cells and thus has antitumor functions. Intravenous injection of recombinant IL-12 has shown modest clinical efficacy in a small number of patients with advanced melanoma and renal cell carcinoma (Gollob et al., Clin. Cancer Res. 2000;6(5):1678-1692). IL-12 has been used as an adjuvant to enhance cytotoxic immunity using melanoma antigen vaccines or peptide-pulsed peripheral blood mononuclear cells and to promote NK cell activity in breast cancer patients with trastuzumab treatment. Local delivery of IL-12 to the tumor microenvironment promotes tumor regression in several tumor models. All these studies indicate that locally increased IL-12 levels can promote antitumor immunity. One major obstacle to systemic or local administration of recombinant IL-12 protein or via oncolytic viral vectors is the severe side effects that can occur when IL-12 is presented at high levels. Developing a system to tightly control IL-12 levels may provide safe use of IL-12 in cancer therapy.

[0204] It is understood in the art that particular gene and / or protein nomenclature may or may not include punctuation marks such as dashes "-" or symbols such as Greek letters for the same gene or protein. Whether these are included or not herein does not imply a change in meaning as understood by those of skill in the art. For example, IL2, IL2, and IL 2 refer to the same interleukin. Similarly, TNF alpha, TNF α, TNF-alpha, TNF-α, TNF alpha, and TNF α all refer to the same protein.

[0205] In one aspect, the effector module of the present invention may be a DD-IL12 fusion polypeptide. This regulatable DD-IL12 fusion polypeptide may be used directly as an immunotherapeutic or transduced into immune effector cells (T cells and TIL cells) to generate modified T cells with greater in vivo proliferation and survival capacity for adoptive cell transfer. Regulated IL12 may be used to minimize the need for harsh pretreatment regimens in current adoptive cell therapies. DD-IL12 may also be utilized to modify the tumor microenvironment and enhance persistence in solid tumors currently resistant to tumor antigen-targeted therapy. In some embodiments, CAR-expressing T cells may be protected with DD-regulated IL12 to reduce immunosuppression without systemic toxicity.

[0206] In some embodiments, IL12 may be Flexi IL12, in which both the p35 and p40 subunits are encoded by a single cDNA, producing a single-chain polypeptide. The single-chain polypeptide may be generated by placing the p35 subunit at the N- or C-terminus of the single-chain polypeptide. Similarly, the p40 subunit may be located at the N- or C-terminus of the single-chain polypeptide. In some embodiments, the IL12 constructs of the present invention may be under the transcriptional control of a CMV promoter (SEQ ID NO: 716), an EF1a promoter (SEQ ID NO: 717, SEQ ID NO: 908), or a PGK promoter (SEQ ID NO: 718). Any portion of IL12 that retains one or more functions of full-length or mature IL12 may be useful in the present invention. In some aspects, DD-IL12 comprises an amino acid sequence listed in Table 11. The amino acid sequences in Table 11 may be derived from a construct that includes the amino acid sequence " * The stop codons may be included as indicated in the table with a "." [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4] [Table 11-5] [Table 11-6] [Table 11-7] [Table 11-8] [Table 11-9] [Table 11-10] [Table 11-11] [Table 11-12] [Table 11-13] [Table 11-14]

[0207] In one embodiment, the payload of the present invention may comprise IL15. Interleukin-15 is a potent immunostimulatory cytokine and an essential survival factor for T cells and natural killer cells. Preclinical studies comparing IL2 and IL15 have shown that IL15 is less toxic than IL2. In some embodiments, the effector module of the present invention may be a DD-IL15 fusion polypeptide. IL15 polypeptides may also be modified to increase their binding affinity to the IL15 receptor. For example, asparagine at position 72 of IL15 may be substituted with aspartic acid (SEQ ID NO: 2 in U.S. Patent Publication US20140134128A1; the contents of which are incorporated by reference in their entirety). In some embodiments, the IL15 construct of the present invention may be under the transcriptional control of a CMV promoter (SEQ ID NO: 716), an EF1a promoter (SEQ ID NO: 717, SEQ ID NO: 908), or a PGK promoter (SEQ ID NO: 718). In some aspects, DD-IL15 has the amino acid sequence set forth in Table 12. The amino acid sequences in Table 12 may be modified by adding " * " may contain the stop codon indicated in the table. [Table 12-1] [Table 12-2] [Table 12-3] [Table 12-4] [Table 12-5]

[0208] A unique feature of IL15-mediated activation is the transpresentation mechanism, in which IL15 is presented as a complex with the IL15 receptor alpha subunit (IL15Ra), which binds to and activates membrane-bound IL15β / γ receptors on the same or different cells. The IL15 / IL15Ra complex is more effective at activating IL15 signaling than IL15 itself. Thus, in some embodiments, the effector module of the present invention may comprise a DD-IL15 / IL15Ra fusion polypeptide. In one embodiment, the payload may be the IL15 / IL15Ra fusion polypeptide described in U.S. Patent Publication No. US20160158285A1 (the contents of which are incorporated herein by reference in their entirety). IL15 receptor alpha contains an extracellular domain called the sushi domain, which contains most of the structural elements necessary for binding to IL15. Thus, in some embodiments, the payload may be an IL15 / IL15Ra sushi domain fusion polypeptide as described in US Patent Publication No. US20090238791A1, the contents of which are incorporated herein by reference in their entirety.

[0209] Modulated IL15 / IL15Ra was used to inhibit CD8+ T cells without affecting regulatory T cells, NK cells, and TIL cells. EM The proliferation, survival, and efficacy of cell populations may be promoted. In one embodiment, DD-IL15 / IL15Ra may be utilized to enhance CD19-directed T cell therapy in B cell leukemia and lymphoma. In one aspect, IL15 / IL15Ra may be used as a payload in the present invention to reduce the need for preconditioning regimens in current CAR-T treatment paradigms.

[0210] Effector modules comprising DD-IL15, DD-IL15 / IL15Ra and / or DD-IL15 / IL15Ra sushi domains may be designed to be secreted (e.g., using an IL2 signal sequence) or membrane-bound (e.g., using an IgE or CD8a signal sequence).

[0211] In some embodiments, DD-IL115 / IL15Ra has the amino acid sequence shown in Tables 13a, 13b, and 13c. The amino acid sequences in Tables 13a, 13b, and 13c have the following at the end of the amino acid sequence: * The stop codons may be included as indicated in the table with a "." [Table 13A-1] [Table 13A-2] [Table 13A-3] [Table 13A-4] [Table 13B-1] [Table 13B-2] [Table 13B-3] [Table 13B-4] [Table 13B-5] [Table 13B-6] [Table 13B-7] [Table 13B-8] [Table 13B-9] [Table 13B-10] [Table 13B-11] [Table 13B-12] [Table 13B-13] [Table 13B-14] [Table 13C-1] [Table 13C-2] [Table 13C-3]

[0212] In one embodiment, the payload of the present invention may comprise IL18. IL18 is a proinflammatory and immunoregulatory cytokine that promotes IFN-γ production by T cells and NK cells. IL18 belongs to the IL1 family. Secreted IL18 binds to a heterodimeric receptor complex consisting of the IL18Rα and β chains and initiates signal transduction. IL18 acts in concert with other cytokines to regulate immune system functions, including the induction of IFN-γ production, Th1 responses, and NK cell activation in response to pathogen products. IL18 has shown anti-cancer effects in several tumors. Administration of recombinant IL18 protein or an IL18 transgene has been shown to inhibit CD4 +It induces regression of melanoma or sarcoma through activation of T- and / or NK cell-mediated responses (reviewed by Srivastava et al., Curr. Med. Chem., 2010, 17:3353-3357). The combination of IL18 with other cytokines, such as IL12 or costimulatory molecules (e.g., CD80), enhances the antitumor effects of IL18. For example, IL18 and IL12A / B or CD80 genes have been successfully integrated into the genome of oncolytic viruses to synergistically induce T-cell-mediated antitumor immune responses (Choi et al., Gene Ther., 2011, 18:898-909). IL2 / IL18 fusion proteins also show improved antitumor properties compared to either cytokine alone and low toxicity in preclinical models (Acres et al., Cancer Res., 2005, 65:9536-9546).

[0213] NK cells are activated by IL18 alone or in combination with IL12 and IL15. Preclinical studies have shown that adoptively transferred IL12, IL15, and IL18-preactivated NK cells exhibit enhanced effector function against established tumors in vivo (Ni et al., J Exp Med. 2012, 209:2351-2365; and Romee et al., Blood. 2012, 120:4751-4760). Human IL12 / IL15 / IL18-activated NK cells also exhibit memory-like characteristics and secrete more IFN-γ in response to cytokines (e.g., lower concentrations of IL2). In one embodiment, the effector module of the present invention may be a DD-IL18 fusion polypeptide.

[0214] In one embodiment, the payload of the present invention may comprise IL21. IL21 is another pleiotropic type I cytokine produced primarily by T cells and natural killer T (NKT) cells. IL21 inhibits the expression of CD4 + and CD8 +IL21 exerts diverse effects on various cell types, including, but not limited to, T cells, B cells, macrophages, monocytes, and dendritic cells (DCs). The functional receptor for IL21 consists of the IL21 receptor (IL21R) and the common cytokine receptor gamma chain, which is also a subunit of the receptors for IL2, IL4, IL7, IL9, and IL15. Studies have provided compelling evidence that IL21 is a promising immunotherapeutic agent for cancer immunotherapy. IL21 promotes maturation, enhances cytotoxicity, and induces the production of IFN-γ and perforin by NK cells. These effector functions inhibit the growth of B16 melanoma (Kasaian et al., Immunity. 2002, 16(4):559-569; and Brady et al., J Immunol. 2004, 172(4):2048-2058). IL21, together with IL15, mediates the activation of antigen-specific CD8 + It increases T cell numbers and their effector functions, leading to tumor regression (Zeng et al., J Exp Med. 2005, 201(1):139-148). IL21 may also be used to rejuvenate multiple immune effector cells within the tumor microenvironment. IL21 can also directly induce apoptosis in certain types of lymphoma, such as diffuse large B-cell lymphoma, mantle cell lymphoma, and chronic lymphocytic leukemia cells, via activation of the STAT3 or STAT1 signaling pathway. IL21, alone or in combination with anti-CD20 mAb (rituximab), can activate NK cell-dependent cytotoxicity. Interestingly, the discovery of the immunosuppressive effects of IL21 suggests that this cytokine is a "double-edged sword," and IL21 stimulation can lead to either induction or suppression of immune responses. When using IL21-related immunotherapeutic agents, both the stimulatory and inhibitory effects of IL21 must be considered. IL21 levels must be tightly controlled by regulatory elements. In one aspect, the effector module of the present invention may be a DD-IL21 fusion polypeptide.

[0215] In some embodiments, the payload of the present invention may comprise a type I interferon. Type I interferon (IFN-I) is a soluble protein important for combating human viral infections. IFN-I includes IFN-α subtypes (IFN-α1, IFN-α1b, IFN-α1c), IFN-β, IFN-δ subtypes (IFN-δ1, IFN-δ2, IFN-δ8), IFN-γ, IFN-κ, as well as IFN-ε, IFN-λ, IFN-ω, IFN-τ, and IFN-ζ. IFN-α and IFN-β are the major IFN-I subtypes involved in immune responses. All IFN-I subtypes signal through a unique heterodimeric receptor, the interferon α receptor (IFNAR), consisting of two subunits, IFNAR1 and IFNAR2. Activation of IFNAR regulates the host response to viral infection and adaptive immunity. Several signaling cascades can be activated by IFN-I, including the Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway, the mitogen-activated protein kinase (MAPK) pathway, the phosphoinositide 3-kinase (PI3K) pathway, the v-crk sarcoma viral CT10 oncogene homolog (avian)-like (CRKL) pathway, and the NF-κB cascade. It has long been established that type I IFN-I directly inhibits the proliferation of tumor cells and virus-infected cells and enhances antigen recognition by increasing MHC class I expression. IFN-I has also been shown to be involved in regulating the immune system. IFN-I can regulate the immune system directly through interferon receptors (IFN-I) or indirectly by inducing chemokines and cytokines. Type I IFN-I enhances NK cell function and promotes NK cell survival. Type I IFN-I also affects monocytes, supporting their differentiation into DCs with high antigen-presenting capacity and stimulating macrophage function and differentiation. Several studies have demonstrated that IFN-I enhances CD8 + It has also been shown to promote T cell survival and function. In some instances, it may be desirable to use the biological circuits of the present invention to modulate type I IFN expression to avoid immunosuppression caused by long-term treatment with IFN.

[0216] Novel anti-cancer immunotherapies using recombinant type I IFN proteins, type I IFN transgenes, type I IFN-encoding vectors, and type I IFN-expressing cells have been developed. For example, IFN-α has been approved as a treatment for several neoplastic diseases, such as melanoma, RCC, and multiple myeloma. Although type I IFN is a powerful tool for directly and indirectly regulating immune system function, the side effects of long-term systemic treatment and its insufficient efficacy have dampened interest in IFN-α for clinical use in oncology. It is believed that type I IFN would be more effective if IFN levels were tightly regulated in malignant tissues. An intermittent delivery approach has been proposed based on the observation that optimizing the intermittent pace can help avoid signaling desensitization (negative feedback) of responding immune cells induced by IFN-I (i.e., by SOCS1 induction). According to the present invention, the effector module may comprise a DD-IFN fusion polypeptide. DD and its ligands regulate the expression of IFN to induce antiviral and antitumor immune responses, while minimizing the side effects caused by long-term exposure to IFN.

[0217] In some embodiments, the payload of the present invention may comprise a member of the tumor necrosis factor (TNF) superfamily. As used herein, the term "TNF superfamily" refers to a group of cytokines capable of inducing apoptosis. Members of the TNF family include TNF-α, TNF-β (also known as lymphotoxin-α (LT-α)), lymphotoxin-β (LT-β), CD40L (CD154), CD27L (CD70), CD30L (CD153), FASL (CD178), 4-1BBL (CD137L), OX40L, TRAIL (TNF-related apoptosis-inducing ligand), APRIL (proliferation-inducing ligand), TWEAK, TRANCE, TALL-1, GITRL, LIGHT, and TNFSF1-TNFSF20 (TNF ligand superfamily members 1-20). In one embodiment, the payload of the present invention may be TNF-α. TNF-α induces cytolysis of tumor cells and also induces cell proliferation and differentiation. In one aspect, an effector module of the present invention may comprise a DD-TNFα fusion polypeptide.

[0218] In some embodiments, the payload of the present invention may comprise an inhibitory molecule that blocks an inhibitory cytokine. The inhibitor may be a blocking antibody specific for the inhibitory cytokine, an antagonist to the inhibitory cytokine, or the like.

[0219] In some embodiments, the payload of the present invention may comprise an inhibitor of the secondary cytokine IL35. IL35 belongs to the interleukin-12 (IL12) cytokine family and is a heterodimer consisting of the IL27 β chain Ebi3 and the IL12 α chain p35. The secretion of bioactive IL35 is mediated by the forkhead box protein 3 (Foxp3). + It has only been described in regulatory T cells (Tregs) (resting and activated Tregs). Unlike other members of the family, IL35 appears to function exclusively in an anti-inflammatory manner by inhibiting effector T cell proliferation and possibly other parameters (Collison 2004). et al., Nature, 2007, 450(7169):566-569).

[0220] In some embodiments, the payload of the present invention may comprise an inhibitor that blocks transforming growth factor beta (TGF-β) subtypes (TGF-β1, TGF-β2, and TGF-β3). TGF-β is secreted by many cell types, including macrophages, and often forms a complex with two proteins, LTBP and LAP. Serum proteinases, such as plasmin, catalyze the release of active TGF-β from the complex from activated macrophages. Increased expression of TGF-β has been shown to correlate with the aggressiveness of many cancers. The immunosuppressive activity of TGF-β in the tumor microenvironment contributes to carcinogenesis.

[0221] In some embodiments, the payload of the present invention may comprise an inhibitor of the IDO enzyme.

