Non-immunogenic circular non-viral DNA vectors

Abstract

The present disclosure relates to circular non-viral DNA vectors, compositions comprising one or more of the disclosed vectors, and methods for delivering and / or expressing one or more therapeutic genes (e.g., proteins) in a mammal, e.g., a human patient. In some embodiments, the disclosure relates to circular non-viral DNA vectors, such as circular non-viral DNA vectors comprising at least two inverted repeat sequences, wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence that is not part of the at least two inverted repeat sequences. In some embodiments, the disclosed circular non-viral DNA vectors do not comprise a "DD element." In some embodiments, the disclosed circular non-viral DNA vectors do not comprise a "DD element," but comprise at least a portion of a bacterial origin of replication.

Description

[Technical Field]

[0001] [CROSS-REFERENCE TO RELATED APPLICATIONS] This application claims the benefit of the filing date of U.S. Provisional Application No. 63 / 390,515, filed July 19, 2022, the entire disclosure of which is incorporated herein by reference.

[0002] The present disclosure relates to non-viral DNA vectors comprising one or more nucleotide sequences encoding one or more therapeutic proteins, which in some embodiments are useful for treating hypophosphatasia or for treating, alleviating, or preventing one or more symptoms of hypophosphatasia in a subject in need of such treatment. [Background technology]

[0003] Gene therapy is an innovative approach in medicine that aims to treat inherited and acquired diseases by delivering new genetic material into a patient's cells to compensate for or suppress the function of mutated genes and / or treat genetic disorders.

[0004] Vectors used in gene therapy are divided into two major categories: viral vectors and non-viral vectors. Viral gene therapy vectors include retroviruses, lentiviruses, adenoviruses, adeno-associated viruses, herpes viruses, and poxviruses (Non-Patent Document 1). Viral vectors actively invade host cells and are efficiently transfected. The major advantage of viral vectors is that the natural properties of viruses allow rapid and highly efficient delivery of therapeutic genetic material to cells. However, the use of viral vectors in clinical practice is significantly limited due to the risks of inflammation, immune responses to gene therapy, cytotoxicity, mutagenesis, and carcinogenesis. There is still a need for non-viral vectors that deliver therapeutic genes. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Lundstrom K., "Viral Vectors in Gene Therapy." Diseases. 2018 May 21; 6(2) Summary of the Invention

[0006] The present disclosure relates to circular non-viral DNA vectors, compositions comprising one or more of the disclosed circular non-viral DNA vectors, and methods for delivering and / or expressing one or more therapeutic genes in a mammal, e.g., a human patient, from the disclosed circular non-viral DNA vectors. The circular non-viral DNA vectors of the present disclosure can promote sustained expression of a transgene delivered to a cell by the vector.

[0007] A first aspect of the present disclosure is an isolated circular non-viral DNA vector comprising a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins being operably linked to a promoter, and a second portion capable of forming at least one cruciform structure. In some embodiments, the second portion comprises at least two inverted repeat sequences. In some embodiments, the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least three nucleotides.

[0008] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector contains fewer than about 750 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 700 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 600 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 500 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 400 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 300 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 200 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 150 CpGs per vector. In some embodiments, the non-viral DNA vector contains less than about 50 CpGs per vector.

[0009] In some embodiments, the unique nucleotide sequence comprises at least 5 nucleotides. In some embodiments, the unique nucleotide sequence comprises at least 10 nucleotides. In some embodiments, the unique nucleotide sequence comprises at least 15 nucleotides. In some embodiments, the unique nucleotide sequence comprises at least 20 nucleotides. In some embodiments, the unique nucleotide sequence comprises at least 25 nucleotides. In some embodiments, the unique nucleotide sequence has at least 3 nucleotides and encodes at least a portion of a bacterial origin of replication. In some embodiments, origins of replication include sequences derived from pMB1, pBR322, ColE1, p15A, pSC101, or F1. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes a heterologous gene or a portion of a heterologous gene. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial suppressor tRNA. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial RNAi repressor. In some embodiments, the unique nucleotide sequence having at least three nucleotides encodes an antisense RNA. In some embodiments, the unique nucleotide sequence having at least three nucleotides encodes a bacterial operator sequence or a portion thereof. In some embodiments, the bacterial operator sequence comprises a lac operator. In some embodiments, the bacterial operator sequence comprises a tet operator.

[0010] In some embodiments, the non-viral DNA vector lacks a drug resistance gene. In some embodiments, the non-viral DNA vector comprises one or more recombination sites. In some embodiments, the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB sites and attP sites, or their product sites attL or attR, or alternative recombination target sites derived from these sites, such as Lox511 sites or Lox66 sites. In some embodiments, the non-viral DNA vector is substantially double-stranded. In some embodiments, the non-viral DNA vector is substantially supercoiled.

[0011] In some embodiments, the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions. In some embodiments, the non-viral DNA vector is non-immunogenic.

[0012] In some embodiments, each of the inverted repeat sequences is derived from a nucleic acid sequence present in one or more AAV serotypes. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 85% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 91% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 92% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 93% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 94% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 95% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 96% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 97% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 98% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 99% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises any one of SEQ ID NOs:1-18.

[0013] In some embodiments, the non-viral DNA vector does not include a DD element. In some embodiments, the non-viral DNA vector does not include a DD element, but includes at least a portion of a bacterial origin of replication. In some embodiments, the non-viral DNA vector does not include a DD element, but includes at least a portion of a bacterial origin of replication as part of the second portion. In some embodiments, the non-viral DNA vector does not include a DD element, but includes at least a portion of a bacterial origin of replication, but this is not within the second portion.

[0014] In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 91% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 92% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 93% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 94% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 58-59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 58-59.In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence having at least 99% identity to any one of SEQ ID NOs: 58 to 59. In some embodiments, the non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence having any one of SEQ ID NOs: 58 to 59.

[0015] In some embodiments, the second portion comprises a first nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. 10. The isolated circular non-viral DNA vector of claim 1, wherein the second portion comprises a first nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:58 to SEQ ID NO:59, and a third nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.

[0016] 10. The isolated circular non-viral DNA vector of claim 1, wherein the second portion comprises a first nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs:58 to 59, and a third nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. 10. The isolated circular non-viral DNA vector of claim 1, wherein the second portion comprises a first nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs:58 to 59, and a third nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. 10. The isolated circular non-viral DNA vector of claim 1, wherein the second portion comprises a first nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:58 to SEQ ID NO:59, and a third nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.10. The isolated circular non-viral DNA vector of claim 1, wherein the second portion comprises a first nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs:58 to 59, and a third nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. 10. The isolated circular non-viral DNA vector of claim 1, wherein the second portion comprises a first nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:58 to SEQ ID NO:59, and a third nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.

[0017] In some embodiments, the second portion comprises a first nucleic acid sequence having any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.

[0018] In some embodiments, the second portion comprises a nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having one of SEQ ID NO:35 and SEQ ID NO:60.

[0019] In some embodiments, the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:69), ATP7B (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:70 or SEQ ID NO:83), AlAT ( In some embodiments, the one or more therapeutic proteins are selected from the group consisting of: ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 66), ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 67), BDF8 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 68), and variants thereof. In some embodiments, the one or more therapeutic proteins are alkaline phosphatase or variants thereof.

[0020] A second aspect of the present disclosure is an isolated circular non-viral DNA vector comprising a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and a second portion capable of forming at least one cruciform structure, the second portion having the formula XY-X', where X and X' are each inverted repeat sequences, and Y comprises a nucleotide sequence that is non-repeated and has at least 3 nucleotides.

[0021] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector contains fewer than about 400 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 300 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 200 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 150 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 50 CpGs per vector.

[0022] In some embodiments, Y comprises at least 5 nucleotides. In some embodiments, Y comprises at least 10 nucleotides. In some embodiments, Y comprises at least 15 nucleotides. In some embodiments, Y comprises at least 20 nucleotides. In some embodiments, Y encodes at least a portion of a bacterial origin of replication. In some embodiments, Y encodes a heterologous gene or a portion of a heterologous gene. In some embodiments, Y encodes a bacterial suppressor tRNA. In some embodiments, Y encodes a bacterial RNAi repressor. In some embodiments, Y encodes an antisense RNA. In some embodiments, Y encodes a bacterial operator sequence. In some embodiments, the bacterial operator sequence comprises a lac operator. In some embodiments, the bacterial operator sequence comprises a tet operator.

[0023] In some embodiments, the non-viral DNA vector lacks a drug resistance gene. In some embodiments, the non-viral DNA vector comprises one or more recombination sites. In some embodiments, the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB sites and attP sites, or their product sites attL or attR, or alternative recombination target sites derived from these sites, such as Lox511 sites or Lox66 sites. In some embodiments, the non-viral DNA vector is substantially double-stranded. In some embodiments, the non-viral DNA vector is substantially supercoiled. In some embodiments, the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions. In some embodiments, the non-viral DNA vector is non-immunogenic.

[0024] In some embodiments, X and X' are derived from nucleic acid sequences present in one or more AAV serotypes. In some embodiments, X and X' each comprise a nucleotide sequence having at least 85% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 91% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 92% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 93% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 94% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 95% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 96% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 97% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 98% identity to any one of SEQ ID NOs:1-18. In some embodiments, X and X' each comprise a nucleotide sequence having at least 99% identity to any one of SEQ ID NOs:1-18. In some embodiments, the non-viral DNA vector does not comprise a DD element. In some embodiments, the non-viral DNA vector does not comprise a DD element, but comprises at least a portion of a bacterial origin of replication.

[0025] In some embodiments, Y has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 91% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 92% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 93% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 94% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence that is at least 99% identical to any one of SEQ ID NOs: 58-59. In some embodiments, Y has a nucleotide sequence having any one of SEQ ID NOs: 58-59. In some embodiments, Y does not comprise a bacterial origin of replication or any part thereof.

[0026] In some embodiments, the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but the bacterial origin of replication or a portion of a bacterial origin of replication is not included in the second portion. In some embodiments, the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but the bacterial origin of replication or a portion of a bacterial origin of replication is not included in Y. In some embodiments, the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:64 or SEQ ID NO:65), ATP7B (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:70 or SEQ ID NO:83), AlAT (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:70 or SEQ ID NO:83), In some embodiments, the one or more therapeutic proteins are selected from the group consisting of: ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 67), ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 67), BDF8 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 68), and variants thereof. In some embodiments, the one or more therapeutic proteins are alkaline phosphatase or variants thereof.

[0027] A third aspect of the present disclosure is an isolated circular non-viral DNA vector comprising the following elements operably linked in a 5' to 3' direction: (i) a first repeat sequence, (ii) a non-repetitive nucleotide sequence having at least three nucleotides, (iii) a second repeat sequence, and (iv) an expression cassette. In some embodiments, the non-viral DNA vector comprises fewer than about 400 CpGs per vector. In some embodiments, the non-viral DNA vector comprises fewer than about 300 CpGs per vector. In some embodiments, the non-viral DNA vector comprises fewer than about 250 CpGs per vector. In some embodiments, the non-viral DNA vector comprises fewer than about 200 CpGs per vector. In some embodiments, the non-viral DNA vector comprises fewer than about 150 CpGs per vector. In some embodiments, the non-viral DNA vector comprises fewer than about 100 CpGs per vector. In some embodiments, the non-viral DNA vector comprises fewer than about 50 CpGs per vector. In some embodiments, the expression cassette comprises one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter.

[0028] In some embodiments, the unique nucleotide sequence comprises at least 5 nucleotides. In some embodiments, the unique nucleotide sequence comprises at least 10 nucleotides. In some embodiments, the unique nucleotide sequence comprises at least 15 nucleotides. In some embodiments, the unique nucleotide sequence comprises at least 20 nucleotides. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes at least a portion of a bacterial origin of replication. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes a heterologous gene or a portion of a heterologous gene. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial suppressor tRNA. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial suppressor RNAi repressor. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes an antisense RNA. In some embodiments, the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial operator sequence. In some embodiments, the bacterial operator sequence comprises a lac operator. In some embodiments, the bacterial operator sequence comprises a tet operator.

