Transgene cassette and epigenetic silencer for the treatment of disorders
Transgene expression cassettes with ESFs using miRNA target sequences address the challenge of incomplete silencing and off-target effects in cancer gene therapy, enhancing the specificity and safety of treatments for GBM by regulating transgene expression in a cell-type-specific manner.
Patent Information
- Application Number
- JP2025500228
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-08
- Filing Date
- 2023-07-07
- Publication Date
- 2025-07-10
AI Technical Summary
Current gene therapy methods for cancer, particularly for highly malignant cancers like glioblastoma multiforme (GBM), face challenges in achieving long-term remission due to incomplete gene silencing and the ability to selectively express transgenes in target cells, leading to off-target effects and tumor regrowth.
Development of transgene expression cassettes containing epigenetic silencer factors (ESFs) that utilize miRNA target sequences to regulate transgene expression in a cell-type-specific manner, using polynucleotides with miR-124, miR-338-3p, and miR-31 target sequences to silence oncogenic transcription factors, thereby reducing unwanted expression and off-target effects.
The ESFs effectively limit cancer cell survival and proliferation, reducing the risk of tumor regrowth by achieving targeted and sustained gene silencing, improving the safety and specificity of gene therapy.
Smart Images

Figure 2025521922000166 
Figure 2025521922000167 
Figure 2025521922000168
Abstract
Description
Technical Field
[0001] The present invention relates to transgene cassettes and polynucleotides for the treatment of diseases or disorders. The polynucleotides of the present invention can include epigenetic silencer factors (ESFs) that mediate targeted gene silencing. Further, the polynucleotides of the present invention can promote cell-specific transgene expression for improved target specificity and safety.
Background Art
[0002] Gene therapy involves the incorporation of genetic material into cells to treat or prevent diseases. The genetic material can complement defective genes with functional copies of those genes, inactivate genes that function inappropriately, silence genes that may be associated with disease states (e.g., oncogenic or cancer-related genes), or introduce novel therapeutic genes into cells.
[0003] To date, two major targeting technologies have been used to silence gene expression: RNA interference (RNAi) using single short hairpin RNAs (shRNAs); and gene targeting using artificial nucleases. Promising preclinical and clinical data have been obtained using these technologies, but the partial depletion of gene expression using shRNAs and the low efficiency by which this results in homozygous disruption in diploid mammalian cells can reduce the effectiveness of these treatments. These drawbacks are particularly important in applications where residual levels of gene activity are sufficient for biological function.
[0004] In addition, epigenetic mechanisms have been utilized to silence gene expression. Epigenetics refers to the mechanism that transmits heritable changes in the function of the genome without changing the primary DNA sequence. These changes can mediate short-term instructions that can be rapidly reverted in response to exogenous stimuli (e.g., histone post-translational modifications: HPTMs). Alternatively, these changes can constitute long-term instructions that stably contribute to cell identity and memory (e.g., DNA methylation).
[0005] Cancer treatment can include a wide range of approaches, including surgery, chemotherapy, and radiation therapy. However, even when the surgical removal of a tumor is as complete as possible, even a small number of residual cancer cells with tumor-initiating ability may be sufficient to regrow the tumor mass in a short period and lead to disease recurrence. In particular, cancer stem cells (CSCs), defined as cells that can self-renew and initiate or regrow tumors, may be in a dormant state or have very low proliferative activity and may be resistant to some adjuvant therapies. That is, there is a significant need to achieve long-term remission, especially after tumor resection, through more effective targeting of cancer cells.
[0006] Such an approach, with 1 to 5 cases per 100,000 people per year and a median survival of 12 to 15 months, may be particularly desirable for diseases such as glioblastoma multiforme (GBM), the most common and lethal brain cancer in adults. This poor outcome is due to a combination of both the malignancy of the disease and the limited effectiveness of current therapies that only slightly increase overall survival. Patients usually undergo surgical resection of the primary tumor mass, followed by adjuvant radiation therapy and chemotherapy (temozolomide), but the above-mentioned problem of tumor regrowth can lead to cancer recurrence.
[0007] Attempts have been made to suppress cancer (e.g., GBM) development by silencing the expression of one or more transcription factors (TFs) using various techniques. For example, TF inactivation has been tried using several techniques including epigenetic repressors based on shRNA, miRNA, and TALEN, but it has been shown that complete and long-term gene silencing is difficult. Furthermore, cancer cells can rearrange their genetic programs to accommodate the silencing of a single gene, i.e., maintain unchanged tumorigenic properties.
[0008] Therefore, there remains a significant need for the development of more effective treatments for cancer, particularly for highly malignant cancers such as GBM, and treatments that can target CSCs.
[0009] A further limitation in gene therapy is the ability to selectively determine whether a transgene is expressed within the cells into which it is delivered. There is a continuing need for transgene expression cassettes that provide cell type-specific transgene expression in order to reduce off-target effects associated with transgene expression and thereby improve the specificity and safety of any such gene therapy. SUMMARY OF THE INVENTION
[0010] The inventors have engineered oncogenic and cancer-related transcription factors that function as epigenetic repressors, termed epigenetic silencer factors (ESFs), which enable, for example, the silencing of downstream tumorigenic networks and thus limit CSC survival and proliferation, thereby reducing the opportunity for tumor regrowth. Herein, the inventors provide polynucleotides (e.g., transgene expression cassettes) that include the ESF and miRNA target sequences that can regulate the expression of the ESF in a cell type-specific manner.
[0011] In this specification, the inventors provide polynucleotides (e.g., transgene expression cassettes) that utilize miRNA target sequences to regulate transgene expression. The expression cassette enables the regulation of transgene expression, thereby reducing or eliminating unwanted expression, improving safety, and reducing off-target effects.
[0012] In a first aspect, there is provided a polynucleotide comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.
[0013] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence, wherein the target sequence is operably linked to a transgene.
[0014] In one embodiment, the polynucleotide comprises at least one miR-338-3p target sequence, wherein the target sequence is operably linked to a transgene.
[0015] In one embodiment, the polynucleotide comprises at least one miR-31 target sequence, wherein the target sequence is operably linked to a transgene.
[0016] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence and at least one miR-338-3p target sequence, wherein the target sequences are operably linked to a transgene.
[0017] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence and at least one miR-31 target sequence, wherein the target sequences are operably linked to a transgene.
[0018] In one embodiment, the polynucleotide comprises at least one miR-338-3p target sequence and at least one miR-31 target sequence, wherein the target sequence is operably linked to a transgene.
[0019] In one embodiment, the polynucleotide comprises at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the target sequence is operably linked to a transgene.
[0020] In one aspect, there is provided a polynucleotide comprising at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.
[0021] In one embodiment, the copy number of each of the miRNA target sequences is independently selected from the group consisting of 1, 2, 3, and 4.
[0022] In one embodiment, the polynucleotide comprises four miR-124 target sequences, four miR-338-3p target sequences, and four miR-31 target sequences, wherein the miRNA target sequence is operably linked to a transgene.
[0023] In one embodiment: (a) the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1; (b) the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3.
[0024] In one embodiment, the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 1. In one embodiment, the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 2. In one embodiment, the miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 3.
[0025] In one embodiment: (a) The miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3.
[0026] In one embodiment: (a) The miR-124 target sequence comprises or consists of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence may comprise or consist of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence may comprise or consist of a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 3.
[0027] In one embodiment: (a) The miR-124 target sequence may comprise or consist of a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence may comprise or consist of a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence may comprise or consist of a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 3.
[0028] In one embodiment: (a) The miR-124 target sequence may comprise or consist of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence may comprise or consist of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence may comprise or consist of a nucleotide sequence having 100% sequence identity to SEQ ID NO: 3.
[0029] In one embodiment, the miRNA target sequence is downstream of the transgene, i.e., located 3'. In other words, the miRNA target sequence can be located after the transgene in the 5' to 3' direction.
[0030] In one embodiment, the miRNA target sequence is located within the 3'-UTR of the transgene.
[0031] In one embodiment, a cluster of miRNA target sequences or copies of miRNA target sequences is arranged in the order of a miR-124 target sequence, a miR-338-3p target sequence, and a miR-31 target sequence from 5' to 3'. A cluster containing a target sequence or one or more copies thereof can be arranged, for example, from 5' to 3', thereby forming groups according to their target specificities. For example, in one embodiment, the polynucleotide contains 5'-[miR-124 target sequence]4-[miR-338-3p target sequence]4-[miR-31 target sequence]4-3'.
[0032] Both individual target sequences and clusters of target sequences can be continuous with each other, separated by a spacer sequence, or any combination thereof.
[0033] Thus, in one embodiment, miRNA target sequences are separated by a spacer sequence.
[0034] In one embodiment, a polynucleotide is provided that contains a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4. In one embodiment, the polynucleotide contains a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0035] In one embodiment, the miRNA target sequence contains the sequence as shown in SEQ ID NO: 4.
[0036] In one embodiment, the miRNA target sequence consists of the sequence as shown in SEQ ID NO: 4.
[0037] In one embodiment, the transgene encodes an epigenetic silencer factor (ESF) that contains a transcription factor DNA-binding domain functionally linked to at least one epigenetic effector domain, wherein the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor.
[0038] In some embodiments, the ESF is a fusion protein comprising a transcription factor DNA-binding domain and at least one epigenetic effector domain.
[0039] In preferred embodiments, the transcription factor is an oncogenic transcription factor. In some embodiments, the transcription factor is a cancer-related transcription factor.
[0040] In one embodiment, the transcription factor is selected from the group consisting of SOX2, MYC, MYCN, TEAD1, TEAD2, TEAD3, TEAD4, FOXA1, FOXA2, ELK1, ELK3, ELK4, SRF, FOXM1, FOXC1, FOXC2, TWIST1, SALL4, ELF1, HIF1A, SOX9, SOX12, SOX18, ETS1, PAX3, PAX8, GLI1, GLI2, GLI3, ETV1, ETV2, ETV3, RUNX1, RUNX2, RUNX3, MAFB, TFAP2C, and E2F1.
[0041] In one embodiment, the transcription factor is SOX2.
[0042] In one embodiment, the transcription factor is TEAD1.
[0043] In one embodiment, the transcription factor is MYC.
[0044] In preferred embodiments, the ESF does not contain a transcription factor activation domain.
[0045] In one embodiment, the epigenetic effector domain is selected from the group consisting of a KRAB domain, a DNMT3A domain, a DNMT3L domain, a ZIM3-KRAB (Z-KRAB) domain, a chromoshadow (CS) domain, a YAF2-RYBP (Y-R) domain, an Engrailed repressor (En-R) domain, a MeCP2 domain, a GLI3RD domain, and a MAD1RD domain.
[0046] In one embodiment, the epigenetic effector domain is (a) a CS domain; (b) a Y-R domain; (c) a CS domain and a Y-R domain; (d) a KRAB domain; and / or (e) a DNMT3A domain and a DNMT3L domain.
[0047] The ESF according to the present invention can include combinations of a number of the above-described transcription factor DNA-binding domains and epigenetic effector domains.
[0048] In one embodiment, the epigenetic effector domain is a CS domain.
[0049] In one embodiment, the epigenetic effector domain is a Y-R domain.
[0050] In one embodiment, the epigenetic effector domain is a CS domain and a Y-R domain.
[0051] In one embodiment, the epigenetic effector domain is a KRAB domain.
[0052] In one embodiment, the epigenetic effector domain is a DNMT3A domain.
[0053] In one embodiment, the epigenetic effector domain is a DNMT3L domain.
[0054] In one embodiment, the epigenetic effector domain is a DNMT3A domain and a DNMT3L domain.
[0055] In one embodiment, the epigenetic effector domain is a ZIM3-KRAB (Z-KRAB) domain.
[0056] In one embodiment, the epigenetic effector domain is an engrailed repressor (En-R) domain.
[0057] In one embodiment, the epigenetic effector domain is a MeCP2 domain.
[0058] In one embodiment, the epigenetic effector domain is a GLI3RD domain.
[0059] In one embodiment, the epigenetic effector domain is a MAD1RD domain.
[0060] In one embodiment, the ESF is: (a) A KRAB domain, a SOX2 DNA-binding domain, a DNMT3A domain, and a DNMT3L domain; (b) A chromodomain (CS) and a SOX2 DNA-binding domain; (c) A SOX2 DNA-binding domain and a YAF2-RYBP (Y-R) domain; (d) A KRAB domain, a TEAD1 DNA-binding domain, a DNMT3A domain, and a DNMT3L domain; (e) A KRAB domain, a DNMT3A domain, a DNMT3L domain, and a MYC DNA-binding domain; (f) A chromodomain (CS) and a TEAD1 DNA-binding domain; (g) A TEAD1 DNA-binding domain and a YAF2-RYBP (Y-R) domain; (h) A chromodomain (CS), a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (i) A chromodomain (CS) and a MYC DNA-binding domain; (j) A YAF2-RYBP (Y-R) domain and a MYC DNA-binding domain; or (k) Chromoshadow (CS) domain, YAF2-RYBP (Y-R) domain, and MYC DNA-binding domain comprising.
[0061] In one embodiment, the ESF is, from 5' to 3': (a) KRAB domain, SOX2 DNA-binding domain, DNMT3A domain, and DNMT3L domain; (b) Chromoshadow (CS) domain and SOX2 DNA-binding domain; (c) SOX2 DNA-binding domain, and YAF2-RYBP (Y-R) domain; (d) KRAB domain, TEAD1 DNA-binding domain, DNMT3A domain, and DNMT3L domain; (e) KRAB domain, DNMT3A domain, DNMT3L domain, and MYC DNA-binding domain; (f) Chromoshadow (CS) domain, and TEAD1 DNA-binding domain; (g) TEAD1 DNA-binding domain, and YAF2-RYBP (Y-R) domain; (h) Chromoshadow (CS) domain, TEAD1 DNA-binding domain, and YAF2-RYBP (Y-R) domain; (i) Chromoshadow (CS) domain, and MYC DNA-binding domain; (j) YAF2-RYBP (Y-R) domain, and MYC DNA-binding domain; or (k) Chromoshadow (CS) domain, YAF2-RYBP (Y-R) domain, and MYC DNA-binding domain comprising.
[0062] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 114-119 and 126-131.
[0063] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 114 to 119 and 126 to 131.
[0064] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 95% sequence identity to any one of SEQ ID NOs: 114 to 119 and 126 to 131.
[0065] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 99% sequence identity to any one of SEQ ID NOs: 114 to 119 and 126 to 131.
[0066] In one embodiment, the polynucleotide comprises or consists of a nucleotide sequence of any one of SEQ ID NOs: 114 to 119 and 126 to 131.
[0067] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, to any one of SEQ ID NOs: 158 to 163.
[0068] In one embodiment, the polynucleotide comprises a sequence according to any one of SEQ ID NOs: 158 to 163.
[0069] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, to any one of SEQ ID NOs: 178 to 182.
[0070] In one embodiment, the polynucleotide comprises a sequence according to any one of SEQ ID NOs: 178 to 182.
[0071] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 164-174.
[0072] In one embodiment, the polynucleotide comprises a sequence that follows any one of SEQ ID NOs: 164-174. In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 136-141 and 153-157.
[0073] In one embodiment, the polynucleotide comprises a sequence that follows any one of SEQ ID NOs: 136-141 and 153-157.
[0074] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 142-152.
[0075] In one embodiment, the polynucleotide comprises a sequence that follows any one of SEQ ID NOs: 142-152.
[0076] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 114-119, 126-131, and 136-174.
[0077] In one embodiment, the polynucleotide comprises a sequence according to any one of SEQ ID NOs: 114-119, 126-131, and 136-174.
[0078] In one embodiment, the polynucleotide further comprises a promoter. In one embodiment, the promoter is operably linked to a nucleotide sequence encoding a transgene or ESF.
[0079] In one embodiment, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is the Ef1a promoter.
[0080] In one embodiment, the promoter is a tissue-specific promoter, preferably a cancer cell-specific promoter.
[0081] In one embodiment, the promoter is a proliferating cell-specific promoter.
[0082] In one embodiment, the polynucleotide further comprises a promoter operably linked to a transgene, and optionally, at this time, the promoter is a tissue-specific promoter or a constitutive promoter, optionally a cancer cell-specific promoter.
[0083] In one embodiment, the promoter is selected from the group consisting of the Mki67 promoter, Ccnd1 promoter, Ccnb2 promoter, Ccna2 promoter, Cdc25c promoter, Cdc2 promoter, Cks1 promoter, PCNA promoter, CDC6 promoter, POLD1 promoter, CSK1B promoter, MCM2 promoter, and PLK1 promoter.
[0084] In one embodiment, the promoter is the Mki67 promoter.
[0085] In one embodiment, the promoter is the Ef1a promoter.
[0086] In one aspect, a vector comprising a polynucleotide according to the present invention is provided.
[0087] In one embodiment, the vector is a viral vector.
[0088] In one embodiment, the vector is a lentiviral vector.
[0089] In one embodiment, the vector is an adeno-associated virus (AAV) vector.
[0090] In one embodiment, the AAV vector is of serotype 2, 5, or 9. In a preferred embodiment, the vector is an AAV2 vector. In another preferred embodiment, the vector is an AAV5 vector.
[0091] In one embodiment, the vector is an mRNA vector.
[0092] In one aspect, a protein encoded by a polynucleotide or vector according to the present invention is provided.
[0093] In one embodiment, a therapeutic protein encoded by a polynucleotide or vector according to the present invention is provided.
[0094] In one embodiment, ESF encoded by a polynucleotide or vector according to the present invention is provided.
[0095] In one aspect, a protein (e.g., ESF) is provided that comprises or consists of an amino acid sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 109 - 113 and 120 - 125.
[0096] In one embodiment, the polynucleotide or transgene encodes a protein having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, to any one of SEQ ID NOs: 109-113 and 120-125, or a fragment thereof.
[0097] In one embodiment, the polynucleotide or transgene encodes a protein having at least 90% sequence identity to any one of SEQ ID NOs: 109-113 and 120-125, or a fragment thereof.
[0098] In one embodiment, the polynucleotide or transgene encodes a protein having at least 95% sequence identity to any one of SEQ ID NOs: 109-113 and 120-125, or a fragment thereof.
[0099] In one embodiment, the polynucleotide or transgene encodes a protein having at least 99% sequence identity to any one of SEQ ID NOs: 109-113 and 120-125, or a fragment thereof.
[0100] In one embodiment, the polynucleotide or transgene encodes a protein having 100% sequence identity to any one of SEQ ID NOs: 109-113 and 120-125, or a fragment thereof.
[0101] In one aspect, there is provided a polynucleotide comprising a transgene encoding an epigenetic silencer factor (ESF), wherein the transgene is operably linked to at least one microRNA (miRNA) target sequence, and the ESF comprises a transcription factor DNA-binding domain operably linked to at least one epigenetic effector domain, and the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor.
[0102] The miRNA target sequence can be designed to be recognized by any suitable miRNA or selected from any suitable known miRNA target sequence, for example, an miRNA that is expressed in a cell type where transgene expression is not desired.
[0103] In one embodiment, at least one miRNA target sequence is a target site for an miRNA selected from the group consisting of miR-124, miR-338-3p, and miR-31.
[0104] In one embodiment, the miRNA target sequence is a target site for miR-124 or consists of a nucleotide sequence having at least 90% sequence identity, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, to SEQ ID NO: 1.
[0105] In one embodiment, the miRNA target sequence is a target site for miR-338-3p or consists of a nucleotide sequence having at least 90% sequence identity, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, to SEQ ID NO: 2.
[0106] In one embodiment, the miRNA target sequence is a target site for miR-31 or consists of a nucleotide sequence having at least 90% sequence identity, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, to SEQ ID NO: 3.
[0107] In one embodiment, at least one miRNA target sequence comprises SEQ ID NOs: 1, 2, and 3, or a sequence having at least 90% sequence identity, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, thereto.
[0108] In a preferred embodiment, at least one miRNA target sequence comprises target sites for miR-124, miR-338-3p, and miR-31, and preferably, at this time, there are 4 copies of each target sequence.
[0109] The order of the miRNA target sequences can vary. In one embodiment, the miRNA target sequences or clusters of copies of the sequences are arranged in the order of the miR-124 target sequence, the miR-338-3p target sequence, and the miR-31 target sequence from 5' to 3'.
[0110] In one embodiment, the miRNA target sequences or clusters of copies of the sequences are arranged in the order of the miR-124 target sequence, the miR-31 target sequence, and the miR-338-3p target sequence from 5' to 3'.
[0111] In another embodiment, the miRNA target sequences or clusters of copies of the sequences are arranged in the order of the miR-338-3p target sequence, the miR-124 target sequence, and the miR-31 target sequence from 5' to 3'.
[0112] In another embodiment, the miRNA target sequences or clusters of copies of the sequences are arranged in the order of the miR-338-3p target sequence, the miR-31 target sequence, and the miR-124 target sequence from 5' to 3'.
[0113] In another embodiment, the miRNA target sequences or clusters of copies of the sequences are arranged in the order of the miR-31 target sequence, the miR-124 target sequence, and the miR-338-3p target sequence from 5' to 3'.
[0114] In another embodiment, the miRNA target sequences or clusters of copies of the sequences are arranged in the order of the miR-31 target sequence, the miR-338-3p target sequence, and the miR-124 target sequence from 5' to 3'.
[0115] Both individual target sequences and clusters of copies of the sequences can be contiguous with each other, separated by spacer sequences, or any combination thereof.
[0116] Thus, in one embodiment, miRNA target sequences are separated by spacer sequences.
[0117] In one embodiment, a polynucleotide is provided that comprises a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4. In one embodiment, the polynucleotide comprises a sequence having at least 90% sequence identity to SEQ ID NO: 4, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
[0118] In one aspect, an epigenetic silencer factor (ESF) is provided that comprises a transcription factor DNA-binding domain operably linked to at least one epigenetic effector domain, or a polynucleotide encoding the same, wherein the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the ESF is: (a) a chromoshadow (CS) domain, and a TEAD1 DNA-binding domain; (b) a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (c) a chromoshadow (CS) domain, a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (d) a chromoshadow (CS) domain, and a MYC DNA-binding domain; (e) a YAF2-RYBP (Y-R) domain, and a MYC DNA-binding domain; or (f) a chromoshadow (CS) domain, a YAF2-RYBP (Y-R) domain, and a MYC DNA-binding domain and comprises.
[0119] In one embodiment, an epigenetic silencer factor (ESF) is provided that includes a transcription factor DNA-binding domain functionally linked to at least one epigenetic effector domain, wherein the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the ESF is: (a) a chromoshadow (CS) domain, and a TEAD1 DNA-binding domain; (b) a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (c) a chromoshadow (CS) domain, a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (d) a chromoshadow (CS) domain, and a MYC DNA-binding domain; (e) a YAF2-RYBP (Y-R) domain, and a MYC DNA-binding domain; or (f) a chromoshadow (CS) domain, a YAF2-RYBP (Y-R) domain, and a MYC DNA-binding domain and consists of.
[0120] In one embodiment, the ESF includes a sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 120-125, or a fragment thereof.
[0121] In one embodiment, the ESF includes a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 120-125, or a fragment thereof.
[0122] In one embodiment, the ESF includes a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 120-125, or a fragment thereof.
[0123] In one embodiment, the ESF comprises a sequence having at least 99% sequence identity to any one of SEQ ID NOs: 120 to 125, or a fragment thereof.
[0124] In one embodiment, the ESF comprises a sequence having 100% sequence identity to any one of SEQ ID NOs: 120 to 125, or a fragment thereof.
[0125] In one embodiment, the ESF comprises or consists of a sequence that follows any one of SEQ ID NOs: 120 to 125, or a fragment thereof.
[0126] In one embodiment, the polynucleotide encoding the ESF comprises a sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 126 to 131.
[0127] In one embodiment, the polynucleotide encoding the ESF comprises a sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 158 to 163.
[0128] In one embodiment, the polynucleotide encoding the ESF comprises a sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 178 to 182.
[0129] In one embodiment, the polynucleotide encoding ESF comprises a sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, to any one of SEQ ID NOs: 168 to 173.
[0130] In one embodiment, the polynucleotide encoding ESF comprises a sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, to any one of SEQ ID NOs: 136 to 141.
[0131] In one embodiment, the polynucleotide encoding ESF comprises a sequence having at least 70% sequence identity, such as at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, to any one of SEQ ID NOs: 146 to 148 and 150 to 152.
[0132] The following aspects and embodiments can be applied to any of the above-described aspects and embodiments of the present invention.
[0133] In one aspect, there is provided a nanoparticle comprising a polynucleotide, vector, ESF, or protein according to the present invention.
[0134] In one embodiment, the nanoparticle is a polymeric nanoparticle, an inorganic nanoparticle, or a lipid nanoparticle. In some embodiments, the nanoparticle is a liposome.
[0135] In one aspect, there is provided a cell comprising a polynucleotide, vector, protein, ESF, or nanoparticle according to the present invention.
[0136] In one embodiment, the cell is a eukaryotic cell such as a mammalian cell. In another embodiment, the cell is a human cell.
[0137] In one aspect, a composition is provided that includes a polynucleotide, vector, protein, ESF, nanoparticle, or cell according to the present invention.
[0138] The composition can be a hydrogel. In some embodiments, the hydrogel is a poly(ethylene glycol) dimethacrylate (PEG-DMA) hydrogel. In some embodiments, the hydrogel further includes hydroxyapatite nanoparticles.
[0139] In one aspect, a pharmaceutical composition is provided that includes a polynucleotide, vector, protein, ESF, nanoparticle, or cell according to the present invention, and a pharmaceutically acceptable diluent, solvent, carrier, salt, and / or adjuvant.