[0222] In some embodiments, the payload of the present invention may comprise a chemokine and a chemokine receptor. Chemokines are a family of secreted small cytokines or signaling proteins that can induce directed chemotaxis in nearby responsive cells. The chemokine may be an SCY (small cytokine) selected from the group consisting of SCYA1-28 (CCL1-28), SCYB1-16 (CXCL1-16), SCYC1-2 (XCL1-2), SCYD-1, and SCYE-1; or a C chemokine selected from XCL1 and XCL2; or CCL1, CCL2, CCL3, CCL4, CCL5, CCL6, CCL7, CCL8, CCL9, CCL10, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, or a C chemokine selected from the group consisting of ... It may be a CC chemokine selected from CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, and CCL28; or a CXC chemokine selected from CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, and CXCL17; or the CX3C chemokine CX3CL1. In some embodiments, the chemokine receptor may be a receptor for C chemokines, including XCR1; or a receptor for CC chemokines, including CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, and CCR10; or a receptor for CXC chemokines, including CXCR1, CXCR2, CXCR3, CXCR4, and CXCR5; or the CX3C chemokine receptor CX3CR1.

[0223] In some embodiments, the payloads of the present invention may include other immunomodulatory agents that play an important role in immunotherapy, such as GM-CSF (granulocyte-macrophage colony-stimulating factor), erythropoietin (EPO), MIP3a, monocyte chemoattractant protein (MCP)-1, intracellular adhesion molecule (ICAM), macrophage colony-stimulating factor (M-CSF), interleukin-1 receptor-activated kinase (iRAK-1), lactotransferrin, and granulocyte colony-stimulating factor (G-CSF).

[0224] In some embodiments, the payload of the present invention may include amphiregulin. Amphiregulin (AREG) is an EGF-like growth factor that binds to the EGFR receptor and enhances the function of CD4+ regulatory T cells (Treg). AREG promotes immunosuppression in a tumor environment. Therefore, in some embodiments, the payload of the present invention may include amphiregulin to attenuate the immune response during immunotherapy.

[0225] In some embodiments, the payloads of the present invention may comprise fusion proteins that may fuse cytokines, chemokines, and / or other soluble factors to other biomolecules, such as antibodies and / or receptor ligands. Such fusion molecules may extend the half-life of the cytokine, reduce systemic toxicity, and increase the local concentration of the cytokine at the tumor site. Fusion proteins containing two or more cytokines, chemokines, and / or other soluble factors may be utilized to achieve synergistic therapeutic effects. In one embodiment, the payload may be a GM-CSF / IL2 fusion protein.

[0226] 3. Additional effect module functions Effector modules of the present invention may include signal sequences that regulate the distribution of the desired payload, cleavage and / or processing functions that facilitate cleavage of the payload from the effector module construct, targeting and / or penetration signals that can regulate the cellular localization of the effector module, tags, and / or one or more linker sequences that connect different components of the effector module.

[0227] signal sequence In addition to the SRE (e.g., DD) and payload region, the effector modules of the present invention may further comprise one or more signal sequences. A signal sequence (also called a signal peptide, targeting signal, targeting peptide, localization sequence, transit peptide, leader sequence, or leader peptide) directs a protein (e.g., an effector module of the present invention) to a specified cellular and / or extracellular location. Protein signal sequences play a central role in the targeting and translocation of nearly all secreted proteins and many integral membrane proteins.

[0228] Signal sequences are short (5–30 amino acids) peptides present at the N-terminus of most newly synthesized proteins that are targeted to specific locations. Signal sequences are recognized by the signal recognition particle (SRP) and can be cleaved using type I and type II signal peptide peptidases. Signal sequences from human proteins can be incorporated as regulatory modules of effector modules to target the effector modules to specific cellular and / or extracellular locations. These signal sequences have been experimentally verified and can be cleaved (Zhang et al., Protein Sci. 2004, 13:2819–2824).

[0229] In some embodiments, a signal sequence may, but is not necessarily, located at the N-terminus or C-terminus of the effector module, and the desired effector module may, but is not necessarily, cleaved to obtain the "mature" payload, i.e., the immunotherapeutic agent discussed herein.

[0230] In some examples, the signal sequence may be a secretory signal sequence derived from a naturally occurring secreted protein or a variant thereof, such as, but not limited to, a cytokine signal sequence, for example, the IL2 signal sequence having the amino acid sequence of SEQ ID NO: 783 encoded by the nucleotides of SEQ ID NOs: 788-791 and / or the p40 signal sequence having the amino acid sequence of SEQ ID NO: 719 encoded by the nucleotides of SEQ ID NOs: 736-744.

[0231] In some instances, a signal sequence may be used to target the desired payload to the surface membrane of the target cell. Expression of the payload on the surface of the target cell may be useful for limiting the diffusion of the payload to non-target in vivo environments, thereby potentially improving the safety profile of the payload. Furthermore, membrane presentation of the payload may enable physiological and qualitative signaling, as well as stabilization and recycling of the payload for a longer half-life. The membrane sequence may be an endogenous signal sequence of the N-terminal component of the desired payload. In some cases, it may be desirable to replace this sequence with a different signal sequence. The signal sequence may be selected based on compatibility with the secretory pathway of the desired cell type, such that the payload is presented on the surface of T cells. In some embodiments, the signal sequence may be an IgE signal sequence having the amino acid sequence of SEQ ID NO: 801 and the nucleotide sequence of SEQ ID NO: 810, 930, or 931; a CD8a signal sequence (also referred to as a CD8a leader) having the amino acid sequence of SEQ ID NO: 628 and the nucleotide sequence of SEQ ID NO: 671-675; or an IL15Ra signal sequence (also referred to as an IL15Ra leader) having the amino acid sequence of SEQ ID NO: 932 and the nucleotide sequence of SEQ ID NO: 933.

[0232] Other examples of signal sequences, including variants, may be the modified signal sequences described in U.S. Pat. Nos. 8,148,494; 8,258,102; 9,133,265; 9,279,007; and U.S. Patent Application Publication No. 20070141666; and International Patent Application Publication No. WO1993018181, the contents of each of which are incorporated herein by reference in their entirety.

[0233] In other examples, the signal sequence may be a heterologous signal sequence from other organisms such as viruses, yeast, and bacteria, which can target the effector module to a specific cellular location, such as the nucleus (e.g., EP1209450). Other examples include the Trichoderma aspartic protease (NSP24) signal sequence (e.g., U.S. Pat. No. 8,093,016 to Cervin and Kim), bacterial lipoprotein signal sequences (e.g., PCT Publication No. WO199109952 to Lau and Rioux), E. coli enterotoxin II signal peptide (e.g., U.S. Pat. No. 6,605,697 to Kwon et al.), E. coli secretion signal sequences (e.g., U.S. Pat. Publication No. US2016090404 to Malley et al.), lipase signal sequences from methylotrophic yeast (e.g., U.S. Pat. No. 8,975,041), and signal peptides of DNases from Corynebacterium bacteria (e.g., U.S. Pat. No. 4,965,197), which can increase secretion of fusion proteins such as enzymes, the contents of each of which are incorporated herein by reference in their entirety.

[0234] Signal sequences may also include nuclear localization signals (NLS), nuclear export signals (NES), polarized cell tubular vesicle structure localization signals (see, e.g., U.S. Patent No. 8,993,742; Cour et al., Nucleic Acids Res. 2003, 31(1):393-396; the contents of each of which are incorporated herein by reference in their entirety), extracellular localization signals, and signals to intracellular locations (e.g., lysosomes, endoplasmic reticulum, Golgi, mitochondria, plasma membranes, peroxisomes, etc.) (see, e.g., U.S. Patent No. 7,396,811; and Negi et al., Database, 2015, 1-7; the contents of each of which are incorporated herein by reference in their entirety).

[0235] In some embodiments, signal sequences of the present invention include, but are not limited to, any of the sequences set forth in Table 6 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated by reference in their entirety.

[0236] Cutting site In some embodiments, the effector module has a cleavage and / or processing function. The effector module of the present invention may comprise at least one protein cleavage signal / site. The protein cleavage signal / site may be located at the N-terminus, the C-terminus, any space between the N-terminus and the C-terminus, for example, but not limited to, midway between the N-terminus and the C-terminus, between the N-terminus and the midpoint, between the midpoint and the C-terminus, and combinations thereof.

[0237] The effector module may comprise one or more cleavage signal(s) / site(s) of any proteinase. The proteinase may be a serine proteinase, a cysteine ​​proteinase, an endopeptidase, a dipeptidase, a metalloproteinase, a glutamic acid proteinase, a threonine proteinase, and an aspartic acid proteinase. In some embodiments, the cleavage site is selected from furin, actinidain, calpain-1, carboxypeptidase A, carboxypeptidase P, carboxypeptidase Y, caspase-1, caspase-2, caspase-3, caspase-4, caspase-5, caspase-6, caspase-7, caspase-8, caspase-9, caspase-10, cathepsin B, cathepsin C, cathepsin G, cathepsin H, cathepsin K, cathepsin L, The signal sequence may be that of cathepsin S, cathepsin V, clostripain, chymase, chymotrypsin, elastase, endoproteinase, enterokinase, factor Xa, formic acid, granzyme B, matrix metallopeptidase-2, matrix metallopeptidase-3, pepsin, proteinase K, SUMO protease, subtilisin, TEV protease, thermolysin, thrombin, trypsin, or TAGZyme.

[0238] In one embodiment, the cleavage site is a furin cleavage site having the amino acid sequence SARNRQKRS (SEQ ID NO: 721) encoded by the nucleotide sequence of SEQ ID NO: 750; or a modified furin cleavage site having the amino acid sequence ARNRQKRS (SEQ ID NO: 722) encoded by the nucleotide sequence of SEQ ID NO: 751; or a modified furin site having the amino acid sequence ESRRVRRNKRSK (SEQ ID NO: 630) encoded by the nucleotide sequence of SEQ ID NOs: 681-683.

[0239] In some embodiments, cleavage sites of the present invention include, but are not limited to, any of those set forth in Table 7 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0240] Protein tags In some embodiments, the effector module of the present invention may comprise a protein tag. Protein tags may be used to detect and monitor the process of the effector module. The effector module may comprise one or more tags, such as an epitope tag (e.g., a FLAG or hemagglutinin (HA) tag). Numerous protein tags may be used in the effector module, including self-labeling polypeptide tags (e.g., haloalkane dehalogenase (HaloTag2 or HaloTag7), ACP tag, clip tag, MCP tag, snap tag), epitope tags (e.g., FLAG, HA, His, and Myc), fluorescent tags (e.g., green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), and variants thereof), bioluminescent tags (e.g., luciferase and variants thereof), affinity tags (e.g., maltose binding protein (MBP) tag, glutathione tag), and the like. These include, but are not limited to, GST-tags), immunogenic affinity tags (e.g., protein A / G, IRS, AU1, AU5, glu-glu, KT3, S-tag, HSV, VSV-G, Xpress, and V5), and other tags (e.g., biotin (small molecule), Strep tag (StrepII), SBP, biotin carboxyl carrier protein (BCCP), eXact, CBP, CYD, HPC, CBD intein-chitin binding domain, Trx, NorpA, and NusA).

[0241] In other embodiments, tags may also be selected from those disclosed in U.S. Patent Nos. 8,999,897; 8,357,511; 7,094,568; 5,011,912; 4,851,341; and 4,703,004; U.S. Patent Application Publication Nos. US2013115635 and US2013012687; and International Application Publication No. WO2013091661, the contents of each of which are incorporated herein by reference in their entirety.

[0242] In some embodiments, multiple protein tags may be used, either the same or different tags, and each tag may be located at the same N- or C-terminus, while in other cases the tags may be located at each terminus.

[0243] In some embodiments, protein tags of the present invention include, but are not limited to, any of the tags set forth in Table 8 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0244] Targeting Peptides In some embodiments, the effector module of the present invention may further comprise a targeting and / or penetrating peptide. Small targeting and / or penetrating peptides that selectively recognize cell surface markers (e.g., receptors, transmembrane proteins, extracellular matrix molecules) can be used to target the effector module to a desired organ, tissue, or cell. To home the effector module to a desired organ, tissue, and cell, and / or subcellular location, short peptides (5-50 amino acid residues) synthesized in vitro and natural peptides, or analogs, variants, or derivatives thereof, may be incorporated into the effector module.

[0245] In some embodiments, the effector module may include a targeting sequence and / or a penetrating peptide to drive the effector module to a target organ, tissue, or cell (e.g., a cancer cell). In other embodiments, the targeting peptide and / or penetrating peptide may direct the effector module to a specific subcellular location within a cell.

[0246] A targeting peptide can have any number of amino acids, from about 6 to about 30. The peptide can have 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 amino acids. Generally, a targeting peptide can have 25 or fewer amino acids, e.g., 20 or fewer, e.g., 15 or fewer amino acids.

[0247] Exemplary targeting peptides can include, but are not limited to, those disclosed in the art, for example, U.S. Pat. Nos. 9,206,231; 9,110,059; 8,706,219; and 8,772,449; and U.S. Application Publication Nos. 2016089447; 2016060296; 2016060314; 2016060312; 2016060311; 2016009772; 2016002613; 2015314011 and 2015166621; and International Application Publication Nos. WO2015179691 and WO2015183044, the contents of each of which are incorporated herein by reference in their entirety.

[0248] In some embodiments, targeting peptides of the present invention include, but are not limited to, any of those set forth in Table 9 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0249] Linker In some embodiments, the effector module of the present invention may further comprise a linker sequence. The linker region mainly functions as a spacer between two or more polypeptides in the effector module. As used herein, "linker" or "spacer" refers to a molecule or group of molecules that connects two molecules or two parts of a molecule, such as two domains of a recombinant protein.

[0250] In some embodiments, the term "linker" (L) or "linker domain" or "linker region" or "linker module" or "peptide linker" as used herein refers to an oligo- or polypeptide region of about 1-100 amino acids in length that connects any of the domains / regions of an effector module (also referred to as a peptide linker). The peptide linker may be 1-40 amino acids in length, 2-30 amino acids in length, 20-80 amino acids in length, or 50-100 amino acids in length. The length of the linker may be optimized based on the type of payload utilized and the crystal structure of the payload. In some instances, a shorter linker may be selected, preferably. In some embodiments, the peptide linker is composed of amino acids joined together by peptide bonds, preferably 1 to 20 amino acids joined by peptide bonds, where the amino acids are selected from the 20 naturally occurring amino acids: glycine (G), alanine (A), valine (V), leucine (L), isoleucine (I), serine (S), cysteine ​​(C), threonine (T), methionine (M), proline (P), phenylalanine (F), tyrosine (Y), tryptophan (W), histidine (H), lysine (K), arginine (R), aspartic acid (D), glutamic acid (E), asparagine (N), and glutamine (Q). As will be appreciated by those of skill in the art, one or more of these amino acids may be glycosylated. In some embodiments, the amino acids of the peptide linker may be selected from alanine (A), glycine (G), proline (P), asparagine (R), serine (S), glutamine (Q), and lysine (K).