[0029] In some embodiments, the non-viral DNA vector lacks a drug resistance gene. In some embodiments, the non-viral DNA vector comprises one or more recombination sites. In some embodiments, the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB sites and attP sites, or their product sites attL or attR, or alternative recombination target sites derived from these sites, such as Lox511 sites or Lox66 sites. In some embodiments, the non-viral DNA vector is non-immunogenic. In some embodiments, the non-viral DNA vector is substantially double-stranded.

[0030] In some embodiments, the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:69), ATP7B (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:70 or SEQ ID NO:83), AlAT ( In some embodiments, the one or more therapeutic proteins are selected from the group consisting of: ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 66), ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 67), BDF8 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 68), and variants thereof. In some embodiments, the one or more therapeutic proteins are alkaline phosphatase or variants thereof.

[0031] A fourth aspect of the present disclosure is an isolated circular non-viral DNA vector comprising: a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, and the at least two inverted repeat sequences are separated by at least a portion of a bacterial origin of replication.

[0032] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector contains fewer than about 400 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 300 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 250 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 200 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 150 CpGs per vector. In some embodiments, the non-viral DNA vector contains fewer than about 50 CpGs per vector.

[0033] In some embodiments, the non-viral DNA vector lacks a drug resistance gene. In some embodiments, the non-viral DNA vector comprises one or more recombination sites. In some embodiments, the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB sites and attP sites, or their product sites attL or attR, or alternative recombination target sites derived from these sites, such as Lox511 sites or Lox66 sites. In some embodiments, the non-viral DNA vector is substantially double-stranded. In some embodiments, the non-viral DNA vector is substantially supercoiled.

[0034] In some embodiments, the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions. In some embodiments, the non-viral DNA vector is non-immunogenic.

[0035] In some embodiments, each of the inverted repeat sequences is derived from a nucleic acid sequence present in one or more AAV serotypes. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 85% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 91% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 92% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 93% identity to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences comprises a nucleotide sequence having at least 94% identity to any one of SEQ ID NOs:1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence at least 95% identical to any one of SEQ ID NOs:1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence at least 96% identical to any one of SEQ ID NOs:1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence at least 97% identical to any one of SEQ ID NOs:1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence at least 98% identical to any one of SEQ ID NOs:1-18. In some embodiments, each inverted repeat sequence comprises a nucleotide sequence at least 99% identical to any one of SEQ ID NOs:1-18. In some embodiments, the non-viral DNA vector does not comprise a DD element.In some embodiments, the non-viral DNA vector does not contain a DD element but does contain at least a portion of a bacterial origin of replication.

[0036] In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 85% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 90% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 95% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 96% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 97% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence that is at least 98% identical to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence having at least 99% identity to any one of SEQ ID NOs: 58 to 59. In some embodiments, at least a portion of the bacterial origin of replication has a nucleotide sequence having any one of SEQ ID NOs: 58 to 59.

[0037] In some embodiments, the second portion comprises a first nucleic acid sequence having at least 85% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 85% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 85% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.In some embodiments, the second portion comprises a first nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.In some embodiments, the second portion comprises a first nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.

[0038] In some embodiments, the second portion comprises a nucleic acid sequence having at least 80% identity to any one of SEQ ID NO: 35 and SEQ ID NO: 60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 85% identity to any one of SEQ ID NO: 35 and SEQ ID NO: 60.

[0039] In some embodiments, the second portion comprises a nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having any one of SEQ ID NO:35 and SEQ ID NO:60.

[0040] In some embodiments, the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:69), ATP7B (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:70 or SEQ ID NO:83), AlAT ( In some embodiments, the one or more therapeutic proteins are selected from the group consisting of: ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 66), ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 67), BDF8 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to SEQ ID NO: 68), and variants thereof. In some embodiments, the one or more therapeutic proteins are alkaline phosphatase or variants thereof.

[0041] In some embodiments, the non-viral DNA vector further comprises an S / MAR element. In some embodiments, the non-viral DNA vector further comprises an insulator element. In some embodiments, the expression cassette further comprises a polyadenylation site downstream of the one or more nucleic acid sequences encoding one or more therapeutic proteins.

[0042] A fifth aspect of the present disclosure is a compound represented by formula (IA) to formula (IE): [A] v -[B]-[C] w -[R] q -([D] x -[E] y ) z (IA), [A]-[B]-[C]-[R] q-([D] x -[E] y ) (IB), ([A]-[B])-([D] x -[E] y ) z (I C), ([A]-[B])-([E] y ) (ID), and [A]-[B]-[R] q -([E] y ) (IE), (In the formula, A comprises an amino acid sequence encoding a secretory signal peptide, B contains the amino acids encoding alkaline phosphatase, C contains an amino acid sequence encoding a GPI anchor, R is -(M o (Fc)N p )-, wherein M and N each independently contain between 1 and 6 amino acids, Fc is an Fc domain, and o and p are each independently 0, 1, or 2; D comprises an amino acid sequence having between 4 and 6 amino acids, or F(G) t F, where each F is the same amino acid, G is an amino acid sequence having 3, 4, or 5 amino acids, and t is an integer ranging from 2 to 5; E comprises an amino acid sequence having between 1 and 8 amino acids, q is 0 or 1; v is 0 or 1, w is 0 or 1; x is 0 or an integer ranging from 1 to 6; y is 0 or an integer ranging from 1 to 16, and and z is 0 or an integer ranging from 1 to 6), wherein the nucleic acid sequence encoding the polypeptide is operably linked to a promoter; and a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, and the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least 3 nucleotides.

[0043] In some embodiments, when v is 1, w is 0, q is 1, o is 1, p is 1, N is diamino acid-DI-, M is diamino acid-LK-, [B] comprises SEQ ID NO: 11, Fc comprises SEQ ID NO: 130, and x is 0, then [E] y does not contain 10 to 16 consecutive aspartic acid residues.

[0044] In some embodiments, E comprises 3 amino acids. In some embodiments, E is -DSS-. In some embodiments, E is -DSS- and y is in the range of 1 to 16. In some embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 0. In other embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 2. In some embodiments, E is -DSS-, y is 6, z is 1, x is 2, and q is 1.

[0045] A sixth aspect of the present disclosure is an isolated circular non-viral DNA vector having a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73, e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the isolated circular non-viral DNA is provided in a pharmaceutically acceptable vehicle. In some embodiments, the isolated circular non-viral DNA is formulated with one or more lipid nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more polymeric nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more proteolipid nanoparticles.

[0046] A seventh aspect of the present disclosure is an isolated circular non-viral DNA vector having a nucleic acid sequence having any one of SEQ ID NOs:28-30, 38, 40-48, and 72-73. In some embodiments, the isolated circular non-viral DNA is provided in a pharmaceutically acceptable vehicle. In some embodiments, the isolated circular non-viral DNA is formulated with one or more lipid nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more polymeric nanoparticles. In some embodiments, the isolated circular non-viral DNA is formulated with one or more proteolipid nanoparticles.

[0047] An eighth aspect of the present disclosure is a pharmaceutical composition comprising any one of the isolated circular non-viral DNA vectors of any one of the above embodiments and a pharmaceutically acceptable carrier or excipient. In some embodiments, the pharmaceutical composition is formulated with a lipid-based delivery vehicle. In some embodiments, the pharmaceutical composition is formulated as a lipid nanoparticle. In some embodiments, the pharmaceutical composition is formulated as a lipid nanoparticle. In some embodiments, the pharmaceutical composition is formulated with one or more polymers.

[0048] A ninth aspect of the present disclosure is a method of treating a patient in need thereof, comprising administering to the patient any of the pharmaceutical compositions described above. In some embodiments, the pharmaceutical composition is administered weekly. In some embodiments, the pharmaceutical composition is administered monthly. In some embodiments, the pharmaceutical composition is administered every two months. In some embodiments, the pharmaceutical composition is administered every six months. In some embodiments, the pharmaceutical composition is administered annually. In some embodiments, the pharmaceutical composition is administered every two years. In some embodiments, the pharmaceutical composition is administered every few years.

[0049] A tenth aspect of the present disclosure is a method for treating hypophosphatasia, comprising administering a therapeutically effective amount of any of the above-described isolated circular non-viral DNA vectors or a pharmaceutical composition comprising same.

[0050] An eleventh aspect of the present disclosure is a method for treating, alleviating, or preventing symptoms of hypophosphatasia, comprising administering a therapeutically effective amount of any of the above-described isolated circular non-viral DNA vectors or a pharmaceutical composition comprising same.

[0051] A twelfth aspect of the present disclosure relates to the use of any of the above-described isolated circular non-viral DNA vectors (or a pharmaceutical composition comprising same) for treating hypophosphatasia.

[0052] To gain a general understanding of the features of the present disclosure, reference is made to the drawings, in which like reference numerals are used throughout to identify identical elements. [Brief explanation of the drawings]

[0053] [Figure 1A] 1 illustrates a non-viral DNA vector comprising: (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by a non-repetitive nucleotide sequence having at least three nucleotides. The first portion comprises a nucleic acid encoding human tissue non-specific alkaline phosphatase (TNALP), under the control of a promoter, including any of the promoters described herein. In some embodiments, the cruciform structure comprises a Holliday junction. [Figure 1B-1C]FIG. 1A shows the non-viral DNA vector of FIG. 1A and illustrates at least one cruciform structure formed. The inverted DNA repeat element that results in the formation of the cruciform DNA structure can include internal inverted DNA repeats, as shown in FIG. 1B. These smaller internal inverted DNA repeat elements can form additional secondary structures that stabilize the formation of larger cruciform structures. As shown in FIG. 1B, cruciform structures are formed between specific repeat elements; however, due to the nature of these repeats, cruciforms can also form between other repeat elements or between the inverted repeat sequence and the remainder of the non-viral DNA vector. In some embodiments, the inverted repeat element can be intermittent, containing regions of non-base-paired DNA or single-stranded DNA. One such region containing non-base-paired DNA or single-stranded DNA is in a region containing a non-repetitive nucleotide sequence of at least three nucleotides that is internal to the cruciform structure (see FIG. 1A). Considering the components of the non-viral DNA vectors of the present disclosure, it is believed that at least two inverted repeat sequences, each separated by a unique nucleotide sequence having at least three nucleotides, promote the formation of a single cruciform structure with two long arms capped by a single-stranded DNA region. [Figure 1D] FIG. 1B shows the non-viral DNA vector of FIG. 1A and illustrates at least one cruciform structure formed, as well as the secondary structure of a portion of the integrated, unique nucleotide sequence having at least three nucleotides that may be part of a bacterial origin of replication. [Figure 1E] Figure 1 shows the predicted secondary structure of the bacterial origin of replication between the two inverted terminal repeats. This single large cruciform structure contains many regions of single-stranded, non-repeated DNA within the region of the bacterial origin of replication. [Figures 2A-2E]1 shows the predicted DNA secondary structure, calculated Gibbs free energy, normalized calculated Gibbs free energy per base pair, and melting temperature (Tm) of the CpG-free internal repeat sequences of the circular non-viral DNA vectors according to the present disclosure (SEQ ID NO: 29, SEQ ID NO: 30, and SEQ ID NO: 31). Based on this evaluation, although the two long inverted repeat sequences contain smaller internal inverted repeats, no internal secondary structure can form within the two long inverted repeat sequences if they contain portions of the bacterial origin of replication. [Figure 3] FIG. 1 shows three representative transmission electron micrographs of a circular non-viral DNA vector of the present disclosure that contains at least two inverted repeat sequences (M012-SEQ ID NO: 10) separated by at least a portion of a bacterial origin of replication. [Figure 4] Figure 1 shows the clearance of circular non-viral vector DNA reporter constructs (P004 - SEQ ID NO: 35, P006 - SEQ ID NO: 14) containing a cruciform structure of the present disclosure delivered to 293 cells by polyethyleneimine (PEI) and SM-102-based lipid nanoparticles (LNP). The data suggest that clearance of reporter constructs delivered using LNP and PEI began on day 6. Furthermore, the data suggest that different inverted repeat sequences have different clearance efficiencies. [Figure 5] FIG. 1 shows that green fluorescent protein (GFP) and red fluorescent protein (RFP) are simultaneously expressed on day 3, and mainly RFP is expressed on day 8, in human hepatocytes derived from non-dividing induced pluripotent stem cells (iPSCs) transfected with a circular non-viral DNA vector (SEQ ID NO: 32) containing an RFP / GFP reporter. [Figure 6]