[0140] In one aspect, a polynucleotide, vector, protein, ESF, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention is provided for use in therapy.
[0141] In one aspect, a polynucleotide, vector, protein, ESF, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention is provided for use in the treatment of a disease or disorder.
[0142] In one aspect, a polynucleotide, vector, protein, ESF, nanoparticle, cell, composition, or pharmaceutical composition according to the present invention is provided for use in the treatment of cancer.
[0143] In some embodiments, the cancer is glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, liver cancer, pancreatic cancer, bladder cancer, oropharyngeal cancer, or kidney cancer. In some embodiments, the cancer is a brain tumor. In some embodiments, the cancer is gliobastoma multiforme.
[0144] In one embodiment, the cancer is a liver metastasis.
[0145] In one embodiment, the cancer is colon cancer, such as, for example, colon adenocarcinoma. In one embodiment, the cancer is colorectal cancer (CRC).
[0146] In some embodiments, the treatment reduces tumor size.
[0147] In some embodiments, the treatment is adjuvant therapy, optionally in combination with surgery. The treatment can reduce the risk of cancer (e.g., GBM) recurrence.
[0148] In some embodiments, the ESF, polynucleotide, vector, cell or composition (e.g., hydrogel) is administered locally.
[0149] In one aspect, there is provided the use of a polynucleotide, vector, protein, ESF, nanoparticle, cell, composition, or pharmaceutical composition according to the invention for reducing the transcription and / or expression of at least one target gene in a cell.
[0150] In one aspect, there is provided a method for reducing the transcription and / or expression of at least one target gene in a cell, comprising the step of introducing a polynucleotide, vector, protein, ESF, nanoparticle, cell, composition, or pharmaceutical composition according to the invention into the cell.
[0151] In one embodiment, the method described above is an in vitro method.
[0152] In one embodiment, the method described above is an in vivo method.
[0153] In one embodiment, the method described above is an ex vivo method.
[0154] In one embodiment, at least one target gene is silenced, preferably permanently silenced.
[0155] In another aspect, the invention provides the use of a polynucleotide, vector, protein, ESF, nanoparticle, cell, composition, or pharmaceutical composition according to the invention for the manufacture of a medicament for therapy.
[0156] In another aspect, the invention provides the use of a polynucleotide, vector, protein, ESF, nanoparticle, cell, composition, or pharmaceutical composition according to the invention for the manufacture of a medicament for the treatment of cancer.
[0157] In one aspect, an epigenetic silencer factor (ESF) for use in the treatment of cancer, or a polynucleotide encoding the same, is provided, wherein the ESF comprises a transcription factor DNA-binding domain operably linked to at least one epigenetic effector domain, the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the cancer is selected from the group consisting of glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, liver cancer, pancreatic cancer (e.g., human pancreatic ductal adenocarcinoma), bladder cancer, oropharyngeal cancer, kidney cancer, colon cancer (e.g., colon adenocarcinoma), or metastases of any of the foregoing.
[0158] The ESF or polynucleotide can be, for example, in the form of or included in a vector, nanoparticle, cell or composition.
[0159] In some embodiments, the cancer is glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, pancreatic cancer (e.g., human pancreatic ductal adenocarcinoma), bladder cancer, oropharyngeal cancer, colon cancer (e.g., colon adenocarcinoma) or kidney cancer. In some embodiments, the cancer is a brain tumor. In some embodiments, the cancer is glioblastoma multiforme.
[0160] In one embodiment, the cancer is glioblastoma, prostate cancer, human pancreatic ductal adenocarcinoma, colon cancer or colon adenocarcinoma.
[0161] In one embodiment, the cancer is a metastasis of a primary cancer, where the primary cancer is glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, pancreatic cancer (e.g., human pancreatic ductal adenocarcinoma), bladder cancer, oropharyngeal cancer, colon cancer (e.g., colon adenocarcinoma) or kidney cancer. In some embodiments, the primary cancer is a brain tumor. In some embodiments, the primary cancer is gliobastoma multiforme.
[0162] In one embodiment, the cancer is glioma.
[0163] In one embodiment, the cancer is human pancreatic ductal adenocarcinoma.
[0164] In one embodiment, the cancer is a liver metastasis of colon cancer. In one embodiment, the cancer is a liver metastasis of pancreatic adenocarcinoma. In one embodiment, the cancer is a liver metastasis of colorectal cancer (CRC).
[0165] In one embodiment, the cancer is colon cancer.
[0166] In some embodiments, the metastasis is a liver metastasis (preferably derived from colon cancer).
[0167] In some embodiments, the treatment is adjuvant therapy, optionally in combination with surgery. The treatment can reduce the risk of cancer (e.g., GBM) recurrence.
[0168] In some embodiments, the ESF, polynucleotide, vector, cell or composition (e.g., hydrogel) is administered locally.
[0169] In one embodiment, the vector is a viral vector.
[0170] In one embodiment, the vector is a lentiviral vector.
[0171] In one embodiment, the vector is an adeno-associated virus (AAV) vector.
[0172] In one embodiment, the vector is an mRNA vector.
Brief Description of the Drawings
[0173] Polynucleotide and transgene cassette It is a figure showing the generation and testing of the SOX2 epigenetic silencer (SES). (a) A construct generated based on the human SOX2 transcription factor and the epigenetic domains KRAB, DNMT3a (3A) and DNMT3L (3L), with V5 added as a tag. (b) Infection efficiency of lentiviruses carrying the indicated constructs in SNB19 cells. (c) Left: The growth curve of SNB19 cells infected with the indicated constructs shows that SES could kill the cells 12 days after culture. ****p<0.0001; statistically compared using two-way ANOVA; Right: Micrographs of cells at the indicated time points from mock (GFP) or SES infection. (d) Western blot (WB) for V5, SOX2 and H3 (as a loading control) in SNB19 cells not infected or infected with lentiviruses carrying GFP or SES. Triplet miRNA cassette It is a figure showing the generation and testing of the SOX2 epigenetic silencer (SES). (e) Left: Growth curve of U87 cells, ****p<0.0001; statistically compared using two-way ANOVA; Right: Micrographs of cells before treatment and 9 days after mock (GFP) or SES infection. (f) Left: Growth curve of U251 cells, ***p<0.001; statistically compared using two-way ANOVA; Right: Micrographs of cells before treatment and 10 days after mock (GFP) or SES infection. (g) Quantification of the indicated SOX2 targets in SNB19 cells 3 days after GFP or SES infection. ****p<0.0001, ***p<0.001; statistically compared using an unpaired t-test. (h) Growth curves of the indicated cancer cell lines. ***p<0.001, ns = not significant; statistically compared using two-way ANOVA. miRNA cassette containing ESF This is a figure showing the efficacy of the SOX2 epigenetic silencer against patient-derived cancer stem cells in vitro. (a) Micrographs, growth curves, and percentage of dead cells of patient-derived stem cells (CSCs) of classical (left) and mesenchymal (right) GBM subtypes infected with GFP (both subtypes), SES (both), or binding-deficient SES (R74P-L97P, classical subtype only). ****p<0.0001; ***p<0.001; statistically compared using two-way ANOVA. Spacer This is a figure showing the efficacy of the SOX2 epigenetic silencer against patient-derived cancer stem cells in vitro. (b) CSCs (classical type) not infected or infected with lentiviruses carrying GFP or SES were assayed for their clonogenic ability using the number and size of spheres (percentage of spheres <100 μm in diameter) at the time points indicated as parameters. ****p<0.0001; statistically compared using two-way ANOVA. Transgene This is a figure showing the molecular consequences of SES. (a) SES caused severe gene deregulation in both U87 and SNB19 cells as evaluated by RNA-seq. (b) IGV snapshots of RNAseq tracks within the Sox2 locus in both cell lines under each condition (mock and SES infection) show overexpression of the first part of SOX2 (see Fig. 1a, included in the SES construct) in both SOX2-negative (U87) and SOX2-positive (SNB19) cell lines. (c) Gene ontology analysis showed that genes related to apoptosis (upregulation) and cell cycle regulation (downregulation) were disrupted by SES expression. Epigenetic silencer factor (ESF)This is a figure showing the molecular regression of SES. (d) Genes predicted to be regulated by SOX2 were affected, and the majority were downregulated. (e) Density plots of ChIP-seq normalized signals (SOX2 and SES) against SOX2 peaks showed that SES binds to the same regions at the genome-wide level. (f) Density plots of MeDIP-seq normalized signals (mock and SES) against SOX2 peaks showed that SES can increase DNA methylation levels. Epigenetic effector domain SES functionality in vivo: This is a figure showing xenograft transplantation. (a) Xenograft transplantation by subcutaneous injection of 1 million GBM cells pre-infected with mock (GFP) or SES in NSG mice. (b) Four weeks after injection, mock U87 cells always formed a large mass, but only one small nodule was recovered from SES-infected cells. (c) Evaluation of the volume of tumors generated using the indicated cells after the indicated time window (Mo = months). Kruppel-associated box (KRAB) domain SES functionality in vivo: This is a figure showing orthotopic xenograft transplantation. (a) Orthotopic xenograft transplantation by injection of 300,000 cells pre-infected with mock (GFP) or SES into the striatum of the brains of NSG mice. (b - c) Twenty-five to thirty days after injection, mock U87 cells always formed a large GFP-positive tumor, which could also invade the cortex, but no tumors were detected in the brains transplanted with SES U87 cells by either Nissl histological staining (b) or V5 antibody (c). (d) Tumors arising from mock cells were formed by human nuclear (HuN)-positive proliferative (PH3-positive) cells, but human cells were not substantially recovered in the brains injected with SES cells. Notably, a few PH3-positive cells were present, localized at the level of the lateral ventricle, and were probably active dividing mouse neural progenitor cells. DNA methyltransferase (DNMT) domainIn vivo SES functionality: Figure showing orthotopic xenotransplantation. (e) Tumor volume estimation. (f) Kaplan–Meier curves showing that mice injected with mock cells died within 1 month of surgery, whereas SES-administered animals were in good health and survived until the time of sacrifice (n = 5 animals / group). (g) Xenografts of mock-infected CSCs gave rise to large tumors, whereas mice injected with SES CSCs showed small tumors 6 weeks after surgery. (h) Tumor volume estimation. (i) Kaplan–Meier curves showing that mice injected with mock cells died within 6 weeks of surgery, whereas SES-administered animals were in relatively good condition at the time of sacrifice (n = 5 animals / group). DNMT-like domain Figure showing GBM-cortical organoids. (a) Initial patterned cortical organoids were seeded with GBM floating spheres (labeled with RFP) to obtain fusions. (b) Fused GBM-cortical organoids (1 week after seeding) using either mock or SES-infected spheres were fixed, sectioned, and stained. Note that SES restricts the growth and invasion of GBM cells (RFP positive) in normal cortical parenchyma (DAPI staining only). Chromoshadow (CS) domainIn vivo SES functionality: figure showing the treatment of preformed orthotopic xenografts. (a) Orthotopic xenografts were generated by injection of 75,000 naive U87 cells into the striatum of NSG mice; 4 days later, the animals were reoperated to inject mock (GFP) or SES-bearing lentivirus and evaluated 26 days later (total of 30 days). (b) Histological staining at the time of lentivirus injection (before treatment) and at the end of the protocol (after treatment) showed that tumor growth was restricted in SES-treated animals. (c) Estimation of tumor volume 26 days after lentivirus injection (treatment). (d) Kaplan–Meier curves show that mice injected with tumors with mock virus died within 2 months after cell injection, while all SES-administered animals reached 3 months except one (n = 4 animals / group). (e) Immunohistochemistry showed that the resulting tumors were GFP positive in the case of mock treatment and V5 negative in the case of SES injection (asterisk), suggesting a negative selection effect on those tumor cells infected with the SES virus. Notably, the V5 label (arrowhead) was present in the parenchyma of the mouse brain around the tumor. (f) Orthotopic xenografts were generated by injection of 100,000 naive CSCs into the striatum of NSG mice; 7 days later, the animals were reoperated to inject mock (GFP) or SES-bearing lentivirus and evaluated by MRI scan 6 weeks after treatment (7 weeks after cell transplantation) and sacrificed. YAF2-RYBP (Y-R) domain In vivo SES functionality: figure showing the treatment of preformed orthotopic xenografts. (g) Examples of MRI scans at 3, 4, and 5 weeks post-injection (p.i.) (two slices each for one mock-treated and one SES-treated mouse). (h) Histological staining at the end of the protocol (endpoint) showed that tumor growth was restricted in SES-treated animals. (i) Evaluation of tumor volume measured by the hyperintensity of T2-weighted imaging (MIPAV software). (j) Estimation of tumor volume by histological measurement at the endpoint and thus 6 weeks after lentivirus injection (treatment), 7 weeks after CSC injection. Additional epigenetic effector domainFigure showing the effect of SES on cultured neurons. (a) Evaluation of infection and death of primary murine hippocampal neurons infected with mock or SES showed no SES-induced neurodegeneration. (b) SES caused only minor gene dysregulation in mouse primary neurons as evaluated by RNA-seq. Transcription factor Figure showing the effect of SES on cultured neurons. (c) Human iPSC-derived neurons were infected with mock or SES. (d) Evaluation of neuronal loss through staining for PI, V5, and MAP2 showed that the presence of SES did not increase neuronal death, at least 21 days after infection. Exemplary ESF Figure showing the effect of SES on normal mouse brain. (a) Mock or SES lentivirus injection into the hippocampus of WT c57bl / 6 mice. (b) Example of viral transduction in the mouse hippocampus using GFP as a reporter 4 weeks after injection. (c) Quantification of both viral genome and mRNA of the exogenous transgene in the infected hippocampus by qPCR showed no differences between conditions. (d) Quantification of cleaved caspase 3-positive cells in the infected hippocampus showed no differences between conditions, indicating that SES was not toxic to mouse neurons in this setting. (e) The spontaneous alternation test showed no differences between mock-injected and SES-injected mice when evaluated by both the percentage of entries into different arms relative to total entries, and the percentage of spontaneous alternation performance (SAP), percentage of alternating arm returns (ARR), and percentage of same arm returns (SAR). Statistical comparison was performed using the Mann–Whitney test. TagThis is a figure showing the effect of SES on normal mouse brains. (f) The radial maze test showed no specific tendency differences in the time to perform the task or in making errors during the entire protocol of the test for SES-treated animals compared to mock-injected animals. Statistical comparisons were made using two-way ANOVA. (g) Morris water maze test. The left side shows the protocol and the layout of the platform (black square) used by the inventors. On the right side, the plot of the time used to perform the task (upper) and the quantification of the time spent in the platform area or the opposite area (lower) indicate no differences between the conditions. Statistical comparisons were made using the Mann-Whitney test. Expression control sequence This is a figure showing vector improvement. (a) The scheme depicts the original SES (v1) and an additional version (v1.1) carrying a different promoter, the KI67 promoter expressed in proliferating cells. (b) The SES v1.1 test in U251 cells showed that the KI67 promoter led to the expression of the transgene (GFP or SES) in a very high percentage of KI67-positive proliferating cells. The effect of SES v1.1 on growth was similar compared to the original version. Promoter This is a figure showing vector improvement. (c) Both constitutive GFP and pKI67-GFP were used on primary mouse cortical cultures, which mainly contain post-mitotic neurons but also include both proliferative and post-mitotic glial types. Immunofluorescence using the indicated antibodies showed that GFP led by pKI67 was found only in KI67+ proliferating cells (red arrows and quantification) and not in MAP2+ neurons (white arrows and quantification). Constitutive GFP was observed in almost all cells as expected. miRNA target sequenceFigure showing the generation of other ESFs. (a) A construct prepared based on the human SOX2 transcription factor fused with the epigenetic domain chromoshadow (CS) and V5 was named SES v2. A construct prepared based on the human SOX2 transcription factor fused with the epigenetic domain YAF2-RYBP (Y-R) and V5 was named SES v3. (b) Infection efficiency of lentiviruses carrying the constructs shown in U251 cells (see panel). (c) The growth curves of U251 cells infected with the constructs shown indicate that SESv2 and v3 were able to kill the cells after 9 days in culture. ****p < 0.0001; statistically compared using two-way ANOVA. Exemplary construct Figure showing the generation of other ESFs. (d) A construct prepared based on the human TEAD1 transcription factor and the epigenetic domains KRAB, DNMT3a (3A), DNMT3L (3L), and V5 was named TES, and a construct prepared based on the human MYC transcription factor and the epigenetic domains KRAB, DNMT3a (3A), DNMT3L (3L), and V5 was named MES. (e) Infection efficiency of lentiviruses carrying the constructs shown in U251 cells (see right panel). (e) The growth curves of U251 cells infected with the constructs shown indicate that MES was able to kill the cells after 9 days in culture. ****p < 0.0001. Target gene transcription and expression Figure showing the efficacy of SESv3 against patient-derived cancer stem cells in vitro. Micrographs (a) and growth curves (b) of patient-derived stem cells (CSC) of the classical GBM subtype infected with either GFP or SESv3. ****p < 0.0001; ***p < 0.001; statistically compared using two-way ANOVA. ProteinFigure showing the efficacy of TES and MES against patient-derived cancer stem cells in vitro. (a–c) Micrographs (a), growth curves, and percentage of dead cells (b–c) of patient-derived stem cells (CSCs) of classical (left) and mesenchymal (right) GBM subtypes that were not infected (NI) or infected with GFP or TES. *p < 0.05; ***p < 0.001; ****p < 0.0001; ns = not significant; statistically compared using two-way ANOVA. Protein transduction Figure showing the efficacy of TES and MES against patient-derived cancer stem cells in vitro. (d–e) Growth curves and percentage of dead cells of patient-derived stem cells (CSCs) of classical (left, d) and mesenchymal (right, e) GBM subtypes that were not infected (NI) or infected with GFP or TES. *p < 0.05; ***p < 0.001; ****p < 0.0001; ns = not significant; statistically compared using two-way ANOVA. Polynucleotide TES / MES functionality in vivo: Figure showing xenotransplantation. (a) Xenotransplantation by subcutaneous injection of 3,000,000 classical CSCs pre-infected with mock (GFP) or TES or MES in NSG mice. Four weeks after injection, mock CSCs always generated large masses, while relatively small tumors developed from TES (b–c) or MES-infected cells (d–e). Vector TES / MES functionality in vivo: Figure showing orthotopic xenotransplantation. (a) Orthotopic xenotransplantation by injection of 300,000 classical CSCs pre-infected with mock (GFP) or TES or MES into the striatum of the brains of NSG mice. (b) Five weeks post-injection (WPI), mock CSCs always generated large tumors that could also invade the cortex, while TES cells formed relatively small tumors in the brain. Evaluation by Nissl histological staining. (c) Estimation of tumor volume (n = 4 animals / group). Viral vectorIn vivo TES / MES functionality: Figure showing orthotopic xenotransplantation. (d) Three weeks post-injection (WPI), mock CSCs already showed significant tumor masses, while MES cells formed relatively small tumors. Evaluation by DAPI staining. (c) Estimation of tumor volume (n = 4 animals / group). Retroviral and lentiviral vectors In vivo TES functionality: Treatment of pre-formed orthotopic xenografts. (a) Orthotopic xenografts were generated by injection of 300,000 classical CSCs into the striatum of NSG mice; 7 days later, the animals were re-operated to inject either mock (GFP) or TES-carrying lentivirus and evaluated 3 weeks post-treatment (WPT) (total 4 weeks). (b) DAPI staining at the end of the protocol (post-treatment) showed that tumor growth was restricted to the injection site in TES-treated animals, while large masses were present in mock-treated mice. (c) Estimation of tumor volume 3 weeks after lentivirus injection (treatment) (n = 3 animals / group). Adeno-associated virus (AAV) vector Figure showing epigenetic silencer factor constructs. Schematic representation of ESF constructs. (a) Constructs generated based on the human TEAD1 transcription factor and the epigenetic repressor domains chromoshadow (CS) (from gene CBX5) and YAF2-RYBP (YR) (from gene RYBP), each variant having a V5 tag at the C-terminus. (b) Constructs generated based on the human MYC transcription factor and the epigenetic repressor domains chromoshadow (CS) (from gene CBX5) and YAF2-RYBP (YR) (from gene RYBP). Each variant has a 3' V5 tag. Subscript notations indicate the respective amino acid ranges of the protein domains encoded by the constructs. Variants, derivatives, analogs, homologs, and fragmentsFigure showing the enhancement of ESF specificity using miRNA-based off-target silencer factor constructs. (a) Schematic depiction of both control and SES vectors containing the Tmir cassette (4 copies of miRNA target sequences for miR124, miR338-3p, and miR31 each) within the 3'UTR. The Tmir cassette enables transgene expression in cancer cells but not in brain cells (neurons, oligodendrocytes, and astrocytes). Codon optimization Figure showing the enhancement of ESF specificity using miRNA-based off-target silencer factor constructs. (b) As shown by GFP / V5 expression counterstained with Hoecst, both GFP-Tmir and SES-Tmir are expressed in the U251 GBM cancer cell line. SES-Tmir can reduce cancer cell proliferation in vitro. Composition Figure showing the enhancement of ESF specificity using miRNA-based off-target silencer factor constructs. (c) SES-Tmir is not expressed (is off-targeted) in primary mouse cortical cultures containing post-mitotic neurons, post-mitotic and proliferative astrocytes, and proliferative oligodendrocyte precursor cells (OPCs). Therapeutic method Figure showing AAV functionality against patient-derived cancer stem cells. A recombinant AAV serotype containing the Ef1a::GFP construct was used to infect patient-derived GBM cancer stem cells in vitro. Four days after infection, the cells were fixed, immunofluorescence was performed against GFP, and the cells were stained with Hoecst, a nuclear marker. AdministrationFigure showing the efficacy of ESF in various cancer cell types. (a) Growth curves of CT26 cells derived from liver metastases of colon adenocarcinoma in mice treated with lentivirus carrying either GFP or SES (Sox2 epigenetic silencer). ****p < 0.0001. (b) Growth curves of BxPC-3 cells, human pancreatic ductal adenocarcinoma cells, treated with lentivirus carrying either GFP or TES (Tead epigenetic silencer). ****p < 0.0001. (c) Growth curves of CFPAC-1 cells, human pancreatic ductal adenocarcinoma cells, treated with lentivirus carrying either GFP or TES (Tead epigenetic silencer). ****p < 0.0001. Dosage Figure showing the effect of SESv3 on SNB19 cells. (a) Infection efficiency, micrograph and quantification of lentivirus carrying the indicated construct in SNB19 cells. (b) Growth curves of SNB19 cells treated with lentivirus carrying either GFP or SES or SESv3; control means untreated cells. **p < 0.01; ns p > 0.05. (c) Percentage of cell death (cells positive for trypan blue solution) of SNB19 cells treated with lentivirus carrying either GFP or SES or SESv3; control means untreated cells. ***p < 0.001; ns p > 0.05. Subject Figure showing the comparative effect of TES in SNB19 cells. (a) Growth curves of SNB19 cells treated with lentivirus carrying either GFP or TES, TES mutated to affect DNA binding ability, YAP / TAZ inhibitor verteporfin (concentration 2 μM); control means untreated cells. **p < 0.01. (b) Percentage of cell death (cells positive for trypan blue solution) of SNB19 cells treated with lentivirus carrying either GFP or TES, TES mutated to affect DNA binding ability, YAP / TAZ inhibitor verteporfin (concentration 2 μM); control means untreated cells. ***p < 0.001; *p < 0.05. Example A Figure showing the transcriptional effect of TES in SNB19 cells. (a) Volcano plot showing differentially expressed genes from an RNAseq experiment comparing SNB19 cells treated with lentivirus carrying either GFP or TES. (b) Gene set enrichment analysis (GSEA) for a gene set manually curated from a literature review of experimentally validated YAP / TAZ targets. (c) Motif enrichment analysis using Homer for the promoters (from -1,000 + 100 bp from the TSS) of genes downregulated in TES-treated SNB19. Results Figure showing the transcriptional effect of TES in SNB19 cells. (d) Overview of gene ontology analysis (biological process) performed on genes upregulated or downregulated after TES treatment. Discussion Figure showing that TES impairs migratory activity in SNB19 cells. (a) Gene set enrichment analysis (GSEA) for the indicated gene sets related to migratory ability in various cell types. Materials and methods Figure showing that TES impairs migratory activity in SNB19 cells. (b) Representative digital photographs of the wound healing assay were taken 0 hours, 24 hours, and 48 hours after scratching performed 2 days after the start of the indicated treatment. Quantification of the results is shown on the right. Construct Figure showing that SES impairs the growth of metastatic cells derived from a mouse model. (a) Schematic diagram of the Flex construct and function. (b) Stable lines of MC38 cells (derived from liver metastases of a mouse model of colorectal cancer - CRC) carrying the Flex-SES construct already show SES vulnerability 6 days after CRE recombinase-mediated SES expression. (c) Stable lines of K8484 cells (derived from liver metastases of a mouse model of pancreatic ductal adenocarcinoma - PDAC) carrying the Flex-SES construct already show SES vulnerability 6 days after CRE recombinase-mediated SES expression.
Mode for Carrying Out the Invention
[0174] As used herein, the terms "comprising," "including," and "consisting of" are synonymous with "beginning with" or "including"; or "containing" or "containing," and are inclusive or open-ended and do not exclude additional unrecited members, elements or steps. The terms "comprising," "including," and "consisting of" also include the term "consisting of."
[0175] When referring to a protein or polypeptide herein, the same may equally apply to the polynucleotide encoding it, and it will be understood that, where relevant (i.e., when referring to the coding sequence within a polynucleotide), the reverse is also true.