[0251] In one embodiment, the artificially designed peptide linker preferably consists of a polymer of flexible residues, such as glycine (G) and serine (S), to allow adjacent protein domains to move freely relative to each other. Longer linkers may be used if it is desired to prevent two adjacent domains from interfering with each other. The selection of a particular linker sequence may affect the biological activity, stability, folding, targeting, and / or pharmacokinetic properties of the fusion construct. Examples of peptide linkers include: MH, SG, GGSG (SEQ ID NO: 822; encoded by the nucleotide sequence of SEQ ID NO: 823), GGSGG (SEQ ID NO: 629; encoded by any of the nucleotide sequences of SEQ ID NOs: 676 to 680), GGSGGG (SEQ ID NO: 824; encoded by any of the nucleotide sequences of SEQ ID NOs: 825 to 826), SGGGS (SEQ ID NO: 827; encoded by the nucleotide sequence of SEQ ID NOs: 828, 844, 909), GGSGGGSGG (SEQ ID NO: 829; encoded by the nucleotide sequence of SEQ ID NO: 830), GGGGG (SEQ ID NO: 831), GGGGS (SEQ ID NO: 832) or (GGGGS)n (n=1 (SEQ ID NO: 832), 2 (SEQ ID NO: 833), 3 (SEQ ID NO: 720, encoded by the nucleotide sequence of SEQ ID NOs: 910 to 915), 4 (SEQ ID NO: 83 4), 5 (SEQ ID NO: 835), or 6 (SEQ ID NO: 836)), SSSSG (SEQ ID NO: 837) or (SSSSG)n (n = 1 (SEQ ID NO: 837), 2 (SEQ ID NO: 838), 3 (SEQ ID NO: 839), 4 (SEQ ID NO: 840), 5 (SEQ ID NO: 841), or 6 (SEQ ID NO: 842)), SGGGSGGGGSGGGGSGGGGSGGGSLQ (SEQ ID NO: 802; encoded by the nucleotide sequence of SEQ ID NOs: 811, 916-920, 1002), EFSTEF (SEQ ID NO: 784; encoded by the nucleotide sequence of SEQ ID NOs: 792-793), GKSSGSGSESKS (SEQ ID NO: 845), GGSTSGSGKSSEGKG (SEQ ID NO: 846), GSTSGSGKSSSEGSGSTKG (SEQ ID NO: 847), GSTSGSGKPGSGEGSTKG (SEQ ID NO: 848), VDYPYDVPDYALD (SEQ ID NO: 849;Examples of suitable amino acid sequences include, but are not limited to, EGKSSGSGSESKEF (SEQ ID NO: 851), SGGGSGGGGSGGGGSGGGGGSGGGGSGGGSGGGS (SEQ ID NO: 921; encoded by SEQ ID NO: 923), SGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 922; encoded by SEQ ID NO: 924), GS (encoded by GGTTCC), SG (encoded by AGCGGC), GSG (encoded by GGATCCGGA or GGATCCGGT), or MLLLVTSLLLCELPHPAFLLIP (SEQ ID NO: 1031; encoded by SEQ ID NO: 1032);

[0252] In other examples, peptide linkers may be composed of a majority of amino acids that are sterically unhindered, such as glycine (G) and alanine (A). Exemplary linkers are polyglycine ((G) (SEQ ID NO: 1233), (G) (SEQ ID NO: 831), (G) (SEQ ID NO: 1234), etc.), poly(GA), and polyalanine. The linkers described herein are exemplary; linkers much longer and containing other residues are contemplated by the present invention.

[0253] The linker sequence may be a natural linker derived from a multidomain protein, which is a short peptide sequence that separates two different domains or motifs within a protein.

[0254] In some aspects, a linker may be flexible or rigid. In other aspects, a linker may be cleavable or non-cleavable. As used herein, the terms "cleavable linker domain or region" and "cleavable peptide linker" are used interchangeably. In some embodiments, a linker sequence may be cleaved enzymatically and / or chemically. Examples of enzymes (e.g., proteinases / peptidases) useful for cleaving peptide linkers include, but are not limited to, Arg-C proteinase, Asp-N endopeptidase, chymotrypsin, clostripain, enterokinase, factor Xa, glutamyl endopeptidase, granzyme B, Achromobacter proteinase I, pepsin, proline endopeptidase, proteinase K, Staphylococcal peptidase I, thermolysin, thrombin, trypsin, and members of the caspase family of proteolytic enzymes (e.g., caspases 1-10). Chemically sensitive cleavage sites may also be included in the linker sequence. Examples of chemical cleavage reagents include, but are not limited to, cyanogen bromide, which cleaves at methionine residues; N-chlorosuccinimide, iodobenzoic acid, or BNPS-skatole (2-(2-nitrophenylsulfenyl)-3-methylindole), which cleave at tryptophan residues; dilute acid, which cleaves at aspartyl-prolyl bonds; and aspartate-prophosphate cleavable recognition sites (i.e., cleavable peptide linkers containing one or more DP dipeptide moieties). Fusion modules can contain multiple regions encoding peptides of interest separated by one or more cleavable peptide linkers.

[0255] In other embodiments, the cleavable linker may be a "self-cleaving" linker peptide, such as a 2A linker (e.g., T2A), a 2A-like linker, or functional equivalents thereof, and combinations thereof. In some embodiments, the linker includes a picornavirus 2A-like linker, the CHYSEL sequence of porcine Teschovirus (P2A), Thosea asigna virus (T2A), or combinations, variants, and functional equivalents thereof. Other linkers will be apparent to those skilled in the art and may be used in connection with alternative embodiments of the present invention. In some embodiments, the biological circuit of the present invention may include a 2A peptide. The 2A peptide is a viral-derived sequence of approximately 20 amino acid residues that is recognized by a cellular endogenous protease (2A peptidase). The 2A peptide has been identified among picornaviruses, a typical example of which is the foot-and-mouth disease virus (Robertson BH, et al., J Virol 1985, 54:651-660). 2A-like sequences have also been found in picornaviruses, such as equine rhinitis A virus, as well as unrelated viruses such as porcine teschovirus-1 and insect Thosea asigna virus (TaV). In such viruses, multiple proteins are derived from a large polyprotein encoded by an open reading frame. The 2A peptide mediates cotranslational cleavage of this polyprotein at a single site that forms the junction between the viral capsid and replication polyprotein domains. 2A sequences contain the consensus motif DV / IEXNPGP (SEQ ID NO: 1235). These sequences are thought to act cotranslationally, preventing normal peptide bond formation between glycine and the final proline, resulting in ribosomal skipping of the subsequent codon (Donnelly ML et al. (2001). J Gen Virol, 82:1013-1025). After cleavage, a short peptide remains fused to the C-terminus of the protein upstream of the cleavage site, while a proline is added to the N-terminus of the protein downstream of the cleavage site.Of the 2A peptides identified to date, four are widely used: FMDV 2A (abbreviated herein as F2A), Equine Rhinitis Virus (ERAV) 2A (E2A), Porcine Teschovirus-1 2A (P2A), and Thoseaasigna Virus 2A (T2A). In some embodiments, 2A peptide sequences useful in the present invention are selected from SEQ ID NOs: 8-11 of International Patent Publication WO2010042490, the contents of which are incorporated by reference in their entirety.

[0256] As a non-limiting example, the P2A cleavable peptide may be GATNFSLLKQAGDVEENPGP (SEQ ID NO:925; encoded by SEQ ID NO:926).

[0257] The linker of the present invention may be a non-peptide linker. For example, an alkyl linker such as -NH-(CH)C(O)- (wherein a = 2 to 20) may be used. These alkyl linkers may be further substituted with any group that is not sterically hindered, such as lower alkyl (e.g., C-C), lower acyl, halogen (e.g., Cl, Br), CN, NH, or phenyl.

[0258] In some embodiments, the linker may be an artificial linker of U.S. Pat. Nos. 4,946,778; 5,525,491; 5,856,456; and International Patent Publication No. WO2012 / 083424, the contents of each of which are incorporated herein by reference in their entirety.

[0259] In some embodiments, linkers of the present invention include, but are not limited to, any of those shown in Table 11 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0260] In one embodiment, the linker may be a spacer region of one or more nucleotides. Non-limiting examples of spacers are TCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO: 927), TATGGCCACAACCATG (SEQ ID NO: 928), AATCTAGATAATACGACTCACTAGAGATCC (SEQ ID NO: 929), GCTTGCCACAACCCACAAGGAGACGACCTTCC (SEQ ID NO: 1000), TCGCGAATG, or TCGCGA.

[0261] In one embodiment, the linker may be a BamHI site. As a non-limiting example, a BamHI site has the amino acid sequence GS and / or the DNA sequence GGATCC.

[0262] Implanted stimuli, signals, and other regulatory properties In some embodiments, the effector modules of the present invention may further comprise one or more microRNAs, microRNA-binding sites, promoters, and tunable elements. In one embodiment, microRNAs may be used to assist in the creation of tunable biological circuits. Each aspect or tunable modality may provide differentially tuned properties to the effector module or biological circuit. For example, a destabilization domain may alter the cleavage site, dimerization properties, or half-life of the payload, while the inclusion of one or more microRNAs or microRNA-binding sites may confer cellular detargeting or transport properties. As a result, the present invention encompasses biological circuits that are multifactorial in their sustainability. Such biological circuits and effector modules may be designed to include one, two, three, four, or more tunable properties.

[0263] In some embodiments, microRNA sequences of the present invention include, but are not limited to, any of the sequences set forth in Table 13 of co-pending, co-owned U.S. Provisional Patent Application No. 62 / 320,864, filed April 11, 2016, or U.S. Provisional Application No. 62 / 466,596, filed March 3, 2017, and International Publication No. WO2017 / 180587, the contents of each of which are incorporated herein by reference in their entirety.

[0264] In some embodiments, the compositions of the present invention may include any proteasome adaptor. As used herein, the term "proteasome adaptor" refers to any nucleotide / amino acid sequence that targets an attached payload for degradation. In some aspects, the adaptor directly targets the payload for degradation, thereby bypassing the need for ubiquitination. Proteasome adaptors may also be used in combination with a destabilization domain to reduce basal expression of the payload. Exemplary proteasome adaptors include the UbL domain of Rad23 or hHR23b, and gankyrin, a protein that binds with high affinity to both the target protein Rb and the S4 subunit of the proteasome, HPV E7, and Rb, as well as the proteasome subunit S6, allowing direct proteasome targeting and bypassing the ubiquitination machinery.

[0265] Polynucleotides The terms "polynucleotide" or "nucleic acid molecule," in their broadest sense, include any compound and / or substance comprising a polymer of nucleotides, e.g., linked nucleosides. These polymers are often referred to as polynucleotides. Exemplary nucleic acids or polynucleotides of the invention include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA, LNA with a β-D-ribo configuration, α-LNA with an α-L-ribo configuration (a diastereomer of LNA), 2'-amino-LNA with a 2'-amino functionalization, and 2'-amino-α-LNA with a 2'-amino functionalization), or hybrids thereof.

[0266] In some embodiments, the polynucleotide of the present invention may be messenger RNA (mRNA) or any nucleic acid molecule, which may or may not be chemically modified. In one aspect, the nucleic acid molecule is mRNA. As used herein, the term "messenger RNA (mRNA)" refers to a nucleic acid molecule that encodes a polypeptide of interest and is translated into It refers to any polynucleotide that is capable of producing the encoded polypeptide of interest in vitro, in vivo, in situ or ex vivo.

[0267] Traditionally, the basic components of an mRNA molecule include at least a coding region, a 5' UTR, a 3' UTR, a 5' cap, and a polyA tail. Based on this wild-type modular structure, the present invention expands the scope of functionality of conventional mRNA molecules by providing payload constructs that maintain the modular organization but contain one or more structural and / or chemical modifications or alterations that confer useful properties to the polynucleotide, such as durability of function. As used herein, a "structural" property or modification is a property or modification that inserts, deletes, duplicates, inverts, or randomizes two or more linked nucleoside residues in a polynucleotide without significant chemical modification to the nucleosides themselves. Because structural modifications necessarily disrupt and rearrange chemical bonds to alter the structure, they are chemical in nature and therefore chemical modifications. However, structural modifications can result in different nucleotide sequences. For example, the polynucleotide "ATCG" can be chemically modified to "AT-5meC-G." The same polynucleotide can be structurally modified from "ATCG" to "ATCCCG." In this case, the dinucleotide "CC" is inserted, resulting in a structural modification of the polynucleotide.

[0268] In some embodiments, polynucleotides of the present invention may possess a 5' UTR sequence that plays a role in translation initiation. The 5' UTR sequence may contain features such as a Kozak sequence, which is commonly known to be involved in the process by which ribosomes initiate gene translation. The Kozak sequence has the consensus sequence XCCR(A / G)CCAUG, where R, three bases upstream of the initiation codon (AUG), is a purine (adenine or guanine), and X is any nucleotide. In one embodiment, the Kozak sequence is ACCGCC. By modifying features commonly found in abundantly expressed genes in target cells or tissues, the stability and protein production of polynucleotides of the present invention can be enhanced.

[0269] Additionally, polynucleotides are provided that may contain an internal ribosome entry site (IRES), which plays an important role in initiating protein synthesis when a 5' cap structure is not present on the polynucleotide. The IRES may function as the sole ribosome binding site or as one of multiple binding sites. Polynucleotides of the invention that contain two or more functional ribosome binding sites may encode several peptides or polypeptides that are independently translated by ribosomes, resulting in bicistronic and / or multicistronic nucleic acid molecules.

[0270] In some embodiments, the polynucleotides encoding the biological circuits, effector modules, SREs, and payloads of interest, e.g., immunotherapeutics, are from about 30 to about 100,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30-50,000, 30-7 0,000, 100-250, 100-500, 100-1,000, 100-1,500, 100-3,000, 100-5,000, 100-7,000, 100-10,000, 100-25,000, 100-50,000, 100-70,000, 100-100,000, 500-1,000, 500-1,500, 500-2,000, 500-3,000, 500-5,000, 500-7,000, 500-10,000 00, 500-25,000, 500-50,000, 500-70,000, 500-100,000, 1,000-1,500, 1,000-2,000, 1,000-3,000, 1,000-5,000, 1,000-7,000, 1,000-10,000, 1,000-25,000, 1,000-50,000, 1,000-70,000, 1,000-100,000, 1,500-3,000, 1,500-5,000 In some embodiments, polynucleotides of the invention may comprise more than 10,000 nucleotides.

[0271] The region of the polynucleotide encoding a particular feature, e.g., a cleavage site, linker, transport signal, tag, or other feature, can independently be 10 to 1,000 nucleotides in length (e.g., 20, 30, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 6000, 7000, 8000, 9000, 10 ... , 700, 800, and 900 nucleotides or more, or at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, and 1,000 nucleotides).

[0272] In some embodiments, polynucleotides of the present invention may further comprise an embedded regulatory moiety, such as a microRNA-binding site, within the 3' UTR of the nucleic acid molecule, which downregulates gene expression by reducing the stability of the nucleic acid molecule upon binding to the microRNA molecule or by inhibiting translation. Conversely, for purposes of polynucleotides of the present invention, microRNA-binding sites can be modified (i.e., removed) from their native sequences to increase protein expression in specific tissues. For example, miR-142 and miR-146 binding sites may be removed to improve protein expression in immune cells. In some embodiments, any of the encoded payloads may be regulated by an SRE and then combined with one or more regulatory sequences to generate dual- or multi-regulated effector modules or biological circuits.

[0273] In some embodiments, polynucleotides of the invention may encode fragments, variants, or derivatives of polypeptides of the invention. In some aspects, variant sequences may retain the same or similar activity. Alternatively, variants may have altered (e.g., increased or decreased) activity relative to the starting sequence. Generally, variants of a particular polynucleotide or polypeptide of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, but less than 100% sequence identity to a particular reference polynucleotide or polypeptide, as determined by sequence alignment programs and parameters described herein and known to those of skill in the art. Such alignment tools include the BLAST suite of tools (Stephen et al., Gapped BLAST and PSI-BLAST: a new generation of protein databases). search programs, Nucleic Acids Res., 1997, 25:3389-3402).

[0274] In some embodiments, polynucleotides of the invention may be modified. As used herein, the term "modified," or, where appropriate, "modification," refers to a chemical modification to an A, G, U (T in DNA), or C nucleotide. Modifications may be on the nucleoside base and / or sugar moiety of a nucleoside contained in a polynucleotide. In some embodiments, a modified nucleic acid or one or more individual nucleosides or nucleotides includes multiple modifications. For example, a modification to a nucleoside may include one or more modifications to the nucleoside base and sugar. Modifications to polynucleotides of the invention may include, for example, any of the modifications set forth in International Publication No. WO2013052523, the contents of which are incorporated herein by reference in their entirety.

[0275] As used herein, a "nucleoside" is defined as a compound comprising a sugar molecule (e.g., pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as a "nucleobase"). As used herein, a "nucleotide" is defined as a nucleoside that comprises a phosphate group.

[0276] In some embodiments, modifications may be made to the internucleoside linkage (e.g., the phosphate backbone). As used herein, the terms "phosphate" and "phosphodiester" are used interchangeably with respect to the polynucleotide backbone. The backbone phosphate group can be modified by replacing one or more oxygen atoms with alternative substituents. Additionally, modified nucleosides and nucleotides can include extensive replacement of the unmodified phosphate moiety with alternative internucleoside linkages. Examples of modified phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates replace both non-linking oxygens with sulfur. Phosphate linkers can also be modified by replacing linking oxygens with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates). Other modifications that may be used are set forth, for example, in International Application No. WO2013052523, the contents of which are incorporated herein by reference in their entirety.