[0023] Figure 10 compares gene expression and durability of firefly luciferase from two different constructs, i.e., a circular non-viral DNA vector of the present disclosure (SEQ ID NO: 30) and a plasmid (SEQ ID NO: 31), in post-mitotic human iPSC-derived hepatocytes. The data demonstrate that transgene expression from the circular non-viral DNA vector of the present disclosure (SEQ ID NO: 30) with a cruciform structure is much higher and more stable than that of the plasmid construct (SEQ ID NO: 31). [Figure 7] Figure 1 compares the secreted ALP activity of human tissue-nonspecific alkaline phosphatase (TNALP) in postmitotic iPSC-derived hepatocytes from three different constructs: a circular nonviral DNA vector of the present disclosure containing a cruciform structure composed of a long inverted repeat containing a bacterial origin of replication (M012-SEQ ID NO: 28), a circular nonviral DNA vector of the present disclosure containing a cruciform structure composed of a shorter inverted repeat without a bacterial origin (M013-SEQ ID NO: 29), and a conventional plasmid vector (P020-SEQ ID NO: 33). The data suggest that transgene (TNALP) expression from the vector composed of the long inverted repeat containing a bacterial origin of replication was significantly enhanced. [Figure 8] Figure 8A shows that a circular, non-viral DNA vector encoding a luciferase reporter according to the present disclosure (M014-SEQ ID NO: 30) demonstrated a sustained bioluminescence signal compared to the rapid decay of a control luciferase plasmid in mouse liver tissue collected from weeks 1 to 4 and 5 after hydrodynamic tail vein injection dosing. Figure 8B shows that the DNA copy number results are consistent with gene expression of the two DNA vectors. While the DNA copy number of the circular, non-viral DNA vector was maintained in mouse liver tissue for one month, the copy number of the control luciferase plasmid (P021-SEQ ID NO: 31) in mouse liver cells significantly decreased from week 1 to week 5, as shown in Figure 8B. [Figure 9]Figure 1 shows data from a single time point compared between two different studies. The first study used a circular non-viral DNA vector containing nucleic acid encoding TNALP, whereas the second study utilized mobilized human hematopoietic stem cells transduced with a lentiviral vector expressing TNALP. Similar plasma ALP activity was mediated in mice in the two different studies. [Figure 10] Figure 1. Classical mechanism of Holliday junction resolution. (A) Antiparallel, stacked X-shaped Holliday junction with 2-fold symmetry. (B) Classical Holliday junction resolvase is a dimeric enzyme that induces a conformational change in the junction upon binding, causing it to unfold. Resolution occurs by the introduction of two coordinated, symmetrically related nicks in the strand of similar polarity at or immediately adjacent to the branch point. (C) Symmetric resolution results in a pair of nicked DNA duplexes, each of which can be repaired directly by nick ligation, or homologous sequences can serve as templates for nonhomologous end joining (NHEJ) or homology-directed repair (HDR). A star represents a given DNA strand. [Figure 11]

[0023] Figure 1 shows the mechanism of resolution of a circular non-viral DNA vector of the present disclosure (Form A) containing at least one cruciform structure (Holliday junction). When introduced into a eukaryotic cell, Holliday junction resolvase introduces two coordinately and symmetrically related nicks in the strand of similar polarity at or immediately adjacent to the branch point. Symmetric resolution results in a nicked circular or linear DNA duplex that can be directly repaired by nick-ligation (yielding Form B) or in which homologous sequences can serve as templates for NHEJ or HDR (yielding Form C). It is further expected that this process can be repeated to obtain higher molecular weight linear or circular forms. [Figures 12A-12B]Figure 12C shows that circular, non-viral DNA vectors of the present disclosure encoding a mouse secreted placental alkaline phosphatase (SEAP) reporter (M027 and M032—SEQ ID NO: 74 and SEQ ID NO: 75) persist in a rodent model via hydrodynamic tail vein injection at 15 μg of DNA per mouse per dose. High plasma SEAP activity in mouse plasma was maintained from day 1 to day 190 after two doses via hydrodynamic tail vein injection (15 μg of DNA per mouse per dose). Furthermore, analysis of DNA vector copy number per diploid cell revealed that three constructs of the present disclosure (M027—SEQ ID NO: 74, M032—SEQ ID NO: 75) persisted in mouse liver for 183 days (Figure 12C). [Figures 13A-13B] Figure 13 shows a comparison of two constructs according to the present disclosure, M012 (SEQ ID NO: 30) and M056 (SEQ ID NO: 73), with two different cruciform structures in iPSC-derived hepatocytes at day 3. Figure 13A shows that cells transfected with construct M056 (SEQ ID NO: 73), which has a more optimized cruciform structure, secreted significantly higher ALP levels into the medium than cells transfected with M012 (SEQ ID NO: 30) using both FuGENE- and SM102-based lipid nanoparticle formulations. Figure 13B shows that both constructs with different structures (M012-SEQ ID NO: 30 and M056-SEQ ID NO: 73) did not significantly affect the viability of the transfected cells. [Figures 14A-14C]Figure 14A shows that nuclear entry of constructs according to the present disclosure having cruciform structures (M012-SEQ ID NO:28, M013-SEQ ID NO:29) is enhanced compared to DNA without cruciform structures (M022-SEQ ID NO:33) in post-mitotic, non-dividing iPSC-derived hepatocytes after transfection. Figure 14A shows a representative image in which DAPI staining (blue) represents the nucleus, green foci without green circles represent constructs of the present disclosure in the cytoplasm, and green foci marked with green circles represent constructs of the present disclosure in the nucleus. A fluorescently labeled circular non-viral DNA vector containing a nucleic acid encoding TNALP and also containing a double inverted repeat (M012-SEQ ID NO:28) showed the highest number of Forsythia per nucleus on days 3 and 6 compared to (i) a circular non-viral DNA vector containing a single inverted repeat without an intervening heterologous sequence (DD-ITR construct) (M013-SEQ ID NO:29) and (ii) a control without any cruciform structures (M022-SEQ ID NO:33) (Figure 14B). A correlation was observed between the number of Forsythia per nucleus and the ALP activity measured in the cell culture medium (Figure 14C). [Figures 15A-15B] 1 shows that a construct of the present disclosure containing firefly luciferase DNA with an improved cruciform structure (SEQ ID NO: 73) resulted in significantly higher luciferase activity in both human hepatocytes and cynomolgus monkey hepatocytes across species than control DNA without a cruciform structure (SEQ ID NO: 74). Both the construct of the present disclosure containing luciferase DNA (SEQ ID NO: 73) and the control luciferase DNA without a cruciform structure (SEQ ID NO: 74) were transfected into hepatocytes using an SM102-based lipid nanoparticle formulation. [Figure 16]1 shows that a construct according to the present disclosure containing luciferase DNA with an improved cruciform structure (SEQ ID NO: 73) also resulted in significantly higher luciferase activity in mice than the control DNA without a cruciform structure (SEQ ID NO: 74). Mice were dosed with a circular non-viral DNA vector containing a firefly luciferase reporter (SEQ ID NO: 73) and the control DNA without a cruciform structure (SEQ ID NO: 74) via hydrodynamic tail vein injection (15 μg per mouse), and mouse liver tissues were harvested on days 7 and 14, followed by luciferase activity assays. [Figure 17] This figure shows that a construct according to the present disclosure (SEQ ID NO: 43) has superior durability compared to mRNA. A construct according to the present disclosure (SEQ ID NO: 43) and chemically modified mRNA encoding a cynomolgus monkey soluble TNALP transgene were transfected into primary human hepatocytes via an SM102-based lipid nanoparticle formulation. ALP activity from the construct according to the present disclosure in the culture medium increased from day 1 to day 3 and was then maintained from day 3 to day 6. Concurrently, ALP activity in cells transfected with the mRNA decreased from day 1 to day 5 and disappeared by day 6. [Figure 18]

[0023] Figure 1 shows the co-localization of PARP1 (purple) with a construct according to the present disclosure (green) (M012-SEQ ID NO: 28) in the cytoplasm of 293 cells 24 hours after transfection. PARP1 is a well-known first responder that promotes genomic DNA repair pathways after detecting DNA damage. The co-localization data suggest that PARP1 may be one of the factors involved in innate immune evasion, resolution, nuclear entry, recombination, and nuclear retention of the construct according to the present disclosure. [Figures 19A-19C]Figure 19B shows the immunomodulatory effects of circular non-viral constructs according to the present disclosure. Figure 19B shows that a human TNALP DNA construct according to the present disclosure (M012-SEQ ID NO: 28) with an optimized cruciform structure results in much higher ALP activity, more durable transgene expression, and no immune response (as indicated by re-administration ability) in mice compared to a non-viral human TNALP DNA vector (DD-ITR construct) with an earlier type of cruciform structure containing a single inverted repeat without an intervening heterologous sequence (M013-SEQ ID NO: 29) (Figure 19A). Figure 19C shows that an optimized cynomolgus monkey TNALP DNA construct according to the present disclosure (M026-SEQ ID NO: 43) with an improved cruciform structure further enhances efficacy and durability of transgene expression while maintaining re-administration ability compared to a similar construct without gene cassette optimization. The non-viral DNA construct was administered repeatedly at 3-week intervals by hydrodynamic tail vein injection (15 μg per mouse), and plasma samples were collected weekly for evaluation of ALP activity. DETAILED DESCRIPTION OF THE INVENTION

[0054] Also, unless expressly indicated to the contrary, it should be understood that in any claimed method including more than one step or act, the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are recited.

[0055] References herein to "one embodiment," "an embodiment," "an illustrative embodiment," etc. indicate that the described embodiment may include a particular feature, structure, or characteristic, but all embodiments may or may not include that particular feature, structure, or characteristic. Moreover, such phrases do not necessarily refer to the same embodiment. Furthermore, when a particular feature, structure, or characteristic is described in connection with an embodiment, it is believed to be within the knowledge of one skilled in the art that such feature, structure, or characteristic may also be affected in connection with other embodiments, whether or not explicitly stated.

[0056] As used herein, the singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. The term "includes" is defined inclusively, so that "includes A or B" means including A, B, or A and B.

[0057] As used in the specification and claims, "or" is understood to have the same meaning as "and / or" as defined above. For example, when separating listed items, "or" or "and / or" shall be construed as inclusive, e.g., the inclusion of at least one, but also two or more, of a plurality of elements or a list of elements, and optionally additional unlisted items. Only terms clearly indicating the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," shall refer to the inclusion of exactly one element of a plurality of elements or a list of elements. In general, the term "or" as used herein shall be construed as indicating exclusive alternatives (i.e., "one or the other, but not both") only when followed by terms of exclusion, such as "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.

[0058] As used herein, terms such as "comprising," "including," and "having" are used interchangeably and have the same meaning. Similarly, terms such as "comprises," "includes," and "has" are used interchangeably and have the same meaning. Specifically, each of these terms is defined consistent with the general U.S. patent law definition of "comprising," and is therefore interpreted as open-ended, meaning "at least the following," and not excluding additional features, limitations, aspects, etc. Thus, for example, "a device having components a, b, and c" means that the device includes at least components a, b, and c. Similarly, "a method involving steps a, b, and c" means that the method includes at least steps a, b, and c. Additionally, although steps and processes may be outlined herein in a particular order, one skilled in the art will recognize that the order of steps and processes may vary.