[0176] It will be understood that any of the following aspects of the invention can be suitably combined in the practice of the invention herein. For example, a miRNA transgene cassette according to the invention can be used in combination with an ESF according to another aspect of the invention, or can be used independently to deliver any suitable transgene.
[0177] Lentivirus production Cell culture Herein, the inventors provide a transgene expression cassette comprising a target sequence recognized by a microRNA (miRNA) for regulating transgene expression. Said expression cassette enables the expression of the transgene to be regulated, thereby reducing or eliminating unwanted expression in cell types containing the miRNA, thereby improving safety and reducing off-target effects.
[0178] In one aspect, a polynucleotide is provided comprising at least one miR-124 target sequence, at least one miR-338-3p target sequence and at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.
[0179] In one embodiment, the copy number of each of the miRNA target sequences is independently selected from the group consisting of one, two, three, and four.
[0180] In one embodiment, the copy number of each of the miRNA target sequences is one.
[0181] In one embodiment, the copy number of each of the miRNA target sequences is two.
[0182] In one embodiment, the copy number of each of the miRNA target sequences is three.
[0183] In one embodiment, the copy number of each of the miRNA target sequences is four.
[0184] In one embodiment, the copy number of each of the miRNA target sequences is more than four, such as five, six, seven, eight, nine, or ten.
[0185] A preferred miRNA target sequence for miR-124 is
Chemical formula
[0186] In one embodiment, the miRNA target sequence includes the sequence of SEQ ID NO: 1.
[0187] A preferred miRNA target sequence for miR-338-3p is
Chemical formula
[0188] In one embodiment, the miRNA target sequence includes the sequence of SEQ ID NO: 2.
[0189] A preferred miRNA target sequence for miR-31 is
Chemical formula
[0190] In one embodiment, the miRNA target sequence comprises the sequence of SEQ ID NO: 3.
[0191] In one embodiment, the miRNA target sequence comprises SEQ ID NOs: 1, 2, and 3.
[0192] In one embodiment, the miRNA target sequence is downstream of the transgene, i.e., located 3'.
[0193] In one embodiment, the miRNA target sequence is located within the 3'-UTR of the transgene.
[0194] In one embodiment, a cluster of miRNA target sequences or copies of the sequence are arranged in the order of miR-124, miR-338-3p, and miR-31 from 5' to 3'.
[0195] According to the above embodiments, a cluster containing a target sequence or one or more copies thereof is arranged from 5' to 3', thereby forming groups according to their target specificities, i.e., 5'-[miR-124 target sequence]4-[miR-338-3p target sequence]4-[miR-31 target sequence]4-3'.
[0196] Both individual target sequences and clusters of copies of the sequence can be contiguous with each other, separated by spacer sequences, or any combination thereof.
[0197] Thus, in one embodiment, the miRNA target sequences are separated by spacer sequences.
[0198] In an embodiment where the polynucleotide contains four target sequences for each of miR-124, miR-338-3p, and miR-31, the polynucleotide can contain a sequence as set forth in SEQ ID NO: 4.
[0199] Triple miRNA target sequence (Tmir) (SEQ ID NO: 4):
Chem.
[0200] In one embodiment, the polynucleotide comprises a sequence as set forth in SEQ ID NO: 4.
[0201] In one embodiment, the polynucleotide consists of a sequence as set forth in SEQ ID NO: 4.
[0202] The polynucleotides and transgene cassettes described herein can be used with any transgene as described herein, for example, ESF.
[0203] MiR-124 may also be referred to as, for example, miRNA-124 or miR124; miR-338-3p may also be referred to as miR-338-3p, or miRNA338-3p; and miR-31 may also be referred to as miRNA-31 or miR31.
[0204] Growth curve analysis MiRNA-mediated regulation of transgene expression can be utilized to control ESF according to the present invention. Thus, in one aspect, there is provided a polynucleotide comprising an epigenetic silencer factor (ESF) sequence operably linked to at least one microRNA (miRNA) target sequence, wherein the ESF comprises a transcription factor DNA-binding domain operably linked to at least one epigenetic effector domain, and the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor.
[0205] In one embodiment, the miRNA target sequence is located downstream of the ESF coding sequence, i.e., 3'.
[0206] In one embodiment, the miRNA target sequence is located within the 3'-UTR of the transgene.
[0207] The miRNA target sequence may be represented by one of multiple copies of a sequence of a given identity. The copy number of each target sequence can be independently selected, i.e., the copy number of a given sequence does not necessarily depend on the copy number of another different sequence.
[0208] Thus, in one embodiment, the miRNA target sequence comprises two or more copies of said miRNA target sequence.
[0209] In one embodiment, the miRNA target sequence comprises one copy of said miRNA target sequence.
[0210] In one embodiment, the miRNA target sequence comprises two copies of said miRNA target sequence.
[0211] In one embodiment, the miRNA target sequence comprises three copies of said miRNA target sequence.
[0212] In one embodiment, the miRNA target sequence comprises four copies of said miRNA target sequence.
[0213] In one embodiment, the miRNA target sequence comprises more than four copies, e.g., five, six, seven, eight, nine, or ten copies of said miRNA target sequence.
[0214] The miRNA target sequence can be designed to be recognized by any suitable miRNA or selected from any suitable known miRNA target sequence, e.g., a miRNA expressed in a cell type where transgene expression is not desired.
[0215] In one embodiment, the miRNA target sequence is a target for a miRNA selected from the group consisting of miR-124, miR-338-3p, and miR-31.
[0216] In one embodiment, the miRNA target sequence is a target site for miR-124.
[0217] In one embodiment, the miRNA target sequence is a target site for miR-338-3p.
[0218] In one embodiment, the miRNA target sequence is a target site for miR-31.
[0219] In one embodiment, the miRNA target sequence comprises a sequence selected from the group consisting of SEQ ID NO: 1, 2, and 3.
[0220] In one embodiment, the miRNA target sequence comprises a sequence according to SEQ ID NO: 1.
[0221] In one embodiment, the miRNA target sequence comprises a sequence according to SEQ ID NO: 2.
[0222] In one embodiment, the miRNA target sequence comprises a sequence according to SEQ ID NO: 3.
[0223] In one embodiment, the miRNA target sequence comprises target sites for miR-124, miR-338-3p, and miR-31.
[0224] In one embodiment, the miRNA target sequence comprises SEQ ID NO: 1, 2, and 3.
[0225] In a preferred embodiment, the miRNA target sequence comprises four copies of the target sequence for each of miR-124, miR-338-3p, and miR-31.
[0226] The order of the miRNA target sequences can vary. In one embodiment, the miRNA target sequence or cluster of copies of the sequence is arranged in the order of miR-124, miR-338-3p, and miR-31 from 5' to 3'.
[0227] In another embodiment, the miRNA target sequence or cluster of copies of the sequence is arranged in the order of miR-124, miR-31, and miR-338-3p from 5' to 3'.
[0228] In another embodiment, the cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-338-3p, miR-124, and miR-31 from 5' to 3'.
[0229] In another embodiment, the cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-338-3p, miR-31, and miR-124 from 5' to 3'.
[0230] In another embodiment, the cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-31, miR-124, and miR-338-3p from 5' to 3'.
[0231] In another embodiment, the cluster of miRNA target sequences or copies of the sequences are arranged in the order of miR-31, miR-338-3p, and miR-124 from 5' to 3'.
[0232] Both the individual target sequences and the clusters of copies of the sequences can be either contiguous with each other, separated by spacer sequences, or any combination thereof.
[0233] Thus, in one embodiment, the miRNA target sequences are separated by spacer sequences.
[0234] In one embodiment, the polynucleotide comprises a sequence according to SEQ ID NO: 4.
[0235] Western blot analysis As used herein, a "spacer" can be a sequence (e.g., a nucleotide or amino acid sequence) that can be used to separate other sequence elements within a relatively large polymer.
[0236] In one embodiment, one or more spacer sequences separate polynucleotide sequences (e.g., miRNA target sequences) from each other.
[0237] Individual miRNA target sequences or groups of miRNA target sequences can be separated by one or more spacer sequences. In one embodiment, the miRNA target sequences are separated by one or more spacer sequences. The spacer sequence can include, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, or at least 30 nucleotide bases.
[0238] As a non-limiting example, in the following triple miRNA target sequences, the miRNA target sequences are each separated by a sequence that cannot be considered as a part of the miRNA target sequence. Such a sequence can be considered as a spacer separating functional sequence elements.
[0239] Triple miRNA target sequence (Tmir) (SEQ ID NO: 4):
Chemical Formula
[0240] The spacer sequences within SEQ ID NO: 4 include (a) at; (b) cgatt; (c) gcatt; (d) tcact; (e) cgatcccggggtttaaaccgat (SEQ ID NO: 175); (f) cgat; (g) tcac; (h) cgatgtttaaaccctgcaggcgat (SEQ ID NO: 176); (i) cgatcctgcaggagatct (SEQ ID NO: 177).
[0241] In one embodiment, the spacer is selected from the group consisting of (a) to (i).
[0242] In one embodiment, the polynucleotide includes one or more spacers selected from the group consisting of (a) to (i).
[0243] In one embodiment, the spacer sequences separating clusters of miRNA target sequences are longer than the spacer sequences separating miRNA target sequences within a cluster.
[0244] Colony formation assay The polynucleotides according to the present invention can include any suitable transgene. The suitable transgene can be operably linked to the miRNA target sequence according to the present invention, whereby the expression of the transgene is dependent on the presence of the miRNA.
[0245] In one embodiment, the transgene is ESF.
[0246] RNA isolation and real-time RT-qPCR The present invention provides a polynucleotide encoding a polypeptide of a transcription factor DNA-binding domain operably linked to at least one epigenetic effector domain, preferably wherein the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor. The polypeptide can be for reducing the transcription and / or expression of one or more target genes. The polypeptide, or the transgene encoding the polypeptide, may be referred to as an epigenetic silencer factor (ESF). The polypeptide can be a multimeric polypeptide, for example, it can be composed of two, three or more polypeptide chains. For example, the polypeptide can be a dimer such as a heterodimer. The polypeptide can be composed of a single polypeptide chain. The polypeptide can be a fusion protein.
[0247] ESF is an agent that can reduce the transcription and / or expression of one or more target genes (e.g., silence one or more target genes). The ESF of the present invention can comprise at least a portion of a transcription factor that binds to DNA, wherein this portion is operably linked to an epigenetic effector domain. The effector domain can have transcriptional repression activity and can enable silencing (e.g., persistent silencing) of one or more target genes of the transcription factor. In particular, when the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, ESF can block the gene expression cascade involved in tumor growth.
[0248] ESF can be a chimeric or fusion protein composed of a DNA-binding domain operably linked to an effector domain (e.g., KRAB domain, chromodomain, YAF2-RYBP domain, DNMT3A domain and / or DNMT3L domain). The effector domain can possess catalytic activity that suppresses the transcription and / or expression of one or more target genes. Alternatively, or additionally, the effector domain can recruit an additional agent intracellularly to one or more target genes, and this additional agent can suppress the transcription and / or expression of the target genes.
[0249] By "functionally linked", it should be understood that individual components are linked together in a manner that enables them to perform their functions (e.g., binding to DNA, catalyzing a reaction, or mobilizing additional agents from within the cell) without substantial interference. For example, a DNA-binding domain can be conjugated to an effector domain to form, for example, a fusion protein. For example, methods for conjugating polypeptides are known in the art through the provision of linker amino acid sequences (e.g., linkers containing glycine and / or serine residues) that link the polypeptides together. Alternative methods for conjugating polypeptides known in the art include chemical methods and photoinduced conjugation methods (e.g., using chemical crosslinking agents). Preferably, the DNA-binding domain and effector domain of the ESF form a fusion protein.
[0250] In some embodiments, the ESF is a fusion protein comprising a transcription factor DNA-binding domain and at least one epigenetic effector domain.
[0251] The ESF can be formed by separate polypeptide chains that bind together to form a complex, such as a heterodimeric complex. For example, the binding can be enabled by epitope-binding molecules such as an epitope (e.g., Suntag) contained on a first chain and a single-chain variable fragment (scFv) contained on a second chain.
[0252] In some embodiments, the ESF comprises, for example, two epigenetic effector domains fused to the same DNA-binding domain. In some embodiments, the ESF comprises, for example, three epigenetic effector domains fused to the same DNA-binding domain. The ESF can comprise, for example, four, five, six or more epigenetic effector domains fused to the same DNA-binding domain.
[0253] If the ESF contains two or more epigenetic effector domains, the effector domains may be different. If the ESF contains two or more epigenetic effector domains, the effector domains may be the same.
[0254] In a preferred embodiment, the ESF comprises a KRAB domain, a DNMT3A domain and / or a DNMT3L domain.
[0255] In other preferred embodiments, the ESF comprises a chromodomain, a YAF2-RYBP domain, a DNMT3A domain and / or a DNMT3L domain.
[0256] RNA sequencing The term "epigenetic effector domain" should be understood to mean, for example, a part of the ESF that provides an epigenetic effect on a target gene by catalyzing a reaction on DNA or chromatin (e.g., methylation of DNA, methylation or acetylation of histones, or demethylation or deacetylation of histones), or by mobilizing additional agents, resulting in suppression of gene transcription.
[0257] In this context, "domain" should be understood to mean a part of the ESF that possesses a specific function. The domain can be an individual domain isolated from a native protein (e.g., a catalytic domain), or it can be the entire full-length native protein. In other words, either the full-length protein or its functional fragment can be used as the effector domain. Thus, for example, the "KRAB domain" can be understood to mean a part of the ESF that contains an amino acid sequence having the function of the KRAB domain.
[0258] Chromatin remodeling enzymes known to be involved in the permanent epigenetic silencing of endogenous retroviruses (ERVs; Feschotte, C. et al. (2012) Nat. Rev. Genet. 13: 283-96; Leung, D.C. et al. (2012) Trends Biochem. Sci. 37: 127-33) can provide suitable effector domains for use in the present invention.
[0259] In some embodiments, the epigenetic effector domain suppresses the transcription and / or expression of at least one target gene. In some embodiments, the epigenetic effector domain is a repressor domain.
[0260] In some embodiments, the epigenetic effector domain catalyzes chemical modifications of chromatin and / or chromatin remodeling.
[0261] In some embodiments, the epigenetic effector domain catalyzes DNA modifications such as DNA methylation. In some embodiments, the epigenetic effector domain is a DNA methyltransferase and / or is capable of mobilizing a DNA methyltransferase.
[0262] In some embodiments, the epigenetic effector domain catalyzes histone modifications such as histone methylation or histone acetylation. In some embodiments, the epigenetic effector domain is a histone methyltransferase or a histone acetyltransferase. In some embodiments, the epigenetic effector domain catalyzes histone demethylation or histone deacetylation. In some embodiments, the epigenetic effector domain is a histone demethylase or a histone deacetylase.
[0263] ChIP sequencing The family of Kruppel-associated boxes containing zinc finger proteins (KRAB-ZFPs; Huntley, S. et al. (2006) Genome Res. 16: 669-77) plays an important role in the silencing of endogenous retroviruses. These transcription factors bind to specific ERV sequences via their ZFP DNA-binding domains while recruiting KRAB-associated protein 1 (KAP1) using their conserved KRAB domains. KAP1 then binds to a number of effectors that promote the local formation of repressive chromatin (Iyengar, S. et al. (2011) J. Biol. Chem. 286: 26267-76). For example, KAP1 can induce repressive chromatin modifications (e.g., H3K9me3) and / or remove active marks (e.g., H3K4ac).
[0264] In some embodiments, the ESF comprises a KRAB domain.
[0265] Among the family of KRAB-ZFP proteins, various KRAB domains are known. For example, the ESF of the present invention can comprise the KRAB domain of human zinc finger protein 10 (ZNF10; Szulc, J. et al. (2006) Nat. Methods 3: 109-16). An exemplary sequence of the KRAB domain of human zinc finger protein 10 is the following sequence:
Chemical formula
[0266] Further examples of suitable KRAB domains for use in the present invention include the following:
Chemical formula
[0267] Exemplary nucleotide sequences encoding the KRAB domain are the following sequences:
[0268] MeDIP sequencing In some embodiments, the ESF comprises a DNA methyltransferase (DNMT) domain. In some embodiments, the ESF comprises a DNMT3A domain, a DNMT3B domain and / or a DNMT1 domain. In some embodiments, the ESF comprises a DNMT3A domain.
[0269] The ESF of the present invention can comprise, for example, a domain of human DNA methyltransferase 3A (DNMT3A; Law, J.A. et al. (2010) Nat. Rev. Genet. 11: 204-20), preferably the catalytic domain. Exemplary DNMT3A sequences are the following sequences:
[0270] DNA methyltransferases 3B and 1 (DNMT3B and DNMT1) also, like DNMT3A, are responsible for the deposition and maintenance of DNA methylation and can also be used in the ESF of the present invention. Exemplary sequences are the following sequences: TIFF2025521922000012.tif72150TIFF2025521922000013.tif46150
[0271] Xenograft In some embodiments, the ESF includes a DNMT-like domain. The "DNMT-like" domain refers to a protein that is a member of the DNMT family but does not possess DNA methylation activity. DNMT-like proteins typically activate or recruit other epigenetic effector domains.
[0272] The ESF of the present invention includes, for example, DNA (cytosine-5)-methyltransferase 3-like (DNMT3L), a catalytically inactive DNA methyltransferase that activates DNMT3A by binding to its catalytic domain. An exemplary DNMT3L sequence is the following sequence:
Chem.
[0273] The DNMT3A and DNMT3L domains can be used together and may be referred to herein as "DNMT3A / 3L" or "DNMT3a3L".
[0274] Exemplary nucleotide sequences encoding the DNMT3A and DNMT3L domains are the following sequences:
Chem.
[0275] Ectopic xenograft In some embodiments, the ESF includes a chromodomain (CD). The CD domain can be the CD domain of CBX5.
[0276] An exemplary CD domain sequence is the following sequence:
Chem.
[0277] Exemplary nucleotide sequences encoding the CD domain are the following sequences:
Chem.
[0278] Intracranial xenograft In some embodiments, the ESF includes a YAF2-RYBP (Y-R) domain.
[0279] An exemplary Y-R domain sequence is the following sequence:
Chemical formula
[0280] An exemplary nucleotide sequence encoding the Y-R domain is the following sequence:
Chemical formula
[0281] In vivo treatment (by U87) Exemplary sequences of further suitable epigenetic effector domains are the following sequences:
[0282]
Table 1
[0283]
Table 2
[0284] The ESF of the present invention can include an amino acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 5 to 12, 14 to 18, 20, 22 or 24 to 27. Preferably, at this time, the amino acid sequence substantially retains the natural function of the protein represented by SEQ ID NOs: 5 to 12, 14 to 18, 20, 22 or 24 to 27, respectively.
[0285] The ESF of the present invention can be encoded by a polynucleotide comprising a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid identity to any one of SEQ ID NOs: 5 to 12, 14 to 18, 20, 22 or 24 to 27. Preferably, at this time, the amino acid sequence substantially retains the natural function of the protein represented by SEQ ID NOs: 5 to 12, 14 to 18, 20, 22 or 24 to 27, respectively.
[0286] The polynucleotide of the present invention can include a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs: 13, 19, 21, 23 or 28 to 32. Preferably, at this time, the encoded amino acid sequence substantially retains the natural function of the protein encoded by SEQ ID NOs: 13, 19, 21, 23 or 28 to 32, respectively.
[0287] In vivo treatment (by CSC) Transcription factors (TFs) can control DNA transcription through binding to specific DNA sequences. Transcription factors typically function, for example, to regulate genes in order to control transcription and / or expression, depending on cell type and timing. Groups of transcription factors can act in a coordinated manner and, in response to extracellular signals, can direct cell division, cell growth and cell death; cell migration and organization during fetal development.
[0288] A transcription factor contains at least one DNA - binding domain that can target transcription factors to specific sequences and direct their regulatory functions.
[0289] The ESF of the present invention contains at least one transcription factor DNA - binding domain. A person skilled in the art can easily identify DNA - binding domains derived from transcription factors using well - known methods, for example, using sequence comparison tools and / or databases.
[0290] The polynucleotides, polypeptides, and ESF of the present invention can contain the minimal transcription factor sequences that retain their function in binding to DNA. However, it is preferred that as many transcription factor sequences as possible be retained in the polypeptides and ESF of the present invention without adversely affecting the function of the ESF in reducing transcription and / or expression. Without wishing to be bound by theory, the transcription factor sequences may, in addition to the DNA - binding domain, enable the recruitment of additional factors within the cell.
[0291] An unmodified transcription factor may contain an activation domain (AD; also referred to as a trans - activation domain) that can function to activate gene transcription and / or expression. The polypeptides and ESF of the present invention preferably do not contain a functional activation domain. The transcription factor sequence can be modified (e.g., mutated or cleaved) to disrupt the activation domain function. The transcription factor sequence incorporated into the polypeptide or ESF can lack an activation domain.
[0292] In a preferred embodiment, the ESF does not contain a functional transcription factor activation domain. The ESF can, for example, not contain a transcription factor activation domain. The ESF can, for example, contain a fragment of a transcription factor that lacks a functional transcriptional activation domain and contains a functional DNA - binding domain.
[0293] In a preferred embodiment, the transcription factor is an oncogenic transcription factor.
[0294] As used herein, the term "oncogenic transcription factor" means a transcription factor that can promote tumor initiation and progression and can transform healthy cells into cancer cells, for example, through induction of inappropriate gene expression patterns.
[0295] In some embodiments, the transcription factor is a cancer-related transcription factor.
[0296] As used herein, the term "cancer-related transcription factor" means a transcription factor that can induce tumorigenicity but cannot transform healthy cells into cancer cells.
[0297] In some embodiments, the transcription factor is selected from the group consisting of SOX2, MYC, MYCN, TEAD1, TEAD2, TEAD3, TEAD4, FOXA1, FOXA2, ELK1, ELK3, ELK4, SRF, FOXM1, FOXC1, FOXC2, TWIST1, SALL4, ELF1, HIF1A, SOX9, SOX12, SOX18, ETS1, PAX3, PAX8, GLI1, GLI2, GLI3, ETV1, ETV2, ETV3, RUNX1, RUNX2, RUNX3, MAFB, TFAP2C, and E2F1.
[0298] In some embodiments, the transcription factor is SOX2. ESF can include a fragment of human SOX2 consisting of amino acids 1-179.
[0299] In some embodiments, the transcription factor is MYC. ESF can include a fragment of human MYC consisting of amino acids 144-454.
[0300] In some embodiments, the transcription factor is TEAD1. ESF can include a fragment of human TEAD1 consisting of amino acids 1-166.
[0301] Exemplary sequences containing a suitable transcription factor DNA-binding domain are the following sequences:
[0302]
Table 3
[0303] An exemplary nucleotide sequence encoding a polypeptide comprising a transcription factor DNA-binding domain is the following sequence:
[0304]
Table 4
[0305] The transcription factor DNA-binding domain can include an amino acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 33 to 70, and preferably, at this time, the amino acid sequences each substantially retain the natural function of the proteins represented by SEQ ID NOs: 33 to 70.
[0306] The transcription factor DNA-binding domain can be encoded by a polynucleotide comprising a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid identity to any one of SEQ ID NOs: 33 to 70, and preferably, at this time, the amino acid sequence substantially retains the natural function of the protein represented by SEQ ID NOs: 33 to 70, respectively.
[0307] The transcription factor DNA-binding domain can be encoded by a polynucleotide comprising a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NOs: 71 to 108, and preferably, at this time, the encoded amino acid sequence substantially retains the natural function of the protein encoded by SEQ ID NOs: 71 to 108, respectively.
[0308] In vivo SES delivery in WT animals In some embodiments, the ESF comprises or consists of a KRAB domain, a SOX2 DNA-binding domain, a DNMT3A domain and a DNMT3L domain.
[0309] In some embodiments, the ESF comprises or consists of a CS domain and a SOX2 DNA-binding domain.
[0310] In some embodiments, the ESF comprises or consists of a SOX2 DNA-binding domain and a Y-R domain.
[0311] In some embodiments, the ESF comprises or consists of a CS domain, a SOX2 DNA-binding domain and a Y-R domain.
[0312] In some embodiments, the ESF comprises or consists of a KRAB domain, a TEAD1 DNA-binding domain, a DNMT3A domain and a DNMT3L domain.
[0313] In some embodiments, the ESF comprises or consists of a KRAB domain, a DNMT3A domain, a DNMT3L domain, and a MYC DNA-binding domain.
[0314] Exemplary sequences of the ESF of the present invention are the following sequences:
Chemical formula
[0315] Exemplary nucleotide sequences encoding the ESF of the present invention are the following sequences:
Chemical formula
[0316] The ESF can comprise or consist of an amino acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 109-113, and preferably, at this time, the amino acid sequences substantially retain the natural functions of the proteins represented by SEQ ID NOs: 109-113, respectively.
[0317] ESF can be encoded by a polynucleotide comprising or consisting of a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid identity to any one of SEQ ID NOs: 109-113, and preferably, at this time, the amino acid sequence substantially retains the natural function of the protein represented by SEQ ID NOs: 109-113, respectively.
[0318] ESF can be encoded by a polynucleotide comprising a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide identity to any one of SEQ ID NOs: 114-119, or a fragment thereof, and preferably, at this time, the encoded amino acid sequence substantially retains the natural function of the protein encoded by SEQ ID NOs: 114-119, respectively.
[0319] Further exemplary sequences of the ESF of the present invention are the following sequences:
Chemical formula
[0320] Further exemplary nucleotide sequences encoding the ESF of the present invention are the following sequences:
Chemical formula
[0321] ESF can include or consist of an amino acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NOs: 120 to 125, and preferably, at this time, the amino acid sequence substantially retains the natural function of the protein represented by SEQ ID NOs: 120 to 125, respectively.