[0277] Chemical modifications and / or substitutions of nucleotides or nucleic acid bases of the polynucleotides of the present invention useful in the present invention include any modified substitutions known in the art, such as (±)1-(2-hydroxypropyl)pseudouridine TP, (2R)-1-(2-hydroxypropyl)pseudouridine TP, 1-(4-methoxy-phenyl)pseudo-UTP, 2'-O-dimethyl adenosine, 1,2'-O-dimethyl guanosine, 1,2'-O-dimethyl inosine, 1-hexyl-pseudo-UTP, 1-homoallylpseudouridine TP, 1-hydroxymethylpseudouridine TP, 1-isopropyl-pseudo-UTP, and 1-Me-2-thio-pseudo-UTP. , 1-Me-4-thio-pseudo-UTP, 1-Me-α-thio-pseudo-UTP, 1-Me-GTP, 2'-amino-2'-deoxy-ATP, 2'-amino-2'-deoxy-CTP, 2'-amino-2'-deoxy-GTP, 2'-amino-2'-deoxy-UTP, 2'-azido-2'-deoxy-ATP, tubercidin, incompletely modified hydroxywybutosine, uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, wybutosine, wyosine, xanthine, xanthosine-5'-TP, xyloadenosine, zebularine, α-thio-adenosine, α-thio-cytidine, α-thio-guanosine, and / or α-thio-uridine.

[0278] Polynucleotides of the present invention may contain one or more modifications as set forth herein. Different sugar modifications, base modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures) may be present at various positions in polynucleotides of the present invention. Those skilled in the art will understand that nucleotide analogs or other modification(s) may be placed at any position(s) of a polynucleotide so long as the function of the polynucleotide is not substantially diminished. Modifications may be 5' or 3' terminal modifications. Polynucleotides may be from about 1% to about 100% (in terms of overall nucleotide content, or in terms of one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intermediate percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 10 ... The modified nucleotides may be from 20% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%.

[0279] In some embodiments, expression of the SRE may be modulated by replacing one or more codons in the polynucleotides of the invention with other codons that encode naturally occurring amino acid sequences through a process called codon selection. Because mRNA codon and tRNA anticodon pools tend to differ across organisms, cell types, subcellular locations, and over time, the codon selection described herein is spatiotemporal (ST) codon selection.

[0280] In some embodiments of the present invention, certain polynucleotide features may be codon-optimized. Codon optimization refers to the process of modifying a nucleic acid sequence by replacing at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 50, or more codons of the native sequence with the codons most frequently used in the host cell's genes, while maintaining the native amino acid sequence, to enhance expression in the host cell. Codon usage may be measured using the codon adaptation index (CAI), which measures the deviation of a coding polynucleotide sequence from a reference gene set. Codon usage tables are available at the Codon Usage Database (http: / / www.kazusa.or.jp / codon / ), and CAI can be calculated using the EMBOSS CAI program (http: / / emboss.sourceforge.net / ). Codon optimization methods are known in the art and can be useful in attempts to achieve one or more of several goals. These goals include matching codon frequencies between the target and host organisms to ensure proper folding, biasing nucleotide content to alter stability or reduce secondary structure, minimizing tandem repeat codons or base runs that may impair gene assembly or gene expression, customizing transcriptional and translational control regions, inserting or removing protein signal sequences, removing / adding sites for post-translational modification of the encoded protein (e.g., glycosylation sites), adding, removing, or shuffling protein domains, inserting or deleting restriction enzyme sites, altering ribosome binding and degradation sites, adjusting translation rates to allow for proper folding of various domains of the protein, or reducing or eliminating problematic secondary structure within the polynucleotide. Codon optimization tools, algorithms, and services are known in the art and include, by way of non-limiting example, algorithms such as those from GeneArt (Life Technologies), DNA2.0 (Menlo Park, CA), OptimumGene (GenScript, Piscataway, NJ), DNAWorks v3.2.3, and / or patented methods.In one embodiment, the polynucleotide sequence, or portion thereof, is codon-optimized using an optimization algorithm. Codon choices for each amino acid are well known in the art, as are tables for various species to optimize expression in that particular species.

[0281] In some embodiments of the present invention, certain polynucleotide features may be codon-optimized. For example, preferred regions for codon optimization may be upstream (5') or downstream (3') of the polypeptide-encoding region. These regions may be incorporated into the polynucleotide before and / or after codon optimization of the payload-encoding region or open reading frame (ORF).

[0282] After optimization (if desired), the polynucleotide components are reconstituted and converted into vectors, including but not limited to, plasmids, viruses, cosmids, and artificial chromosomes.

[0283] Because codon composition determines the translation rate and stability of an mRNA species, spatiotemporal codon selection can affect the expression of the polynucleotides of the present invention. For example, tRNA anticodons for optimized codons are abundant, and therefore translation may be enhanced. In contrast, tRNA anticodons for less common codons are scarce, and therefore translation may proceed at a slower rate. Presnyak et al. have shown that the stability of mRNA species depends on the codon content, and that by utilizing optimized codons, greater stability and therefore higher protein expression can be achieved (Presnyak et al. (2015) Cell 160, 1111-1124; the contents of which are incorporated herein by reference in their entirety). Thus, in some embodiments, ST codon selection includes the selection of optimized codons, which may enhance expression of the SRES, effector modules, and biological circuits of the present invention. In other embodiments, spatiotemporal codon selection may include the selection of codons that are less commonly used in host cell genes, thereby reducing expression of the compositions of the present invention. The ratio of optimized codons to codons less commonly used in the host cell's genes may also be altered to modulate expression.

[0284] In some embodiments, certain regions of a polynucleotide may be preferred for codon selection. For example, preferred regions for codon selection may be upstream (5') or downstream (3') of the region encoding the polypeptide. These regions may be incorporated into the polynucleotide before and / or after the codon selection of the region encoding the payload or open reading frame (ORF).

[0285] The stop codons of polynucleotides of the invention may be modified to include sequences and motifs for altering the expression levels of the SREs, payloads, and effector modules of the invention. Such sequences may be incorporated to induce stop codon readthrough, which may specify an amino acid, for example, selenocysteine ​​or pyrrolysine. In other examples, the stop codon may be skipped entirely, resuming translation via an alternative open reading frame. Stop codon readthrough may be used to adjust expression of components of the effector module at specific ratios (e.g., as dictated by the context of the stop codon). Examples of preferred stop codon motifs include UGAN, UAAN, and UAGN, where N is either C or U. Modification and manipulation of polynucleotides can be accomplished by methods known in the art, including, but not limited to, site-directed mutagenesis and recombinant techniques. The resulting modified molecules may then be tested for activity using in vitro or in vivo assays, such as those described herein or any other suitable screening assay known in the art.

[0286] In some embodiments, polynucleotides of the invention may contain two or more effector module sequences, or two or more payload sequences of interest, repeated once, twice, or more than three times in a pattern such as ABABAB or AABBABBAABB or ABCABCABC or variants thereof, where each letter A, B, or C represents a different effector module component.

[0287] In yet another embodiment, the polynucleotide of the present invention may comprise sequences of two or more effector module components, each component having one or more SRE sequences (DD sequences) or two or more payload sequences. As a non-limiting example, the sequence may be a pattern such as ABABAB, AABBABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times in each region. As another non-limiting example, the sequence may be a pattern such as ABABAB, AABBABBAABB, or ABCABCABC, or variants thereof, repeated once, twice, or more than three times throughout the polynucleotide. In these patterns, each letter A, B, or C represents a different sequence or component.

[0288] According to the present invention, polynucleotides encoding separate biological circuits, effector modules, SREs, and payload constructs may be linked together via their 3' ends using nucleotides modified at the 3' end. Chemical linkages may be used to control the stoichiometry of delivery to cells. Polynucleotides can be designed to bind to other polynucleotides, dyes, intercalating agents (such as acridine), crosslinkers (such as psoralens and mitomycin C), porphyrins (such as TPPC4, texaphyrin, and sapphyrin), polycyclic aromatic hydrocarbons (such as phenazine and dihydrophenazine), artificial endonucleases (such as EDTA), alkylating agents, phosphate, amino, mercapto, PEG (such as PEG-40K), MPEG, (MPEG)2, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (such as biotin), transport / absorption enhancers (e.g., aspirin, vitamin E, and folic acid), synthetic ribonucleases, proteins, such as glycoproteins, or peptides, e.g., molecules with specific affinity for co-ligands, or antibodies, e.g., antibodies that bind to specific cell types such as cancer cells, endothelial cells, and bone cells, hormones and hormone receptors, non-peptide species, such as lipids, lectins, carbohydrates, vitamins, cofactors, or drugs. As a non-limiting example, they may be complexes with other immunoconjugates.

[0289] In some embodiments, polynucleotide compositions of the invention may be generated by combining various components of an effector module using the Gibson assembly method. The Gibson assembly reaction consists of three isothermal reactions, each relying on a different enzymatic activity: a 5' exonuclease to generate long overhangs, a polymerase to fill gaps in annealed single-stranded regions, and a DNA ligase to seal nicks in the annealed and filled gaps. Gibson assembly is preceded by a polymerase chain reaction, which is used to generate PCR products with overlapping sequences. These methods can be repeated in sequence to assemble larger molecules. For example, this method may involve repeating the above method to join a second set of two or more DNA molecules of interest, then repeating the method again to join the first and second sets of DNA molecules of interest. At any stage during these multiple assembly rounds, the assembled DNA can be amplified by transformation into an appropriate microorganism, or the DNA can be amplified in vitro (e.g., using PCR).

[0290] In some embodiments, a polynucleotide of the invention may encode a fusion polypeptide comprising a destabilization domain (DD) and at least one immunotherapeutic agent described herein. The DD domain may be an FKBP mutant encoded by the nucleotide sequence of SEQ ID NOs: 684-686, 688-691, 987-989, 994, 1013, and / or 1028, an ecDHFR mutant encoded by the nucleotide sequence of SEQ ID NOs: 687, 692, 772, 798, 814-815, 988, 991, and / or 993, or an hDHFR mutant encoded by the nucleotide sequence of SEQ ID NOs: 693-700, 773, 852-857, and / or 934-980, and / or 995-998.

[0291] In some embodiments, a polynucleotide of the invention may encode an effector module comprising a CD19 CAR as a payload having the nucleotide sequence of SEQ ID NOs: 701-715 and / or 1019-1042, or an IL12 as a payload having the nucleotide sequence of SEQ ID NOs: 774-782, or an IL15 as a payload having the nucleotide sequence of SEQ ID NOs: 749, 799-800, and / or 1055-1056, or an IL15 / IL15Ra fusion polypeptide as a payload having the nucleotide sequence of SEQ ID NOs: 816-821, 1086-1089, 1091-1095, 1098-1111, 1120, and / or 1123.

[0292] cell In accordance with the present invention, there are provided cells genetically engineered to express at least one biological circuit, SRE (e.g., DD), effector module, and immunotherapeutic agent of the present invention. Cells of the present invention include, but are not limited to, immune cells, stem cells, and tumor cells. In some embodiments, immune cells are CD8 + T cells and CD4 + Immune effector cells include, but are not limited to, T cells such as T cells (e.g., Th1, Th2, Th17, Foxp3+ cells), memory T cells, e.g., T memory stem cells, central memory T cells, and effector memory T cells, terminally differentiated effector T cells, natural killer (NK) cells, NK T cells, tumor-infiltrating lymphocytes (TILs), cytotoxic T lymphocytes (CTLs), regulatory T cells (Tregs), and dendritic cells (DCs), other immune cells capable of eliciting effector function, or mixtures thereof. T cells may be Tαβ cells and Tγδ cells. In some embodiments, stem cells may be derived from human embryonic stem cells, mesenchymal stem cells, and neural stem cells. In some embodiments, T cells may be endogenous T cell receptor depleted (see U.S. Patent Nos. 9,273,283; 9,181,527; and 9,028,812; the contents of each of which are incorporated herein by reference in their entirety).

[0293] In some embodiments, the cells of the present invention may be autologous, allogeneic, syngeneic, or xenogeneic with respect to a particular individual subject.

[0294] In some embodiments, the cells of the invention may be mammalian cells, particularly human cells. The cells of the invention may be primary cells or immortalized cell lines.

[0295] In some embodiments, the cells of the present invention may contain growth factors as a payload to induce cell proliferation and expansion. Exemplary payloads include RAS such as KRAS, NRAS, RRAS, RRAS2, MRAS, ERAS, and HRAS, DIRAS such as DIRAS1, DIRAS2, and DIRAS3, NKIRAS such as NKIRAS1 and NKIRAS2, RAL such as RALA and RALB, RAP such as RAP1A, RAP1B, RAP2A, RAP2B, and RAP2C, RASD such as RASD1 and RASD2, RASL such as RASL10A, RASL10B, RASL11A, RASL11B, and RASL12, REM such as REM1 and REM2, GEM, RERG, RERGL, and RRAD.

[0296] Artificial immune cells can be achieved by transducing a cell composition with a polypeptide, effector module, SRE, and / or payload of interest (i.e., immunotherapeutic agent), or a polynucleotide encoding the polypeptide, or a vector containing the polynucleotide. The vector may be a viral vector, such as a lentiviral vector, a gammaretroviral vector, a recombinant AAV, an adenoviral vector, or an oncolytic viral vector. In other aspects, non-viral vectors, such as nanoparticles and liposomes, may also be used. In some embodiments, immune cells of the present invention may be genetically engineered to express at least one immunotherapeutic agent of the present invention that can be regulated using a stimulus. In some examples, two, three, or more immunotherapeutic agents constructed in the same biological circuit and effector module are introduced into the cell. In other examples, two, three, or more biological circuits and effector modules, each containing an immunotherapeutic agent, may be introduced into the cell.

[0297] In some embodiments, the immune cells of the present invention may be T cells engineered to express an antigen-specific T cell receptor (TCR) or an antigen-specific chimeric antigen receptor (CAR) (known as a CAR T cell). Accordingly, at least one polynucleotide encoding a CAR system (or TCR) described herein, or a vector containing such a polynucleotide, is introduced into T cells. T cells expressing a CAR or TCR bind to a specific antigen via the extracellular targeting portion of the CAR or TCR, thereby transmitting a signal to the T cell via the intracellular signaling domain(s), thereby activating the T cell. Activated CAR T cells change their behavior, including releasing cytotoxic cytokines (e.g., tumor necrosis factor and lymphotoxin), increasing cell proliferation rates, and altering cell surface molecules. Such changes lead to the destruction of target cells expressing the antigen recognized by the CAR or TCR. Furthermore, the release of cytokines or alterations in cell surface molecules stimulate other immune cells, such as B cells, dendritic cells, NK cells, and macrophages.

[0298] The CAR introduced into T cells may be a first-generation CAR containing only the intracellular signaling domain derived from TCR CD3ζ, a second-generation CAR containing the intracellular signaling domain derived from TCR CD3ζ and a costimulatory signaling domain, a third-generation CAR containing the intracellular signaling domain derived from TCR CD3ζ and two or more costimulatory signaling domains, a split CAR system, or an on / off switch CAR system. In one example, the expression of the CAR or TCR is controlled by a destabilization domain (DD), such as an hDHFR variant, of the effector module of the present invention. The presence or absence of an hDHFR-binding ligand, such as TMP, is used to regulate the expression of the CAR or TCR in transduced T cells or NK cells.

[0299] In some embodiments, the CAR T cells of the invention may be further engineered to express one, two, three, or more additional immunotherapeutic agents. The immunotherapeutic agents may be another CAR or TCR specific for a different target molecule; a cytokine such as IL2, IL12, IL15, and IL18, or a cytokine receptor such as IL15Ra; a chimeric switch receptor that converts an inhibitory signal into a stimulatory signal; a homing receptor that directs adoptively transferred cells to a target site such as tumor tissue; a drug that optimizes immune cell metabolism; or a safety switch gene (e.g., a suicide gene) that kills activated T cells if a severe event is observed after adoptive cell transfer or if the transferred immune cells are no longer needed. These molecules may be included in the same effector module or in separate effector modules.