[0059] The phrase "at least one," as used herein and in the claims, in reference to a list of one or more elements, is understood to mean at least one element selected from any one or more of the elements in the list of elements, but does not necessarily include at least one of each and every element specifically listed in the list of elements, and does not exclude any combination of elements in the list of elements. Again, this definition allows for the optional presence of elements other than those specifically identified in the list of elements to which the phrase "at least one" refers, whether or not related to the specifically identified elements. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B," or, equivalently, "at least one of A and / or B") can refer in one embodiment to at least one A (optionally including more than one) and no B (optionally including elements other than B); in another embodiment to at least one B (optionally including more than one) and no A (optionally including elements other than A); in yet another embodiment to at least one A (optionally including more than one) and at least one B (optionally including more than one) (optionally including other elements); and so on.

[0060] As used herein, the term "about" refers to a value such as a measurable quantity, such as the length of a nucleotide sequence, polynucleotide, or polypeptide sequence, dosage, time, temperature, etc., and is meant to encompass variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.

[0061] As used herein, the term "Fc" refers to the Fc domain of human IgG. All subtypes of IgG, such as IgG1, IgG2, IgG3, and IgG4, are contemplated for use as the Fc domain.

[0062] As used herein, the term "heterologous gene" refers to a nucleotide sequence that is not naturally associated with the host animal into which it is introduced, including, for example, an exon-coding sequence from a human gene that is introduced into a host nematode as a chimeric heterologous gene.

[0063] As used herein, the term "host cell" refers to any cell type that can be transformed, transfected, transduced, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present disclosure. In some embodiments, the term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. Host cells can include packaging cells, producer cells, and cells infected with a viral vector. In certain embodiments, host cells infected with a viral vector of the present disclosure are administered to a subject in need of therapy. In some embodiments, host cells are transduced ex vivo. In other embodiments, host cells are transduced in vivo.

[0064] As used herein, the terms "hypophosphatasia" and "HPP" refer to a rare genetic skeletal disorder caused by one or more loss-of-function mutations in the ALPL (alkaline phosphatase, liver / bone / kidney) gene, which encodes tissue-nonspecific alkaline phosphatase (TNALP). Furthermore, HPP can be characterized as, for example, infantile HPP or perinatal HPP (e.g., benign perinatal HPP or fatal perinatal HPP). For example, "infantile HPP" refers to patients suffering from HPP at approximately 3 years of age or younger, while "perinatal HPP" refers to patients suffering from HPP shortly before or shortly after birth (e.g., 1 to 4 weeks after birth). The age of onset of HPP, e.g., when a subject exhibits symptoms of HPP, can also be classified, for example, as perinatal-onset HPP and infantile-onset HPP. Patients with HPP may exhibit symptoms of HPP including, but not limited to, skeletal deformities, hypotonia, movement disorders, gait disturbances, bone deformities, joint pain, bone pain, fractures, muscle weakness, muscle pain, rickets (e.g., defects in growth plate cartilage), premature loss of primary teeth, incomplete bone mineralization, elevated blood and / or urinary levels of phosphoethanolamine (PEA), PPi, pyridoxal 5'-phosphate (PLP), hypomineralized, rachitic ribs, hypercalciuria, dwarfism, HPP-associated epilepsy, poor weight gain, craniosynostosis, and / or calcium pyrophosphate dihydrate crystal deposition disease (CPPD) in the joints, leading to, for example, chondrocalcinosis and early death. Symptoms of HPP can also include TBM and symptoms of TBM such as cardiopulmonary arrest, tracheostomy, cardiac arrest, respiratory distress, sputum retention, wheezing, cough, anoxic episodes, cyanosis, bradycardia, tachyarrhythmia, spontaneous hyperextension of the neck, prolonged expiratory respiratory phase, failure to thrive, sternal retraction, substernal retraction, intercostal retractions, intermittent or persistent dyspnea, and recurrent bronchitis or pneumonia.

[0065] As used herein, the term "nucleic acid" refers to a polynucleotide such as DNA or RNA. A nucleic acid can be single-stranded, partially double-stranded, or completely double-stranded, and in some cases partially or completely triple-stranded. Nucleic acids include genomic DNA, cDNA, mRNA, and the like. A nucleic acid can be purified from a natural source, produced using a recombinant expression system and optionally purified, or chemically synthesized. Optionally, for example, in the case of chemically synthesized molecules, the nucleic acid can contain nucleoside analogs, such as analogs having chemically modified bases or sugars, backbone modifications, and the like. As used herein, the term "nucleic acid sequence" can refer to the nucleic acid substance itself and is not limited to the sequence information (i.e., a string of letters selected from the five base letters A, G, C, T, or U) that biochemically characterizes a particular nucleic acid, such as a DNA molecule or an RNA molecule. A nucleic acid sequence is represented in the 5' to 3' direction unless otherwise specified. As used herein, the term "nucleic acid segment" is used to refer to a nucleic acid sequence that is a portion of a longer nucleic acid sequence.

[0066] As used herein, the terms "operably linked" or "operably associated" refer to a functional relationship between two nucleic acids in which the expression, activity, localization, etc. of one sequence is controlled, directed, regulated, coordinated, etc. by the other nucleic acid. Two nucleic acids are said to be operably linked, or operably associated, or in operative association. "Operably linked" or "operably associated" can also refer to the relationship between two polypeptides in which the expression of one polypeptide is controlled, directed, regulated, coordinated, etc. by the other polypeptide. For example, transcription of the nucleic acid is directed by an operably linked promoter, post-transcriptional processing of the nucleic acid is directed by an operably linked processing sequence, translation of the nucleic acid is directed by an operably linked translational regulatory sequence such as a translation initiation sequence, transport, stability, or localization of the nucleic acid or polypeptide is directed by an operably linked transport or localization sequence such as a secretion signal sequence, and post-translational processing of the polypeptide is directed by an operably linked processing sequence. Typically, a first nucleic acid sequence operably linked to a second nucleic acid sequence, or a first polypeptide operably linked to a second polypeptide, will be directly or indirectly covalently linked to such sequences, although any effective three-dimensional association is acceptable. Those skilled in the art will understand that multiple nucleic acids or multiple polypeptides can be operably linked or associated with each other.

[0067] As used herein, the terms "pharmaceutically acceptable excipient," "carrier," or "diluent" refer to a pharmaceutical ingredient that does not alter the therapeutic properties of the administered active agent. An example of a pharmaceutically acceptable carrier substance is physiological saline. For example, pharmaceutically acceptable carriers can include sodium chloride (e.g., 150 mM sodium chloride) and sodium phosphate (e.g., 25 mM sodium phosphate). Other physiologically acceptable excipients, carriers, and diluents, and their formulations, are known to those skilled in the art and are described, for example, in Remington's "The Science and Practice of Pharmacy" (22nd ed.), Allen (2012). For example, pharmaceutically acceptable excipients, carriers, or diluents can include dibasic sodium phosphate heptahydrate, monobasic sodium phosphate monohydrate, and sodium chloride at a pH between 7.2 and 7.6.

[0068] As used herein, the term "pharmaceutical composition" refers to a composition comprising an active agent described herein and formulated with at least one pharmaceutically acceptable excipient, carrier, or diluent. A pharmaceutical composition may be manufactured or sold with the approval of a government regulatory agency as part of a treatment regimen to treat or prevent a disease or event in a patient (e.g., an infant with HPP, such as an infant with perinatal-onset HPP or an infant with infantile-onset HPP, or a patient with juvenile-onset HPP or childhood-onset HPP). A pharmaceutical composition may be formulated, for example, in a unit dosage form, for subcutaneous administration, intravenous administration (e.g., as a sterile solution free of particulate matter, in a solvent system suitable for intravenous use), oral administration (e.g., as a tablet, capsule, caplet, gelcap, or syrup), or any other formulation described herein.

[0069] As used herein, the terms "polypeptide," "polypeptide fragment," "peptide," and "protein" are used interchangeably according to their conventional meaning, i.e., as sequences of amino acids, unless specified to the contrary. Polypeptides are not limited to a particular length; for example, they can include full-length protein sequences or fragments of full-length proteins, and can include post-translational modifications of the polypeptide, such as glycosylation, acetylation, phosphorylation, etc., as well as other modifications (both naturally occurring and non-naturally occurring) known in the art. In various embodiments, polypeptides contemplated herein include a signal (or leader) sequence at the N-terminus of the protein, which directs protein transport co- or post-translationally. Polypeptides can be prepared using any of a variety of well-known recombinant and / or synthetic techniques. In some embodiments, polypeptides contemplated herein include sequences having deletions from, additions to, and / or substitutions of one or more amino acids of alkaline phosphatase or a CAR disclosed herein.

[0070] As used herein, "prevent" and similar terms such as "prevented," "preventing," and the like refer to an approach that averts, inhibits, or reduces the likelihood of the occurrence or recurrence of a disease or condition. This also refers to delaying the onset or recurrence of a disease or condition, or delaying the onset or recurrence of symptoms of a disease or condition. As used herein, "prevention" and similar terms also include reducing the intensity, effects, symptoms, and / or burden of a disease or condition prior to the onset or recurrence of the disease or condition.

[0071] As used herein, the term "promoter" refers to a DNA sequence that determines a transcription start site for RNA polymerase. A promoter sequence contains motifs that are recognized and bound by polypeptides, i.e., transcription factors. Upon binding, the transcription factors recruit RNA polymerase II, preferably RNA polymerase I, RNA polymerase II, or RNA polymerase III, more preferably RNA polymerase II or RNA polymerase III, and most preferably RNA polymerase II. This initiates expression of a nucleic acid operably linked to a transcription control sequence. Depending on the type of nucleic acid to be expressed, expression as interpreted herein may involve transcribing a DNA sequence into an RNA polynucleotide (e.g., suitable for antisense, RNAi, or ribozyme approaches) or may involve transcribing a DNA sequence into an RNA polynucleotide and subsequently translating the RNA polynucleotide into a polypeptide (e.g., suitable for gene expression and recombinant polypeptide production approaches). To control the expression of a nucleic acid sequence, a transcriptional regulatory sequence may be located immediately adjacent to the nucleic acid to be expressed, i.e., physically linked to the 5' end of the nucleic acid. Alternatively, the transcriptional regulatory sequence may be located in close physical proximity. In the latter case, however, the sequence must be positioned in a way that allows functional interaction with the nucleic acid to be expressed.

[0072] As used herein, the term "regulatory sequence" or "regulatory element" refers to a nucleic acid sequence that regulates one or more steps in the expression (particularly transcription, but possibly other events such as splicing or other processing) of an operably linked nucleic acid sequence(s). The term includes promoters, enhancers, and other transcription control elements that direct or enhance transcription of an operably linked nucleic acid. Regulatory sequences can direct constitutive expression (e.g., expression in most or all cell types under typical physiological conditions in culture or an organism), cell-type-specific, lineage-specific, or tissue-specific expression, and / or regulatable (inducible or repressible) expression. For example, expression can be induced or repressed by the presence or addition of an inducer such as a hormone or other small molecule, by elevated temperature, etc. Non-limiting examples of cell type-, lineage-, or tissue-specific promoters suitable for use in mammalian cells include lymphoid-specific promoters (see, e.g., Calame et al., Adv. Immunol. 43:235, 1988), such as T cell receptor promoters (see, e.g., Winoto et al., EMBO J. 8:729, 1989) and immunoglobulin promoters (see, e.g., Banerji et al., Cell 33:729, 1983; Queen et al., Cell 33:741, 1983), and neuron-specific promoters (e.g., the neurofilament promoter; Byrne et al., Proc. Natl. Acad. Sci. USA 86:5473, 1989). Developmentally regulated promoters include hox promoters (see, e.g., Kessel et al., Science 249:374, 1990) and the alpha-fetoprotein promoter (Campes et al., Genes Dev. 3:537, 1989). Some regulatory elements may inhibit or reduce expression of an operably linked nucleic acid. Such regulatory elements are sometimes referred to as "negative regulatory elements."Regulatory elements whose activity can be induced or repressed by exposure to inducers or repressors and / or alterations in environmental conditions are referred to herein as "regulatable" elements.