[0322] ESF can be encoded by a polynucleotide that includes or consists of a nucleic acid sequence encoding a protein having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid identity to any one of SEQ ID NOs: 120 to 125, and preferably, at this time, the amino acid sequence substantially retains the natural function of the protein represented by SEQ ID NOs: 120 to 125, respectively.
[0323] ESF can be encoded by a polynucleotide that includes a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide identity to any one of SEQ ID NOs: 126 to 131, or a fragment thereof, and preferably, at this time, the encoded amino acid sequence substantially retains the natural function of the protein encoded by SEQ ID NOs: 126 to 131, respectively.
[0324] Immunostaining The polynucleotide of the present invention can encode a tag such as a polypeptide tag. The tag can be selected according to the intended purpose of the polynucleotide in question.
[0325] In one embodiment, the polynucleotide according to the present invention further includes a tag.
[0326] In one embodiment, the tag is a V5 tag.
[0327] The ESF of the present invention can have a polypeptide tag.
[0328] In one embodiment, the polypeptide tag is a V5 tag.
[0329]
Chemical formula
[0330] In one embodiment, the polypeptide tag comprises or consists of SEQ ID NO: 132.
[0331] The polypeptide tag can be separated from the ESF sequence by a spacer.
[0332] In one embodiment, the polypeptide tag is a C-terminal tag.
[0333] In one embodiment, the polypeptide tag has an N-terminal spacer sequence between the tag and the ESF.
[0334]
Chemical formula
[0335] It will be understood that such tags may not be advantageous in some settings but may be advantageous in other settings. For example, a tag may be useful for in vitro assays but may not be desirable in polynucleotides intended for medical use.
[0336] In one embodiment, the ESF of the present invention does not contain a polypeptide tag such as a V5 tag. In one embodiment, the present invention provides a sequence obtained from any of the sequences described herein that contain a V5 tag by deletion of the V5 tag (and optionally any spacer sequence between the V5 tag and the ESF).
[0337] The above-mentioned ESF can be advantageously used in combination with any one of the miRNA target sequence cassettes of the present invention. Further, the above-mentioned ESF can be advantageously used for treating cancer according to the present invention, whether or not it is included in the polynucleotide or cassette according to the present invention.
[0338] Nissl staining The polynucleotide of the present invention can contain one or more expression control sequences. Preferably, the nucleic acid sequence encoding the ESF or the transgene is operably linked to one or more expression control sequences.
[0339] As used herein, an "expression control sequence" is any nucleotide sequence that controls the expression of a transgene, for example, to promote and / or increase expression in some cell types and / or to decrease expression in other cell types.
[0340] The expression control sequence and the transgene (for example, the nucleic acid sequence encoding the ESF) can be in any suitable arrangement in the polynucleotide, provided that the expression control sequence is operably linked to the transgene (for example, the nucleic acid sequence encoding the ESF).
[0341] MRI acquisition In some embodiments, the expression control sequence is a promoter.
[0342] Any suitable promoter can be used, and its selection can be readily performed by those skilled in the art. The promoter sequence can be constitutively active (i.e., operable in any host cell background) or alternatively, active only in a specific host cell environment and thus enable targeted expression of the nucleotide of interest (e.g., ESF) in a specific cell type (e.g., a tissue-specific promoter). The promoter can exhibit inducible expression in response to the presence of another factor, e.g., a factor present in the host cell. In any event where the vector is administered for therapy, it is preferred that the promoter be functional in the target cell (e.g., cancer cell) background.
[0343] In some embodiments, the polynucleotide further comprises a promoter operably linked to the transgene. In some embodiments, the polynucleotide further comprises a promoter operably linked to a nucleic acid sequence encoding ESF.
[0344] In some embodiments, the promoter is a constitutive promoter. In some embodiments, the constitutive promoter is the Ef1a promoter.
[0345] An exemplary sequence of the Ef1a promoter is the following sequence:
Chemical formula
[0346] In some embodiments, the promoter is a tissue-specific promoter, preferably a cancer cell-specific promoter.
[0347] In some embodiments, the promoter is a proliferating cell-specific promoter.
[0348] In some embodiments, the promoter is selected from the group consisting of the Mki67 promoter, the Ccnd1 promoter, the Ccnb2 promoter, the Ccna2 promoter, the Cdc25c promoter, the Cdc2 promoter, the Cks1 promoter, the PCNA promoter, the CDC6 promoter, the POLD1 promoter, the CSK1B promoter, the MCM2 promoter, and the PLK1 promoter.
[0349] In some embodiments, the promoter is the Mki67 promoter.
[0350] An exemplary sequence of the Mki67 promoter is the following sequence:
Chemical Formula
[0351] The promoter can comprise or consist of a nucleic acid sequence having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any one of SEQ ID NO: 134 or 135, and preferably, at this time, the promoter substantially retains the natural function of the promoter of SEQ ID NO: 134 or 135, respectively.
[0352] In some embodiments, the promoter is the Ef1a promoter. An exemplary polynucleotide sequence comprising an EF1a promoter operably linked to a transgene encoding ESF is as follows:
Chemical Formula
[0353] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 158-163.
[0354] In one embodiment, the polynucleotide comprises a sequence that follows any one of SEQ ID NOs: 158-163.
[0355] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 178-182.
[0356] In one embodiment, the polynucleotide comprises a sequence that follows any one of SEQ ID NOs: 178-182.
[0357] GBM-cortical organoid In some embodiments, the polynucleotide further comprises one or more miRNA target sequences. Preferably, the nucleic acid sequence encoding the transgene (e.g., ESF) is operably linked to one or more miRNA target sequences.
[0358] MicroRNA (miRNA) genes are scattered across all human chromosomes except the Y chromosome. miRNAs can be located either in the non-coding regions of the genome or within the introns of protein-coding genes. Approximately 50% of miRNAs occur in clusters that are transcribed as polycistronic primary transcripts. Similar to protein-coding genes, miRNAs are usually transcribed from polymerase II promoters, yielding so-called primary miRNA transcripts (pri-miRNAs). These pri-miRNAs are subsequently processed through a series of endonuclease cleavage steps carried out by two enzymes belonging to the RNase III family, Drosha and Dicer. From the pri-miRNA, a stem-loop approximately 60 nucleotides in length, termed the miRNA precursor (pre-miRNA), is excised by a specific nuclear complex composed of Drosha and the DiGeorge syndrome critical region gene (DGCR8), which cleaves both strands near the base of the primary stem-loop, leaving a 5' phosphate and a 2-bp long 3' overhang. Subsequently, the pre-miRNA is actively transported from the nucleus to the cytoplasm by RAN-GTP and exportin. Subsequently, Dicer makes a double-strand cut at the end of the stem-loop not defined by Drosha cleavage, generating a 19- to 24-bp duplex, which is the mature miRNA and miRNA *It is composed of the opposite strands of the double-stranded molecule called miRNA. According to the thermodynamic asymmetry rule, only one strand of the double-stranded molecule is selectively loaded into the RNA-induced silencing complex (RISC) and accumulates as mature microRNA. This strand usually has a 5'-end that does not base pair as tightly with its complement as demonstrated by a single nucleotide mismatch introduced at the 5'-end of each strand of the siRNA duplex. However, some miRNAs help the accumulation of both duplexes to a similar extent.
[0359] MicroRNAs (miRNAs) trigger RNA interference (RNAi) that is highly similar to that of small interfering RNAs (siRNAs), which are widely used for experimental gene knockdown. The main difference between miRNAs and siRNAs is their biogenesis. Once loaded into RISC, the guide strand of the small RNA molecule interacts with the mRNA target sequence, which is predominantly found in the 3'-untranslated region (3'UTR) of protein-coding genes. Nucleotides 2-8, counting from the 5'-end of the miRNA, so-called the seed sequence, have been shown to be essential for triggering RNAi. As is usually the case for siRNAs and plant miRNAs, when the entire guide strand sequence is perfectly complementary to the mRNA target, the mRNA is endonucleolytically cleaved by the Argonaute (Ago) protein, also known as the "slicer" of the small RNA duplex, with the involvement of the RNA-induced silencing complex (RISC). DGCR8 (DiGeorge syndrome critical region gene 8) and TRBP (TAR (HIV) RNA-binding protein 2) are double-stranded RNA-binding proteins that facilitate the biogenesis of mature miRNAs by the Drosha and Dicer RNase III enzymes, respectively. The guide strand of the miRNA duplex is incorporated into the effector complex RISC, which recognizes specific targets through imperfect base pairing and induces post-transcriptional gene silencing. Several mechanisms have been proposed for this regulatory mode: miRNAs can induce the repression of translation initiation, mark the target mRNA for degradation by deadenylation, or sequester the target into cytoplasmic P-bodies.
[0360] On the one hand, when only the seed is completely complementary to the target mRNA while the remaining residues show imperfect pairing, RNAi acts through multiple mechanisms to bring about translational repression. Eukaryotic mRNA degradation occurs mainly via shortening of the polyA tail at the 3' end of the mRNA and decapping at the 5' end, followed by 5'-3' exonucleolytic digestion and accumulation of miRNAs in so-called P bodies, which are discrete cytoplasmic regions rich in components of the mRNA degradation pathway.
[0361] Expression of a nucleic acid sequence encoding a transgene (e.g., ESF) can be regulated by one or more endogenous miRNAs using one or more corresponding miRNA target sequences. Using this method, one or more miRNAs endogenously expressed in a cell prevent or reduce transgene expression in that cell by binding to their corresponding miRNA target sequences located in a polynucleotide or vector.
[0362] The target sequence can be completely or partially complementary to the miRNA. As used herein, the term "completely complementary" can mean that the target sequence has a nucleic acid sequence that is 100% complementary to the sequence of the miRNA that recognizes it. As used herein, the term "partially complementary" can mean that the target sequence is only partially complementary to the sequence of the miRNA that recognizes it, such that the partially complementary sequence is still recognized by the miRNA. In other words, a partially complementary target sequence in the context of the present invention is effective in the recognition of the corresponding miRNA and the achievement of prevention or reduction of transgene expression in a cell expressing that miRNA. Preferably, the partially complementary miRNA target sequence can be completely complementary to the miRNA seed sequence.
[0363] Increasing the number of miRNA target sequences beyond one copy can enhance the effectiveness of the system. Additionally, different miRNA target sequences can be included. For example, a protein coding (e.g., ESF coding) sequence can be operably linked to two or more miRNA target sequences that can be either different or identical. The miRNA target sequences can be in tandem, although other arrangements are envisioned. For example, a polynucleotide can contain 1, 2, 3, 4, 5, 6, 7, or 8 copies of the same or different miRNA target sequences. Preferably, the polynucleotide contains 4 copies of each miRNA target sequence.
[0364] Copies of the miRNA target sequences can be separated by spacer sequences. The spacer sequences can contain, for example, at least 1, at least 2, at least 3, at least 4, or at least 5 nucleotide bases.
[0365] One or more miRNA target sequences can, for example, suppress the expression of a transgene (e.g., a nucleic acid sequence encoding ESF) in non-cancer cells. This can, for example, increase the safety of a treatment using ESF. The expression of a transgene (e.g., a nucleic acid sequence encoding ESF) in cancer cells may not be suppressed by one or more miRNA target sequences.
[0366] One or more miRNA target sequences can suppress transgene expression in one or more cell types other than cancer cells, such as neurons, astrocytes, and / or oligodendrocytes. In one embodiment, one or more miRNA target sequences suppress transgene expression in neurons. In one embodiment, one or more miRNA target sequences suppress transgene expression in astrocytes. In one embodiment, one or more miRNA target sequences suppress transgene expression in oligodendrocytes.
[0367] As used herein, the term "suppressing expression" can mean a reduction in the expression of a transgene in a relevant cell type to which one or more miRNA target sequences are functionally linked, compared to transgene expression under substantially the same conditions except in the absence of the one or more miRNA target sequences. In some embodiments, transgene expression is suppressed by at least 50%. In some embodiments, transgene expression is suppressed by at least 60%, 70%, 80%, 90% or 95%. In some embodiments, transgene expression is substantially prevented.
[0368] In some embodiments, a transgene encoding ESF is functionally linked to an Ef1a promoter and one or more miRNA target sequences. Exemplary polynucleotide sequences comprising a transgene encoding ESF functionally linked to an EF1a promoter and one or more miRNA target sequences are as follows:
Chemical formula
[0369] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 164 to 174.
[0370] In one embodiment, the polynucleotide comprises a sequence that follows any one of SEQ ID NOs: 164 to 174.
[0371] In one embodiment, the polynucleotide comprises a nucleotide sequence having at least 90% sequence identity, such as at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 168 to 173.
[0372] In one embodiment, the polynucleotide comprises a sequence that follows any one of SEQ ID NOs: 168 to 173.
[0373] Behavioral test The polynucleotide can comprise or consist of a nucleic acid sequence or a fragment thereof having at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 114 to 119, 126 to 131, and 136 to 174, and preferably, at this time, the polynucleotide substantially retains the natural function of the polynucleotide of SEQ ID NOs: 114 to 119, 126 to 131, or 136 to 174, respectively.
[0374] Spontaneous alternation test The ESF of the present invention can be used in a method for suppressing the transcription and / or expression of at least one target gene. Preferably, the target gene is an endogenous gene.
[0375] The transcription and / or expression of at least one target gene can be suppressed by epigenetic editing.
[0376] The level of transcription or expression of the target gene can be reduced by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or 100% compared to, for example, the level of transcription or expression in the absence of ESF.
[0377] At least one target gene can be silenced. It should be understood that "silencing the target gene" reduces the transcription and / or expression of the target gene to a level sufficient to achieve the desired effect. The reduced expression can be sufficient to achieve a therapeutically important effect such as the prevention or treatment of diseases such as cancer. For example, preferably, the target gene is suppressed such that no transcription and / or expression of the target gene is observed, or the residual level of transcription and / or expression of the target gene is low enough to improve or prevent the disease state.
[0378] Methods for analyzing gene transcription or expression are well known in the art. Methods for measuring gene transcription are known in the art and include reverse transcription PCR and Northern blot-based approaches. Methods for measuring gene expression are known in the art and include Western blot-based approaches or flow cytometry approaches.
[0379] Preferably, the suppression of the target gene occurs after transient delivery or expression of the ESF of the present invention into or in the cell.
[0380] It should be understood that by "transient expression", the expression of ESF is not stable over a long period of time. Preferably, the polynucleotide encoding ESF is not integrated into the host genome. More specifically, transient expression can be an expression that is substantially lost within 20 weeks after introduction of the polynucleotide encoding ESF into the cell. Preferably, the expression is substantially lost within 12, 6, 4 or 2 weeks after introduction of the polynucleotide encoding ESF into the cell.
[0381] Similarly, it should be understood that by "transient delivery", the ESF does not substantially remain in the cells over a long period of time (i.e., is substantially lost by the cells). More specifically, transient delivery can result in the ESF being substantially lost by the cells within 20 weeks after introduction of the ESF into the cells. Preferably, the ESF is substantially lost within 12, 6, 4, or 2 weeks after introduction of the ESF into the cells.
[0382] In some embodiments, the ESF is delivered transiently. Transient delivery can result in a permanent change.
[0383] Preferably, at least one target gene is permanently suppressed or silenced. By "permanent suppression" or "permanent silencing" of the target gene, the transcription or expression of the target gene is reduced (e.g., at least 60%, at least 70%, at least 80%, at least 90% or 100% reduction) compared to the level of transcription or expression in the absence of the ESF for at least 2 months, 6 months, 1 year, 2 years or over the entire lifespan of the cell / organism. Preferably, the target gene that is permanently suppressed or silenced remains suppressed or silenced for the remainder of the cell's lifespan.
[0384] In some embodiments, the ESF is stably expressed.
[0385] Radial maze test As used herein, the term "protein" includes single-chain polypeptide molecules as well as multi-polypeptide complexes in which the individual constituent polypeptides are linked by covalent or non-covalent means. As used herein, the terms "polypeptide" and "peptide" mean a multimer in which the monomers are amino acids and are linked together via peptide bonds or disulfide bonds.
[0386] Morris water maze test As an alternative to the delivery of polynucleotides to cells, the ESF of the present invention can be delivered to cells by protein transduction.
[0387] Protein transduction can be mediated by vector delivery (Cai et al. (2014) Elife 3: e01911; Maetzig et al. (2012) Curr. Gene Ther. 12: 389-409). Vector delivery involves genetic manipulation of viral particles (e.g., lentiviral particles) for containing the protein to be delivered to cells. Thus, when the genetically engineered viral particles enter cells as part of their natural life cycle, the proteins contained in the particles are carried into the cells.
[0388] Protein transduction can be mediated by protein delivery (Gaj et al. (2012) Nat. Methods 9: 805-7). Protein delivery can be achieved, for example, by using a vehicle (e.g., nanoparticles such as liposomes) or even by directly administering the protein itself to cells.
[0389] In some embodiments, the ESF is contained within nanoparticles. In some embodiments, the nanoparticles are polymeric nanoparticles, inorganic nanoparticles or lipid nanoparticles. In some embodiments, the nanoparticles are liposomes.
[0390] Nanoparticles can be targeted to specific cell types (e.g., cancer cells) using one or more ligands presented on their surface.
[0391] iPSC-derived neurons The polynucleotides of the present invention can comprise DNA or RNA. The polynucleotides can be single-stranded or double-stranded. As a result of the degeneracy of the genetic code, it will be understood by those skilled in the art that a number of different polynucleotides can encode the same polypeptide. In addition, those skilled in the art can use conventional techniques to make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the present invention in order to reflect the codon usage frequency of any particular host organism in which the polypeptides of the present invention are intended to be expressed.
[0392] The transgenes and coding sequences of the present invention, such as the sequences disclosed herein, can also include a stop codon, for example, TGA, at the 3' end of the transgene or coding sequence.
[0393] The polynucleotides can be modified by any method available in the art. Such modifications can be made to enhance the in vivo activity or lifespan of the polynucleotides of the present invention.
[0394] Polynucleotides, such as DNA polynucleotides, can be produced recombinantly, synthetically, or by any means available to those skilled in the art. The polynucleotides can also be cloned by standard techniques.
[0395] Generally, relatively long polynucleotides will be generated using recombinant means, for example, using polymerase chain reaction (PCR) cloning techniques. This technique can include steps of creating a pair of primers (e.g., of about 15-30 nucleotides) adjacent to the target sequence to be cloned, contacting the primers with mRNA or cDNA obtained from animal or human cells, performing a polymerase chain reaction under conditions that result in amplification of the desired region, isolating the amplified fragment (e.g., by purifying the reaction mixture using an agarose gel), and recovering the amplified DNA. The primers can be designed to include suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable vector.
[0396] Primary mouse neuron culture A vector is a tool that enables or facilitates the movement of an entity from one environment to another. According to and by way of example of the present invention, some vectors used in recombinant nucleic acid technology enable an entity such as a nucleic acid segment (e.g., a heterologous DNA segment such as a heterologous cDNA segment) to move into a target cell. A vector can serve the purpose of maintaining a heterologous nucleic acid (DNA or RNA) within a cell, facilitating the replication of a vector containing a nucleic acid segment, or facilitating the expression of a protein encoded by a nucleic acid segment. A vector can be non-viral or viral. Examples of vectors used in recombinant nucleic acid technology include, but are not limited to, plasmids, mRNA molecules (e.g., in vitro transcribed mRNA), chromosomes, artificial chromosomes, and viruses. A vector can also be, for example, naked nucleic acid (e.g., DNA). In its simplest form, a vector can be the nucleotide of interest itself.
[0397] The vectors used in the present invention can be, for example, plasmids, mRNAs or viral vectors, and can contain a promoter for the expression of polynucleotides and optionally a regulator of the promoter.
[0398] Vectors containing the polynucleotides used in the present invention can be introduced into cells using various techniques known in the art such as transfection, transformation and transduction. Several such techniques, for example, infection with recombinant viral vectors such as retroviruses, lentiviruses (e.g., integration-deficient lentiviruses), adenoviruses, adeno-associated viruses, baculoviruses and herpes simplex virus vectors; direct injection of nucleic acids and biolistic transformation are known in the art.
[0399] Non-viral delivery systems include, but are not limited to, DNA transfection methods. Here, transfection includes the process of using non-viral vectors to deliver genes into target cells. Typical transfection methods include electroporation, DNA biolistic methods, lipid-mediated transfection, compressed DNA-mediated transfection, liposomes, immunoliposomes, lipofectins, cationic agent-mediated transfection, cationic facial amphiphiles (CFA) (Nat. Biotechnol. (1996) 14: 556) and combinations thereof.
[0400] Transfection of cells using mRNA vectors can be achieved using, for example, nanoparticles such as liposomes.
[0401] In some embodiments, the vector (e.g., mRNA vector) is contained within the nanoparticles. In some embodiments, the nanoparticles are polymeric nanoparticles, inorganic nanoparticles or lipid nanoparticles. In some embodiments, the nanoparticles are liposomes.
[0402] The nanoparticles can be targeted to specific cell types (e.g., cancer cells) using one or more ligands presented on their surface.
[0403] Example B In a preferred embodiment, the vector is a viral vector. The viral vector can be in the form of viral vector particles.
[0404] The viral vector can be, for example, a retrovirus, a lentivirus, an adeno-associated virus (AAV) or an adenovirus vector.
[0405] In some embodiments, the vector is a lentivirus vector. In some embodiments, the vector is an AAV vector. In some embodiments, the vector is an AAV vector particle.
[0406] Materials and methods The retrovirus vector can be derived from or be derivable from any suitable retrovirus. A number of different retroviruses have been identified. Examples include murine leukemia virus (MLV), human T-cell leukemia virus (HTLV), murine mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukemia virus (A-MLV), avian myelocytomatosis virus-29 (MC29) and avian erythroblastosis virus (AEV). A detailed list of retroviruses can be found in Coffin et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63.
[0407] Retroviruses can be broadly classified into two categories, "simple" and "complex". Retroviruses can be further classified into seven groups. Five of these groups represent retroviruses with oncogenic potential. The remaining two groups are lentiviruses and spumaviruses. A review of these retroviruses is presented in Coffin et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63.
[0408] The basic structures of retrovirus and lentivirus genomes share a number of common features such as the 5' LTR and 3' LTR. Between or within these are packaging signals that enable the genome to be packaged, primer binding sites, integration sites that enable integration into the host cell genome, and the gag, pol, and env genes that encode packaging components (these are polypeptides required for the assembly of virus particles). Lentiviruses have additional features such as the rev and RRE sequences in HIV that enable efficient export of the integrated proviral RNA transcripts from the nucleus of the infected target cell to the cytoplasm.
[0409] In the provirus, these genes are flanked at both ends by regions called long terminal repeats (LTRs). The LTRs are responsible for provirus integration and transcription. The LTRs also function as enhancer-promoter sequences and can control the expression of viral genes.
[0410] The LTR itself is the same sequence that can be divided into three elements: U3, R, and U5. U3 is derived from the sequence unique to the 3' end of the RNA. R is derived from the sequence repeated at both ends of the RNA. U5 is derived from the sequence unique to the 5' end of the RNA. The sizes of the three elements can vary significantly between different retroviruses.
[0411] In defective retroviral vectors, gag, pol, and env may be absent or non-functional.
[0412] In typical retroviral vectors, at least a portion of one or more protein-coding regions essential for replication can be removed from the virus. This renders the viral vector replication-defective.
[0413] Lentiviral vectors are part of a relatively large group of retroviral vectors. A detailed list of lentiviruses can be found in Coffin et al. (1997) Retroviruses, Cold Spring Harbour Laboratory Press, 758-63. Lentiviruses can be classified into primate and non-primate groups. Examples of primate lentiviruses include, but are not limited to, human immunodeficiency virus (HIV), the causative agent of human acquired immunodeficiency syndrome (AIDS); and simian immunodeficiency virus (SIV). Examples of non-primate lentiviruses include the prototype "slow virus" visna / maedi virus (VMV), as well as related caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).
[0414] The lentivirus family differs from retroviruses in that lentiviruses have the ability to infect both dividing and non-dividing cells (Lewis et al. (1992) EMBO J. 11: 3053-8; Lewis et al. (1994) J. Virol. 68: 510-6). In contrast, other retroviruses such as MLV cannot infect non-dividing or slowly dividing cells, such as those that make up muscle, brain, lung, and liver tissues.
[0415] A lentiviral vector, as used herein, is a vector that contains at least one component derivable from a lentivirus. Preferably, the component is involved in a biological mechanism by which the vector infects cells, expresses genes, or replicates.
[0416] A lentiviral vector can be a "primate" vector. A lentiviral vector can be a "non - primate" vector (i.e., derived from a virus that does not primarily infect primates, particularly humans). Examples of non - primate lentiviruses can be any member of the family Lentiviridae that does not naturally infect primates.
[0417] Preferably, the viral vector used in the present invention has a minimal viral genome.
[0418] By "minimal viral genome", it should be understood that the viral vector has been engineered to remove non - essential elements and retain essential elements in order to provide the functionality required to infect, transduce, and deliver the nucleotide sequence of interest to the target host cell. Further details of this strategy can be found in WO 1998 / 017815.
[0419] Preferably, the plasmid vector used to generate the viral genome in the host cell / packaging cell has sufficient lentiviral genetic information to allow packaging of the RNA genome into viral particles that can infect target cells in the presence of packaging components but are incapable of independent replication to produce infectious viral particles in the final target cell. Preferably, the vector is deficient in functional gag - pol and / or env genes and / or other genes essential for replication.