[0300] In one embodiment, the CAR T cells (including TCR T cells) of the present invention may be "armed" CAR T cells transformed with an effector module comprising a CAR and an effector module comprising a cytokine. Active cytokines, either inducibly or constitutively secreted, further arm the CAR T cells, improving their potency and persistence. In this context, such CAR T cells are also referred to as "armed CAR T cells." The "protective" molecule may be selected based on the tumor microenvironment and other elements of the innate and adaptive immune systems. In some embodiments, the molecule may be a stimulatory factor, such as IL2, IL12, IL15, IL18, type I IFN, CD40L, and 4-1BBL, which have been shown to further enhance the potency and persistence of CAR T cells in the face of a hostile tumor microenvironment through different mechanisms (Yeku et al., Biochem Soc Trans., 2016, 44(2):412-418).

[0301] In some embodiments, armed CAR T cells of the invention are engineered to express a CD19 CAR and IL12. Such T cells, after CAR-mediated activation in tumors, release inducible IL12, enhancing T cell activation and attracting and activating innate immune cells to eliminate CD19-negative cancer cells.

[0302] In one embodiment, a T cell of the invention may be engineered to express an effector module comprising a CAR and an effector module comprising a suicide gene.

[0303] In one embodiment, the CAR T cells (including TCR T cells) of the present invention may be transformed with an effector module comprising a cytokine and a safety switch gene (e.g., a suicide gene). The suicide gene may be an inducible caspase, such as caspase 9, that induces apoptosis when activated by extracellular stimuli in the biological circuitry. Such induced apoptosis eliminates the transfected cells as needed, reducing the risk of direct toxicity and uncontrolled cell proliferation.

[0304] In some embodiments, the immune cells of the present invention may be NK cells modified to express an antigen-specific T cell receptor (TCR) or antigen-specific chimeric antigen receptor (CAR) as described herein.

[0305] Natural killer (NK) cells are members of the innate lymphoid cell family and are characterized in humans by the expression of the phenotypic marker CD56 (neural cell adhesion molecule) in the absence of CD3 (T cell co-receptor). NK cells are potent effector cells of the innate immune system that mediate cytotoxic attack without the need for prior antigen priming and form the first line of defense against diseases such as cancer malignancies and viral infections.

[0306] Several preclinical and clinical studies have shown that adoptive transfer of NK cells is a promising therapeutic approach for cancers such as acute myeloid leukemia (Ruggeri et al. al., Science; 2002, 295: 2097-2100; and Geller ( et al., Immunotherapy, 2011, 3:1445-1459). Adoptive transfer of NK cells expressing CARs, such as DAP12-based activated CARs, has demonstrated improved tumor cell eradication (Topfer et al., J Immunol. 2015;194:3201-3212). NK cells engineered to express a CS-1-specific CAR also demonstrated enhanced cytolysis and interferon-γ (IFN-γ) production in multiple myeloma (Chu et al., Leukemia, 2014, 28(4):917-927).

[0307] NK cell activation is characterized by a series of receptors with activating and inhibitory functions. Key activating receptors on NK cells include CD94 / NKG2C and NKG2D (C-type lectin-like receptors) and the natural cytotoxicity receptors (NCRs) NKp30, NKp44, and NKp46, which recognize ligands on tumor cells or virus-infected cells. NK cell inhibition is essentially mediated by the interaction of polymorphic inhibitory killer cell immunoglobulin-like receptors (KIRs) with their cognate human leukocyte antigen (HLA) ligands via the α-1 helix of the HLA molecule. The balance of signals generated by activating and inhibitory receptors primarily determines immediate cytotoxic activation.

[0308] NK cells can be isolated from peripheral blood mononuclear cells (PBMCs) or derived from human embryonic stem (ES) cells and induced pluripotent stem cells (iPSCs). Primary NK cells isolated from PBMCs can be further expanded for adoptive immunotherapy. Strategies and protocols useful for expanding NK cells can include interleukin 2 (IL2) stimulation and the use of autologous feeder cells or the use of genetically modified allogeneic feeder cells. In some embodiments, NK cells can be selectively expanded with a combination of stimulatory ligands including IL15, IL21, IL2, 41BBL, IL12, IL18, MICA, 2B4, LFA-1, and BCM1 / SLAMF2 (see, e.g., U.S. Patent Publication No. US20150190471).

[0309] Immune cells expressing effector modules containing CAR and / or other immunotherapeutic agents can be used as cancer immunotherapies. Immunotherapies include cells expressing CAR and / or other immunotherapeutic agents as active ingredients, and may further include suitable excipients. Examples of excipients include the pharmaceutically acceptable excipients described above, including various cell culture media and isotonic sodium chloride.

[0310] In some embodiments, the cells of the invention may be dendritic cells genetically modified to express the compositions of the invention. Such cells may be used as cancer vaccines.

[0311] Methods for developing and characterizing CD19 antibodies In some embodiments, the present invention provides methods for producing CD19 antibodies, antibody fragments, or variants. Such methods may include: (1) preparing a composition comprising CD19, (2) contacting a library of antibodies or antibody fragments or variants with the composition, and (3) identifying one or more CD19 antibodies. Also provided herein are methods for identifying CD19 antibodies, antibody fragments, or variants distinct from FMC63.

[0312] In some embodiments, the present invention provides methods for identifying CD19 scFv. Such methods may include screening a phagemid library for CD19 scFv. Phagemid libraries expressing recombinant scFvs associated with the surface of bacteria or bacteriophage are useful in the present invention. Phagemid libraries may be generated by PCR amplification of polynucleotides encoding the heavy and kappa light chains of immunoglobulin IgM and infecting Cre recombinase-positive bacteria with vectors containing the PCR products at a high multiplicity of infection (MOI). A high MOI results in bacteria containing multiple phagemids, each encoding a different VH and VL gene, which are recombined again by Cre recombinase. Libraries that can be generated by recombination can be approximately 10 8 In some examples, a library of CD19 scFvs formatted into a chimeric antigen receptor construct may be screened to identify a CD19 scFv useful in the present invention.

[0313] In some embodiments, scFv immunologically specific to CD19 may be identified using cells that ectopically express full-length, fragments, or portions of CD19. Cell lines with low endogenous CD19 expression may be selected for ectopically expressing CD19. In some embodiments, CD19 may be a naturally occurring isoform of human CD19.

[0314] In some embodiments, a fusion protein (CD19sIg) comprising the extracellular domain of CD19 (i.e., exons 1 to 4) fused to the Fc region of human IgG1 is used to identify CD19-specific scFvs. Such a fusion protein is described in Oliveira et al. (2013) Journal of Translational Biology. Medicine 11:23; the contents of which are incorporated herein by reference in their entirety.

[0315] Also provided herein are methods for identifying scFvs distinct from FMC63, including scFvs that are immunologically specific for and bind to epitopes of the CD19 antigen that are different from or dissimilar to the epitope of the CD19 antigen bound by FMC63. In some embodiments, scFvs distinct from FMC63 are identified by screening an scFv library with a complex consisting of human CD19 bound to FMC63. CD19 of rhesus monkeys (Macaca mulatta), referred to herein as rhesus CD19, shares 88% homology with human CD19. Despite this high degree of homology, rhesus CD19 is not recognized by FMC63, indicating that the FMC63 epitope resides in a region of human CD19 that is non-homologous to rhesus CD19. Thus, in some embodiments, rhesus CD19 may be used to screen an scFv library for scFvs distinct from FMC63. Previously, mutations in regions of rhesus CD19 that are non-homologous to human CD19 have been used to identify residues in human CD19 that confer binding to FMC63 (Sommermeyer et al. (2017) Leukemia Feb 16. doi:10.1038 / leu.2017.57). In some embodiments, the mutational analysis described by Sommermeyer et al. may be used to design human CD19 variants that are unable to bind to FMC63. Such variants may include human CD19(H218R, A237D, M243V, E244D, P250T) and human CD19(H218R, A237D) and may be used to screen scFv libraries for scFvs distinct from FMC63. Sotillo et al. identified a splice variant of human CD19 lacking exon 2 in cancer patients (Sotillo et al. (2015) Cancer Discov. 2015 Dec;5(12):1282-95). Splice variants lacking exon 2 are not recognized by FMC63 and may be used to screen scFv libraries for scFvs distinct from FMC63.

[0316] CD19 IgG fusion molecules generated by fusing the Fc region of human IgG1 with the complete human CD19 extracellular domain, i.e., exons 1 to 4 (CD19sIgG1-4), or the extracellular domain lacking exon 2, i.e., exons 1, 3, and 4 (CD19sIgG1, 3, 4), may be used to screen scFv libraries for scFvs distinct from FMC63.

[0317] CD19 proteins, variants and mutants useful in the present invention are provided in Table 14. [Table 14-1] [Table 14-2] [Table 14-3]

[0318] III. Pharmaceutical Compositions and Formulations The present invention further provides pharmaceutical compositions comprising one or more biological circuits, effector modules, SREs (e.g., DDs), stimulatory and targeting payloads (i.e., immunotherapeutics), vectors, cells and other components of the present invention, and optionally at least one pharmaceutically acceptable excipient or inactive ingredient.

[0319] As used herein, the term "pharmaceutical composition" refers to a preparation containing the biological circuits, SREs, stimulatory and intended payloads (i.e., immunotherapeutic agents) described herein, other components, vectors, cells, or pharmaceutically acceptable salts thereof, and optionally other chemical components, such as physiologically suitable carriers or excipients. Pharmaceutical compositions of the present invention comprise an effective amount of one or more active compositions of the present invention. The preparation of pharmaceutical compositions containing at least one composition of the present invention and / or additional active ingredients will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990, incorporated herein by reference.

[0320] The term "excipient" or "inactive ingredient" refers to an inactive substance added to pharmaceutical compositions and formulations to further facilitate administration of an active ingredient. For purposes of this disclosure, the phrase "active ingredient" generally refers to any one or more biological circuits, effector modules, SREs, stimulatory and target payloads (i.e., immunotherapeutics), other components, vectors, and delivered cells, as described herein. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that do not elicit adverse, allergic, or other untoward reactions when appropriately administered to an animal, e.g., a human.

[0321] In some embodiments, pharmaceutical compositions and formulations are administered to humans, human patients, or subjects. Although the description of pharmaceutical compositions provided herein is primarily directed to pharmaceutical compositions suitable for administration to humans, those skilled in the art will understand that such compositions are generally suitable for administration to any other animal, such as non-human animals, for example, non-human mammals. The intended subjects for administration of pharmaceutical compositions include, but are not limited to, agricultural animals such as cows, horses, chickens, and pigs, domestic animals such as cats and dogs, or non-human mammals, including research animals such as mice, rats, rabbits, dogs, and non-human primates. It will be understood that for administration to humans, preparations must meet the sterility, pyrogenicity, general safety, and purity standards required by the FDA Office of Biological Standards.

[0322] Pharmaceutical compositions and formulations according to the invention may be prepared, packaged, and / or sold in bulk as a single unit dose and / or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of a pharmaceutical composition comprising a predetermined amount of an active ingredient. The amount of the active ingredient is generally equal to the dose of the active ingredient that would be administered to a subject and / or a convenient fraction of such a dose, for example, one-half or one-third of such a dose.

[0323] The compositions of the present invention may be formulated in any manner suitable for delivery, including, but not limited to, nanoparticles, poly(lactic-co-glycolic acid) (PLGA) microspheres, lipidoids, lipoplexes, liposomes, polymers, carbohydrates (including monosaccharides), cationic lipids, and combinations thereof.

[0324] In one embodiment, the formulation is a nanoparticle that may contain at least one lipid. The lipid may be selected from, but is not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, and PEGylated lipids. In another embodiment, the lipid may be a cationic lipid, such as, but not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, and DODMA.

[0325] For polynucleotides of the invention, formulations may be selected from, for example, any of the formulations set forth in International Application PCT / US2012 / 069610, the contents of which are incorporated herein by reference in their entirety.

[0326] The relative amounts of active ingredient, pharmaceutically acceptable excipient or inactive ingredient, and / or any additional ingredients in a pharmaceutical composition according to the invention will vary depending on the identity, size, and / or condition of the subject being treated, as well as the route by which the composition is to be administered. By way of example, the composition may contain from 0.1 to 100, e.g., 0.5 to 50, 1 to 30, 5 to 80, at least 80 (w / w) active ingredient.

[0327] The effectiveness of treatment or improvement of disease can be assessed, for example, by measuring disease progression, disease remission, symptom severity, pain relief, quality of life, the dose of drug required to maintain therapeutic efficacy, the level of a disease marker, or any other measurable parameter appropriate to the disease being treated or prevented. Monitoring the effectiveness of treatment or prevention by measuring any such parameter or any combination of parameters is well within the capabilities of one of ordinary skill in the art. With respect to the administration of the compositions of the present invention, for example, against cancer, "effective" means that administration in a clinically relevant manner results in a beneficial effect in at least a statistically significant proportion of patients, such as improvement of symptoms, cure, reduction in disease burden, reduction in tumor burden or cell count, extension of life span, improvement in quality of life, or other effect generally recognized as positive by physicians familiar with the treatment of a particular type of cancer.

[0328] Therapeutic or preventive effects are evident when there is a statistically significant improvement in one or more parameters of the disease state, or when symptoms worsen or develop otherwise as expected.For example, a favorable change of at least 10, preferably at least 20, 30, 40, 50 or more in measurable parameters of the disease can be indicative of effective treatment.The effectiveness of a given composition or formulation of the present invention can also be determined using an experimental animal model of a given disease known in the art.When using an experimental animal model, the effectiveness of treatment is proven when a statistically significant change is observed.

[0329] IV. Application One aspect of the present invention provides a method for reducing tumor volume or burden. The method comprises administering to a tumor-bearing subject a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or a payload of interest (i.e., immunotherapeutic agent), at least one vector, or cells. The biological circuit system and effector module comprising any of the immunotherapeutic agents described herein may be in the form of a polypeptide, a polynucleotide such as mRNA, a viral vector containing the polynucleotide, or a cell engineered to express the biological circuit, effector module, DD, and payload of interest (i.e., immunotherapeutic agent).

[0330] Another aspect of the present invention provides a method for inducing an anti-tumor immune response in a subject. The method comprises administering to a tumor-bearing subject a pharmaceutically effective amount of a pharmaceutical composition comprising at least one biological circuit system, effector module, DD, and / or a payload of interest (i.e., an immunotherapeutic agent), at least one vector, or cells. The biological circuit and effector module comprising any of the immunotherapeutic agents described herein may be in the form of a polypeptide, a polynucleotide such as mRNA, a viral vector containing the polynucleotide, or a cell engineered to express the biological circuit, effector module, DD, and payload of interest (e.g., an immunotherapeutic agent).

[0331] The method of the present invention may be adoptive cell transfer (ACT) using genetically modified cells such as immune effector cells of the present invention, cancer vaccines comprising biological circuitry, effector modules, DDs, payloads of interest (i.e., immunotherapeutic drugs) of the present invention, or compositions that manipulate the tumor immunosuppressive microenvironment, or combinations thereof. These treatments may also be used in conjunction with other cancer treatments such as chemotherapy or radiation therapy.

[0332] 1. Adoptive cell transfer (adoptive immunotherapy) In some embodiments, cells genetically engineered to express at least one biological circuit system, effector module, DD, and / or payload of interest (immunotherapeutic drug) may be used in adoptive cell therapy (ACT). As used herein, adoptive cell transfer refers to the administration of immune cells (autologous, allogeneic, or derived from a genetically engineered host) with direct anti-cancer activity. ACT has promising clinical applications for malignant and infectious diseases. For example, T cells genetically modified to recognize CD19 have been used to treat follicular B-cell lymphoma (Kochenderfer et al., Blood, 2010, 116:4099-4102; and Kochenderfer and Rosenberg, Nat Rev Clin Oncol., 2013, 10(5):267-276), and ACT using autologous lymphocytes genetically modified to express anti-tumor T-cell receptors has been used to treat metastatic melanoma (Rosenberg and Dudley, Curr. Opin. Immunol. 2009, 21:233-240).