[0073] As used herein, the term "signal peptide" refers to a short peptide (about 5 to about 30 amino acids in length) at the N-terminus of a polypeptide that directs the polypeptide into the secretory pathway (e.g., the extracellular space). In some embodiments, the signal peptide is typically cleaved during secretion of the polypeptide. In some embodiments, a signal sequence can direct a polypeptide to an intracellular compartment or organelle. In some embodiments, a signal sequence can be identified by homology or biological activity to peptides with known function in targeting polypeptides to specific regions of a cell.

[0074] As used herein, the term "subject" refers to any animal subject, including laboratory animals (e.g., primates, rats, mice), farm animals (e.g., cows, sheep, goats, pigs, turkeys, chickens), household pets (e.g., dogs, cats, rodents, etc.), and humans.

[0075] As used herein, the term "therapeutically effective amount" refers to a virus or transduced therapeutic cells and can vary depending on factors such as the individual's medical condition, age, sex, and weight, and the ability of the stem and progenitor cells to elicit a desired response in the individual. In some embodiments, a therapeutically effective amount is also an amount in which any toxic or detrimental effects of the virus or transduced therapeutic cells are outweighed by the therapeutically beneficial effects. In some embodiments, the term "therapeutically effective amount" includes an amount effective to "treat" a subject (e.g., a patient).

[0076] As used herein, the term "treatment" or "treating" refers to any beneficial or desired effect on the symptoms or pathology of a disease or pathological condition, and may include even a minimal decrease in one or more measurable markers of the disease or condition being treated. In some embodiments, treatment may optionally include either a reduction or amelioration of symptoms of the disease or condition, or a delay in the progression of the disease or condition. "Treatment" does not necessarily refer to a complete eradication or cure of the disease or condition, or the symptoms associated therewith.

[0077] As used herein, "variants" or "variants" refer to nucleic acids or polypeptides that differ from a reference nucleic acid or polypeptide, but retain essential properties thereof. Generally, variants are overall closely similar, and in many regions identical, to the reference nucleic acid or polypeptide. Thus, "variant" forms of a transcription factor are overall closely similar and are capable of binding to DNA and activating gene transcription.

[0078] As used herein, the term "vector" refers to a nucleic acid molecule capable of transferring or transporting another nucleic acid molecule. In some embodiments, the transferred nucleic acid is generally linked to, e.g., inserted into, the vector's nucleic acid molecule. In some embodiments, the vector may contain sequences that direct autonomous replication within a cell or may contain sequences sufficient to allow integration into host cell DNA. Useful vectors include, for example, plasmids (typically DNA plasmids, although RNA plasmids are also used), cosmids, and viral vectors. As will be apparent to those skilled in the art, the term "viral vector" is used broadly to refer to either a nucleic acid molecule (e.g., a plasmid) that typically contains viral-derived nucleic acid elements that facilitate the transfer or integration of the nucleic acid molecule into a cellular genome, or a viral particle that mediates the transfer of the nucleic acid. In some embodiments, the viral particle typically contains various viral components, and sometimes host cell components, in addition to the nucleic acid(s).

[0079] Circular non-viral DNA vectors The present disclosure relates to circular non-viral DNA vectors, such as circular non-viral DNA vectors comprising at least two inverted repeat sequences, wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence that is not part of the at least two inverted repeat sequences. In some embodiments, the non-repetitive nucleotide sequence comprises at least 3 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 4 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 5 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 7 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 10 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 15 nucleotides. In some embodiments, the non-repetitive nucleotide sequence comprises at least 20 nucleotides. Examples of suitable non-repetitive nucleotide sequences include, but are not limited to, TTG, AAT, TAA, TAG, AGTT, AGTA, TAAA, TCAA, GAGTA, AAGTGCA, AGTACAAATTG, and ACCTTAGAGGCTA.

[0080] In some embodiments, the unique nucleotide sequence comprises a minimal bacterial origin of replication. In other embodiments, the unique nucleotide sequence comprises a heterologous gene or a portion of a heterologous gene, such as a gene encoding a bacterial suppressor tRNA, an RNAi repressor, or an antisense RNA. In other embodiments, the unique nucleotide sequence comprises a bacterial operator sequence, such as a lac operator or a tet operator.

[0081] In some embodiments, the circular non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the circular non-viral DNA vector comprises less than about 500 CpGs per vector, less than about 450 CpGs per vector, less than about 400 CpGs per vector, less than about 350 CpGs per vector, less than about 300 CpGs per vector, less than about 250 CpGs per vector, less than about 200 CpGs per vector, less than about 150 CpGs per vector, less than about 100 CpGs per vector, less than about 75 CpGs per vector, less than about 50 CpGs per vector, less than about 25 CpGs per vector, less than about 20 CpGs per vector, less than about 15 CpGs per vector, less than about 10 CpGs per vector, etc.

[0082] In some embodiments, the circular non-viral DNA vector lacks a drug resistance gene. In some embodiments, the circular non-viral DNA vector comprises two inverted repeats separated by a unique nucleotide sequence, wherein the vector further comprises at least a portion of a bacterial origin of replication, and the at least a portion of the bacterial origin of replication is not within either of the two inverted repeats or the unique nucleotide sequence. In some embodiments, the at least a portion of the bacterial origin of replication is located adjacent to the heterologous gene. In some embodiments, the circular non-viral DNA vector comprises one or more recombination sites, such as a LoxP site, an FRT site, an attB site, and an attP site, or their product sites attL or attR, or alternative recombination target sites derived from these sites, such as a Lox7 site, a Lox511 site, or a Lox66 site.

[0083] In some embodiments, the circular non-viral DNA vector is substantially double-stranded. In other embodiments, the circular non-viral DNA vector is substantially supercoiled. In other embodiments, the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions.

[0084] In some embodiments, circular non-viral DNA vectors are non-immunogenic (e.g., less likely to elicit an immune response compared to other non-viral DNA vectors or viral vectors such as lentiviral vectors, adenoviral vectors, and adeno-associated viral (AAV) vectors). The circular non-viral DNA vectors of the present disclosure are also believed to be suitable for repeated dosing, as further described herein. Furthermore, the reduced immunostimulatory CpG content facilitates re-dosing, which may be important in pediatric patients.

[0085] In some embodiments, the circular non-viral DNA vectors of the present disclosure promote sustained in vivo expression of one or more heterologous genes encoding one or more therapeutic proteins. Without intending to be bound by any particular theory, it is believed that the non-viral DNA vectors of the present disclosure function like endogenous genes in the nucleus, enhancing persistence of gene expression. In some embodiments, the circular non-viral DNA vector persists for a period of at least about 4 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 6 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 8 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 10 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 12 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 14 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 16 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 20 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 24 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 36 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 48 weeks after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 1 year after in vivo administration. In other embodiments, the circular non-viral DNA vector persists for a period of at least about 2 years after in vivo administration.In other embodiments, the circular non-viral DNA vector persists for a period of at least about 4 years following in vivo administration.

[0086] It is believed that transgenes carried by the circular non-viral DNA vectors of the present disclosure are taken up by cells, expressed at levels similar to transgene expression from viral vectors, and persist for periods similar to those of non-integrating viral vectors. Without intending to be bound by any particular theory, it is believed that the circular non-viral DNA vectors of the present disclosure function similarly to some non-integrating viral vectors by adopting a molecular form that allows for sustained gene expression. This similarity may be related to the chromatin factors with which both the circular non-viral DNA vectors and viral vectors of the present disclosure interact, or to the chromatin structure adopted by both viral vectors and the non-viral DNA vectors of the present disclosure. Chromatin is a term used to describe the structure that organizes DNA within the nucleus of eukaryotic cells. In its simplest concept, chromatin is composed of histone proteins that form nucleosomes on DNA. However, the spacing and modifications of these histones are complex and non-random, providing structural and signaling capabilities to the protein scaffold surrounding genes or structural elements. Although the role of chromatin in viral biology varies greatly among different viruses, interaction with chromatin is essential for all viruses that traverse the nucleus. The importance of chromatin dynamics in regulating essential viral vector processes, including entry, gene expression, and persistence, is beginning to be understood. The circular non-viral DNA vectors of the present disclosure are believed to exploit various aspects of chromatin dynamics in a manner similar to viral vectors. These attributes may include, among others, chromatin structures that promote interaction with the nuclear matrix, structures that regulate epigenetic factors that affect gene expression, structures that mediate nuclear organization, or structures that promote an active, transcriptionally active chromatin state.

[0087] In some embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by a non-repetitive nucleotide sequence having at least three nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least five nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 10 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 15 nucleotides.

[0088] In some embodiments, the second portion does not include a bacterial origin of replication or any portion thereof. In other embodiments, the unique nucleotide sequence does not include a bacterial origin of replication or any portion thereof. In other embodiments, the circular non-viral DNA vector includes a bacterial origin of replication or a portion thereof, but the bacterial origin of replication or portion thereof is not located within the second portion. In yet other embodiments, at least a portion of a bacterial origin of replication is included in the first portion or in a third portion adjacent to either the first portion or the second portion, but not within the second portion.

[0089] In some embodiments, the cruciform structure comprises a Holliday junction.

[0090] In some embodiments, each of the inverted repeat sequences comprises or is derived from a nucleic acid sequence present in an AAV serotype (including any of those disclosed herein).

[0091] In some embodiments, the unique nucleotide sequence is single-stranded, while the remainder of the second portion is double-stranded. In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises less than about 500 CpGs per vector, less than about 450 CpGs per vector, less than about 400 CpGs per vector, less than about 350 CpGs per vector, less than about 300 CpGs per vector, less than about 250 CpGs per vector, less than about 200 CpGs per vector, less than about 150 CpGs per vector, less than about 100 CpGs per vector, less than about 75 CpGs per vector, less than about 50 CpGs per vector, less than about 25 CpGs per vector, less than about 20 CpGs per vector, less than about 15 CpGs per vector, less than about 10 CpGs per vector, etc.

[0092] In other embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, the second portion having the formula XY-X', where X and X' are each an inverted repeat sequence, and Y is non-repeated and comprises at least 3 nucleotides, e.g., at least 5 nucleotides, at least 10 nucleotides, at least 15 nucleotides, etc. In some embodiments, the second portion does not comprise a bacterial origin of replication or any portion thereof. In other embodiments, the circular non-viral DNA vector comprises a bacterial origin of replication or a portion thereof, but the bacterial origin of replication or a portion thereof is not located within the second portion.

[0093] In some embodiments, the inverted repeat sequences (Xi and X') are derived from nucleic acid sequences present in the AAV genome. In some embodiments, the non-viral DNA vector is substantially free of CpG sequences. In some embodiments, the non-viral DNA vector comprises fewer than about 500 CpGs per vector, fewer than about 450 CpGs per vector, fewer than about 400 CpGs per vector, fewer than about 350 CpGs per vector, fewer than about 300 CpGs per vector, fewer than about 250 CpGs per vector, fewer than about 200 CpGs per vector, fewer than about 150 CpGs per vector, fewer than about 100 CpGs per vector, fewer than about 75 CpGs per vector, fewer than about 50 CpGs per vector, fewer than about 25 CpGs per vector, fewer than about 20 CpGs per vector, fewer than about 15 CpGs per vector, fewer than about 10 CpGs per vector, etc.

[0094] In yet other embodiments, the non-viral DNA vector comprises the following elements operably linked in a 5' to 3' direction: (i) a first repeat sequence, (ii) a non-repetitive nucleotide sequence having at least 3 nucleotides, (iii) a second repeat sequence, and (iv) an expression cassette. In some embodiments, the non-repetitive nucleotide sequence has at least 5 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 10 nucleotides. In some embodiments, the non-repetitive nucleotide sequence has at least 15 nucleotides.

[0095] In some embodiments, the unique nucleotide sequence does not comprise a bacterial origin of replication or any portion thereof. In other embodiments, the circular non-viral DNA vector comprises a bacterial origin of replication or a portion thereof, but the bacterial origin of replication or a portion thereof is not part of or contained within the unique nucleotide sequence. In some embodiments, the first repeat sequence and the second repeat sequence comprise or are derived from nucleic acid sequences present in an AAV genome (including any of those disclosed herein).