[0420] However, the plasmid vectors used to generate viral genomes within host cells / packaging cells will also include transcriptional regulatory control sequences operably linked to the lentiviral genome that direct transcription of the genome in the host cell / packaging cell. These regulatory sequences can be native sequences associated with the viral sequences to be transcribed (i.e., the 5' U3 region), or can be heterologous promoters such as another viral promoter (e.g., the CMV promoter).
[0421] The vector can be a self-inactivating (SIN) vector in which viral enhancer and promoter sequences are deleted. SIN vectors can be produced and transduced into non-dividing cells in vivo with similar efficacy as wild-type vectors. Transcriptional inactivation of the long terminal repeat (LTR) in the SIN provirus should prevent mobilization by replication-competent viruses. This should also allow for regulated expression of genes from internal promoters by removing any cis-acting effects of the LTRs.
[0422] The vector can be integration-deficient. Integration-deficient lentiviral vectors (IDLVs) can be produced, for example, by packaging vectors having a catalytically inactive integrase (such as HIV integrase with a D64V mutation in the catalytic site), by modifying or deleting the essential att sequences from the vector LTR, or by a combination of the above.
[0423] Construct Adeno-associated virus (AAV) is an attractive vector system for use in the present invention because it has a high frequency of integration. Furthermore, AAV can diffuse through brain tissue due to its small size and low binding to cell membranes.
[0424] AAV has a broad host range with respect to infectivity. Details regarding the production and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.
[0425] Recombinant AAV vectors have been successfully used for the in vitro and in vivo transduction of marker genes and genes involved in human diseases.
[0426] In some embodiments, the vector is an AAV2 vector. In some embodiments, the vector is an AAV5 vector.
[0427] In some embodiments, the vector is an AAV9 vector.
[0428] The viral vector can be a modified or mutant viral vector. Such a vector can be a vector modified to possess certain desirable properties. For example, the AAV2 vector HBKO (or AAV2-HBKO) is a modified AAV2 that cannot bind to the heparan sulfate proteoglycan receptor (Naidoo et al. (2018) Mol Ther 26: 2418-2430).
[0429] In one embodiment, the vector is a modified AAV2 vector.
[0430] In one embodiment, the vector is an AAV2-HBKO vector.
[0431] The modified viral vector can contain, for example, a protein that confers altered cell tropism, as described, for example, in International Publication Nos. 2021 / 155137 and 2015 / 168666.
[0432] In one embodiment, the vector is a modified AAV5 vector.
[0433] In one embodiment, the vector comprises a capsid having one or more mutations at one or more positions in one or more capsid proteins.
[0434] In one embodiment, the vector comprises a capsid having one or more mutations at one or more positions in VP1.
[0435] In one embodiment, the vector is an AAV vector, preferably an AAV5 vector, comprising a capsid protein (e.g., VP1 protein) comprising (a) G at the position corresponding to amino acid 194; (b) R at the position corresponding to amino acid 474; (c) R at the position corresponding to amino acid 564; and / or (d) R at the position corresponding to amino acid 573, wherein the amino acids are numbered with reference to VP1 of AAV5.
[0436] Cell culture In addition to the specific proteins and polynucleotides referred to herein, the invention also encompasses the use of variants, derivatives, analogs, homologs and fragments thereof.
[0437] In the context of the present invention, a variant of any given sequence is a sequence in which the specific sequence of residues (whether amino acid residues or nucleic acid residues) is modified in such a way that the polypeptide or polynucleotide in question substantially retains at least one of its endogenous functions. Variant sequences can be obtained by addition, deletion, substitution, modification, replacement and / or alteration of at least one residue present in a naturally occurring protein.
[0438] As used herein with respect to the proteins or polypeptides of the present invention, the term "derivative" includes any substitution, alteration, modification, replacement, deletion and / or addition of one (or more) amino acid residues from or to a sequence, provided that the resulting protein or polypeptide substantially retains at least one of its endogenous functions.
[0439] As used herein with respect to a polypeptide or polynucleotide, the term "analog" includes any mimetic, i.e., compound, that possesses at least one of the native functions of the polypeptide or polynucleotide that it mimics.
[0440] Typically, amino acid substitutions can be made, for example, from 1, 2, or 3 to 10 or 20 substitutions, provided that the activity or ability that requires the modified sequence is substantially retained. Amino acid substitutions can include the use of non-naturally occurring analogs.
[0441] The proteins used in the present invention can also have deletions, insertions, or substitutions of amino acid residues that result in silent changes and produce functionally equivalent proteins. Intentional amino acid substitutions can be made based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathicity of the residues, as long as the native function is retained. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids having uncharged polar head groups with similar hydrophilicity values include asparagine, glutamine, serine, threonine, and tyrosine.
[0442] Conservative substitutions can be made, for example, according to the following table. Amino acids within the same block in the second column and preferably within the same row in the third column can be substituted for each other:
[0443]
Table 5
[0444] As used herein, the term "homolog" means an entity having a certain homology with a wild-type amino acid sequence or wild-type nucleotide sequence. The term "homology" can be regarded as identical to "identity".
[0445] Examples of homologous sequences include amino acid sequences that can be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical, to the target sequence. Typically, a homolog will contain the same active site etc. as the target amino acid sequence. Homology can also be considered in terms of similarity (i.e., amino acid residues having similar chemical properties / functions), but in the context of the present invention, it is preferred to express homology in terms of sequence identity.
[0446] Examples of homologous sequences include nucleotide sequences that can be at least 50%, 55%, 65%, 75%, 85% or 90% identical, preferably at least 95% or 97% or 99% identical, to the target sequence. Homology can also be considered in terms of similarity, but in the context of the present invention, it is preferred to express homology in terms of sequence identity.
[0447] Preferably, a reference to a sequence having percent identity to any one of the SEQ ID NOs disclosed herein means a sequence having the recited percent identity over the full length of the referenced SEQ ID NO.
[0448] Homology comparisons can be performed visually or, more usually, using readily available sequence comparison programs. These commercially available computer programs can calculate the percent homology or identity between two or more sequences.
[0449] Percent homology can be calculated over contiguous sequences, i.e., one sequence is aligned with the other and each amino acid in one sequence is directly compared, one residue at a time, with the corresponding amino acid in the other sequence. This is referred to as a "gapless" alignment. Typically, such a gapless alignment is performed only over a relatively short number of residues.
[0450] This is a very simple and consistent method, but, for example, in pairs of otherwise identical sequences, a single insertion or deletion in the nucleotide sequence can shift subsequent codons out of alignment, and thus, when a global alignment is performed, it is not possible to consider that this can result in a large reduction in percent homology. As a result, most sequence comparison methods are designed to generate an optimal alignment that takes into account possible insertions and deletions without unduly penalizing the overall homology score. This is achieved by inserting "gaps" into the sequence alignment in an attempt to maximize local homology.
[0451] However, these more complex methods assign a "gap penalty" to each gap that occurs in the alignment such that, for the same number of identical amino acids, a sequence alignment with the fewest possible gaps, reflecting a higher relatedness between the two sequences being compared, will achieve a higher score than one with a large number of gaps. An "affine gap cost", which places a relatively high cost on the presence of a gap and a relatively small penalty on each subsequent residue in the gap, is typically used. This is the most commonly used gap scoring system. Naturally, a high gap penalty will result in an optimized alignment with fewer gaps. Most alignment programs allow modification of the gap penalty. However, when using such software for sequence comparison, it is preferable to use the default values. For example, when using the GCG Wisconsin Bestfit package, the default gap penalty for amino acid sequences is -12 for the gap and -4 for each extension.
[0452] Therefore, calculation of the maximum percent identity requires first generating an optimal alignment that takes into account a gap penalty. A suitable computer program for performing such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al. (1984) Nucleic Acids Res. 12: 387). Examples of other software capable of performing sequence comparisons include, but are not limited to, the BLAST package, FASTA (Atschul et al. (1990) J. Mol. Biol. 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for both offline and online searches. However, for some applications, it is preferred to use the GCG Bestfit program. Another tool, called BLAST 2 Sequences, is also available for comparing protein and nucleotide sequences (see FEMS Microbiol. Lett. (1999) 174: 247-50; FEMS Microbiol. Lett. (1999) 177: 187-8).
[0453] The final percent identity can be measured with respect to identity, but the alignment process itself typically does not rely on all-or-nothing pairwise comparisons. Instead, an extended similarity scoring matrix that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance is commonly used. An example of such a commonly used matrix is the BLOSUM62 matrix, which is the default matrix for the BLAST suite of programs. The GCG Wisconsin program generally uses either the public default values or, if supplied, a custom symbol comparison table (see the user manual for further details). For some applications, it is preferred to use the public default values for the GCG package or, in the case of other software, a default matrix such as BLOSUM62.
[0454] Once the software has created the optimal alignment, it is possible to calculate the percent identity, preferably the percent sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.
[0455] A "fragment" is also a variant, and this term typically refers to a selected region of a polypeptide or polynucleotide of interest, either functionally or, for example, during an assay. Thus, a "fragment" refers to an amino acid or nucleic acid sequence that is part of a full-length polypeptide or polynucleotide.
[0456] Such variants can be made using standard recombinant DNA techniques such as site-directed mutagenesis. When making an insertion, synthetic DNA encoding the insertion can be made along with the 5' and 3' flanking regions corresponding to the naturally occurring sequences on either side of the insertion site. The flanking regions contain convenient restriction sites corresponding to sites in the naturally occurring sequences, such that the sequences can be cut with appropriate enzymes and the synthetic DNA ligated to the cut sites. Subsequently, the DNA is expressed according to the invention and the encoded protein is produced. These methods are merely illustrative of a number of standard techniques known in the art for manipulating DNA sequences, and other known techniques can also be used.
[0457] Growth curve analysis The polynucleotides used in the present invention can be codon-optimized. Codon optimization has been previously described in WO 1999 / 41397 and WO 2001 / 79518. Different cells vary in their usage frequencies of specific codons. This codon bias corresponds to a bias in the relative abundance of specific tRNAs in the cell type. By changing the codons in a sequence and thereby engineering them to match the relative abundance of the corresponding tRNAs, it is possible to increase expression. Similarly, by intentionally selecting codons known to have rare corresponding tRNAs in a specific cell type, it is possible to decrease expression. Thus, an additional level of translational control is available.
[0458] Primary mouse neuron culture The polynucleotides, proteins, vectors, nanoparticles and cells of the present invention can be formulated for administration to a subject together with a pharmaceutically acceptable carrier, diluent or excipient. Suitable carriers and diluents include isotonic saline solutions, such as phosphate buffered saline, which may contain human serum albumin.
[0459] The materials used to formulate the pharmaceutical composition should be non-toxic and should not interfere with the effectiveness of the active ingredient. The exact nature of the carrier or other materials can be determined by those skilled in the art according to the route of administration.
[0460] The pharmaceutical composition is typically in liquid form. Liquid pharmaceutical compositions generally contain a liquid carrier such as water, petroleum, animal or vegetable oils, mineral oil or synthetic oils. It can include physiological saline solution, magnesium chloride, dextrose or other sugar solutions, or glycols such as ethylene glycol, propylene glycol or polyethylene glycol. In some cases, surfactants such as 0.001% Pluronic® acid (PF68) can be used. In some cases, serum albumin can be used in the composition.
[0461] For injection, the active ingredient can be in the form of an aqueous solution that is pyrogen-free and has a suitable pH, isotonicity and stability. Those skilled in the art can successfully prepare a suitable solution using an isotonic vehicle such as sodium chloride injection solution, Ringer's injection solution or lactated Ringer's injection solution. If necessary, preservatives, stabilizers, buffers, antioxidants and / or other additives can be included.
[0462] For delayed release, the medicament can be included in a pharmaceutical composition formulated for sustained release according to methods known in the art, for example, in microcapsules formed from a biocompatible polymer, or in a liposome carrier system.
[0463] The handling of cell therapy products is preferably carried out in compliance with the FACT-JACIE international standards for cell therapy.
[0464] Immunostaining In one aspect, the present invention provides the polynucleotides, vectors, proteins, nanoparticles, cells, compositions or pharmaceutical compositions of the present invention for use in therapy.
[0465] In another aspect, the present invention provides the ESF, polynucleotide, vector, cell or composition of the present invention for use in the treatment of cancer.
[0466] In some embodiments, the cancer is glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, liver cancer, pancreatic cancer, bladder cancer, oropharyngeal cancer or kidney cancer. In some embodiments, the cancer is a brain tumor. In some embodiments, the cancer is gliobastoma multiforme.
[0467] In some embodiments, the treatment reduces tumor size.
[0468] In some embodiments, the treatment is an adjuvant therapy, optionally in combination with surgery.
[0469] All references herein to treatment include curative treatment, palliative treatment and prophylactic treatment. Treatment of mammals, particularly humans, is preferred. Both human treatment and veterinary treatment fall within the scope of the present invention.
[0470] In some embodiments, the treatment method provides the polynucleotide, vector, ESF, protein, nanoparticle, cell, composition or pharmaceutical composition of the present invention to the tumor.
[0471] In some embodiments, the treatment method provides the polynucleotide, vector, ESF, protein, nanoparticle, cell, composition or pharmaceutical composition of the present invention to the brain of the subject.
[0472] AAV production and infection In some embodiments, the polynucleotide, vector, ESF, protein, nanoparticle, cell, composition or pharmaceutical composition is administered to the subject locally.
[0473] In some embodiments, the polynucleotide, vector, ESF, protein, nanoparticle, cell, composition or pharmaceutical composition is administered to the brain of a subject.
[0474] In preferred embodiments, the polynucleotide, vector, ESF, protein, nanoparticle, cell, composition or pharmaceutical composition is administered to a tumor.
[0475] In some embodiments, the polynucleotide, vector, ESF, protein, nanoparticle, cell, composition or pharmaceutical composition is administered systemically, e.g., intravenously, to a subject.
[0476] In some embodiments, the polynucleotide, vector, ESF, protein, nanoparticle, cell, composition or pharmaceutical composition is administered locally to a subject.
[0477] As used herein, the terms "systemic delivery" or "systemic administration" mean that an agent of the invention is administered into the circulatory system, e.g., to achieve a broad distribution of the agent. In contrast, local or regional administration confines delivery of the agent to a limited area, e.g., a tumor.
[0478] Example B1 One of ordinary skill in the art can readily determine the appropriate dosage of an agent of the invention for administration to a subject. Typically, a physician determines the actual dosage most suitable for an individual patient, and the actual dosage will depend on various factors including the activity of the specific compound utilized, the metabolic stability and length of action of that compound, age, body weight, general health status, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, as well as the individual ongoing therapy. Of course, there can be individual instances where higher or lower dosage ranges are appropriate, and such instances are within the scope of the invention.
[0479] Example B2 As used herein, the term "subject" means either a human or a non-human animal.
[0480] Examples of non-human animals include vertebrates such as mammals such as non-human primates (especially higher primates), dogs, rodents (e.g., mice, rats or guinea pigs), pigs and cats. The non-human animal can be a companion animal.
[0481] Preferably, the subject is a human.
[0482] One skilled in the art will understand that all features of the invention disclosed herein can be combined without departing from the scope of the invention as disclosed.
[0483] Preferred features and embodiments of the invention are now described by way of non-limiting examples.
[0484] The practice of the present invention, unless otherwise indicated, will employ conventional techniques of chemistry, biochemistry, molecular biology, microbiology, and immunology, which are within the capabilities of those of ordinary skill in the art. Such techniques are explained in the literature. See, for example, Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press; Ausubel, F.M. et al. (1995 and periodic supplements) Current Protocols in Molecular Biology, Ch. 9, 13 and 16, John Wiley & Sons; Roe, B., Crabtree, J. and Kahn, A. (1996) DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; Polak, J.M. and McGee, J.O'D. (1990) In Situ Hybridization: Principles and Practice, Oxford University Press; Gait, M.J. (1984) Oligonucleotide Synthesis: A Practical Approach, IRL Press; and Lilley, D.M. and Dahlberg, J.E. (1992) Methods in Enzymology: DNA Structures Part A: Synthesis and Physical Analysis of DNA, Academic Press. Each of these general textbooks is hereby incorporated by reference into this specification.
[0485] All publications mentioned in the above specification are incorporated herein by reference. Various modifications and variations of the disclosed polypeptides, polynucleotides, vectors, cells, compositions, uses, and methods of the present invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been disclosed in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the disclosed modes for carrying out the invention which are obvious to those skilled in the art are intended to fall within the scope of the following claims.
Example
[0486] Example B3 Example B4 The inventors attempted to construct a set of epigenetic silencer factors by adding the Kruppel-associated box (KRAB) domain and / or the catalytic domain of DNA methyltransferase DNMT3A, together with its cofactor DNMT3L, to full-length Sox2 or Sox2 lacking its C-terminal transcriptional activation domain (Figure 1a).
[0487] The KRAB domain (derived from the zinc finger protein ZNF10) recruits distinct epigenetic complexes capable of both inducing repressive chromatin modifications (e.g., H3K9me3) and removing active marks (e.g., H3K4ac), while the DNMT domain regulates de novo DNA methylation and thus ultimately inhibits gene transcription (Amabile et al. (2016) Cell 167: 219-232.e14). Only the factor composed of the N-terminal and DNA-binding regions of SOX2, and the KRAB and DNMT domains at the 5' and 3' ends respectively (referred to as SES) rapidly killed glioma cell lines (e.g., U87, U251, and SNB19) in vitro (Figure 1b-f). Thus, genes related to cell proliferation and bona fide SOX2 targets (CDK1, CDC6, CCND1, etc.) were strongly suppressed in SES-treated cancer cells (Figure 1g). That is, the removal of the SOX2 transcriptional activation domain was important for obtaining synthetic factors capable of suppressing cancer cell proliferation. Interestingly, the growth of cell lines derived from prostate cancer, liver cancer, and pancreatic cancer was mostly unaffected by SES treatment, suggesting cancer-specific SES efficacy (Figure 1h). We extended in vitro analysis to patient-derived glioblastoma cancer stem cells (GBM CSC) of both classical and mesenchymal subtypes, which better preserve the characteristics of primary tumors. Both GBM CSC lines showed strong growth loss and high levels of cell death after SES lentivirus (LV) transduction (Figure 2a). To determine SES specificity, we mutated two residues in the HMG box domain that have been described as important for Sox2 binding to DNA (arginine at position 74 and leucine at position 97 were replaced by two prolines) (Figure 1e). Expression of SES(R74P / L97P) was unable to arrest CSC growth, indicating that SES activity depends on its DNA-binding activity (Figure 2a). Additionally, clonogenic analysis showed that SES-treated CSCs exhibited a decrease in self-renewal ability, accompanied by impairment in the formation of tumor spheres and the maintenance of their growth (Figure 2b).
[0488] Next, the inventors attempted to evaluate the comprehensive SES transcriptional output and its genome occupancy. SES-treated GBM CSCs showed very large transcriptional changes, including overall upregulation of apoptosis-related genes and silencing of genes encoding growth and cancer-promoting factors, in at least two different glioma cell lines (Figs. 3a - c). Interestingly, using a list of putative SOX2 targets predicted by a computational method (Janky (2014) et al. PLoS Comput Biol. 10: e1003731), the inventors found that they were mostly downregulated in SES-expressing cells (Fig. 3d). Comparative ChIP-seq experiments to determine the genome-wide binding of SOX2 and SES to CSCs revealed that SES maintains the ability to bind to the majority of SOX2 genomic sites (Fig. 3e). Considering that SES contains the catalytic domain of DNMT3A / L de novo DNA methyltransferase, the inventors used MeDIP-seq to profile methylated DNA. Notably, SOX2 binding regions showed a significant increase in methylation status in SES-transduced cells (Fig. 2f).
[0489] Subsequently, the inventors asked whether SES expression in vivo could exert any anti-tumor activity. First, the inventors performed subcutaneous xenografts in NSG immunodeficient mice using CSCs pre-transduced with either GFP (mock) or SES-expressing lentiviruses. Importantly, the ectopic grafts grew only from the transplanted mock cells, and SES-transduced cells could not maintain tumor growth (Figs. 4a - c), suggesting that this factor is toxic to glioma cells and inhibits tumor formation. Even when some scar-like epithelial masses could be isolated within the injection site, SES +Cells were not identified at all (Figure 4c). Similar results were obtained when subcutaneous tumor growth was induced using glioma cell lines (U87, SNB19, U251) (Figure 4d). Next, orthotopic intracranial xenografts were performed using GFP or SES-expressing U87 cancer cells. Four weeks after brain transplantation, mock GFP + Transplanted cells formed large tumor masses that extended throughout the striatum and into the cerebral cortex rich in proliferating cells (Figures 5a - e). Therefore, all mice transplanted with mock U87 cells died within 30 days of transplantation (Figure 5f). In contrast, transplanted SES + U87 cells completely lost their tumor initiation ability and no tumor masses could be recovered from transplanted mice showing an unchanged survival curve (Figures 5b - g). Similar results were obtained using SES-treated GBM CSCs, and SES-treated GBM CSCs were able to form very small tumor masses 6 weeks after brain transplantation (Figure 5h). To test GBM CSC tumorigenicity in a fully humanized model system, the inventors developed brain organoids by 3D differentiation of human iPSCs (Lancaster et al. (2013) Nature 501: 373 - 9) and assembled them together with GBM CSC-derived spheroids using Matrigel embedding (Linkous et al. (2019) Cell Rep. 26: 3203 - 3211.e5; Goranci-Buzhala et al. (2020) Cell Rep. 31: 107738). In these assembloids (GBM-cortical organoids), mock GFP +CSC successfully infiltrates and diffuses into the cortical-like tissue over time (Figure 6a). In contrast, in the SES-treated organoids, the GBM portion remains very small and cannot grow over time, and the cell layer detaches in the organoid region (Figure 6b). These results strongly suggest that SES expression in GBM cancer cells suppresses their growth and survival and abrogates their in vivo tumor initiation ability. In accordance with these findings verifying the anti-tumor activity of SES based on in vitro transduction of cancer cells before transplantation, the inventors moved on to an approach of in vivo SES viral transduction to limit the development of GBM masses already growing in the brain parenchyma. Intracranial transplanted U87 cancer cells were grown for 4 days to form tumor masses, and then mock (GFP) or SES-expressing lentivirus was injected (Figures 7a, b). Four weeks after lentiviral gene transfer, the mock-transduced tumors developed large masses that spread throughout the striatum (Figures 7b, c). In contrast, in situ SES expression strongly reduced the tumor mass and was sufficient to significantly extend the survival rate of the affected animals (Figures 7b–d). It should be noted that V5 immunohistochemistry in the brains transplanted for 4 weeks showed that the SES + cells were not present in the tumor mass and were only present in the surrounding brain parenchymal tissue (Figure 7e). This finding indicates that the cancer cells transduced with the SES lentivirus were lost over time and that the remaining tumor tissue at 4 weeks after transplantation consisted solely of SES - cells.
[0490] Subsequently, the inventors verified their approach by treating tumors arising from patient-derived CSCs. A lentivirus expressing either mock (GFP) or SES was injected in situ (7 days after CSC transplantation), and tumor growth was tracked by weekly MRI T1 scans until histological analysis 6 weeks later (Figure 7f). SES-treated tumors were smaller compared to the mock-treated group at both the time of MRI screening and the endpoint (Figures 7g–j). These data suggested that in situ viral treatment with SES could reduce the bulk of patient-derived GBM in mice.
[0491] SOX2 is a highly important factor in stem cells and neural progenitor cells but is strongly downregulated during neural differentiation. That is, SES should have little effect on adult mature brain neurons. To determine the effect of SES on brain cells, primary mouse cortical neuron cultures were treated with SES LV and survival, morphology, and gene expression were evaluated 2 weeks later. Mock and SES-expressing neurons showed no signs of cell damage and similar low numbers of PI + dead cells and had similar morphologies (Figure 8a). Notably, the transcriptomes of mock- and SES-transduced cultures were substantially equivalent and only Sox2 and 15 other genes were differentially expressed between the two neural populations (Figure 8b). SES treatment did not affect MAP2 +Similar results were collected using human iPSC-derived neuronal cultures that did not alter neuron survival and morphology (Figure 8c, d). This analysis could only be continued for less than two weeks, taking into account the short lifespan of primary neurons in vitro. Therefore, the inventors moved in vivo, transduced the hippocampus of C57BL / 6 adult mice with SES, and evaluated long-term behavioral performance (Figure 9a, b). Four weeks after stereotactic injection of mock (GFP) and SES LV, viral vectors of both mock and SES were equally present in the postmortem hippocampus (Figure 9c). Similar results were obtained using evaluation of transgene mRNA (Figure 9c). Notably, the same level of cell death was observed following both GFP and SES injections (Figure 9d). Before sacrifice, mice were evaluated in spontaneous alternation, radial maze, and Morris water maze tests to assess their exploratory behavior and cognitive functions related to spatial learning and memory (Figure 9e-g). Animals in both groups showed equally successful performance in these tasks, suggesting that SES expression did not cause significant functional changes in hippocampal neurons.
[0492] Subsequently, the inventors devised a strategy to restrict SES expression to cancer cells after brain viral inoculation. The inventors isolated the KI67 promoter (Zambon (2010) Cytometry A 77: 564-70) and inserted it into the LV cassette (SES v1.1) to drive SES expression only in proliferating cells (Figure 10a). First, the inventors confirmed that their strategy did not affect either GFP (when placed downstream of the KI67 promoter) or SES expression levels in cancer cells and, in the case of SES, caused significant cell loss of transduced cancer cells in vitro (Figure 10b). Next, primary mouse neuronal cultures composed of both neurons and glial cells were transfected with either EF1a-GFP (constitutive) or pKI67-GFP LV, and the presence of fluorescent protein was examined after one week. Interestingly, the majority of neurons (MAP2 + ) infected with pKI67-GFP were GFP -It was found that this strongly reduced its transcription to undetectable levels, while constitutive GFP was expressed in all cells of the dish (Figure 10c). Curiously, a small amount of GFP in the pKI67-GFP transduction culture + cells were also Ki67 + and thus were likely in an active cell cycle corresponding to young proliferative astrocytes (red arrows in Figure 10c). That is, this strategy resulted in effective silencing of SES expression in post-mitotic cells of the brain without impairing the introduced gene activation of SES in cancer cells.