[0333] According to the present invention, biological circuits and systems may be used in the development and implementation of cell therapies, such as adoptive cell therapy. Specific effector modules useful for cell therapy are shown in Figures 7-12. The biological circuits, their components, effector modules and their SREs, and payloads may be used in cell therapy to induce CAR therapy, in the manipulation or modulation of TILs, in allogeneic cell therapy, in combination T cell therapy with other lines of treatment (e.g., radiation, cytokines), to encode engineered or modified TCRs, or to enhance T cells with other TCRs (e.g., by introducing cytokine genes, genes for checkpoint inhibitors PD1, CTLA4).

[0334] Provided herein are methods of use in adoptive cell therapy, comprising preconditioning a subject in need thereof, modulating immune cells with the SREs, biological circuits, and compositions of the invention, administering modified immune cells expressing the compositions of the invention to the subject, and successfully engrafting the modified cells in the subject.

[0335] In some embodiments, the SREs, biological circuits, and compositions of the present invention may be used to minimize preconditioning regimens associated with adoptive cell therapy. As used herein, "preconditioning" refers to any therapeutic regimen administered to a subject to improve the outcome of adoptive cell therapy. Preconditioning strategies include, but are not limited to, total body irradiation and / or lymphodepleting chemotherapy. Clinical trials of adoptive therapy without preconditioning have failed to demonstrate clinical benefit, demonstrating the importance of preconditioning in ACT. However, preconditioning is associated with significant toxicity, limiting the cohort of subjects suitable for ACT. In some examples, immune cells for ACT may be modified to express cytokines such as IL12 and IL15 as payloads using the SREs of the present invention, reducing the need for preconditioning (Pengram et al. (2012) Blood 119(18):4133-41; the contents of which are incorporated by reference in their entirety).

[0336] In some embodiments, the immune cells in the ACT are dendritic cells, CD8 + T cells and CD4 + The immune stimulatory cells may be T cells, such as T cells, natural killer (NK) cells, NK T cells, cytotoxic T lymphocytes (CTLs), tumor-infiltrating lymphocytes (TILs), lymphokine-activated killer (LAK) cells, memory T cells, regulatory T cells (Tregs), helper T cells, cytokine-induced killer (CIK) cells, and any combination thereof. In other embodiments, the immune stimulatory cells for ACT may be generated from embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs). In some embodiments, autologous or allogeneic immune cells are used for ACT.

[0337] In some embodiments, the cells used for ACT may be T cells engineered to express a CAR containing an antigen-binding domain specific for an antigen on tumor cells of interest. In other embodiments, the cells used for ACT may be NK cells engineered to express a CAR containing an antigen-binding domain specific for an antigen on tumor cells of interest. In addition to adoptive transfer of genetically modified T cells (e.g., CAR T cells) for immunotherapy, alternative CAR-expressing leukocytes, alone or in combination with CAR T cells, may also be used for adoptive immunotherapy. In one example, a mixture of T cells and NK cells may be used for ACT. According to the present invention, the expression level of the CAR in T cells and NK cells is regulated and controlled by a small molecule that binds to the DD(s) operably linked to the CAR in the effector module.

[0338] In some embodiments, the CAR of the present invention may be placed under the transcriptional control of the T cell receptor alpha constant (TRAC) locus of a T cell to enhance T cell potency while achieving uniform CAR expression. The TRAC locus may be disrupted by CRISPR / Cas9, zinc finger nuclease (ZFN), or TALEN followed by insertion of the CAR construct. Methods for modifying CAR constructs directed at the TRAC locus are described in Eyquem J. et al. (2017) Nature. 543(7643):113-117, the contents of which are incorporated herein by reference in their entirety.

[0339] In some embodiments, NK cells modified to express the compositions may be used in ACT. Activation of NK cells induces perforin / granzyme-dependent apoptosis in target cells. Activation of NK cells also induces the secretion of cytokines such as IFN-γ, TNF-α, and GM-CSF. These cytokines enhance the phagocytic function of macrophages and their antibacterial activity, and potentiate adaptive immune responses through upregulation of antigen presentation by antigen-presenting cells such as dendritic cells (DCs) (reviewed in Vivier et al., Nat. Immunol., 2008, 9(5):503-510).

[0340] Other examples of genetic modifications may include the introduction of chimeric antigen receptors (CARs) and downregulation of inhibitory NK cell receptors such as NKG2A.

[0341] NK cells can also be genetically reprogrammed to circumvent NK cell inhibitory signals upon interaction with tumor cells. For example, NK cells can be genetically modified using CRISPR, ZFN, or TALEN to silence inhibitory receptors, thereby enhancing the anti-tumor capabilities of NK cells.

[0342] Immune cells can be isolated and expanded ex vivo using various methods known in the art. For example, methods for isolating and expanding cytotoxic T cells are described in U.S. Patent Nos. 6,805,861 and 6,531,451; U.S. Patent Publication No. US20160348072A1; and International Patent Publication No. WO2016168595A1, the contents of each of which are incorporated herein by reference in their entirety. NK cell isolation and expansion are described in U.S. Patent Publication Nos. US20150152387A1, U.S. Patent No. 7,435,596; and Oyer, JL (2016). Cytotherapy. 18(5):653-63, the contents of each of which are incorporated herein by reference in their entirety. Specifically, human primary NK cells may be expanded in the presence of feeder cells, such as a bone marrow cell line genetically modified to express membrane-bound IL15, IL21, IL12, and 4-1BBL.

[0343] In some examples, a subpopulation of immune cells may be enriched for ACT. Methods for enriching immune cells are described in International Patent Publication No. WO2015039100A1. In another example, B and T lymphocyte attenuator marker (BTLA)-positive T cells may be used to enrich for anti-cancer reactive T cells as described in U.S. Patent No. 9,512,401 (the contents of each of which are incorporated herein by reference in their entirety).

[0344] In some embodiments, immune cells for ACT may be depleted of select subpopulations to enhance T cell proliferation. For example, immune cells may be depleted of Foxp3+ T lymphocytes to minimize anti-tumor immune responses using methods set forth in U.S. Patent Publication No. US20160298081A1, the contents of which are incorporated herein by reference in their entirety.

[0345] In some embodiments, activation and proliferation of T cells for ACT is achieved by antigen stimulation with a chimeric antigen receptor (CAR) transiently expressed on the cell surface. Such activation methods are set forth in International Patent Publication No. WO2017015427, the contents of which are incorporated herein by reference in their entirety.

[0346] In some embodiments, immune cells may be activated by antigens associated with antigen-presenting cells (APCs). In some embodiments, APCs may be dendritic cells, macrophages, or B cells, which may be antigen-specific or non-specific. APCs may be autologous or allogeneic in organs. In some embodiments, APCs may be artificial antigen-presenting cells (aAPCs), such as cell-based aAPCs or cell-free aAPCs. Cell-based aAPCs may be selected from either genetically modified allogeneic cells, such as human erythroleukemia cells, or xenogeneic cells, such as mouse fibroblasts and Drosophila cells. Alternatively, APCs may be cell-free, in which case the antigen or costimulatory domain is presented on a synthetic surface, such as latex beads, polystyrene beads, lipid vesicles, or exosomes.

[0347] In some embodiments, cells of the present invention, particularly T cells, may be expanded using artificial cell platforms. In one embodiment, mature T cells may be generated using artificial thymic organoids (ATOs) as described by Seet CS et al. 2017. Nat Methods. 14, 521-530, the contents of which are incorporated herein by reference in their entirety. ATOs are based on a stromal cell line expressing delta-like canonical notch ligand (DLL1). In this method, stromal cells and hematopoietic stem and progenitor cells are aggregated by centrifugation and placed on cell culture inserts at an air-liquid interface to generate organoid cultures. ATO-derived T cells exhibit a naive phenotype, a diverse T cell receptor (TCR) repertoire, and TCR-dependent functions.

[0348] In some embodiments, adoptive cell therapy is performed by autologous transplantation, in which cells are derived from a subject in need of treatment and, after isolation and processing, are administered to the same subject. In other examples, ACT may involve allogeneic transplantation, in which cells are isolated and / or prepared from a donor subject other than the recipient subject who will ultimately receive the cell therapy. The donor and recipient subjects may be genetically identical or similar, or express the same HLA class or subtype.

[0349] In some embodiments, multiple immunotherapeutic agents delivered to immune cells (e.g., T cells and NK cells) for ACT may be controlled by the same biological circuit system. In one example, a cytokine such as IL12 and a CAR construct such as a CD19 CAR are linked to the same hDHFR destabilization domain. Expression of the IL12 and CD19 CAR is simultaneously regulated using TMP. In other embodiments, multiple immunotherapeutic agents delivered to immune cells (e.g., T cells and NK cells) for ACT may be controlled by different biological circuit systems. In one example, a cytokine such as IL12 and a CAR construct such as a CD19 CAR are linked to different DDs of two separate effector modules, thereby allowing them to be separately regulated using different stimuli. In another example, a suicide gene and a CAR construct may be linked to two separate effector modules.

[0350] Following gene regulation using the SREs, biological circuits, and compositions of the present invention, the cells are administered to a subject in need thereof. Methods for administering cells for adoptive cell therapy are known and may be used in connection with the provided methods and compositions. For example, methods for adoptive T cell therapy are described, for example, in U.S. Patent Application Publication No. 2003 / 0170238 to Gruenberg et al.; U.S. Patent No. 4,690,915 to Rosenberg; Rosenberg (2011) Nat Rev Clin Oncol. 8(10):577-85. See, e.g., Themeli et al. (2013) Nat Biotechnol. 31(10):928-933; Tsukahara et al. (2013) Biochem Biophys Res Commun 438(1):84-9; Davila et al. (2013) PLoS ONE 8(4):e61338, the contents of each of which are incorporated herein by reference in their entirety.

[0351] In some embodiments, immune cells for ACT may be engineered to express one or more immunotherapeutic agents that promote immune cell activation, infiltration, proliferation, survival, and anti-tumor function. The immunotherapeutic agent may be a second CAR or TCR specific for a different target molecule; a cytokine or cytokine receptor; a chimeric switch receptor that converts inhibitory signals into stimulatory signals; a homing receptor that directs adoptively transferred cells to a target site such as tumor tissue; a drug that optimizes immune cell metabolism; or a safety switch gene (e.g., a suicide gene) that kills activated T cells if a severe event is observed after adoptive cell transfer or if the transferred immune cells are no longer needed.

[0352] In some embodiments, the immune cells used for adoptive cell transfer are genetically engineered to further enhance their ability to kill tumors in cancer patients. This can improve their in vivo persistence, cytotoxicity, tumor targeting ability, and homing ability to disease sites. One example is introducing an effector module of the present invention containing a cytokine, such as gamma cytokines (IL2 and IL15), into immune cells to promote their proliferation and survival. Transduction of cells with cytokine genes (e.g., gamma cytokines IL2 and IL15) can promote immune cell proliferation without the addition of exogenous cytokines, and cytokine-expressing NK cells have enhanced tumor cytotoxicity.

[0353] In some embodiments, biological circuits, their components, SREs, or effector modules can be utilized to prevent T cell exhaustion. As used herein, "T cell exhaustion" refers to the gradual and progressive loss of T cell function caused by chronic T cell activation. T cell exhaustion is a major factor limiting the efficacy of antiviral and antitumor immunotherapy. Exhausted T cells have reduced proliferation and cytokine production, as well as high rates of apoptosis and high surface expression of multiple inhibitory receptors. T cell activation leading to exhaustion can occur in the presence or absence of antigen.

[0354] In some embodiments, biological circuits and their components may be utilized to prevent T cell exhaustion in chimeric antigen receptor-T cell therapy (CAR-T). In this regard, in some instances, exhaustion can be caused by oligomerization of the CAR's scFv on the cell surface, leading to continuous activation of the CAR's intracellular domain. As a non-limiting example, the CAR of the present invention may comprise an scFv that is unable to oligomerize. As another non-limiting example, a CAR that rapidly internalizes and re-expresses after antigen exposure may be selected to prevent chronic scFv oligomerization at the cell surface. In one embodiment, the framework region of the scFv may be modified to prevent constitutive CAR signaling (Long et al. 2014. Cancer Research. 74(19)S1; the contents of which are incorporated by reference in their entirety). The tunable biological circuit system of the present invention may also be used to regulate the surface expression of the CAR on the T cell surface to prevent chronic T cell activation. The CAR of the present invention may be modified to minimize exhaustion. As a non-limiting example, a 41-BB signaling domain may be incorporated into the design of a CAR to improve T cell depletion. In some embodiments, any of the strategies disclosed by Long HA et al. (Long AH et al. (2015) Nature Medicine 21, 581-590; the contents of which are incorporated herein by reference in their entirety) may be utilized to prevent depletion.

[0355] In some embodiments, the adjustable nature of the biological circuit of the present invention can be used to reverse the human T cell depletion observed with persistent CAR signaling.Reversible silencing of the biological activity of adoptively transferred cells using the composition of the present invention can be used to reverse persistent signaling, which can then reactivate T cells.Reversal of depletion can be measured by downregulation of multiple inhibitory receptors associated with depletion.

[0356] In some embodiments, metabolic pathways of T cells may be modified to reduce the susceptibility of T cells to depletion. Metabolic pathways include, but are not limited to, glycolysis, urea cycle, citric acid cycle, beta-oxidation, fatty acid biosynthesis, pentose phosphate pathway, nucleotide biosynthesis, and glycogen metabolism. As a non-limiting example, a payload that reduces the rate of glycolysis may be utilized to limit or prevent T cell depletion (Long et al. Journal for Immunotherapy of Cancer 2013, 1(Suppl 1):P21; the contents of which are incorporated by reference in their entirety). In one embodiment, the T cells of the present invention may be used in combination with inhibitors of glycolysis, such as 2-deoxyglucose and rapamycin.

[0357] In some embodiments, an effector module of the invention useful for immunotherapy may be placed under the transcriptional control of the T cell receptor alpha locus constant (TRAC) locus in a T cell. Eyquem et al. showed that expression of a CAR from the TRAC locus prevents T cell exhaustion and accelerated T cell differentiation caused by excessive T cell activation (Eyquem J. et al (2017) Nature. 543(7643):113-117; the contents of which are incorporated herein by reference in their entirety).

[0358] In some embodiments, the payloads of the invention may be used in conjunction with antibodies or fragments that target T cell surface markers associated with T cell depletion, including, but not limited to, CTLA-1, PD-1, TGIT, LAG-3, 2B4, BTLA, TIM3, VISTA, and CD96.

[0359] In one embodiment, the payload of the invention may be a CD276 CAR (having CD28, 4-IBB, and CD3ζ intracellular domains) that does not exhibit upregulation of markers associated with early T cell exhaustion (see International Patent Publication No. WO2017044699; the contents of which are incorporated herein by reference in their entirety).

[0360] In some embodiments, the compositions of the invention may be used to alter the TIL (tumor infiltrating lymphocyte) population in a subject. In one embodiment, any of the payloads described herein may be used to alter the ratio of CD4-positive cells to the CD8-positive population. In some embodiments, TILs may be sorted ex vivo and engineered to express any of the cytokines described herein. The payloads of the invention may be used to expand the CD4 and / or CD8 population of TILs and enhance TIL-mediated immune responses.

[0361] 2. Cancer vaccines In some embodiments, the biological circuits, effector modules, payloads of interest (immunotherapeutics), vectors, cells and compositions of the present invention may be used in combination with cancer vaccines.

[0362] In some embodiments, cancer vaccines can include peptides and / or proteins derived from tumor-associated antigens (TAAs). Such strategies can be used to induce an immune response in a subject, which in some instances can be a cytotoxic T lymphocyte (CTL) response. Peptides used in cancer vaccines can also be modified to match the mutation profile of the subject. For example, EGFR-derived peptides with mutations matching those found in subjects in need of treatment have been successfully used in patients with lung cancer (Li F et al. (2016) Oncoimmunology. Oct 7;5(12):e1238539; the contents of which are incorporated herein by reference in their entirety).

[0363] In one embodiment, the cancer vaccine of the present invention may be a superagonist TAA-derived modified peptide ligand (APL). These are mutant peptide ligands that deviate from the native peptide sequence by one or more amino acids, activating specific CTL clones more effectively than native epitopes. These changes may allow the peptide to better bind to restricted class I MHC molecules or interact better with the TCR of a given tumor-specific CTL subset. APLs may be selected using the methods described in U.S. Patent Publication No. US20160317633A1, the contents of which are incorporated herein by reference in their entirety.