[0096] In some embodiments, an expression cassette comprises one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter. In some embodiments, the expression cassette comprises one or more of an enhancer and / or promoter, a 3' untranslated region (with or without introns), a translation initiation region, a transgene (protein coding region, which itself may be broken down into several components), a 5' untranslated region, and a polyadenylation region.

[0097] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences, ie, comprises less than about 500 CpGs per vector, less than about 450 CpGs per vector, less than about 400 CpGs per vector, less than about 350 CpGs per vector, less than about 300 CpGs per vector, less than about 250 CpGs per vector, less than about 200 CpGs per vector, less than about 150 CpGs per vector, less than about 100 CpGs per vector, less than about 75 CpGs per vector, less than about 50 CpGs per vector, less than about 25 CpGs per vector, less than about 20 CpGs per vector, less than about 15 CpGs per vector, less than about 10 CpGs per vector, etc.

[0098] In further embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by at least a portion of a bacterial origin of replication. In some embodiments, each of the inverted repeat sequences comprises or is derived from a nucleic acid sequence present in an AAV serotype. In some embodiments, the cruciform structure comprises a Holliday junction.

[0099] In some embodiments, at least a portion of the bacterial origin of replication is single-stranded.

[0100] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences, ie, comprises less than about 500 CpGs per vector, less than about 450 CpGs per vector, less than about 400 CpGs per vector, less than about 350 CpGs per vector, less than about 300 CpGs per vector, less than about 250 CpGs per vector, less than about 200 CpGs per vector, less than about 150 CpGs per vector, less than about 100 CpGs per vector, less than about 75 CpGs per vector, less than about 50 CpGs per vector, less than about 25 CpGs per vector, less than about 20 CpGs per vector, less than about 15 CpGs per vector, less than about 10 CpGs per vector, etc.

[0101] In yet further embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, the second portion having the formula XY-X', where X and X' are each inverted repeat sequences, and Y comprises at least a portion of a bacterial origin of replication. In some embodiments, the inverted repeat sequences comprise or are derived from nucleic acid sequences present in the AAV genome. In some embodiments, when the repeat sequences form a cruciform structure, at least a portion of the bacterial origin of replication is single-stranded. In some embodiments, the cruciform structure comprises a Holliday junction.

[0102] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences, ie, comprises less than about 500 CpGs per vector, less than about 450 CpGs per vector, less than about 400 CpGs per vector, less than about 350 CpGs per vector, less than about 300 CpGs per vector, less than about 250 CpGs per vector, less than about 200 CpGs per vector, less than about 150 CpGs per vector, less than about 100 CpGs per vector, less than about 75 CpGs per vector, less than about 50 CpGs per vector, less than about 25 CpGs per vector, less than about 20 CpGs per vector, less than about 15 CpGs per vector, less than about 10 CpGs per vector, etc.

[0103] In still further embodiments, the non-viral DNA vector comprises the following elements operably linked in a 5' to 3' direction: (i) a first repeat sequence, (ii) a minimal bacterial origin of replication, (iii) a second repeat sequence, and (iv) an expression cassette. In some embodiments, the first repeat sequence and the second repeat sequence comprise or are derived from nucleic acid sequences present in the AAV genome. In some embodiments, when the repeat sequences form a cruciform structure, at least a portion of the minimal bacterial origin of replication is single-stranded. In some embodiments, the cruciform structure comprises a Holliday junction.

[0104] In some embodiments, an expression cassette comprises one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter. In some embodiments, the expression cassette comprises one or more of an enhancer and / or promoter, a 3' untranslated region (with or without introns), a translation initiation region, a transgene (protein coding region, which itself may be broken down into several components), a 5' untranslated region, and a polyadenylation region.

[0105] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences, ie, comprises less than about 500 CpGs per vector, less than about 450 CpGs per vector, less than about 400 CpGs per vector, less than about 350 CpGs per vector, less than about 300 CpGs per vector, less than about 250 CpGs per vector, less than about 200 CpGs per vector, less than about 150 CpGs per vector, less than about 100 CpGs per vector, less than about 75 CpGs per vector, less than about 50 CpGs per vector, less than about 25 CpGs per vector, less than about 20 CpGs per vector, less than about 15 CpGs per vector, less than about 10 CpGs per vector, etc.

[0106] In even further embodiments, the circular non-viral DNA vector comprises: (i) a first portion comprising an expression cassette including one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding one or more therapeutic proteins is operably linked to a promoter; and (ii) a second portion capable of forming at least one cruciform structure, wherein the second portion comprises at least two inverted repeat sequences separated by a unique nucleotide sequence comprising a heterologous gene or a portion of a heterologous gene. In some embodiments, at least a portion of a bacterial origin of replication is contained within the circular non-viral DNA vector but not within the second portion. In some embodiments, at least a portion of a bacterial origin of replication is contained within the first portion or within a third portion adjacent to either the first portion or the second portion, but not within the second portion. In some embodiments, the cruciform structure comprises a Holliday junction. In some embodiments, the inverted repeat sequences comprise or are derived from nucleic acid sequences present in an AAV serotype. In some embodiments, the unique nucleotide sequence comprising the heterologous gene or a portion thereof is single-stranded, while the remainder of the second portion is double-stranded.

[0107] In some embodiments, the non-viral DNA vector is substantially free of CpG sequences, ie, comprises less than about 500 CpGs per vector, less than about 450 CpGs per vector, less than about 400 CpGs per vector, less than about 350 CpGs per vector, less than about 300 CpGs per vector, less than about 250 CpGs per vector, less than about 200 CpGs per vector, less than about 150 CpGs per vector, less than about 100 CpGs per vector, less than about 75 CpGs per vector, less than about 50 CpGs per vector, less than about 25 CpGs per vector, less than about 20 CpGs per vector, less than about 15 CpGs per vector, less than about 10 CpGs per vector, etc.

[0108] In some embodiments, each of the inverted repeat sequences is a nucleic acid sequence comprising between about 20 bp and about 500 bp, between about 20 bp and about 450 bp, between about 20 bp and about 400 bp, between about 20 bp and about 300 bp, between about 20 bp and about 250 bp, between about 20 bp and about 200 bp, between about 20 bp and about 160 bp, between about 60 bp and about 160 bp, between about 70 bp and about 150 bp, between about 80 bp and about 140 bp, between about 90 bp and about 130 bp, etc. In some embodiments, each of the inverted repeat sequences has about 115bp, 116bp, 117bp, 118bp, 119bp, 120bp, 121bp, 122bp, 123bp, 124bp, 125bp, 126bp, 127bp, 128bp, 129bp, 130bp, 131bp, 132bp, 133bp, 134bp, 135bp, 136bp, 137bp, 138bp, 139bp, 140bp, 141bp, 142bp, etc.

[0109] In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 80% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 85% identical to any one of SEQ ID NOs: 1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 90% identical to any one of SEQ ID NOs: 1-18.

[0110] In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 91% identical to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 92% identical to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 93% identical to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 94% identical to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 95% identical to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 96% identical to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 97% identical to any one of SEQ ID NOs:1-18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 98% identical to any one of SEQ ID NOs: 1 to 18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 99% identical to any one of SEQ ID NOs: 1 to 18. In some embodiments, each of the inverted repeat sequences has a nucleic acid sequence that is at least 98% identical to any one of SEQ ID NOs: 1 to 18.

[0111] In some embodiments, each of the inverted repeat sequences comprises or is derived from an AAV inverted terminal repeat element (e.g., derived from elements of an AAV serotype, such as any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, and / or AAV7). For example, each of the groups of inverted repeats can comprise one or more of the A, A', B, B', C, C', D, and / or D' elements of the inverted repeat elements from one or more AAV serotypes.

[0112] In some embodiments, the 5' A element comprises at least 90% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5' A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3' A element comprises at least 90% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3' A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5' B element comprises at least 90% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5' B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3' B element comprises at least 90% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO:77). In some embodiments, the 5'C element comprises at least 90% identity to CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 3'C element comprises at least 90% identity to GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 3'C element comprises GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 5'D element comprises at least 90% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 3'D element comprises at least 90% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO:81).In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0113] In some embodiments, the 5' A element comprises at least 95% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5' A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3' A element comprises at least 95% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3' A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5' B element comprises at least 95% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5' B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3' B element comprises at least 95% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO:77). In some embodiments, the 5'C element comprises at least 95% identity to CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 3'C element comprises at least 95% identity to GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 3'C element comprises GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 5'D element comprises at least 95% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 3'D element comprises at least 95% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO:81).In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0114] In some embodiments, the 5' A element comprises at least 97% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5' A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3' A element comprises at least 97% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3' A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5' B element comprises at least 97% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5' B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3' B element comprises at least 97% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO:77). In some embodiments, the 5'C element comprises at least 97% identity to CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 3'C element comprises at least 97% identity to GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 3'C element comprises GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 5'D element comprises at least 97% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 3'D element comprises at least 97% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO:81).In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0115] In some embodiments, the 5' A element comprises at least 99% identity to TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 5' A element comprises TTGGCCACTCCCTCTCTGCGCGCTDGCTCGCTCACTGAGGC (SEQ ID NO: 74). In some embodiments, the 3' A element comprises at least 99% identity to GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 3' A element comprises GCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA (SEQ ID NO: 75). In some embodiments, the 5' B element comprises at least 99% identity to CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 5' B element comprises CGGGCGACC (SEQ ID NO: 76). In some embodiments, the 3' B element comprises at least 99% identity to GGTCGCCCG (SEQ ID NO: 77). In some embodiments, the 3'B element comprises GGTCGCCCG (SEQ ID NO:77). In some embodiments, the 5'C element comprises at least 99% identity to CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 5'C element comprises CGCCCGGGC (SEQ ID NO:78). In some embodiments, the 3'C element comprises at least 99% identity to GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 3'C element comprises GCCCGGGGCG (SEQ ID NO:79). In some embodiments, the 5'D element comprises at least 99% identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 5'D element comprises identity to AGGAACCCCTAGTGATGGAG (SEQ ID NO:80). In some embodiments, the 3'D element comprises at least 99% identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO:81).In some embodiments, the 3'D element comprises identity to CTCCATCACTAGGGGTTCCT (SEQ ID NO: 81).

[0116] In some embodiments, the first inverted repeat sequence may have the formula DAC-C'-B-B'-A', while the second inverted repeat sequence may have the formula -AB-B'-C-C'-A'-D'. In some embodiments, the first inverted repeat sequence may have the formula DAC-C'-B-B'-A', while the second inverted repeat sequence may have the formula -AB-B'-C-C'-A'-D', but do not contain a DD element as described herein. As shown herein, each of these first and second inverted repeat sequences is separated by a unique nucleotide sequence having at least three nucleotides (e.g., at least a portion of a bacterial origin of replication, such as at least a portion of a bacterial origin of replication derived from R6K0).

[0117] In some embodiments, the non-viral DNA vectors of the present disclosure do not contain or form DD-ITRs, "double D" ITRs, or "DD elements." In some embodiments, the non-viral DNA vectors do not contain DD elements but contain at least a portion of a bacterial origin of replication. In some embodiments, the circular non-viral DNA vectors lack drug resistance genes and do not contain DD elements. In other words, the D and D' elements contained within the inverted repeat sequences of the non-viral DNA vectors of the present disclosure are separated by a heterologous non-repetitive element, which may contain at least a portion of a bacterial origin of replication. Surprisingly, Applicant has found that non-viral vectors of the present disclosure that do not contain "DD elements" can direct the expression of higher amounts of linked heterologous genes and can persist in vivo for as long or longer than vectors containing "DD elements." Furthermore, the structure of the repetitive elements in the non-viral DNA vectors of the present disclosure is not formed by the process of circularization of a viral genome (e.g., an AAV genome or an AAV vector genome) or a linear DNA fragment via inverted terminal repeat sequences.