[0493] Subsequently, the inventors generated additional variants of SES using alternative repressor domains such as the chromodomain derived from the CBX5 protein (inserted at the 5') or the YAF2-RYBP domain derived from the RYBP protein (inserted at the 3') that replaced the KRAB and DNMT3A / L catalytic domains (Figure 11a). Cancer cells transduced with either SESv2 or v3 showed rapid loss of proliferative ability and widespread cell death, which caused premature termination of the culture within two weeks from the initial treatment (Figures 11b - c). Patient-derived GBM CSCs of classical subtypes that better preserved primary tumor characteristics also showed a strong loss of proliferative ability after SESv3 lentivirus (LV) transduction (Figures 12a - b).
[0494] These results obtained using SES indicate that the repositioning of activating TFs to the epigenetic silencer factor (ESF) can be generalized to construct more epigenetic regulators by genetically engineering other activating cancer-related TFs. For this purpose, the inventors applied the same rational design to two other transcriptional activators, TEAD1 and c-MYC, which have decisive carcinogenic activity, thereby generating TES and MES factors, respectively (Figure 11d). Similar to SES, ESFs were generated by removing the transcriptional activation domain and adding the KRAB and DNMT3A / L catalytic domains to the remaining parts of the two TFs (Figure 11d). In the case of c-MYC, a repressor domain was inserted at the 5' end to avoid steric hindrance at the 3' end that directly interacts with MAX regarding heterodimer formation (Figure 11d). Cancer cells transduced with either TES or MES showed rapid loss of proliferative ability and diffuse cell death, which caused premature termination of the culture within two weeks from the initial treatment (Figures 11e - f and 13).
[0495] Subsequently, the inventors evaluated the TES / MES suppression of tumor development in vivo. Both TES- and MES-pre-infected CSCs showed reduced tumorigenic potential when xenografted subcutaneously in NSG mice (Figure 14). TES / MES-pre-infected CSCs also showed limited tumor growth in the NSG brain (orthotopic transplantation) compared to mock-infected CSCs (Figure 15). It should be noted that in situ TES expression was sufficient to strongly reduce the growth of tumor masses formed by transplantation of naive CSCs one week before viral injection (Figure 16).
[0496] That is, ESF design can be applied to various oncogenic TFs to generate a family of synthetic factors with strong antitumor activity. ESF represents a new class of rationally designed factors with broad and persistent epigenetic functions that can remodel the entire transcriptional pathway with accuracy and effectiveness. Targeted ESF expression can suppress cancer development and can represent a novel gene-based therapeutic agent against glioblastoma and other cancers.
[0497] Discussion The activity of TF during development is mainly limited during morphogenesis and plays a major role in stem cell identity, cell lineage restriction, and differentiation. However, these TFs can be reactivated or hijacked by the genetic program of cancer and drive tumor development and progression. Approximately 20% of all known oncogenic proteins are estimated to be represented by TFs that are of great importance for the acquisition of malignant cell dedifferentiation, proliferation, and migration. Despite their extensive roles in tumors, it has been shown to be difficult to interfere with their functions from a translational perspective. Indeed, stable and complete gene silencing by various genetic tools or small molecules has been difficult to achieve in cancer cells. Furthermore, the genetic program of cancer has repeatedly been shown to overcome the inactivation of a single gene by reorganizing the transcriptional network and promote cancer resistance and recurrence. Herein, the inventors designed epigenetic repressors (SESs) by reconstructing the SOX2 TF through the rational assembly of transcriptional and epigenetic negative regulators of gene transcription. This design is modular and multi-purpose and, in principle, can be applied to other activating oncogenic TFs as the inventors have shown for TEAD1 and c-MYC. Importantly, SES-dependent de novo DNA methylation at SOX2 target genes induced by the DNMTA / L catalytic domain promotes broad and stable silencing of the SOX2 downstream network. These extensive transcriptional changes inhibited cell proliferation in cancer cells, and the cancer cells were unable to cope with these changes and ultimately died. Therefore, the inventors show that these domains can reconstitute the transcriptional activity of endogenous TFs while preserving their chromatin occupancy and target selectivity. The inventors also showed that different configurations of SESs can give rise to the same functional activity by using different epigenetically active protein domains (e.g., the chromoshadow domain from CBX5 and the YAF2-RYBP domain from RYBP).
[0498] SOX2 expression is fundamental for controlling self-renewal and malignant phenotypes in GBM cancer cells as well as in a number of stem cells, including pluripotent and neural types. Importantly, SOX2 has a major role in promoting tumor development in medulloblastoma and in a number of other malignancies, including lung cancer, prostate cancer, and breast cancer, other than GBM.
[0499] That is, the use of SES and other ESFs can be extended to the treatment of other cancers. Tumor targeting of ESFs by viral-mediated delivery can be effective in principle for cancers limited to solid tissues that can be efficiently targeted by viral transduction in vivo. In this regard, cancers in the liver, lung, breast, and kidney represent promising targets in this approach since the delivery routes and viral strains are known to achieve broad and high tissue transduction efficiency. Similarly, the same approach can be proposed for treating metastatic masses in the same organ.
[0500] In this specification, SES was directly injected into the tumor mass and its development was suppressed. A similar approach may be useful in a clinical setting for treating glioblastoma where surgical resection is not realistic due to inaccessible locations within the brain or in regions very close to brain areas critical for life support. Furthermore, SES can be delivered into the brain parenchyma around the resected primary tumor as adjuvant therapy to target residual cancer cells and suppress subsequent tumor recurrence.
[0501] In this specification, glioblastoma treatment using ESF was performed via lentiviral transduction by local injection into the affected tissue. However, alternative therapeutic viruses could equally be utilized, particularly as viral strains of adeno-associated virus (AAV) that can diffuse through brain tissue due to their small size and low binding affinity to the cell membrane. By maximizing viral diffusion in the brain parenchyma, the targeting efficiency of scattered cancer cells in the tissue would increase, providing better protection against tumor recurrence. Additionally, non-viral vehicles such as nanoparticles or liposomes can be used to deliver SES mRNA or protein, obtaining acute transgene expression that is still sufficient to inhibit cancer cells while strongly enhancing the overall safety profile of the procedure.
[0502] The inventors have shown that SES expression is not harmful to neural cultures and in the murine brain, and the inventors have further elaborated on strategies to restrict its activation only to proliferative cells that are strongly enriched in cancer and rarely present in the brain parenchyma. The system described herein has been shown to be effective in that it mainly expresses the viral transgene in cancer cells and not in post-mitotic cells of the brain.
[0503] That is, the inventors assembled an epigenetic repressor that acts as a dominant negative form of the oncogenic SOX2 TF and can bind and stably suppress the SOX2 transcriptional network. Targeted viral delivery of SES in glioblastoma is sufficient to inhibit tumor development by arresting cell proliferation and inducing cell death. Considering its broad applicability to other oncogenic TFs and the high efficiency of targeting cancer cells by viral transduction, this approach offers opportunities to suppress glioblastoma and other lethal cancers.
[0504] Example C1 Results KRAB-hSOX2: The full-length human SOX2 gene was fused at its N-terminus with the KRAB repressor domain (derived from the gene ZNF10 encoding a zinc finger protein, aa1 - 97), and a V5 tag was fused at the C-terminus of SOX2. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0505] KRAB-hSOX2-D3A&L: The full-length human SOX2 gene was fused at its N-terminus with the KRAB repressor domain (derived from the gene ZNF10 encoding a zinc finger protein, aa1 - 97), and the functional domains of DNMT3A (aa388 - 689) and 3L (aa206 - 421) were fused at the C-terminus of SOX2. A V5 tag was fused at the end of the last domain at the C-terminus of the novel chimeric transgene. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0506] KRAB-hSOX2 1-179 : The first part of the SOX2 gene encoding aa1 - 179 (thus excluding the SOX2 activator domain) was fused at its N-terminus with the KRAB repressor domain (derived from the gene ZNF10 encoding a zinc finger protein, aa1 - 97), and a V5 tag was fused at the C-terminus of SOX2. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0507] hSOX2 1-179 -D3A&L: The first part of the SOX2 gene encoding aa1 - 179 (thus excluding the SOX2 activator domain) was fused with the functional domains of DNMT3A (aa388 - 689) and 3L (aa206 - 421), and a V5 tag was fused at the C-terminus of SOX2. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0508] The first part of the SOX2 gene encoding SES v1:aa1~179 (thus excluding the SOX2 activator domain) was fused at its N-terminus with the KRAB repressor domain (derived from the gene ZNF10 encoding a zinc finger protein, aa1~97), the functional domains of DNMT3A (aa388~689) and 3L (aa206~421) were fused at the C-terminus of the SOX2 part, and a V5 tag was fused at the end of the last domain at the C-terminus of the novel chimeric transgene. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0509] SES(R74P / L97P): SESv1 was mutated at residues 74 and 97 of the first part of the SOX2 gene (changing arginine at position 74 and leucine at position 97 to proline).
[0510] SES v1.1: The transgene was the same as SES version 1, but the Ef1a promoter was replaced with the proximal promoter of the mouse Mki67 gene (-1263~-1 relative to Mki67 atg).
[0511] SES v2: The first part of the SOX2 gene encoding aa1~179 (thus excluding the SOX2 activator domain) was fused at its N-terminus with the chromoshadow (CS) repressor domain (derived from the gene CBX5, aa121~179), and a V5 tag was fused at the C-terminus of SOX2.
[0512] SES v3: The first part of the SOX2 gene encoding aa1~179 (thus excluding the SOX2 activator domain) was fused at its C-terminus with the YAF2-RYBP (Y-R) repressor domain (derived from the gene RYBP, aa145~189), and a V5 tag was fused at the C-terminus of Y-R.
[0513] The first part of the TEAD1 gene encoding aa1 - 166 (thus excluding the TEAD1 activator domain) was fused at its N - terminus with the KRAB repressor domain (derived from the gene ZNF10 encoding a zinc - finger protein, aa1 - 97), the functional domains of DNMT3A (aa388 - 689) and 3L (aa206 - 421) were fused at the C - terminus of the TEAD1 part, and a V5 tag was fused at the end of the last domain at the C - terminus of the novel chimeric transgene. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0514] The C - terminal part of the MYC gene encoding aa144 - 454 (thus excluding the MYC activator domain) was fused with the KRAB repressor domain (derived from the gene ZNF10 encoding a zinc - finger protein, aa1 - 97), DNMT3A (aa388 - 689) and 3L (aa206 - 421) were fused in series at the N - terminus of the MYC part, and a V5 tag was fused at the C - terminus. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0515] Materials and methods Replication - incompetent VSVg - pseudotyped lentiviral particles were packaged in 293T cells. Cells were transfected using 30 μg of vector and packaging constructs according to the conventional CaCl2 transfection protocol. After 30 hours, the medium was collected, filtered through 0.44 μm cellulose acetate, and centrifuged at 20000 rpm for 2 hours at 20 °C to concentrate the virus.
[0516] Cell growth analysis U-87, U-251, and SNB-19 (human glioblastoma cell lines), HeLa (human cervical cancer cell line), DU145 (human prostate cancer cell line), and HepG2 (human liver cancer cell line) were cultured under plastic adherence conditions in DMEM medium (Dulbecco's Modified Eagle Medium - high glucose, Sigma-Aldrich) containing 10% fetal bovine serum (FBS, Sigma-Aldrich), 1% Pen / Strept (Sigma-Aldrich), 2 mM glutamine (Sigma-Aldrich), 1% non-essential amino acids (MEM NEAA, ThermoFisher Scientific), and 1% sodium pyruvate solution (Sigma-Aldrich), and subcultured twice a week using trypsin-EDTA solution (Sigma-Aldrich).
[0517] BxPC3 (human pancreatic cancer cell line) was cultured under plastic adherence conditions in RPMI-1640 (Sigma-Aldrich) containing 10% FBS, 1% Pen / Strept, and 2 mM glutamine. All cell lines were subcultured twice a week using trypsin-EDTA solution (Sigma-Aldrich).
[0518] Cancer stem cells (CSCs) derived from classical (L0627) and mesenchymal (1312) glioblastoma tumors were maintained as spheres in suspension culture in DMEM / F12 (Sigma-Aldrich) supplemented with Hormone Mix (DMEM / F12, 0.6% glucose (Sigma-Aldrich) (30% in phosphate buffered saline (PBS) (Euroclone)), insulin (Sigma-Aldrich) 250 μg / mL, putrescine powder (Sigma-Aldrich) 97 μg / mL, apotransferrin powder (Sigma-Aldrich), sodium selenite 0.3 μM, progesterone 0.2 μM), 1% Pen / Strep, 2 mM glutamine, 0.66% glucose (30% in phosphate buffered salts (PBS) (Euroclone)), and heparin (4 mg / mL, Sigma-Aldrich), and bFGF (20 ng / mL, ThermoFisher Scientific) and EGF (20 ng / mL, ThermoFisher Scientific) were freshly added to the culture medium. The sphere cultures were passaged once a week by mechanically dispersing the spheres into a single cell suspension.
[0519] All cultures were maintained in a humidified atmosphere of 37 °C and 5% CO2 under atmospheric oxygen conditions.
[0520] RNA-seq and analysis 5×10 5 cells of each cancer cell line were seeded in a 6-well plate under adherent conditions on day 0; the cultures were infected with a lentiviral vector on day 1, the cells were detached on day 3, and viable cells were stained with trypan blue solution (0.4%, ThermoFisher Scientific) and counted using a Countess TM II automated cell counter (ThermoFisher Scientific); after this passage, 3×10 5 cells were seeded again. This was repeated 3 times at 3 - 4 day intervals; the experiment was repeated 3 times for each time point. Representative brightfield photographs were taken at each time point.
[0521] 25×10 4 Twenty-five × 10 4 CSCs were seeded in a 24-well plate on day 0 under single-cell suspension conditions; on day 1, the cultures were infected with a lentiviral vector (expressing either SES or GFP). On days 4, 7, 10, and 13, CSC spheres were dispersed into single-cell suspensions, viable cells were stained with trypan blue solution, and counted as previously described. The number of viable cells and the % of dead cells were reported on a graph for each time point; the experiment was repeated three times for each time point. Representative bright-field photographs were taken at each time point.
[0522] Wound healing assay Cells were homogenized in RIPA buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, SDS (0.1% for cells, 1% for 3D culture), 1% Triton X-100, Roche Complete EDTA-free protease inhibitor cocktail, Roche PhosSTOP EASYpack), and primary antibodies were incubated overnight at 4 °C in a blocking solution consisting of 5% BSA (Sigma-Aldrich) or 5% non-fat dry milk in PBS-TWEEN® 0.1% (Sigma-Aldrich) according to the antibody datasheet for Western blot analysis. The primary antibodies used were as follows: anti-V5 (mouse, 1:1000, ThermoFisher Scientific, R96025), anti-SOX2 (clone #245610, mouse, 1:500, R&D system, MAB2018), anti-histone H3 (rabbit, 1:2000, Abcam, ab1791). Band density measurements were compared to a control and normalized to the housekeeping gene (H3) and calculated using Fiji software (NIH, USA).
[0523] 25×10 4Individual CSCs were seeded in a 24-well plate on day 0 under single-cell suspension conditions; on day 1, the cultures were either infected with a lentiviral vector (expressing either SES or GFP) or not infected. On day 6, the spheres were dispersed into single-cell suspensions, viable cells were counted as previously described, and 25×10 4 individual CSCs were reseeded, and the cells were grown to form spheres by day 10. Bright-field images were taken on days 6 and 10, and the number of spheres obtained was counted for each condition (no infection, GFP infection, or SES infection); the sphere diameter was measured, and the percentage of spheres with a diameter less than 100 mm was reported on the graph for each condition and time point. The experiment was repeated three times for each time point.
[0524] RNA was extracted using the TRI reagent isolation system (Sigma-Aldrich) according to the manufacturer's instructions. For quantitative RT-PCR (qRT-PCR), 1 microgram of RNA was reverse-transcribed using the ImProm-II reverse transcription system (Promega). Subsequently, qRT-PCR was performed in triplicate using custom-designed oligos with the CFX96 real-time PCR detection system (Bio-Rad, USA) together with the Titan HotTaq EvaGreen qPCR mix (BIOATLAS). The resulting cDNA was diluted 1:10 and amplified in a 16-μL reaction mixture containing 2 μL of diluted cDNA, 1× Titan Hot Taq EvaGreen qPCR mix (Bioatlas, Estonia), and 0.4 mM of each primer. Analysis of relative expression was performed using the ΔΔCt method with 18S rRNA as a housekeeping gene and CFX Manager software (Bio-Rad, USA).
[0525] Starting from 1 mg of total RNA (derived from U87, SNB19, and mouse hippocampus) whose quantity was evaluated by using a TapeStation instrument (Agilent), an RNA library was prepared. Only high-quality RNA with an RNA Integrity Number (RIN) of R8 was used to avoid overrepresentation at the 30 end. The RNA was processed according to the TruSeq Stranded mRNA Library Prep kit protocol. The library was sequenced on an Illumina HiSeq 3000 with 76-bp stranded reads using Illumina TruSeq technology. Image processing and base calling were performed using Illumina real-time analysis software. The Fastq files were aligned against the hg19 or mm10 human or mouse reference genome by using a splice junction map through TopHat. Differential gene expression and functional enrichment analysis were performed using DESeq2 and GSEA, respectively.
[0526] Chromatin was isolated from SNB19. 6×10 per plate 6At a density of, cells were plated on Matrigel-coated 15 mm plates under adhesion conditions. When the plates reached 90% confluence, the cells were fixed by directly adding formaldehyde to the cell culture medium to reach a final concentration of 1%, followed by incubation at RT for 10 minutes. Glycine was added to a final concentration of 125 mM to quench the reaction and incubated at RT for 5 minutes. Subsequently, the medium was removed, and the cells were washed 3 times with cold sterile PBS + protease inhibitor, after which the cells were gently scraped and collected at 1200 rpm for centrifugation at 4 °C for 50. For ChIP experiments, the collected cell pellets were lysed in lysis buffer (50 mM Tris-HCl pH 8, 0.1% SDS, 10 mM EDTA pH 8, 1 mM phenylmethylsulfonyl fluoride (PMSF, Sigma, #P7626), protease inhibitor cocktail (Roche, #04693159001)), and the chromatin was sonicated using a Branson D250 sonifier until an average fragment size of 0.1 - 0.5 kb was obtained (4 cycles of 30 seconds, 20% intensity). After quantification, 100 μg of sonicated chromatin was used for each immunoprecipitation and incubated overnight at 4 °C with 4 μg of V5 antibody (mouse, 1:5, ThermoFisher Scientific, R96025).
[0527] ChIP-seq libraries were generated using 5 ng of each immunoprecipitation and purified DNA. End repair of DNA fragments was achieved by sequential 15-minute incubations at 12 °C and 25 °C with 0.15 U / mL T4 PNK (New England Biolabs, #M0201L), 0.04 U / mL T4 POL (New England Biolabs, #M0203L), and 0.1 mM dNTP (New England Biolabs, #N0446S). A-base addition was performed by incubation with 0.25 U / mL Klenow fragment (New England Biolabs, #M0212L) and 167 mM dATP (New England Biolabs, N0440S) for 30 minutes at 30 °C. Adapter ligation was achieved using the Quick ligation kit (New England Biolabs, #M2200L) with a 15-minute incubation at 25 °C. Finally, DNA fragments were amplified over 14 cycles using the PfuUltra II Fusion HS DNA Pol kit (Agilent, #600674). The DNA purification step after each enzymatic reaction was performed using Agencourt AMPure XP SPRI beads (Beckman, #A63882). The resulting libraries were quality controlled using an Agilent Bioanalyzer (Agilent Technologies, #G2943CA) and then sequenced using an Illumina HiSeq 2000. Sequencing read quality was evaluated using fastQC (https: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ), and the total reads were aligned to the human genome (hg19) using Bowtie2 version 2.2.3 (http: / / bowtie-bio.sourceforge.net / bowtie2 / index.shtml). Only uniquely mapped reads were used in subsequent analyses, with an initial total of reads with an average mapping likelihood > 96%.Standardized BigWig tracks for ChIP-seq experiments were created using bedtools 2.24.0 (https: / / bedtools.readthedocs.io / en / latest / ) and the bedGraphToBigWig program (https: / / www.encodeproject.org / software / bedgraphtobigwig / ) and visualized in the UCSC Genome Browser (http: / / genome.ucsc.edu / ). To find regions of ChIP-seq enrichment compared to background, we used SICER V1.1 (https: / / home.gwu.edu / $wpeng / Software.html) (window size = 200; gap size = 200; FDR < 0.01 parameter, FDR 0.01 parameter for all ChIP-seq data). Density plots (±10 kb) were created using the ngsplot 2.47 (https: / / github.com / shenlab-sinai / ngsplot) command ngs.plot.r and finally replotted using GraphPad Prism.
[0528] 1 μg of purified genomic DNA (gDNA) was used together with the qiAMP DNA mini kit (Qiagen, cat. 51304). Briefly, the MagMeDIPseq kit (Diagenode, cod. C02010040) was used for methylation DNA immunoprecipitation and purification. First, the gDNA was sonicated to a fragment size of 150 - 300 bp, then denatured to ssDNA and immunoprecipitated using the α-methylcytosine antibody provided by the kit. The next day, the immunoprecipitated DNA and the input were purified and eluted. Library preparation was performed using the NEBNext Ultra II kit for Illumina (cod. E7645) according to the manufacturer's instructions. Each library was dual-indexed using the NEBNext Multiplex Oligos for Illumina (cod. E6440) and sequenced at 30 million paired-end depth using the Illumina HiSeq 2000. The first adapter trimming was performed using Trimmomatic (http: / / www.usadellab.org / cms / ?page=trimmomatic). Subsequently, the trimmed reads were aligned to the reference Hg19 genome using Bowtie2 (http: / / bowtie-bio.sourceforge.net / bowtie2 / index.shtml). To obtain the coverage track, bamCoverage was used (https: / / deeptools.readthedocs.io / en / develop / content / tools / bamCoverage.html) to convert the BAM file to BigWigs with CPM normalization and the effective genome size parameter using a bin size of 10. Peaks were called using Macs2 (https: / / github.com / macs3-project / MACS). The normal peak calling mode was used in paired-end mode with a q-value set to 0.05. Differential peaks were called by Macs2 using the BedGraph obtained by comparing the BAM files of the treatment condition to the control condition.Subsequently, differential peaks were intersected with normal peaks for each condition to filter out differential peaks that actually existed in at least one of the two conditions. Density plots (±10 kb) were created using the ngsplot 2.47 (https: / / github.com / shenlab-sinai / ngsplot) command ngs.plot.r and finally replotted using GraphPad Prism.
[0529] GBM cell lines or cancer stem cells L0627 were seeded in 6-well dishes and infected with 10 μL of LV-EIF1α-SES / TES / MES or 5 μL of LV-EIF1α-GFP per well for 48 hours as described in the infection section.
[0530] Infected cells were counted, and 3×10 6 cells were resuspended in 100 μL of Matrigel (Matrigel low growth factor, Corning). GFP-infected cells were subcutaneously injected into the left flank of NOD-SCID mice (NOD.cg-Prkdc scid Il2rg tm1Wjl / SzJ) using a 1 mL syringe pre-cooled at 20°C, and SES / TES / MES-infected cells were subcutaneously injected into the right flank of the same animals. Mice were sacrificed 1 - 3 months after injection (according to the growth rate), and subcutaneous growing tumors were excised and fixed in 4% PFA for at least 24 hours. The dimensions of tumor samples were measured, maintained overnight in 30% sucrose in PBS, and subsequently embedded in O.C.T. for cryoprotection. Histological slides were cut into 50 μm sections on a cryostat (CM1850 UV, Leica). Subsequently, the sections were processed for immunofluorescence or placed on gelatin-coated glass slides and processed for Nissl staining.
[0531] Infected cells were counted, and 3×10 5The cells were resuspended in 3 μL of 1× PBS and subsequently injected unilaterally into the striatum of NOD-SCID mice (AP +0.5; ML ±1.8; DV -3.3 from the skull). Mice were sacrificed at the time of observation of the general condition or 40 days after U87 injection or 3 - 5 weeks after CSC injection; after anesthesia, the mice were perfused transcardially with 4% PFA in PBS, and then the brains were removed from the skulls and maintained in the same solution for overnight fixation. After fixation, the brains were maintained in 30% sucrose in PBS overnight and subsequently embedded in O.C.T. for cryoprotection. Samples were coronally sectioned into 50-μm sections on a cryostat (CM1850 UV, Leica). Subsequently, the sections were processed for immunofluorescence or placed on gelatin-coated glass slides and processed for Nissl staining.
[0532] . U87 orthotopic xenografts were induced as previously described, but using 75,000 naive cells. Four days later, mice randomly divided into two groups were injected at the same local anatomical coordinates using LV carrying either GF or SES. One cohort of animals was sacrificed 26 days after LV injection, and another cohort was kept alive for survival rate measurement and sacrificed at the time of observation of the general condition or 90 days after the first surgery; after anesthesia, the mice were perfused transcardially with 4% PFA in PBS, and then the brains were removed from the skulls and maintained in the same solution for overnight fixation. After fixation, the brains were maintained in 30% sucrose in PBS overnight and subsequently embedded in O.C.T. for cryoprotection. Samples were coronally sectioned into 50-μm sections on a cryostat (CM1850 UV, Leica). Subsequently, the sections were processed for immunofluorescence or placed on gelatin-coated glass slides and processed for Nissl staining.