[0364] 3. Combination treatment In some embodiments, it may be desirable to use a combination of compositions, vectors, and cells of the invention for administration to a subject. Compositions of the invention comprising different immunotherapeutic agents may be used in combination to enhance immunotherapy.

[0365] In some embodiments, it may be desirable to combine the compositions of the present invention with an adjuvant to enhance the potency and longevity of the antigen-specific immune response. Adjuvants used as immunostimulatory agents in combination therapy include biological molecules or delivery vehicles that deliver antigens. By way of non-limiting example, the compositions of the present invention may be combined with biological adjuvants such as cytokines, Toll-like receptors, bacterial toxins, and / or saponins. In other embodiments, the compositions of the present invention may be combined with a delivery vehicle. Exemplary delivery vehicles include polymer microspheres, immunostimulatory complexes, emulsions (oil-in-water or water-in-oil), aluminum salts, liposomes, or virosomes.

[0366] In some embodiments, immune effector cells engineered to express the biological circuits, effector modules, DDs, and payloads of the present invention may be combined with the biological adjuvants described herein. Dual modulation of CARs with cytokines and ligands is utilized to decouple the kinetic control of target-mediated activation from endogenous T cell proliferation. Such dual modulation also minimizes the need for patient preconditioning regimens. As a non-limiting example, a DD-regulated CAR, e.g., a CD19 CAR, may be combined with a cytokine, e.g., IL12, to enhance the antitumor efficacy of the CAR (Pegram HJ, et al. Tumor-targeted T cells modified to secrete IL12 eradicate systemic tumors without need for prior conditioning. Blood. 2012;119:4133-4; incorporated herein by reference in its entirety). As another non-limiting example, Merchant et al. used dendritic cell-based vaccination in combination with recombinant human IL7 to improve outcomes in patients with high-risk pediatric sarcomas (Merchant, MS et. al. Adjuvant immunotherapy to Improve Outcome in High-Risk Pediatric Sarcomas. Clin Cancer Res. 2016. 22(13):3182-91; the contents of each are incorporated herein by reference in their entirety).

[0367] In some embodiments, immune effector cells engineered to express one or more antigen-specific TCRs or CARs may be combined with compositions of the invention comprising immunotherapeutic agents that alter the immunosuppressive tumor microenvironment.

[0368] In one embodiment, effector immune cells engineered to express CARs specific for different target molecules on the same cell may be combined. In another embodiment, different immune cells engineered to express the same CAR construct, such as NK cells and T cells, may be combined for tumor treatment, for example, T cells engineered to express a CD19 CAR may be combined with NK cells engineered to express the same CD19 CAR to treat B-cell malignancies.

[0369] In other embodiments, immune cells engineered to express a CAR may be used in combination with checkpoint blockade drugs.

[0370] In some embodiments, immune effector cells engineered to express the biological circuits, effector modules, DDs, and payloads of the present invention may be used in combination with cancer vaccines of the present invention.

[0371] In some embodiments, the methods of the present invention may involve the use of a composition of the present invention in combination with other agents effective in treating cancer, infectious diseases, and other immunodeficiency disorders, such as anti-cancer agents. As used herein, the term "anti-cancer agent" refers to any agent that can negatively affect cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the rate of proliferation of cancer cells, reducing the incidence or number of metastases, shrinking tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response to cancer cells or tumors, preventing or inhibiting the progression of cancer, or extending the lifespan of a subject with cancer.

[0372] In some embodiments, the anti-cancer agent or therapy may be a chemotherapy agent or radiation therapy, an immunotherapy agent, surgery, or any other therapeutic agent that can be used in combination with the present invention to improve the therapeutic efficacy of the treatment.

[0373] In one embodiment, the effector module comprising the CD19 CAR may be combined with an aminopyrimidine derivative, such as a Burkitt tyrosine receptor kinase (BTK) inhibitor, using the methods set forth in International Patent Application No. WO2016164580, the entire contents of which are incorporated herein by reference.

[0374] In some embodiments, the compositions of the present invention may be used in combination with immunotherapeutic agents other than the therapies of the present invention described herein, for example, antibodies specific for some target molecule on the surface of tumor cells.

[0375] Exemplary chemotherapeutic agents include acivicin; aclarubicin; acodazole hydrochloride; acronine; adzelesin; aldesleukin; altretamine; ambomycin; amethanthrone acetate; amsacrine; anastrozole; anthramycin; asparaginase; asperlin, sulindac, curcumin; alkylating agents including: mechlorethamine, cyclophosphamide, ifosfamide, melphalan, and nitrogen mustards such as chlorambucil; carmustine (BCU), lomustine (CCNU), and semustine (methylCC Nitrosoureas such as triethylenemelamine (TEM), triethylene, thiophosphoramide (thiotepa), hexamethylmelamine (HMM, altretamine), and other methylmelamines; alkylsulfonates such as busulfan; triazines such as dacarbazine (DTIC); antimetabolites, e.g., folic acid analogs such as methotrexate and trimetrexate, 5-fluorouracil, fluorodeoxyuridine, gemcitabine, cytosine arabinoside (AraC, cytarabine), pyrrolidine analogs such as 5-azacytidine, 2,2'-difluorodeoxycytidine, 6-mercaptopurine, 6-thioguanine, azathioprine, and 2'-deoxycoformycin (Pentos purine analogs such as tatin, erythrohydroxynonyl adenine (EHNA), fludarabine phosphate, and 2-chlorodeoxyadenosine (cladribine, 2-CdA); natural products, including paclitaxel, vinca alkaloids, e.g., vinblastine (VLB), vincristine, and vinorelbine, antimitotics such as taxotere, estramustine, and estramustine phosphate; epipodophyllotoxins such as etoposide and teniposide; antibiotics such as actimomycin D, daunomycin (rubidomycin), doxorubicin, mitoxantrone, idarubicin, bleomycin, plicamycin (mithramycin), mitomycin C, and actinomycin;Enzymes such as L-asparaginase, cytokines such as interferon (IFN)-γ, tumor necrosis factor (TNF)-α, TNF-β and GM-CSF, anti-angiogenic factors such as angiostatin and endostatin, inhibitors of FGF or VEGF, soluble forms of angiogenic factor receptors, including soluble VGF / VEGF receptors, platinum coordination complexes such as cisplatin and carboplatin, anthracenediones such as mitoxantrone, substituted ureas such as hydroxyurea, methylhydrazine derivatives such as N-methylhydrazine (MIFf) and procarbazine Adrenal cortical suppressants such as steroid derivatives, mitotane (o,p'-DDD) and aminoglutethimide; hormones and antagonists, including corticosteroid antagonists such as prednisone and equivalents, dexamethasone and aminoglutethimide; progestins such as hydroxyprogesterone caproate, medroxyprogesterone acetate, and megestrol acetate; estrogens such as diethylstilbestrol and ethinyl estradiol equivalents; antiestrogens such as tamoxifen; androgens, including testosterone propionate and fluoxymesterone / equivalents antiandrogens such as flutamide, gonadotropin-releasing hormone analogs, and leuprolide; nonsteroidal antiandrogens such as flutamide; kinase inhibitors, histone deacetylase inhibitors, methylation inhibitors, proteasome inhibitors, monoclonal antibodies, oxidants, antioxidants, telomerase inhibitors, BH3 mimetics, ubiquitin ligase inhibitors, stat inhibitors, and other antiandrogens, such as imatinib mesylate (sold as Gleevac or Glivac) and erlotinib (an EGF receptor inhibitor), currently sold as Tarveca. Receptor tyrosine kinase inhibitors; antivirals such as oseltamivir phosphate, amphotericin B, and palivizumab; Sdi1 mimetics; semustine; senescence-derived inhibitor 1; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stipiamid; stromelysin inhibitors; sulfinosines; superactive vasoactive intestinal peptide antagonists; veraresol; veramine; verudines; verteporfin; vinorelbine; vinxartin; vitaxin; vorozole; zanoteron; zeniplatin; zilascorub;and zinostatin stimalamer; the PI3Kβ small molecule inhibitor, GSK2636771; the pan-PI3K inhibitor (BKM120); the BRAF inhibitors, vemurafenib (Zelboraf) and dabrafenib (Tafinlar); or analogs or derivatives and variants of any of the foregoing.

[0376] Radiotherapeutic agents and factors include radiation and waves that induce DNA damage, such as gamma irradiation, X-rays, UV irradiation, microwaves, electronic emissions, and radioisotopes. Therapy may be achieved by irradiating the localized tumor site with these forms of radiation. All of these factors most likely result in widespread DNA damage in DNA precursors, DNA replication and repair, and chromosome assembly and maintenance. X-ray doses range from daily doses of 50-200 roentgens for prolonged periods (3-4 weeks) to single doses of 2000-6000 roentgens. Dose ranges for radioisotopes vary widely and depend on the half-life of the isotope, the strength and type of radiation emitted, and uptake by tumor cells.

[0377] In some embodiments, the chemotherapeutic agent may be an immunomodulatory agent such as lenalidomide (LEN). Recent studies have shown that lenalidomide can enhance the anti-tumor function of CAR-modified T cells (Otahal et al., Oncoimmunology, 2015, 5(4):e1115940). Some examples of anti-tumor antibodies include tocilizumab and siltuximab.

[0378] Other agents that may be used in combination with the compositions of the invention also include, but are not limited to, agents that affect the upregulation of cell surface receptors and their ligands (e.g., Fas / Fas ligand, DR4 or DR5 / TRAIL) and GAP junctions, cytostatic and differentiating agents, cell adhesion inhibitors such as focal adhesion kinase (FAK) inhibitors and lovastatin, or agents that sensitize hyperproliferative cells to apoptosis inducers such as the antibody C225.

[0379] The combination may include simultaneous or separate administration of the composition of the present invention and the other agent, or the immunotherapy may precede or follow the other agent / therapy by intervals ranging from minutes to days to weeks to months.

[0380] 4.Disease The present invention provides a method for reducing tumor volume or tumor burden in a subject in need thereof, the method comprising introducing into the subject a composition of the present invention.

[0381] The present invention also provides a method for treating cancer in a subject, comprising administering to the subject an effective amount of immune effector cells genetically modified to express at least one effector module of the present invention.

[0382] cancer The pharmaceutical compositions, biological circuits, biological circuit components, SREs, or effector modules containing payloads of the present invention can be used to treat various cancers. As used herein, the term "cancer" refers to any of a variety of malignant neoplasms characterized by the proliferation of undifferentiated cells that tend to invade surrounding tissues and metastasize to new body sites, as well as pathological conditions characterized by the growth of such malignant neoplasms. The cancer may be a tumor or a hematological malignancy, including, but not limited to, all types of lymphoma / leukemia, carcinoma, and sarcoma, such as cancers or tumors found in the anus, bladder, bile duct, bone, brain, breast, cervix, colon / rectum, endometrium, esophagus, eye, gallbladder, head and neck, liver, kidney, larynx, lung, mediastinum (chest), mouth, ovaries, pancreas, penis, prostate, skin, small intestine, stomach, spinal cord, tailbone, testicles, thyroid, and uterus.

[0383] Types of carcinomas that may be treated with the compositions of the present invention include, but are not limited to, papilloma / carcinoma, choriocarcinoma, yolk sac tumor, teratoma, adenoma / adenocarcinoma, melanoma, fibroma, lipoma, leiomyoma, rhabdomyoma, mesothelioma, hemangioma, osteoma, chondroma, glioma, lymphoma / leukemia, squamous cell carcinoma, small cell carcinoma, undifferentiated large cell carcinoma, basal cell carcinoma, and undifferentiated sinonasal carcinoma.

[0384] Types of carcinomas that may be treated with the compositions of the present invention include, but are not limited to, soft tissue sarcomas, such as alveolar soft part sarcoma, angiosarcoma, dermatofibrosarcoma, desmoid tumor, desmoplastic small round cell tumor, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, angiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma, lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, synovial sarcoma, as well as Askin's tumor, Ewing's sarcoma (primitive neuroectodermal tumor), malignant hemangioendothelioma, malignant schwannoma, osteosarcoma, and chondrosarcoma.

[0385] By way of non-limiting example, carcinomas that may be treated include acute granulocytic leukemia, acute lymphocytic leukemia, acute myeloid leukemia, adenocarcinoma, adenosarcoma, adrenal carcinoma, adrenocortical carcinoma, anal carcinoma, anaplastic astrocytoma, angiosarcoma, appendix carcinoma, astrocytoma, basal cell carcinoma, B-cell lymphoma), bile duct carcinoma, bladder carcinoma, bone cancer, intestinal cancer, brain cancer, brain stem glioma, brain tumor, breast cancer, carcinoid tumor, cervical cancer, cholangiocarcinoma, chondrosarcoma, chronic lymphocytic leukemia, chronic myeloid leukemia, and leukemia. Myeloid leukemia, colon cancer, colorectal cancer, craniopharyngioma, cutaneous lymphoma, cutaneous melanoma, diffuse astrocytoma, ductal carcinoma in situ, endometrial cancer, ependymoma, epithelioid sarcoma, esophageal cancer, Ewing's sarcoma, extrahepatic bile duct cancer, eye cancer, fallopian tube cancer, fibrosarcoma, gallbladder cancer, gastric cancer, gastrointestinal cancer, gastrointestinal carcinoid cancer, common gastrointestinal stromal tumor, germ cell tumor, glioblastoma multiforme, glioma, hairy cell leukemia, head and neck cancer, hemangioendothelioma, Hodgkin's disease Lymphoma, Hodgkin's disease, Hodgkin's lymphoma, hypopharyngeal cancer, invasive ductal carcinoma, invasive lobular adenocarcinoma, inflammatory breast cancer, intestinal cancer, intrahepatic bile duct cancer, invasive breast cancer / invasive breast cancer, pancreatic islet cell carcinoma, jaw cancer, Kaposi's sarcoma, kidney cancer, laryngeal cancer, leiomyosarcoma, leptomeningeal metastasis, leukemia, lip cancer, liposarcoma, liver cancer, lobular carcinoma in situ, low-grade astrocytoma, lung cancer, lymph node cancer, lymphoma, male breast cancer, medullary carcinoma, medulloblastoma, melanoma, meningioma, melanocorticoid Kell cell carcinoma, mesenchymal chondrosarcoma, mesenchymoma, mesothelioma, metastatic breast cancer, metastatic melanoma, metastatic squamous cell cervical cancer, mixed glioma, oral cancer, mucinous carcinoma, mucosal melanoma, multiple myeloma, nasal cancer, nasopharyngeal carcinoma, cervical cancer, neuroblastoma, neuroendocrine tumor, non-Hodgkin's lymphoma, non-small cell lung cancer, oat cell carcinoma, eye cancer, intraocular melanoma, oligodendroglioma, oral cancer, oral cavity cancercancer), oropharyngeal cancer, osteogenic sarcoma, osteosarcoma, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian primary peritoneal cancer, ovarian sex cord stromal tumor, Paget's disease, pancreatic cancer, papillary cancer, sinus cancer, parathyroid cancer, pelvic cancer, penile cancer, peripheral nerve cancer, peritoneal cancer, pharyngeal cancer, pheochromocytoma, pilocytic astrocytoma, pineal tumor, pineoblastoma, pituitary cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis cancer, rhabdomyosarcoma, salivary gland cancer, The cancer may be sarcoma, osteosarcoma, soft tissue sarcoma, uterine sarcoma, sinus cancer, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, spinal cancer, vertebral column cancer, spinal cancer, spinal tumor, squamous cell carcinoma, gastric cancer, synovial sarcoma, T-cell lymphoma), testicular cancer, pharyngeal cancer, thymoma / thymic cancer, thyroid cancer, tongue cancer, tonsillar cancer, transitional cell carcinoma, transitional cell carcinoma, triple-negative breast cancer, fallopian tube cancer, tubular carcinoma, ureteral cancer, urethral cancer, uterine adenocarcinoma, uterine cancer, uterine sarcoma, vaginal cancer, or vulvar cancer.

[0386] infectious disease In some embodiments, the biological circuits of the present invention may be used to treat infectious diseases. The biological circuits of the present invention may be introduced into cells suitable for adoptive cell transfer, such as macrophages, dendritic cells, natural killer cells, and / or T cells. The infectious diseases treated by the biological circuits of the present invention may be diseases caused by viruses, bacteria, fungi, and / or parasites. The IL15-IL15Ra payloads of the present invention may be used to enhance immune cell proliferation and / or immune cell persistence, which are useful for treating infectious diseases.