[0118] In some embodiments, the inverted repeat sequence is adjacent to and flanked on both sides by a unique nucleic acid sequence having at least three nucleotides. In some embodiments, the unique nucleic acid sequence having at least three nucleotides comprises at least a portion of a bacterial origin of replication. In some embodiments, at least a portion of the bacterial origin of replication is derived from plasmid R6K (e.g., its gamma origin of replication (oriR6Kγ)). In some embodiments, the R6K-derived bacterial origin of replication has been modified to reduce its CpG content, e.g., to reduce its CpG content by at least 60%, at least 50%, at least 40%, at least 30%, at least 25%, at least 20%, at least 10%, at least 5%, etc. In some embodiments, at least a portion of the bacterial origin of replication comprises one or more internal direct repeat sequences. In some embodiments, at least a portion of the bacterial origin of replication comprises one or more regions of internal secondary structure believed to be important in helping to maintain a cruciform structure.

[0119] In some embodiments, at least a portion of the bacterial origin of replication has at least 90% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 91% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 92% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 93% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 94% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 95% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 96% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 97% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 98% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has at least 99% identity to any one of SEQ ID NOs: 58-59. In some embodiments, at least a portion of the bacterial origin of replication has any one of SEQ ID NOs: 58-59.

[0120] In some embodiments, the second portion comprises a first nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 91% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 91% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.In some embodiments, the second portion comprises a first nucleic acid sequence having at least 93% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 93% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 94% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 94% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.

[0121] In some embodiments, the second portion comprises a first nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 97% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.In some embodiments, the second portion comprises a first nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:58-59, and a third nucleic acid sequence having at least 98% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:58 to SEQ ID NO:59, and a third nucleic acid sequence having at least 99% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18. In some embodiments, the second portion comprises a first nucleic acid sequence having any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:18.

[0122] In some embodiments, the second portion comprises a nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 91% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 92% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 93% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 94% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 96% identity to any one of SEQ ID NO:35 and SEQ ID NO:60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 97% identity to any one of SEQ ID NO: 35 and SEQ ID NO: 60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 98% identity to any one of SEQ ID NO: 35 and SEQ ID NO: 60. In some embodiments, the second portion comprises a nucleic acid sequence having at least 99% identity to any one of SEQ ID NO: 35 and SEQ ID NO: 60. In some embodiments, the second portion comprises a nucleic acid sequence having SEQ ID NO: 60.

[0123] In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73.In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73. In some embodiments, the circular non-viral DNA vector comprises a nucleic acid sequence having any one of SEQ ID NOs:28-30, SEQ ID NO:38, SEQ ID NOs:40-48, and SEQ ID NOs:72-73.

[0124] one or more nucleic acid sequences encoding one or more peptides or polypeptides In some embodiments, the circular non-viral DNA vectors of the present disclosure comprise one or more nucleic acid sequences encoding one or more peptides, polypeptides, etc. In some embodiments, the circular non-viral DNA vectors of the present disclosure comprise one or more nucleic acid sequences encoding one or more reporter genes. In still other embodiments, the circular non-viral DNA vectors of the present disclosure comprise one or more heterologous genes encoding one or more therapeutic proteins.

[0125] In some embodiments, the one or more nucleic acid sequences encoding one or more therapeutic proteins range in size from about 1 Kb to about 150 Kb, e.g., from about 1 Kb to about 120 Kb, from about 1 Kb to about 100 Kb, from about 1 Kb to about 80 Kb, from about 1 Kb to about 60 Kb, from about 1 Kb to about 40 Kb, from about 1 Kb to about 30 Kb, from about 1 Kb to about 25 Kb, from about 1 Kb to about 20 Kb, from about 1 Kb to about 15 Kb, from about 1 Kb to about 12 Kb, from about 1 Kb to about 11 Kb, from about 1 Kb to about 10 Kb, from about 1 Kb to about 9 Kb, from about 1 Kb to about 8 Kb, from about 1 Kb to about 7 Kb, from about 1 Kb to about 6 Kb, etc. In some embodiments, the one or more nucleic acid sequences encoding one or more therapeutic proteins have a size of about 5 Kb, about 6 Kb, about 7 Kb, about 7.5 Kb, about 8 Kb, about 8.5 Kb, about 9 Kb, about 9.5 Kb, about 10 Kb, about 10.5 Kb, about 11 Kb, about 12 Kb, about 13 Kb, about 14 Kb, about 15 Kb, about 16 Kb, about 17 Kb, about 18 Kb, about 19 Kb, about 20 Kb, about 21 Kb, etc.

[0126] Therapeutic proteins include, but are not limited to, ALPL, PCSK9, PCSK7, SerpinA1, ABCB4 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:64, SEQ ID NO:65, SEQ ID NO:66, or SEQ ID NO:69), ATP7B (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NO:69, SEQ ID NO:70, or SEQ ID NO:83), AlAT (SEQ ID NO:6 6), ABCB11, anti-CD19-anti-CD3 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NOs: 67), BDF8 (having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to any one of SEQ ID NOs: 68), and variants thereof. Examples of diseases that can be treated according to the methods of the claimed invention include, but are not limited to, hypophosphatasia, anti-alpha 1 antitrypsin deficiency (such as treated with a protein having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 99% identity to the protein of SEQ ID NO: 82), familial hypercholesterolemia, hyperlipidemia, and progressive familial intrahepatic cholestasis types 1, 2, and 3.

[0127] In some embodiments, the non-viral DNA vectors of the present disclosure comprise one or more nucleic acid sequences encoding alkaline phosphatase or variants thereof, hi other embodiments, the non-viral DNA vectors of the present disclosure comprise a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence encoding alkaline phosphatase.

[0128] For example, in some embodiments, a polypeptide comprising an amino acid sequence encoding an alkaline phosphatase has the structure of Formula (IA) to Formula (IE): [A] v -[B]-[C] w -[R] q -([D] x -[E] y ) z (IA), [A]-[B]-[C]-[R] q -([D] x -[E] y ) (IB), ([A]-[B])-([D] x -[E] y ) z (I C), ([A]-[B])-([E] y ) (ID), and [A]-[B]-[R] q -([E] y ) (IE), (In the formula, A comprises an amino acid sequence encoding a secretory signal peptide, B contains the amino acids encoding alkaline phosphatase, C contains an amino acid sequence encoding a GPI anchor, R is -(M o (F c )N p )-, wherein M and N each independently contain between 1 and 6 amino acids, Fc is an Fc domain, and o and p are each independently 0, 1, or 2; D comprises an amino acid sequence having between 4 and 6 amino acids, or F(G) t F, where each F is the same amino acid, G is an amino acid sequence having 3, 4, or 5 amino acids, and t is an integer ranging from 2 to 5; E comprises an amino acid sequence having between 1 and 8 amino acids, q is 0 or 1; v is 0 or 1, w is 0 or 1; x is 0 or an integer ranging from 1 to 6; y is 0 or an integer ranging from 1 to 16; z is 0 or an integer ranging from 1 to 6, With the proviso that when v is 1, w is 0, q is 1, o is 1, p is 1, N is diamino acid-DI-, M is diamino acid-LK-, [B] comprises SEQ ID NO: 11, Fc comprises SEQ ID NO: 130, and x is 0, then [E] y does not contain 10 to 16 consecutive aspartic acid residues).

[0129] In some embodiments, the polypeptide of any one of Formulas (IA)-(IE) is not conjugated to dextran. In other embodiments, the polypeptide of any one of Formulas (IA)-(IE) has the ability to catalyze the formation of hydroxyapatite crystals in bone.

[0130] In some embodiments, E comprises three amino acids. In some embodiments, the three amino acids are selected from aspartic acid, serine, lysine, threonine, tyrosine, alanine, methionine, valine, tryptophan, proline, arginine, and glutamine. In other embodiments, the three amino acids are selected from aspartic acid and serine. In some embodiments, E is -DSS-. In other embodiments, E is -DDS-. In other embodiments, E is -DDD. In other embodiments, E is -DSS-.

[0131] In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 16. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 12. In some embodiments, E comprises 3 amino acids, and y is in the range of 2 to 12. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 10. In some embodiments, E comprises 3 amino acids, and y is in the range of 2 to 10. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 8. In some embodiments, E comprises 3 amino acids, and y is in the range of 2 to 8. In some embodiments, E comprises 3 amino acids, and y is in the range of 1 to 6. In some embodiments, E comprises 3 amino acids, and y is in the range of 3 to 6. In some embodiments, E comprises 3 amino acids, and y is in the range of 3 to 6, and q is 0.

[0132] In some embodiments, E is -DSS- and y is in the range of 1 to 16. In some embodiments, E is -DSS- and y is in the range of 1 to 12. In some embodiments, E is -DSS- and y is in the range of 1 to 10. In some embodiments, E is aspartic acid and y is in the range of 1 to 8. In some embodiments, E is -DSS- and y is 6, i.e., [E]y is [-DSS-]6. In other embodiments, E is -DSS-, y is 6, and z is 1. In some embodiments, E is -DSS-, y is 6, and q is 0. In other embodiments, E is -DSS-, y is 6, z is 1, and q is 0. In other embodiments, E is -DSS-, y is 6, z is 1, q is 0, and x is 0. In another embodiment, E is -DSS-, y is 6, z is 1, q is 0, and x is 2.

[0133] In some embodiments, E is -DSS-, y is 6, and q is 1. In other embodiments, E is -DSS-, y is 6, z is 1, and q is 1. In other embodiments, E is -DSS-, y is 6, z is 1, x is 0, and q is 1. In other embodiments, E is -DSS-, y is 6, z is 1, x is 2, and q is 1.

[0134] Other examples of polypeptides encoding soluble alkaline phosphatases are described in PCT Publication No. WO 2022 / 051555, the disclosure of which is incorporated herein by reference in its entirety.

[0135] In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 95% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 96% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 97% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 98% identity to any one of SEQ ID NOs: 19-21 and 23-24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having at least 99% identity to any one of SEQ ID NOs: 19 to 21 and 23 to 24. In some embodiments, the non-viral DNA vector comprises a nucleic acid sequence encoding an amino acid sequence having SEQ ID NOs: 20 to 21 and 23 to 24.

[0136] In some embodiments, one or more heterologous genes are reporter genes. As used herein, a "reporter gene" is any gene whose expression can be measured. In some embodiments, a reporter gene may have a predetermined reference range of detectable expression. In some embodiments, a reporter gene may express a selectable or screenable marker. In some embodiments, a selectable marker may also be used to select organisms or cells containing the exogenous genetic material.

[0137] Reporter genes may encode enzymes such as β-lactamase, β-galactosidase, mouse secreted embryonic alkaline phosphatase (MUSEAP), and luciferase (for β-lactamase, see Tsien, International Publication No. WO 96 / 30540, published October 3, 1996). Reporter genes may also encode fluorescent proteins such as green fluorescent protein (GFP), or mutants thereof known in the art or later developed (see Tsien, U.S. Pat. No. 5,625,048, issued April 29, 1997; Tsien, International Publication No. WO 96 / 23810, published August 8, 1996; Tsien, International Publication No. WO 97 / 28261, published August 7, 1997; and Tsien, International Application No. PCT / US97 / 12410, filed July 16, 1996). The product of the reporter gene can be detected using methods known in the art, such as the use of chromogenic or fluorogenic substrates for the enzyme. Chromogenic or fluorescent readouts can be detected using optical methods, such as absorbance or fluorescence.

[0138] Examples of selectable markers include, but are not limited to, the neo gene, which encodes kanamycin resistance and allows selection using kanamycin, GUS, green fluorescent protein (GFP), neomycin phosphotransferase II (nptII), luciferase (LUX), or antibiotic resistance coding sequences. In some embodiments, screenable markers can be used to monitor expression. In some embodiments, exemplary screenable markers include, for example, the β-glucuronidase gene, i.e., the uidA gene (GUS), which encodes an enzyme for which various chromogenic substrates are known, the β-lactamase gene, which encodes an enzyme for which various chromogenic substrates (e.g., PADAC, a chromogenic cephalosporin) are known, the luciferase gene, the tyrosinase gene, which encodes an enzyme that can oxidize tyrosine to DOPA and dopaquinone, which can further aggregate into melanin, and α-galactosidase, which can convert chromogenic α-galactose substrates.