[0533] . Classical naive CSC orthotopic xenografts were induced as previously described (3×10 5Cells). After 7 days, the mice randomly divided into two groups were injected at the same local anatomical coordinates using LV carrying either GFP or TES, and sacrificed 3 weeks after LV injection; after anesthesia, the mice were perfused transcardially with 4% PFA in PBS, and then the brains were removed from the skulls and maintained in the same solution for overnight fixation. After fixation, the brains were maintained in 30% sucrose in PBS overnight, and then embedded in O.C.T. for cryoprotection. The samples were coronally sectioned into 50-μm sections on a cryostat (CM1850 UV, Leica). Subsequently, the sections were processed for immunofluorescence or placed on gelatin-coated glass slides and processed for Nissl staining.
[0534] LV carrying either GFP or SES was injected into the hippocampus of Wt C57BL / 6 animals (two injections per hippocampus, AP - 2.8, ML ± 3, DV - 3.5; -2.5, 0.8 μL each). One month after surgery, the animals were tested for behavioral tasks and sacrificed for molecular and histological analyses.
[0535] Cells were seeded onto cover glasses (pre-coated with Matrigel to enable cell adhesion for CSCs) and fixed on ice for 20 minutes in a 4% paraformaldehyde (PFA, Sigma) solution in phosphate-buffered saline (PBS, Euroclone). Subsequently, they were washed twice with PBS and permeabilized for 30 minutes in a blocking solution containing 0.2% Triton X-100 (Sigma Aldrich) and 5% donkey serum (Euroclone), and then incubated overnight at 4 °C with the primary antibodies diluted in the blocking solution. The primary antibodies used were as follows: anti-V5 (mouse, 1:500, Thermo Fisher Scientific, R96025), anti-GFP (chicken, 1:1000, Thermo Fisher Scientific, A10262), anti-MAP2 (chicken, 1:1000, Abcam, ab92434), anti-phosphorylated histone H3 (Ser10, rabbit, 1:200, Sigma-Aldrich, 06-570), anti-cleaved caspase 3 (Asp175, rabbit, 1:200, Cell Signaling Technology, 9661), anti-Ki-67 (clone SP6, rabbit, 1:500, Immunological Sciences, MAB-90948), anti-human nucleus (mouse, 1:500, Millipore, MAB1281). The next day, the cells were washed three times for 5 minutes each with PBS and incubated at room temperature for 1 hour in the blocking solution with Hoechst 33342 (Thermo Fischer Scientific) and with the secondary antibodies (Thermo Fisher Scientific). Brain sections were blocked for 1 hour at RT in 10% donkey serum and 0.2% Triton X-100. Incubation with the primary antibodies was carried out overnight at 4 °C. The secondary antibodies were added to the sections in the blocking solution containing Hoechst 33342 at RT for 2 hours. Finally, the slices were washed and mounted in a fluorescence mounting medium (Dako Cytomation). Images were acquired using an epifluorescence microscope Nikon DS-Qi2 and analyzed using Fiji software.
[0536] Brain sections were rinsed in distilled H2O for 1 minute and then stained in 0.1% cresyl violet solution heated at 50 °C for 7 minutes. Subsequently, they were first rinsed in distilled H2O for 3 minutes and then washed in serial dilutions of 70%–100% ethanol for 1 minute. Finally, they were cleared in xylene for 2 hours and mounted using mounting solution (Eukitt, Sigma Aldrich).
[0537] MRI was performed on a 7T scanner dedicated for small animals (30 / 70 BioSpec; Bruker, Ettlingen, Germany). The animal protocol included a high-resolution T2 sequence. Analysis of tumor volume was performed using MIPAV software (https: / / mipav.cit.nih.gov).
[0538] For brain organoid generation, WT iPSCs at 70–80% confluence were detached by incubation with accutase solution at 37 °C for 10 minutes to obtain single cell suspensions. Cells were centrifuged, counted, and subsequently, a total of 9000 cells were resuspended in DMEM / F12, 20% KnockOut TMPlated in each well of ultra-low attachment 96-well plates (Corning) in a medium containing serum replacement (KSR, Thermo Fisher Scientific), 2 mM glutamine, 1% Pen / Strep, 1% non-essential amino acids, 50 nM β-mercaptoethanol (Thermo Fisher Scientific), and 4 ng / mL bFGF. After seeding, the plates were briefly centrifuged to allow single EB formation inside each well; the ROCK inhibitor Y27632 (50 μM) was included for the first 24 hours. EBs were maintained in 96-well plates for 6 days, and then transferred to ultra-low attachment 24-well plates (Corning) in a neural induction medium containing DMEM / F12, 1× N-2 supplement, 1% non-essential amino acids, 2 mM glutamine, and 1 μg / mL heparin (Sigma-Aldrich) by vigorously pipetting the medium in the wells up and down (using the cut end of a P200 tip). On day 10, the EBs were embedded in Matrigel (Matrigel low growth factor, Corning) together with CSC spheres (pre-infected with either RFP only or SES+RFP) in the same droplet of Matrigel to allow fusion, and then gelled at 37°C for 30 - 60 minutes. Subsequently, the embedded EB-CSCs were cultured in a neural maturation medium containing 50% DMEM / F12, 50% Neurobasal A, 0.5× N-2 supplement, 0.5× B-27 supplement without vitamin A, 2 mM glutamine, 2.5 ng / mL human insulin, 1% non-essential amino acids, and 25 nM β-mercaptoethanol. The droplets were cultured in a 6 cm suspension dish under static conditions for 4 days, and then transferred to an Orbit TM LS low-speed orbital shaker; here, the 0.5× B-27 supplement with vitamin A was replaced in the neural maturation medium.
[0539] Animals were housed at a constant temperature of 23°C on a 12-hour light-dark cycle (lights off at 19:00) with ad libitum access to food and water. The inventors analyzed adult (2 - 4 months old range) (all tests) male and female WT C57BL / 6 mice that had been infected with either GFP (mock) or SES in the hippocampus 4 weeks prior. Sessions were recorded using video-tracking software Ethovision XT (Noldus).
[0540] To test exploratory behavior and cognitive functions related to spatial learning and memory, mice were placed in a four-arm maze and video-recorded for 10 minutes for the following assessments: total number of entries into all arms, percentage of entries into each arm, and consistency of arm entries. This latter item was a score index for spontaneous alternation performance (SAP): visits to four different non-repeating arms were scored as 1, and at least one repetition during a string of four entries was scored as 0; alternating arm returns: a score index where at least one repetition during a string of three entries was scored as 1; and same-arm returns (SAR): two consecutive entries into the same arm were scored as 1, which enabled the identification of behavioral patterns (see also Fig. 9e).
[0541] The 8-arm radial maze consisted of 8 identical arms extending radially from an octagonal platform. It was 80 cm above the floor and surrounded by an outer cue. Cups containing food were placed at the end of each arm. The protocol was divided into different phases: Day 1 - 10-minute habituation in the apparatus (no food at the end of the arms). Day 2 - Food deprivation until the animal reached 80% - 85% of its initial body weight; during the experiment, the mouse had to maintain this body weight. Day 3 - Training: Place food at half and at the end of each arm. Release the mouse in the center of the arena and the mouse had to eat 2 out of 8 pellets placed at the end of the arms. Days 4 - 13 (Experimental days 1 - 10 in Figure 10f) - Testing: Pellets were placed only at the end of the 8 arms. Release the mouse in the center of the arena and calculate (i) the time taken to eat 8 pellets and (ii) the percentage of incorrect choices (mouse choosing an empty arm) relative to total entries. The maze was cleaned with water and 70% ethanol before the next mouse was placed on the apparatus.
[0542] The mouse was placed in a circular pool with a platform that allowed it to escape from the water (maximum length of each trial: 120 seconds). The release position could be in different quadrants of the pool (see protocol in Figure 9g), the position of the platform was the same for the first 3 days and reversed for the last 2 days of the protocol. The time to complete each trial and the time spent in the platform area and in the opposite quadrant were quantified.
[0543] WT iPSCs were maintained under feeder-free conditions in mTeSR1 (Stem Cell Technologies) supplemented with Pen / Strept and seeded onto a human embryonic stem cell (HESC)-qualified Matrigel (Corning)-coated 6-well plate; cells were fed daily and passaged once a week as cell clumps using Accutase solution (Sigma-Aldrich). At the time of differentiation on day -2, the 90% confluent iPSC culture was infected overnight with the lentiviral vector TetO-Ngn2-T2A-Puro in mTeSR1 medium supplemented with doxycycline (2 μg / mL, Sigma-Aldrich). The next day, the medium was replaced with fresh mTeSR1 medium supplemented with antibiotic selection (puromycin 1 μg / mL, Sigma-Aldrich) and doxycycline; doxycycline was maintained for all experiments. On day 0, the medium was replaced with the differentiation medium “mTeSR1+LSBX”. The differentiation medium was changed daily according to the following scheme: day 0, day 1: mTeSR1+LSBX; day 2, day 3: mTeSR1+LSBX+PSD; day 4, day 5: 2 / 3 mTeSR1+1 / 3 N-2 medium+LSX+PSD; day 6, day 7: 1 / 3 mTeSR1+2 / 3 N-2 medium+PSD. On day 8, cells were detached by incubation with Accutase solution at 37 °C for 20 min to obtain a single cell suspension. Cells were centrifuged, counted, and seeded onto poly-L-lysine / laminin / fibronectin-coated plates or coverslips at a density of 55000 cells / cm 2 ² in neuronal maturation medium supplemented with the ROCK inhibitor Y27632 (10 μM, Selleckchem) for the first 24 h. The next day, the culture medium was changed to remove the ROCK inhibitor, and thereafter, half of the medium was changed to fresh neuronal maturation medium twice a week.
[0544] LSBX: LDN193189 (Stemgent, 250 nm), SB431542 (Sigma-Aldrich, 10 μM), XAV939 (Sigma-Aldrich, 5 μM). PSD: PD0325901 (Sigma-Aldrich, 8 μM), SU5402 (Sigma-Aldrich, 10 μM), DAPT (Sigma-Aldrich, 10 μM). N-2 medium: DMEM / F12 containing B-27 supplement (0.5×, ThermoFisher Scientific) and N-2 supplement (0.5×, ThermoFisher Scientific). Neural maturation medium: Neurobasal A (ThermoFisher Scientific) supplemented with 1× B-27 supplement, 2 mM glutamine, 1% Pen / Strept, BDNF (Peprotech, 20 ng / mL), ascorbic acid (Sigma-Aldrich, 100 nM), laminin (1 μg / μL), DAPT (10 μM), dbcAMP (Selleckchem, 250 μM).
[0545] Primary cultures of mouse fetal cortical neurons were prepared from E17.5 C57BL / 6 wild-type mice. Briefly, after dissection, the cortex was enzymatically digested with 0.025% trypsin (GIBCO) in Hank's balanced salt solution (HBSS) (Euroclone) at 37 °C for 20 minutes. Subsequently, the trypsin-containing HBSS was removed, and the hippocampus was washed with plating medium (Neurobasal A medium supplemented with 1× B-27 supplement, 3.3 mM glucose, 2 mM glutamine, and 1% penicillin / streptomycin) and mechanically dispersed using a P1000 pipette to obtain a homogeneous cell suspension. Subsequently, the cells were plated onto poly-L-lysine (PLL) (0.1 mg / mL)-coated cover glasses.
[0546] TES v2: The first part of the TEAD1 gene encoding amino acids (aa) 1 to 166 (thus excluding the TEAD1 activator domain) was fused at its N-terminus with the chromodomain (CD) repressor domain (derived from the gene CBX5, encoding aa 121 to 179), and a V5 tag was fused at the end of the last domain at the C-terminus of the novel chimeric transgene. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0547] TES v2 (SEQ ID NO: 136):
Chem.
[0548] TES v3: The first part of the TEAD1 gene encoding aa 1 to 166 (thus excluding the TEAD1 activator domain) was fused at its C-terminus with the YAF2-RYBP (Y-R) repressor domain (derived from the gene RYBP, aa 145 to 189), and a V5 tag was fused at the C-terminus of Y-R. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0549] TES v3 (SEQ ID NO: 137):
Chem.
[0550] TES v4: TES v2 was fused at its C-terminus with the YAF2-RYBP (Y-R) repressor domain (derived from the gene RYBP, aa 145 to 189), and a V5 tag was fused at the C-terminus of Y-R. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0551] TES v4 (SEQ ID NO: 138):
Chem.
[0552] The C-terminal portion of the MYC gene encoding aa144 - 454 (thus excluding the MYC activator domain) was fused at its N-terminus to the chromoshadow (CS) repressor domain (derived from the gene CBX5, aa121 - 179), and a V5 tag was fused at the C-terminus of the newly introduced gene. The introduced gene was used in a lentiviral construct containing Ef1a as a promoter.
[0553] MES v2 (SEQ ID NO: 139):
Chemical formula
[0554] The C-terminal portion of the MYC gene encoding aa144 - 454 (thus excluding the MYC activator domain) was fused at its N-terminus to the YAF2 - RYBP (Y - R) repressor domain (derived from the gene RYBP, aa145 - 189), and a V5 tag was fused at the C-terminus of the newly introduced gene. The introduced gene was used in a lentiviral construct containing Ef1a as a promoter.
[0555] MES v3 (SEQ ID NO: 140):
Chemical formula
[0556] The C-terminal portion of the MYC gene encoding MES v4:aa144~454 (thus excluding the MYC activator domain) was fused in series at its N-terminus with the chromoshadow (CS) repressor domain (derived from the gene CBX5, aa121~179) and the YAF2-RYBP (Y-R) repressor domain (derived from the gene RYBP, aa145~189), and a V5 tag was fused at the C-terminus of the novel transgene. The transgene was used in a lentiviral construct containing Ef1a as a promoter.
[0557] MES v4 (SEQ ID NO: 141):
Chemical formula
[0558] ESF-Tmir: miR124 TIFF2025521922000120.tif6129, MiR338-3p TIFF2025521922000121.tif6129 and miR31 A Tmir cassette consisting of four target sequences in series for both 6129 was prepared by synthesis and cloned into the 3'UTR of ESF.
[0559] The triple miRNA target sequence (Tmir) is shown below as SEQ ID NO: 4:
Chemical formula
[0560] The Tmir cassette containing ESF is shown in the following sequence.
[0561] SES-Tmir (SEQ ID NO: 142):
Chemical formula
[0562] SES (Sequence Number 155):
Chem.
[0563] SESv2 - Tmir (Sequence Number 143):
Chem.
[0564] SESv2 (Sequence Number 156):
Chem.
[0565] SESv3 - Tmir (Sequence Number 144):
Chem.
[0566] SESv3 (Sequence Number 157):
Chem.
[0567] TES - Tmir (Sequence Number 145):
Chem.
[0568] TES (Sequence No. 153):
Chem.
[0569] TESv2 - Tmir (Sequence No. 146):
Chem.
[0570] TESv3 - Tmir (Sequence No. 147):
Chem.
[0571] TESv4 - Tmir (Sequence No. 148):
Chem.
[0572] MES - Tmir (Sequence No. 149):
Chem.
[0573] MES (Sequence No. 154): [Chemical] TIFF2025521922000156.tif245160TIFF2025521922000157.tif127160
[0574] MESv2 - Tmir (Accession No. 150): [Chemical] TIFF2025521922000159.tif249159TIFF2025521922000160.tif17139
[0575] MESv3 - Tmir (Accession No. 151): [Chemical] TIFF2025521922000162.tif154161
[0576] MESv4 - Tmir (Accession No. 152): [Chemical] TIFF2025521922000164.tif245161TIFF2025521922000165.tif69141
[0577] U - 251 and CT26 cells were cultured in DMEM medium (Dulbecco's Modified Eagle Medium - high glucose, Sigma - Aldrich) containing 10% fetal bovine serum (FBS, Sigma - Aldrich), 1% Pen / Strept (Sigma - Aldrich), 2 mM glutamine (Sigma - Aldrich), 1% non - essential amino acids (MEM NEAA, ThermoFisher Scientific), and 1% sodium pyruvate solution (Sigma - Aldrich) under plastic - adherent conditions and passaged twice a week using trypsin - EDTA solution (Sigma - Aldrich).
[0578] BxPC-3 and CFPAC-1 were cultured under plastic adherent conditions in RPMI-1640 (Sigma-Aldrich) containing 10% FBS, 1% Pen / Strept, and 2 mM glutamine. All cell lines were passaged twice a week using trypsin-EDTA solution (Sigma-Aldrich).
[0579] Cancer stem cell (CSC) glioblastoma tumors were maintained under plastic adherent conditions in DMEM / F12 (Sigma-Aldrich) supplemented with Hormone Mix (DMEM / F12, 0.6% glucose (Sigma-Aldrich) (30% in phosphate buffered saline (PBS) (Euroclone)), insulin (Sigma-Aldrich) 250 μg / mL, putrescine powder (Sigma-Aldrich) 97 μg / mL, apotransferrin powder (Sigma-Aldrich), sodium selenite 0.3 μM, progesterone 0.2 μM), 1% Pen / Strept, 2 mM glutamine, 0.66% glucose (30% in phosphate buffered saline (PBS) (Euroclone)), and heparin (4 mg / mL, Sigma-Aldrich); bFGF (20 ng / mL, ThermoFisher Scientific) and EGF (20 ng / mL, ThermoFisher Scientific) were freshly added to the culture medium.
[0580] All cultures were maintained in a humidified atmosphere of 5% CO2 at 37 °C under atmospheric oxygen conditions.
[0581] 1.5×10 5 Individual cells were seeded at adherent conditions into 6-well plates on day 0; the cultures were infected with lentiviral vectors on day 1, the cells were detached on day 3, and viable cells were stained using trypan blue solution (0.4%, ThermoFisher Scientific), and Countess TMII Counted using an automated cell counter (ThermoFisher Scientific); after this passage, 1.5×10 5 cells were seeded again. This was repeated 3 - 4 times at time points every 3 - 4 days; the experiment was repeated 3 times for each time point.
[0582] Primary cultures of mouse fetal cortical neurons were prepared from E17.5 C57BL / 6 wild - type mice. Briefly, after dissection, the cortex was enzymatically digested with 0.025% trypsin (GIBCO) in Hank's balanced salt solution (HBSS) (Euroclone) at 37°C for 20 minutes. Subsequently, the trypsin - containing HBSS was removed, and the hippocampus was washed with plating medium (Neurobasal A medium supplemented with 1×B - 27 supplement, 3.3 mM glucose, 2 mM glutamine, and 1% penicillin / streptomycin) and mechanically dispersed using a P1000 pipette to obtain a uniform cell suspension. Subsequently, the cells were plated onto poly L - lysine (PLL) (0.1 mg / mL) - coated cover glasses.
[0583] Cells were seeded onto cover glasses and fixed on ice for 20 minutes in a 4% paraformaldehyde (PFA, Sigma) solution in phosphate-buffered saline (PBS, Euroclone). Subsequently, they were washed twice with PBS, permeabilized for 30 minutes in a blocking solution containing 0.2% Triton X-100 (SigmaAldrich) and 5% donkey serum (Euroclone), and incubated overnight at 4 °C with primary antibodies diluted in the blocking solution. The primary antibodies used were as follows: anti-V5 (mouse, 1:500, ThermoFisher Scientific, R96025), anti-GFP (chicken, 1:1000, Thermo Fisher Scientific, A10262), and anti-MAP2 (chicken, 1:1000, Abcam, ab92434). The next day, the cells were washed three times with PBS for 5 minutes each, and incubated at room temperature for 1 hour in the blocking solution with Hoechst 33342 (ThermoFischer Scientific) and with secondary antibodies (ThermoFisher Scientific). Finally, the slides were washed and mounted in a fluorescence mounting medium (Dako Cytomation). Images were acquired using an epifluorescence microscope Nikon DS-Qi2 and analyzed using Fiji software.
[0584] Recombinant virus particles without replication ability were generated in 293T cells by polyethyleneimine (PEI) (Polyscience) co-transfection of the following three different plasmids: a transgene-containing plasmid, a packaging plasmid for the rep and cap genes, and pHelper (Agilent) for three adenovirus helper genes. Cells and supernatants were harvested at 120 h. Cells were lysed in a hypertonic buffer (40 mM Tris, 500 mM NaCl, 2 mM MgCl2, pH = 8) containing 100 U / mL salt-active nuclease (SAN, Arcticzymes) at 37 °C for 1 h, and virus particles present in the supernatant were concentrated by precipitation using 8% PEG8000 (polyethylene glycol 8000, Sigma-Aldrich), followed by addition to the supernatant for further incubation at 37 °C for 30 min. Cell debris was separated by centrifugation (4000 g, 30 min) to clarify the lysate. The virus phase in the 40% fraction was isolated by an iodixanol step gradient (15%, 25%, 40%, 60% Optiprep, Sigma-Aldrich) and concentrated in PBS (phosphate-buffered saline) using a 100K cut-off concentrator (Amicon Ultra15, MERCK-Millipore). Virus titers were determined using the AAVpro titer measurement kit Ver2 (TaKaRa).
[0585] 2.5×10 4 293T cells were infected with an adenovirus vector expressing GFP (5 μL / well) in 2.5×10 4 CSC L0627 and seeded onto coverslips pre-coated with Matrigel in a 24-well plate. After 4 days, the cells were fixed and used for immunostaining studies.
[0586] The present inventors attempted to construct a set of ESF mutants using two transcriptional activators with carcinogenic activity, TEAD1 and c-MYC. ESF was generated by a rational design in which the transcriptional activation domain of the relevant transcription factor (TF) was removed and alternative suppressor domains, namely, the chromoshadow (CS) domain derived from the CBX5 protein and the YAF2-RYBP (Y-R) domain derived from the RYBP protein, were added thereto. The TEAD epigenetic silencer (TES) was prepared by fusing CS (TESv2) at the N-terminus of amino acids 1 to 166 of human TEAD; Y-R (TESv3) at the C-terminus of amino acids 1 to 166 of human TEAD; CS at the N-terminus and Y-R at the C-terminus of amino acids 1 to 166 of human TEAD (TESv4) (Figure 17a). The MYC epigenetic silencer (MES) was prepared by fusing CS, or Y-R or both of them, at the N-terminus of amino acids 144 to 454 of human MYC in order to avoid steric hindrance at the C-terminus of the protein that directly interacts with MAX regarding heterodimer formation (MESv2-4) (Figure 17b).
[0587] ESF should have no detectable harmful effects on healthy brain cells that do not express the target cancer gene and are not proliferating cells. In such healthy cells, a decrease in some important cell cycle genes induced by ESF could be harmful to the cells. However, ESF-dependent chromatin changes can potentially alter nerve performance in vivo over a relatively long period of time, for example, when used for treatment in humans. Therefore, the inventors devised a strategy to restrict ESF expression to cancer cells after viral inoculation of the brain. The strategy is based on a microRNA (miRNA) decoy system, which enables the silencing of transgenes by the inclusion of binding / silencing sites (TS) of miRNAs that are endogenously expressed in specific cell types where their expression is not desired. For this purpose, a cassette was created in which the 3'-UTR downstream of the transgene, for example, ESF cDNA, contains a cluster of 4×TS for each of miRNA-124, -338-3p, and -31, which are specifically expressed in neurons, astrocytes, and oligodendrocytes, respectively. Therefore, exogenous transgene expression, for example, SES expression as demonstrated in Figure 18, should be silenced in all of the above cell types through miRNA-dependent post-transcriptional silencing and blockade of protein translation (Figure 18a). It should be noted that, as demonstrated by GFP-Tmir and SES-Tmir lentiviruses (LV) that showed transgene expression not affected in cancer cells, miRNA-124, -338-3p, and -31 are not expressed in GBM (Figure 18b). The data herein further demonstrate that the presence of Tmir did not threaten SES activity, as the construct induced significant cell loss in cancer cells transduced in vitro (Figure 18b, lower right). The specificity of the miRNA decoy system is demonstrated in Figure 18c, which shows that, as intended and due to miRNA decoying, there were no cells expressing SES when used in primary cortical cultures derived from mice (Figure 18c).
[0588] It is desirable that ESF be used with a delivery system that allows for easy and widespread distribution of vectors across brain regions that may contain residual tumor cells after surgery. This would reduce the likelihood of tumor recurrence, a significant problem in GBM. For this purpose, the inventors tested the use of adeno-associated virus (AAV) as a shuttle vector for the constructs of the present invention. Recombinant serotypes 2 and 5 showed better performance with respect to transgene delivery, as evaluated by GFP expression in patient-derived cancer stem cells, compared to serotype 9 (Figure 19).
[0589] Since SOX2, TEAD1, and MYC are widely expressed in a number of cancer types, it is envisioned that the use of ESF disclosed herein may particularly be extended to other cancer types where these types can be efficiently targeted by viral transduction in vivo. For example, here the inventors show that SES can restrict the growth of a murine cell line (CT26) derived from liver metastases of colon adenocarcinoma (Figure 20a). Furthermore, TES is also effective in reducing the growth of human pancreatic ductal adenocarcinoma (PDAC) cell lines, including BxPC-3 and CFPAC-1 (Figures 20b and 20c).