[0387] As used herein, "infectious disease" refers to a disease caused by any pathogen or agent that infects mammalian cells, preferably human cells, and causes a disease state, including bacteria, yeast, fungi, protozoa, mycoplasma, viruses, prions, and parasites. By way of example, (a) a viral disease, such as a disease resulting from infection with an adenovirus, a herpesvirus (e.g., HSV-I, HSV-II, CMV, or VZV), a poxvirus (e.g., an orthopoxvirus such as smallpox or vaccinia, or molluscum contagiosum), a picornavirus (e.g., a rhinovirus or an enterovirus), an orthomyxovirus (e.g., an influenza virus), a paramyxovirus (e.g., a parainfluenza virus, a mumps virus, a measles virus, and a respiratory syncytial virus (RSV)), a coronavirus (e.g., SARS), a papovavirus (e.g., a papillomavirus that causes genital warts, common warts, or plantar warts), a hepadnavirus (e.g., a hepatitis B virus), a flavivirus (e.g., a hepatitis C virus or a dengue virus), or a retrovirus (e.g., a lentivirus such as HIV). (b) Bacterial diseases, such as Escherichia, Enterobacter, Salmonella, Staphylococcus, Shigella, Listeria, Aerobacter, Helicobacter, Klebsiella, Proteus, Pseudomonas, Streptococcus, Chlamydia, Mycoplasma, Pneumococcal Diseases caused by infections with bacteria of the genera Ccus, Neisseria, Clostridium, Bacillus, Corynebacterium, Mycobacterium, Campylobacter, Vibrio, Serratia, Providencia, Chromobacterium, Brucella, Yersinia, Haemophilus, or Bordetella;(c) other infectious diseases such as chlamydia, fungal diseases including but not limited to candidiasis, aspergillosis, histoplasmosis, and cryptococcal meningitis, parasitic diseases including but not limited to malaria, Pneumocystis carnii pneumonia, leishmaniasis, cryptosporidiosis, and toxoplasmosis, as well as trypanosome infections and prion-related infections that cause human diseases such as Creutzfeldt-Jakob disease (CJD), variant Creutzfeldt-Jakob disease (vCJD), Gerstmann-Sträussler-Scheinker syndrome, fatal familial insomnia, and kuru;

[0388] 5. Microbiome Changes in the composition of the microbiome can affect the action of anti-cancer therapies. Diverse communities of mutualistic, commensal, and pathogenic microorganisms exist at all environmentally exposed sites within the body, referred to herein as the "microbiome." Environmentally exposed sites of the body where the microbiome may reside include the skin, nasopharynx, oral cavity, respiratory tract, gastrointestinal tract, and reproductive system.

[0389] In some embodiments, the natural or immunotherapeutic modified microbiome may be used to improve the efficacy of anti-cancer immunotherapy. Methods for using the microbiome to improve responsiveness to immunotherapeutic drugs have been described by Sivan et al. A., et al. Commensal Bifidobacterium promotes antitumor immunity and facilitates anti-PD-L1 efficacy. Science 2015;350:1084-9; incorporated herein by reference in its entirety. In one embodiment, proteins, RNA, and / or other biomolecules derived from the microbiome may be used as payloads to influence the efficacy of anti-cancer immunotherapy.

[0390] 6. Tools and drugs for creating therapeutic drugs The present invention provides tools and agents that can be used to generate immunotherapeutic agents to reduce tumor volume or tumor burden in subjects in need thereof. A significant number of variables are involved in the production of therapeutic agents, including payload structure, cell type, method of gene transfer, method and time of ex vivo propagation, preconditioning, and tumor volume and type in the subject. Such parameters may be optimized using the tools and agents described herein.

[0391] cell line The present disclosure provides mammalian cells genetically modified with the compositions of the present invention. Suitable mammalian cells include primary cells and immortalized cell lines. Suitable mammalian cell lines include, but are not limited to, the human embryonic kidney cell line 293, the fibroblast cell line NIH 3T3, the human colorectal cancer cell line HCT116, the ovarian cancer cell line SKOV-3, immortalized T cell lines (e.g., Jurkat cells and SupT1 cells), lymphoma cell lines Raji cells, NALM-6 cells, K562 cells, HeLa cells, PC12 cells, HL-60 cells, and NK cell lines (e.g., NKL, NK92, NK962, and YTS). In some examples, the cells are not immortalized cell lines but are cells obtained from an individual and are referred to herein as primary cells. For example, the cells are T lymphocytes obtained from an individual. Other examples include, but are not limited to, cytotoxic cells, stem cells, peripheral blood mononuclear cells, or progenitor cells obtained from an individual.

[0392] SRE, biological circuits, and cell line tracking In some embodiments, it may be desirable to track the compositions of the invention or cells modified with the compositions of the invention. Tracking may be achieved by using a reporter moiety, which, as used herein, refers to any protein capable of generating a detectable signal in response to an input. Examples include alkaline phosphatase, β-galactosidase, chloramphenicol acetyltransferase, β-glucuronidase, peroxidase, β-lactamase, catalytic antibodies, bioluminescent proteins such as luciferase, and fluorescent proteins such as green fluorescent protein (GFP).

[0393] The reporter moiety may be used to monitor the response of the DD upon addition of a ligand corresponding to the DD. In other examples, the reporter moiety may be used to track cell survival, persistence, cell proliferation, and / or localization in vitro, in vivo, or ex vivo.

[0394] In some embodiments, a preferred reporter moiety may be a luciferase protein. In one embodiment, the reporter moiety is Renilla luciferase (encoded by the nucleic acid sequences of SEQ ID NOs: 866, 867) or firefly luciferase (encoded by the nucleic acid sequences of SEQ ID NOs: 868, 869).

[0395] Animal models The usefulness and efficacy of the compositions of the present invention may be tested in an in vivo animal model, preferably a mouse model. The mouse model used may be a syngeneic mouse model in which mouse cells are modified with the compositions of the present invention and tested in mice of the same genetic background. Examples include the pMEL-1 and 4T1 mouse models. Alternatively, xenograft models in which human cells, such as tumor cells or immune cells, are introduced into immunodeficient mice may also be utilized in such studies. The immunodeficient mice used are CByJ.Cg-Foxn1 nu / J, B6;129S7-Rag1 tm1Mom / J, B6.129S7-Rag1tm1Mom / J, B6.CB17-Prkdc scid / SzJ, NOD.129S7(B6)-Rag1 tm1Mom / J, NOD.Cg-Rag1 tm1Mom Prf1 tm1Sd z / Sz, NOD.CB17-Prkdc scid / SzJ, NOD.Cg-Prkdc scid B2m tm1Unc / J, NOD-scid IL2Rg null , nude (nu) mice, SCID mice, NOD mice, RAG1 / RAG2 mice, NOD-Scid mice, IL2rg null mice, b2m null mice, NOD-scid IL2rγ null mice, NOD-scid-B2m null mice, beige mice, and HLA transgenic mice.

[0396] Cell assay In some embodiments, the effectiveness of the compositions of the present invention as immunotherapeutics may be evaluated using cellular assays. The expression level and / or identity of the compositions of the present invention may be determined according to any method known in the art for identifying proteins and / or quantifying protein levels. In some embodiments, such methods may include Western blotting, flow cytometry, and immunoassays.

[0397] Provided herein are methods for functionally characterizing cells expressing the SREs, biological circuits, and compositions of the present invention. In some embodiments, functional characterization may be performed on primary immune cells or immortalized immune cell lines and determined by the expression of cell surface markers. Examples of cell surface markers for T cells include, but are not limited to, CD3, CD4, CD8, CD14, CD20, CD11b, CD16, CD45, and HLA-DR, CD69, CD28, CD44, and IFNγ. Markers of T cell exhaustion include PD1, TIM3, BTLA, CD160, 2B4, CD39, and LAG3. Examples of cell surface markers for antigen-presenting cells include, but are not limited to, MHC class I, MHC class II, CD40, CD45, B7-1, B7-2, IFNγ receptor, IL2 receptor, ICAM-1, and / or Fcγ receptor. Examples of cell surface markers of dendritic cells include, but are not limited to, MHC class I, MHC class II, B7-2, CD18, CD29, CD31, CD43, CD44, CD45, CD54, CD58, CD83, CD86, CMRF-44, CMRF-56, DCIR, and / or Dectin-1; while in some cases, CD2, CD3, CD4, CD8, CD14, CD15, CD16, CD19, CD20, CD56, and / or CD57 are simultaneously absent. Examples of cell surface markers of NK cells include, but are not limited to, CCL3, CCL4, CCL5, CCR4, CXCR4, CXCR3, NKG2D, CD71, CD69, CCR5, phospho-JAK / STAT, phospho-ERK, phospho-p38 / MAPK, phospho-AKT, phospho-STAT3, granulysin, granzyme B, granzyme K, IL10, IL22, IFNg, LAP, perforin, and TNFa.

[0398] V. Delivery Methods and / or Vectors vector The present invention also provides vectors that package polynucleotides of the present invention encoding biological circuits, effector modules, SREs (DDs), and payload constructs, as well as combinations thereof. The vectors of the present invention may also be used to deliver the packaged polynucleotides to cells, local tissue sites, or subjects. These vectors may be of any type, including DNA vectors, RNA vectors, plasmids, viral vectors, and particles. Viral vector technology is well known and is described in Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). Viruses useful as vectors include, but are not limited to, lentiviral vectors, adenoviral vectors, adeno-associated viral (AAV) vectors, herpes simplex viral vectors, retroviral vectors, oncolytic viruses, and the like.

[0399] Generally, a vector contains an origin of replication functional in at least one organism, a promoter sequence and convenient restriction endonuclease sites, as well as one or more selectable markers, such as drug resistance genes.

[0400] As used herein, a promoter is defined as a DNA sequence recognized by the cellular transcriptional machinery necessary to initiate specific transcription of a polynucleotide sequence of the present invention. A vector can contain a native or non-native promoter operably linked to a polynucleotide of the present invention. The selected promoter may be strong, weak, constitutive, inducible, tissue-specific, developmental stage-specific, and / or organism-specific. One example of a suitable promoter is the immediate-early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high levels of expression of a polynucleotide sequence operably linked to it. Another example of a preferred promoter is elongation growth factor-1.α (EF-1.α). Other constitutive promoters, including but not limited to, simian virus 40 (SV40), mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV), long terminal repeat (LTR) promoters, avian leukosis virus promoters, Epstein-Barr virus immediate early promoters, and Rous sarcoma virus promoters, as well as human gene promoters, including but not limited to, the phosphoglycerate kinase (PGK) promoter, actin promoter, myosin promoter, hemoglobin promoter, ubiquitin C (Ubc) promoter, human U6 small nuclear protein promoter, and creatine kinase promoter, may also be used. In some examples, inducible promoters, such as, but not limited to, the metallothionine promoter, glucocorticoid promoter, progesterone promoter, and tetracycline promoter, may be used. In some embodiments, the promoter may be selected from SEQ ID NOs: 716-718.

[0401] In some embodiments, optimal promoters may be selected based on their ability to achieve minimal expression of the SRE and payload of the invention in the absence of a ligand, and detectable expression in the presence of a ligand.

[0402] Additional promoter elements, such as enhancers, may be used to regulate the frequency of transcription initiation. Such regions may be located 10 to 100 base pairs upstream or downstream of the initiation site. In some instances, two or more promoter elements may be used to activate transcription coordinately or independently.

[0403] In some embodiments, the recombinant expression vector may include regulatory sequences, such as transcriptional and translational initiation and termination codons, that are specific to the type of host cell into which the vector is to be introduced.

[0404] 1. Lentiviral Vectors In some embodiments, lentiviral vectors / particles may be used as vehicles and delivery modes. Lentiviruses are a subgroup of viruses in the retroviridae family, named for the need for reverse transcription of the viral RNA genome into DNA prior to integration into the host genome. Therefore, the most important feature of lentiviral vehicles / particles is the integration of genetic material into the genome of target / host cells. Some examples of lentiviruses include human immunodeficiency viruses: HIV-1 and HIV-2, simian immunodeficiency virus (SIV), feline immunodeficiency virus (FIV), bovine immunodeficiency virus (BIV), Jembrana disease virus (JDV), equine infectious anemia virus (EIAV), equine infectious anemia virus, visna-maedi virus, and caprine arthritis-encephalitis virus (CAEV).

[0405] Generally, the lentiviral particles that constitute gene delivery vehicles are replication-deficient (also known as "self-inactivating"). Lentiviruses can infect both dividing and non-dividing cells by entering through the intact host nuclear envelope (Naldini L et al., Curr. Opin. Biotechnol, 1998, 9:457-463). Recombinant lentiviral vehicles / particles have been generated by multiple attenuation of HIV pathogenicity genes, e.g., deletion of Env, Vif, Vpr, Vpu, Nef, and Tat genes to make the vector biologically safe. Similarly, lentiviral vehicles derived from, for example, HIV-1 / HIV-2, can mediate efficient delivery, integration, and long-term expression of transgenes in non-dividing cells. As used herein, the term "recombinant" refers to vectors or other nucleic acids containing both lentiviral and non-lentiviral retroviral sequences.

[0406] Lentiviral particles may be produced by co-expressing viral packaging elements and the vector genome itself in producer cells, such as human HEK293T cells. These elements are typically provided in three (second-generation lentiviral systems) or four (third-generation lentiviral systems) separate plasmids. Plasmids encoding lentiviral components, including the viral core (i.e., structural proteins) and enzymatic components, as well as the envelope protein(s), (called packaging systems), and a plasmid encoding the genome containing the exogenous transgene to be introduced into target cells, i.e., the vehicle itself (also called transfer vector), are co-transfected into producer cells. Typically, the plasmid or vector is contained in a producer cell line. The plasmid / vector is introduced into the producer cell line via transfection, transduction, or infection. Methods for transfection, transduction, or infection are well known to those skilled in the art. By way of non-limiting example, packaging and delivery constructs can be introduced into a producer cell line by calcium phosphate transfection, lipofection, or electroporation, followed by isolation of clones, typically using dominant selectable markers such as neo, DHFR, Gln synthetase, or ADA, and selection in the presence of the appropriate drug.

[0407] The producer cells produce recombinant viral particles containing the foreign gene, e.g., the effector module of the present invention. The recombinant viral particles are recovered from the culture medium and titered using standard methods used by those skilled in the art. The recombinant lentiviral vehicle can be used to infect target cells.

[0408] Cells that can be used to produce high-titer lentiviral particles include HEK293T cells, 293G cells, STAR cells (Relander et al., Mol. Ther., 2005, 11:452-459), FreeStyle™ 293 Expression System (ThermoFisher, Waltham, MA), and other HEK293T-based producer cell lines (e.g., Stewart et al., Hum Gene Ther. 2011, 22(3):357-369; Lee et al., Biotechnol Bioeng, 2012, 10996):1551-1560; Throm et al., Blood. 2009, 113(21):5104-5110; the contents of each are incorporated herein by reference in their entirety).

[0409] In some embodiments, the envelope protein may be a heterologous envelope protein from another virus, such as the G protein of vesicular stomatitis virus (VSV G) or baculovirus gp64 envelope protein. VSV-G glycoprotein is particularly useful in the genus Vesiculovirus, including species such as Carajas virus (CJSV), Chandipura virus (CHPV), Coccoccus virus (COCV), Isfahan virus (ISFV), Maraba virus (MARAV), Pili virus (PIRYV), Vesicular stomatitis Alagoas virus (VSAV), Vesicular stomatitis Indiana virus (VSIV), and Vesicular stomatitis New Jersey virus (VSNJV), and / or grass carob rhabdovirus, BeAn157575 virus (BeAn157575), Botec virus (BTKV), Calchaqui virus (CQIV), El virus Americana virus (EV). The virus may be selected from strains tentatively classified in the genus Vesiculovirus as A), Grey Lodge virus (GLOV), Uronavirus (JURY), Klamath virus (KLAV), Quattavirus (KWAV), La Jolla virus (LJV), Malpes S...

Claims

[Claim 1] The invention described in the present specification.