[0590] The activity of oncogenic transcription factors (TFs) is mainly limited during morphogenesis and plays a major role in stem cell identity, cell lineage commitment, and differentiation. However, these TFs can be reactivated or hijacked by the genetic program of cancer to drive tumor development and progression. Approximately 20% of all known oncogenic proteins are estimated to be represented by TFs that are of great importance for the acquisition of malignant cell dedifferentiation, proliferation, and migration. Despite their extensive roles in tumors, it has been shown to be difficult to interfere with their functions from a translational perspective. Indeed, stable and complete gene silencing by various genetic tools or small molecules has been difficult to achieve in cancer cells. Furthermore, the genetic program of cancer has repeatedly been shown to overcome the inactivation of a single gene by reconfiguring the transcriptional network, promoting cancer resistance and recurrence. Here, we designed additional versions of ESF, as well as miRNA-based cassettes for detargeting ESF expression or the expression of any associated transgenes from brain resident cells, by rationally assembling transcriptional and epigenetic negative regulators of gene transcription to reconstitute SOX2, TEAD1, and MYC TFs.
[0591] We demonstrate herein that different epigenetically active protein domains (e.g., the chromodomain from CBX5 and the YAF2-RYBP domain from RYBP) can elicit the same functional activity as those carrying the KRAB and DNMT3A / L domains. Furthermore, it was demonstrated that by using miRNA target sequences within the 3'UTR, the expression of exogenous ESF can be detargeted from healthy brain cells, such as neurons, astrocytes, and oligodendrocytes, and thus safety and specificity can be improved. By utilizing target sequences of miRNAs that are highly expressed in brain cells but not in tumor cells, we provide polynucleotides and transgene expression cassettes with high specificity, for example, for use as an anti-GBM therapy.
[0592] The inventors also provide herein alternative therapeutic viruses to lentivirus that can be similarly used. A viral strain of adeno-associated virus (AAV) that can diffuse through brain tissue due to its small size and exhibits low binding to cell membranes is particularly useful. By maximizing viral diffusion in the brain parenchyma, the targeting efficiency of scattered cancer cells in the tissue will increase, providing better protection against tumor recurrence. Here, the inventors demonstrate that AAV2 can diffuse in the brain parenchyma when directly injected into the organ and can infect GBM CSCs with high efficiency in vitro.
[0593] The inventors further provide evidence that ESF can function as an effective anti-cancer agent / treatment in various cancers that share common vulnerabilities due to the important role of selected TFs in promoting tumor development. In particular, the inventors demonstrate herein that SES can reduce the proliferation of cells derived from liver metastases of colon adenocarcinoma in mice, and that TES is effective in inhibiting the growth of human PDAC cell lines.
[0594] Considering this, the disclosure herein provides a set of epigenetic repressors that act as dominant negative forms of the oncogenic TFs SOX2, TEAD1, and MYC and can bind and stably suppress their respective transcriptional networks. Targeted viral delivery of these ESFs in glioblastoma cells is sufficient to inhibit tumor development by blocking cell proliferation and inducing cell death. Specificity and thus safety are obtained by assembling miRNA target sequences that can detarget, i.e., inhibit, the expression of ESF from specific brain cells, while ESF is expressed in tumor cells. Considering its broad applicability to other oncogenic TFs and the high efficiency of targeting cancer cells by viral transduction using viral vectors such as AAV, this approach offers an opportunity to suppress glioblastoma and other lethal and treatment-resistant cancers.
[0595] The inventors further tested SESv3 in treating SNB19 glioma cells (Figure 21a) in which lentivirus-mediated infection reached approximately 100%. The inventors demonstrated that the efficacy of SESv3 was similar to that of the parental SES factor with respect to both cell number and cell death (Figures 21b and 21c).
[0596] For the same cell line, the inventors verified the efficacy of TES by comparing it with (i) a version of TES (TES mut) carrying an inactivating mutation R85K that destabilizes TEAD DNA-binding ability (Cao et al. (2008) Genes Dev 22: 3320-34), (ii) the chemical inhibitor verteporfin of YAP / TAZ signaling (Liu-Chittenden et al. (2012) Genes Dev 26: 1300-5), as well as (iii) GFP and (iv) uninfected cells as a control (Figure 22). The inventors showed that the version of TES having activity similar to that of the chemical inhibitor but limited DNA-binding activity had only a slight effect on cell growth (Figures 22a, 22b), which provided evidence regarding TES specificity.
[0597] Next, the inventors attempted to evaluate the global TES transcriptional output compared to mock (GFP)-infected cells. TES-treated SNB19 cells showed very large transcriptional changes (Figure 23a), accompanied by a global downregulation of known YAP / TAZ targets (Figure 23b), and a high presence of TEAD-binding motifs (Figure 23c). Among the downregulated genes, interestingly, the inventors found features of DNA repair, cell division, and migration, while among the upregulated gene ontologies, they demonstrated several categories related to neural differentiation (Figure 23d). Gene set enrichment analysis (GSEA) confirmed a large downregulation of genes related to cell migration and motility, which have already been associated with YAP / TAZ functionality (Zhang et al. (2018) J Mol Neurosci 64: 262-272) (Figure 24a). Therefore, the inventors directly assayed the inhibition of cell motility of treated SNB19 cells using an in vitro wound healing assay. The inventors found that the wounds of uninfected cells healed efficiently 48 hours after scratching, while cells treated with either TES or verteporfin healed more slowly (Figure 24b). The inventors also found that inhibition of the DNA-binding activity of TES was crucial for the limitation of cell motility in this context (Figure 24b).
[0598] To expand the knowledge of SES activity towards cancer types other than GBM, the inventors tested the SES efficacy in cell lines established from liver metastases that developed in both genetically engineered mouse models of colorectal cancer (CRC) and pancreatic ductal adenocarcinoma (PDAC), which are commonly used in preclinical applications regarding these cancer types. The inventors generated stable cell lines carrying a conditional construct for expressing SES in a CRE-dependent manner (Flex-SES, Figure 25a). Upon CRE transduction, both cancer cell lines already showed extreme sensitivity to SES six days after its induction (Figures 25b and 25c).
[0599] A total of 1.5×10 5 individuals of SNB19 were seeded under adhesion conditions in a 6-well plate on day 0; on day 1, the culture was infected with an LV vector (MOI = 0.7), on day 3, the cells were detached, viable cells were stained using a trypan blue solution (0.4%, Thermo Fisher Scientific), and counted using a Countess II automated cell counter (Thermo Fisher Scientific); after this passage, 1.5×10 5 cells were seeded again. This was repeated 3 times at 3 - 4 day intervals; the experiment was repeated at least 3 times for each time point. The YAP / TAZ inhibitor verteporfin was used at a concentration of 2 μM instead of LV infection.
[0600] Starting from 1 mg of total RNA whose quantity was evaluated by using a TapeStation instrument (Agilent), an RNA library was prepared. Only high-quality RNA with an RNA integrity number of more than 8 was used to avoid overrepresentation at the 3' end. The RNA was processed according to the TruSeq Stranded mRNA Library Prep kit protocol. The library was sequenced on an Illumina HiSeq 3000 with 76 bp stranded reads using Illumina TruSeq technology. Image processing and basecalling were performed using Illumina real-time analysis software. The FASTQ files were aligned against the hg38 human reference genome by using a splice junction map through TopHat. Differential gene expression and functional enrichment analysis were performed using DESeq2 and gene set enrichment analysis, respectively. Using the software Homer, with the following settings: +1,000 - 100 from the TSS, novel enriched motifs in the promoters of downregulated genes were found.
[0601] The wound healing assay was performed according to Zhang et al. (2018) J Mol Neurosci 64: 262-272. At the indicated time points, five randomly selected fields of view of the lesion border were acquired under an inverted microscope (Olympus, IX71). The average number of cells in the control group was defined as 100%, and the average numbers of the other groups were normalized by the average of the control group, respectively.
[0602] Flex-SES The SES transgene (for SES v1) was inserted in reverse orientation between two tandem LoxP sites (LoxP and Lox2272) in an LV vector together with Ef1a as a promoter. CRE recombinase is required for flipping the transgene into the correct orientation for productive expression.
[0603] Embodiment Various preferred features and embodiments of the present invention will now be described with reference to the following numbered paragraphs.
[0604] 1. A polynucleotide comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene.
[0605] 2. The polynucleotide of paragraph 1, wherein the copy number of each of the miRNA target sequences is independently selected from the group consisting of one, two, three, and four.
[0606] 3. The polynucleotide of paragraph 1 or paragraph 2, comprising four miR-124 target sequences, four miR-338-3p target sequences, and four miR-31 target sequences, wherein the miRNA target sequences are operably linked to a transgene.
[0607] 4. (a) The miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3, a polynucleotide according to any one of paragraphs 1 to 3.
[0608] 5. A polynucleotide according to any one of paragraphs 1 to 4, wherein the miRNA target sequence is located downstream of the transgene in the 5' to 3' direction.
[0609] 6. A polynucleotide according to any one of paragraphs 1 to 5, wherein a cluster of miRNA target sequences or copies of miRNA target sequences are arranged in the order of the miR-124 target sequence, the miR-338-3p target sequence, and the miR-31 target sequence from 5' to 3'.
[0610] 7. A polynucleotide according to any one of paragraphs 1 to 6, wherein the miRNA target sequences are separated by a spacer sequence.
[0611] 8. A polynucleotide according to any one of paragraphs 1 to 7, comprising a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4.
[0612] 9. A polynucleotide according to any one of paragraphs 1 to 8, wherein the transgene encodes an epigenetic silencer factor (ESF) comprising a transcription factor DNA-binding domain functionally linked to at least one epigenetic effector domain, and the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor.
[0613] 10. A polynucleotide according to any one of paragraph 9, wherein the transcription factor is selected from the group consisting of SOX2, MYC, MYCN, TEAD1, TEAD2, TEAD3, TEAD4, FOXA1, FOXA2, ELK1, ELK3, ELK4, SRF, FOXM1, FOXC1, FOXC2, TWIST1, SALL4, ELF1, HIF1A, SOX9, SOX12, SOX18, ETS1, PAX3, PAX8, GLI1, GLI2, GLI3, ETV1, ETV2, ETV3, RUNX1, RUNX2, RUNX3, MAFB, TFAP2C and E2F1.
[0614] 11. A polynucleotide according to paragraph 9 or paragraph 10, wherein the transcription factor is SOX2, TEAD1 or MYC.
[0615] 12. A polynucleotide according to any one of paragraphs 9 to 11, wherein the epigenetic effector domain is selected from the group consisting of KRAB domain, DNMT3A domain, DNMT3L domain, ZIM3-KRAB (Z-KRAB) domain, chromoshadow (CS) domain, YAF2-RYBP (Y-R) domain, engrailed repressor (En-R) domain, MeCP2 domain, GLI3RD domain and MAD1RD domain.
[0616] 13. A polynucleotide according to any one of paragraphs 9 to 12, wherein the ESF comprises (a) CS domain; (b) Y-R domain; (c) CS domain and Y-R domain; (d) KRAB domain; and / or (e) DNMT3A domain and DNMT3L domain.
[0617] 14. The ESF is: (a) KRAB domain, SOX2 DNA binding domain, DNMT3A domain, and DNMT3L domain; (b) chromoshadow (CS) domain and SOX2 DNA binding domain; (c) SOX2 DNA binding domain, and YAF2-RYBP (Y-R) domain; (d) KRAB domain, TEAD1 DNA-binding domain, DNMT3A domain, and DNMT3L domain; (e) KRAB domain, DNMT3A domain, DNMT3L domain, and MYC DNA-binding domain; (f) Chromoshadow (CS) domain, and TEAD1 DNA-binding domain; (g) TEAD1 DNA-binding domain, and YAF2-RYBP (Y-R) domain; (h) Chromoshadow (CS) domain, TEAD1 DNA-binding domain, and YAF2-RYBP (Y-R) domain; (i) Chromoshadow (CS) domain, and MYC DNA-binding domain; (j) YAF2-RYBP (Y-R) domain, and MYC DNA-binding domain; or (k) Chromoshadow (CS) domain, YAF2-RYBP (Y-R) domain, and MYC DNA-binding domain A polynucleotide according to any one of paragraphs 9 to 13, comprising
[0618] 15. A polynucleotide according to any one of paragraphs 9 to 14, comprising a nucleotide sequence having at least 90% sequence identity to any one of SEQ ID NOs: 114 to 119 and 126 to 131.
[0619] 16. A polynucleotide according to any one of paragraphs 1 to 15, further comprising a promoter operably linked to the transgene, optionally wherein the promoter is a tissue-specific promoter or a constitutive promoter, optionally a cancer cell-specific promoter or a proliferating cell-specific promoter.
[0620] 17. A polynucleotide according to paragraph 16, wherein the promoter is an Ef1a promoter or an Mki67 promoter.
[0621] 18. A vector comprising any one of the polynucleotides of paragraphs 1 to 17, optionally a viral vector, optionally a lentiviral vector or an adeno-associated virus (AAV) vector.
[0622] 19. A protein encoded by any one of the polynucleotides of paragraphs 1 to 17 or the vector of paragraph 18.
[0623] 20. An epigenetic silencer factor (ESF) comprising a transcription factor DNA-binding domain functionally linked to at least one epigenetic effector domain, wherein the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the ESF is: (a) A chromodomain (CS) and a TEAD1 DNA-binding domain; (b) A TEAD1 DNA-binding domain and a YAF2-RYBP (Y-R) domain; (c) A chromodomain (CS), a TEAD1 DNA-binding domain and a YAF2-RYBP (Y-R) domain; (d) A chromodomain (CS) and a MYC DNA-binding domain; (e) A YAF2-RYBP (Y-R) domain and a MYC DNA-binding domain; or (f) A chromodomain (CS), a YAF2-RYBP (Y-R) domain and a MYC DNA-binding domain comprising the above ESF.
[0624] 21. A nanoparticle comprising any one of the polynucleotides of paragraphs 1 to 17, the vector of paragraph 18, the protein of paragraph 19 or the ESF of paragraph 20.
[0625] 22. A cell comprising any one of the polynucleotides of paragraphs 1 to 17, the vector of paragraph 18, the protein of paragraph 19, the ESF of paragraph 20, or the nanoparticle of paragraph 21.
[0626] 23. A composition comprising any one of the polynucleotides of paragraphs 1 to 17, the vector of paragraph 18, the protein of paragraph 19, the ESF of paragraph 20, the nanoparticles of paragraph 21, or the cells of paragraph 22.
[0627] 24. Any one of the polynucleotides of paragraphs 1 to 17, the vector of paragraph 18, the protein of paragraph 19, the ESF of paragraph 20, the nanoparticles of paragraph 21, the cells of paragraph 22, or the composition of paragraph 23 for use in therapy.
[0628] 25. Any one of the polynucleotides of paragraphs 1 to 17, the vector of paragraph 18, the protein of paragraph 19, the ESF of paragraph 20, the nanoparticles of paragraph 21, the cells of paragraph 22, or the composition of paragraph 23 for use in the treatment of cancer.
[0629] 26. Use of any one of the polynucleotides of paragraphs 1 to 17, the vector of paragraph 18, the protein of paragraph 19, the ESF of paragraph 20, the nanoparticles of paragraph 21, the cells of paragraph 22, or the composition of paragraph 23 to reduce the transcription and / or expression of at least one target gene in a cell.
[0630] 27. A method of reducing the transcription and / or expression of at least one target gene in a cell, comprising the step of introducing any one of the polynucleotides of paragraphs 1 to 17, the vector of paragraph 18, the protein of paragraph 19, the ESF of paragraph 20, the nanoparticles of paragraph 21, or the composition of paragraph 23 into the cell.
[0631] 28. An epigenetic silencer factor (ESF) for use in the treatment of cancer, or a polynucleotide encoding the same, wherein the ESF comprises a transcription factor DNA-binding domain functionally linked to at least one epigenetic effector domain, the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the cancer is selected from the group consisting of glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, liver cancer, pancreatic cancer (e.g., human pancreatic ductal adenocarcinoma), bladder cancer, oropharyngeal cancer, kidney cancer, colon cancer (e.g., colon adenocarcinoma), or metastases of any of the foregoing, said ESF or polynucleotide.
[0632] Additional preferred features and embodiments of the present invention are described herein with reference to the following numbered paragraphs.
[0633] B1. A polynucleotide comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is functionally linked to a transgene.
[0634] B2. The polynucleotide of paragraph B1, comprising at least one miR-124 target sequence, at least one miR-338-3p target sequence, and at least one miR-31 target sequence, wherein the miRNA target sequence is functionally linked to a transgene.
[0635] B3. (a) the miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1; (b) the miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or (c) the miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3 The polynucleotide of paragraph B1 or paragraph B2.
[0636] B4. A polynucleotide of any one of paragraphs B1 to B3, comprising a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 4.
[0637] B5. A polynucleotide of any one of paragraphs B1 to B4, wherein the transgene encodes an epigenetic silencer factor (ESF) comprising a transcription factor DNA-binding domain operably linked to at least one epigenetic effector domain, and the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor.
[0638] B6. A polynucleotide of any one of paragraphs B5, wherein the transcription factor is selected from the group consisting of SOX2, MYC, MYCN, TEAD1, TEAD2, TEAD3, TEAD4, FOXA1, FOXA2, ELK1, ELK3, ELK4, SRF, FOXM1, FOXC1, FOXC2, TWIST1, SALL4, ELF1, HIF1A, SOX9, SOX12, SOX18, ETS1, PAX3, PAX8, GLI1, GLI2, GLI3, ETV1, ETV2, ETV3, RUNX1, RUNX2, RUNX3, MAFB, TFAP2C and E2F1.
[0639] B7. A polynucleotide of paragraph B5 or paragraph B6, wherein the epigenetic effector domain is selected from the group consisting of KRAB domain, DNMT3A domain, DNMT3L domain, ZIM3-KRAB (Z-KRAB) domain, chromoshadow (CS) domain, YAF2-RYBP (Y-R) domain, engrailed repressor (En-R) domain, MeCP2 domain, GLI3RD domain and MAD1RD domain.
[0640] A polynucleotide according to any one of paragraphs B1 - B7, further comprising a promoter operably linked to the introduced gene, optionally, the promoter is a tissue - specific promoter or a constitutive promoter, optionally a cancer cell - specific promoter or a proliferating cell - specific promoter.
[0641] A polynucleotide according to paragraph B8, wherein the promoter is an Ef1a promoter or an Mki67 promoter.
[0642] A vector comprising a polynucleotide according to any one of paragraphs B1 - B9, optionally, the vector is a viral vector, optionally a lentiviral vector or an adeno - associated virus (AAV) vector.
[0643] An epigenetic silencer factor (ESF) comprising a transcription factor DNA - binding domain operably linked to at least one epigenetic effector domain, wherein the transcription factor is an oncogenic transcription factor or a cancer - related transcription factor, and the ESF is: (a) a chromodomain (CS) and a TEAD1 DNA - binding domain; (b) a TEAD1 DNA - binding domain and a YAF2 - RYBP (Y - R) domain; (c) a chromodomain (CS), a TEAD1 DNA - binding domain, and a YAF2 - RYBP (Y - R) domain; (d) a chromodomain (CS) and a MYC DNA - binding domain; (e) a YAF2 - RYBP (Y - R) domain and a MYC DNA - binding domain; or (f) a chromodomain (CS), a YAF2 - RYBP (Y - R) domain, and a MYC DNA - binding domain comprising the above - mentioned ESF.
[0644] A nanoparticle comprising any one polynucleotide of paragraphs B1 to B9, the vector of paragraph B10, or the ESF of paragraph B11.
[0645] A cell comprising any one polynucleotide of paragraphs B1 to B9, the vector of paragraph B10, the ESF of paragraph B11, or the nanoparticle of paragraph B12.
[0646] Any one polynucleotide of paragraphs B1 to B9, the vector of paragraph B10, the ESF of paragraph B11, the nanoparticle of paragraph B12, or the cell of paragraph B13, for use in therapy.
[0647] An epigenetic silencer factor (ESF) for use in the treatment of cancer, or a polynucleotide encoding the same, wherein the ESF comprises a transcription factor DNA-binding domain functionally linked to at least one epigenetic effector domain, the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the cancer is selected from the group consisting of glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, liver cancer, pancreatic cancer (e.g., human pancreatic ductal adenocarcinoma), bladder cancer, oropharyngeal cancer, kidney cancer, colon cancer (e.g., colon adenocarcinoma), or metastases of any of the foregoing, the above ESF or polynucleotide.
Claims
**Claim 1** An epigenetic silencer factor (ESF) for use in the treatment of cancer, or a polynucleotide encoding the same, wherein the ESF comprises a transcription factor DNA-binding domain functionally linked to at least one epigenetic effector domain, the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the cancer is selected from the group consisting of glioma, glioblastoma, medulloblastoma, astrocytoma, neuroblastoma, epithelioma, meningioma, retinoblastoma, rhabdomyosarcoma, lung cancer, prostate cancer, breast cancer, liver cancer, pancreatic cancer (e.g., human pancreatic ductal adenocarcinoma), bladder cancer, oropharyngeal cancer, kidney cancer, colon cancer (e.g., colon adenocarcinoma), colorectal cancer (CRC), or metastases of any of the foregoing, the ESF or polynucleotide. **Claim 2** The ESF or polynucleotide for use according to claim 1, wherein the transcription factor is selected from the group consisting of SOX2, MYC, MYCN, TEAD1, TEAD2, TEAD3, TEAD4, FOXA1, FOXA2, ELK1, ELK3, ELK4, SRF, FOXM1, FOXC1, FOXC2, TWIST1, SALL4, ELF1, HIF1A, SOX9, SOX12, SOX18, ETS1, PAX3, PAX8, GLI1, GLI2, GLI3, ETV1, ETV2, ETV3, RUNX1, RUNX2, RUNX3, MAFB, TFAP2C and E2F1. **Claim 3** The ESF or polynucleotide for use according to claim 1 or 2, wherein the epigenetic effector domain is selected from the group consisting of KRAB domain, DNMT3A domain, DNMT3L domain, ZIM3-KRAB (Z-KRAB) domain, chromo shadow (CS) domain, YAF2-RYBP (Y-R) domain, engrailed repressor (En-R) domain, MeCP2 domain, GLI3RD domain and MAD1RD domain. **Claim 4** The ESF is: (a) a chromo shadow (CS) domain, and a TEAD1 DNA-binding domain; (b) a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (c) a chromo shadow (CS) domain, a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (d) Chromoshadow (CS) domain, and MYC DNA-binding domain; (e) YAF2-RYBP (Y-R) domain, and MYC DNA-binding domain; or (f) Chromoshadow (CS) domain, YAF2-RYBP (Y-R) domain, and MYC DNA-binding domain An ESF or polynucleotide for use according to any one of claims 1 to 3, comprising
5. An ESF or polynucleotide for use according to any one of claims 1 to 3, wherein the ESF comprises (a) a KRAB domain, a SOX2 DNA-binding domain, a DNMT3A domain and a DNMT3L domain; (b) a CS domain and a SOX2 DNA-binding domain; (c) a SOX2 DNA-binding domain and a Y-R domain; (d) a KRAB domain, a TEAD1 DNA-binding domain, a DNMT3A domain and a DNMT3L domain; or (e) a KRAB domain, a DNMT3A domain, a DNMT3L domain and a MYC DNA-binding domain.
6. A polynucleotide for use according to any one of claims 1 to 5, comprising at least one miR-124 target sequence, and / or at least one miR-338-3p target sequence, and / or at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene encoding the ESF.
7. A polynucleotide for use according to any one of claims 1 to 6, comprising at least one miR-124 target sequence, at least one miR-338-3p target sequence and at least one miR-31 target sequence, wherein the miRNA target sequence is operably linked to a transgene encoding the ESF.
8. (a) The miR-124 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 1; (b) The miR-338-3p target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 2; and / or (c) The miR-31 target sequence comprises or consists of a nucleotide sequence having at least 90% sequence identity to SEQ ID NO: 3, A polynucleotide for use according to claim 6 or 7.
9. A polynucleotide for use according to any one of claims 1 to 8, comprising a nucleotide sequence having at least 90% sequence identity to SEQ ID NO:
4.
10. A polynucleotide for use according to any one of claims 1 to 9, further comprising a promoter operably linked to a transgene encoding ESF, optionally wherein the promoter is a tissue-specific promoter or a constitutive promoter, optionally a cancer cell-specific promoter or a proliferating cell-specific promoter.
11. A polynucleotide for use according to claim 10, wherein the promoter is the Ef1a promoter or the Mki67 promoter.
12. A polynucleotide for use according to any one of claims 1 to 11, comprised in a vector, nanoparticle, cell or composition, optionally wherein the vector is a viral vector, optionally wherein the vector is a lentiviral vector or an adeno-associated virus (AAV) vector.
13. An epigenetic silencer factor (ESF) comprising a transcription factor DNA-binding domain operably linked to at least one epigenetic effector domain, wherein the transcription factor is an oncogenic transcription factor or a cancer-related transcription factor, and the ESF is: (a) a chromodomain (CS), and a TEAD1 DNA-binding domain; (b) a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (c) a chromodomain (CS), a TEAD1 DNA-binding domain, and a YAF2-RYBP (Y-R) domain; (d) a chromodomain (CS), and a MYC DNA-binding domain; (e) a YAF2-RYBP (Y-R) domain, and a MYC DNA-binding domain; or (f) a chromodomain (CS), a YAF2-RYBP (Y-R) domain, and a MYC DNA-binding domain comprising the above ESF.
14. A nanoparticle comprising the ESF according to claim 13.
15. A cell comprising the ESF according to claim 13, or the nanoparticle according to claim 14.
16. The ESF according to claim 13, the nanoparticle according to claim 14, or the cell according to claim 15 for use in therapy.