[0139] promoter Any promoter available in the art can be used to drive expression of one or more nucleic acid sequences in the expression vectors described herein, for example, to drive expression of a nucleic acid sequence encoding a polypeptide. In some embodiments, the promoter is a promoter functional in mammalian cells. High-level constitutive promoters are preferred for use in vectors according to the present disclosure. Examples of such promoters include, but are not limited to, the retroviral Rous sarcoma virus (RSN) LTR promoter (optionally with the RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with the CMV enhancer) [see, e.g., Boshart et al., Cell, 41:521-530 (1985)], the SN40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the β-active promoter linked to the enhancer derived from the cytomegalovirus (CMN) immediate-early (IE) promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter [Invitrogen].Inducible promoters are regulated by exogenously supplied compounds and include the zinc-inducible sheep metallothionine (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system [WO 98 / 10088], the ecdysone insect promoter [No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)], the tetracycline-repressible system [Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)], and the tetracycline-inducible system [Gossen et al., Science, 268:1766-1769 (1995)]. Harvey et al., Curr. Opin. Chem. Biol, 2:512-518 (1998)]. (1998)], the RU486-inducible system [Wang et al, Nat. Biotech., 15:239-243 (1997) and Wang et al, Gene Ther., 4:432-441 (1997)], and the rapamycin-inducible system [Magari et al, J Clin. Invest., 100:2865-2872 (1997)]. Other types of inducible promoters that may be useful in the present disclosure are those that are regulated by specific physiological conditions, such as temperature, acute phase, a specific differentiation state of a cell, or only in replicating cells.

[0140] Exemplary ubiquitous expression control sequences suitable for use in certain embodiments include, but are not limited to, the cytomegalovirus (CMV) immediate early promoter, the viral Simian Virus 40 (SV40) (e.g., early or late), the Moloney murine leukemia virus (MoMLV) LTR promoter, the Rous sarcoma virus (RSV) LTR, the herpes simplex virus (HSV) (thymidine kinase) promoter, the H5 promoter, the P7.5 promoter, and the P11 promoter from vaccinia virus, the short elongation factor (EF) promoter, and the EGFR promoter. Elongation factor 1 alpha (EF1α-short) promoter, elongation factor 1 alpha long (EF1α-long) promoter, early growth response 1 (EGR1), ferritin H (FerH), ferritin L (FerL), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), eukaryotic translation initiation factor 4A1 (EIF4A1), heat shock 70 kDa protein 5 (HSPA5), heat shock protein 90 kDa beta member 1 (HSP90B1), heat shock protein 70 kDa (HSP70), beta-kinesin (3-KIN), human ROSA 26 loci (Orions et al., Nature Biotechnology 25, 1477-1482 (2007)), ubiquitin C promoter (UBC), phosphoglycerate kinase-1 (PGK) promoter, cytomegalovirus enhancer / chicken β-actin (CAG) promoter, β-actin promoter and myeloproliferative sarcoma virus enhancer, and negative control region deleted d1587rev primer binding site substitution (MND) promoter (Challita et al., J Viral. 69(2):748-55 (1995)).

[0141] In some embodiments, the promoter can be selected from a cytomegalovirus (CMV) minimal promoter, more preferably from a human CMV (hCMV) promoter, such as the minimal promoter derived from the hCMV immediate-early promoter described in Gossen and Bujard (Proc. Natl. Acad. Sci. USA, 1992, 89: 5547-5551). Modified promoters, including insertion and deletion mutations of the native promoter, as well as combinations or permutations thereof, can also be utilized. One example of a modified promoter is the "minimal CMV promoter" described by Gossen and Bujard (Proc. Natl. Acad. Sci. USA, 1992, 89: 5547-5551). In any case, the effectiveness of any promoter can be easily tested in the tetracycline-responsive expression system described herein by substitution of the minimal CMV promoter described herein.

[0142] In some embodiments, the promoter is an MND promoter. In some embodiments, the promoter is an EF1α promoter. In some embodiments, the promoter is a CD11b promoter. In some embodiments, the promoter is an EFS promoter. In some embodiments, the promoter is a Ubc promoter. In some embodiments, the promoter is a CD68LPp promoter.

[0143] In some embodiments, the promoter is a tissue-specific promoter, where tissue-specific promoters are used to achieve cell-type-, lineage-, or tissue-specific expression of a desired polynucleotide sequence (e.g., to express a particular nucleic acid encoding a polypeptide only in a subset of cell types or tissues, or at a particular developmental stage). Examples of tissue-specific promoters include, but are not limited to, the B29 promoter (B cell expression), the runt transcription factor (CBFa2) promoter (stem cell-specific expression), the CD14 promoter (monocyte cell expression), the CD43 promoter (leukocyte and platelet expression), the CD45 promoter (hematopoietic cell expression), the CD68 promoter (macrophage expression), and the CYP450 promoter. 3A4 promoter (hepatocyte expression), desmin promoter (muscle expression), elastase 1 promoter (pancreatic acinar cell expression), endoglin promoter (endothelial cell expression), fibroblast-specific protein 1 promoter (FSP1) promoter (fibroblast expression), fibronectin promoter (fibroblast expression), fms-related tyrosine kinase 1 (FLT1) promoter (endothelial cell expression), glial fibrillary acidic protein (GFAP) promoter (astrocytic expression), insulin promoter (pancreatic beta cell expression), integrin alpha 2b (ITGA2B) promoter (megakaryocytes), intercellular adhesion molecule 2 (ICAM-2) promoter (endothelial cells), interleukin-2 (IL-2) promoter (endothelial cells), and IL-1. These promoters include the IFN-β (interferon beta) promoter (hematopoietic cells), keratin 5 promoter (keratinocyte expression), myoglobin (MB) promoter (muscle expression), myogenic differentiation 1 (MYOD1) promoter (muscle expression), nephrin promoter (podocyte expression), bone gamma-carboxyglutamic acid protein 2 (OG-2) promoter (osteoblast expression), 3-oxoacid CoA transferase 2B (Oxct2B) promoter (haploid spermatid expression), surfactant protein B (SP-B) promoter (lung expression), synapsin promoter (neuron expression), and Wiskott-Aldrich syndrome protein (WASP) promoter (hematopoietic cell expression).

[0144] In some embodiments, the native promoter of the transgene is utilized. In some embodiments, the native promoter may be preferred when it is desired that gene expression mimic native expression. In some embodiments, the native promoter may be used when gene expression must be regulated temporally or developmentally, in a tissue-specific manner, or in response to a specific transcriptional stimulus. In some embodiments, other native expression control elements, such as enhancer elements, polyadenylation sites, or Kozak consensus sequences, can also be used to mimic native expression. In some embodiments, the expressed transgene product or other desired product is operably linked to a tissue-specific promoter. For example, if expression in skeletal muscle is desired, a promoter active in muscle should be used. These promoters include promoters from genes encoding skeletal α-actin, myosin light chain 2A, dystrophin, and muscle creatine kinase, as well as synthetic muscle promoters with higher activity than naturally occurring promoters [see Li et al., Nat. Biotech, 17:241-245 (1999)].Examples of tissue-specific promoters include, among others, liver [albumin, Miyatake et al. J Virol, 71:5124-32 (1997); human thyroxine-binding globulin (TBG) promoter (see Yan et al, Gene. 2012 15;506(2):289-94 (2012), the disclosure of which is incorporated herein by reference in its entirety), hepatitis B virus core promoter, Sandig et al, Gene Ther., 3:1002-9 (1996), and alpha-fetoprotein (AFP), Arbuthnot et al, Hum. Gene Ther, 7:1503-14 (1996)], bone [osteocalcin, Stein et al, Mol. Biol. Rep., 24:185-96 (1997), and bone sialoprotein, Chen et al, J Bone Miner. Res., 11:654-64 (1996)], lymphocytes [CD2, Hansal et al., J Immunol, 161:1063-8 (1998); immunoglobulin heavy chain; T cell receptor α chain], neurons [neuron-specific enolase (NSE) promoter, Andersen et al. Cell. Mol. Neurobiol, 13:503-15 (1993); neurofilament light chain gene, Piccioli et al., 1991, Proc. Natl. Acad. Sci. USA, 88:5611-5 (1991); and neuron-specific vgf gene, Piccioli et al., Neuron 15:373-84 (1995)].

[0145] Transcription can be increased by inserting an enhancer sequence into the non-viral DNA vector of the present disclosure. Enhancers are typically cis-acting elements of DNA, usually about 10 to 300 bp in length, that act on a promoter to increase its transcription. Many enhancer sequences are currently known from mammalian genes (globin, elastase, albumin, α-fetoprotein, and insulin) and eukaryotic viruses. Examples include the SV40 enhancer on the late side of the replication origin (bp 100 to 270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. Enhancers may be spliced into the vector at a position 5' or 3' from the antigen-specific polynucleotide sequence, but are preferably located at a site 5' from the promoter.

[0146] In some embodiments, a vector of the present disclosure comprises an insulator element, for example, a cHS insulator.

[0147] Toll-like receptor 9 inhibitory sequence Toll-like receptor 9 (TLR9), an immune sensor of DNA, detects non-viral DNA vectors and activates innate immune and CD8 + It has been well documented that TLRs play a central role in activating T cell responses. TLRs are a family of innate immune sensors found on the endosomal or plasma membranes of immune and other cells and are conserved across mammalian species. TLR9 typically detects DNA from invading pathogenic DNA viruses and bacteria, containing unmethylated cytosine-phosphate-guanine (CpG) motifs. After binding to TLR9, the CpG-rich motifs in DNA trigger its dimerization, activating TLR9 signaling via MyD88 and promoting the induction of type I interferons and proinflammatory cytokines. While innate immune responses, such as interferon induction, trigger an antiviral state among cells, inflammation recruits other immune cells to the site of infection and primes the adaptive immune response.

[0148] One solution to blocking TLR9 activation is to include specific short DNA oligonucleotides that antagonize TLR9 activation in the non-viral DNA vectors of the present disclosure. In some embodiments, the vectors of the present disclosure contain one copy of such a sequence (SEQ ID NO: 39). In some embodiments, the vectors of the present disclosure contain two or more copies of such a sequence (SEQ ID NO: 39).

[0149] In vivo resolution The non-viral DNA vectors of the present disclosure are eliminated in vivo. In some embodiments, the non-viral DNA vector enters cells via an endosomal mechanism (e.g., receptor-mediated endocytosis, pinocytosis, phagocytosis) or a non-endosomal mechanism (e.g., electroporation, ultrasound-induced microbubbles, membrane fusion by fusion complexes, etc.). Once inside the endosome, the non-viral DNA vector "escapes" the endosome and enters the cytoplasm, where the endosome fuses with lysosomes and the DNA is degraded. It is believed that the formulation of the non-viral DNA vector determines how the DNA escapes from the endosome.

[0150] Once in the cytoplasm, DNA must enter the nucleus for expression. This process is believed to be assisted by the cruciform structure (repeated elements) of the circular non-viral DNA vector of the present disclosure. Cellular proteins or protein complexes known to bind to this cruciform structure or known to be involved in the resolution of Holliday junctions are believed to have nuclear localization motifs. In other words, this structure is believed to be bound by proteins that direct its transport into the nucleus. Because the proteins that help mediate nuclear import are the same (or a subset) of the proteins that mediate resolution, it is unclear whether resolution occurs in the cytoplasm or the nucleus, but resolution is expected to occur in the nucleus. For example, PARP1 was confirmed to colocalize with constructs according to the present disclosure in the cytoplasm of 293 cells after transfection (see, e.g., Figure 18). Generally speaking, PARP1 is a nuclear protein that may travel to the cytoplasm to assist DNA in the transfer into the nucleus.

[0151] While the process of "resolution" is largely unknown, we can describe the events that likely require resolution to occur. It is noted that the process of normal endogenous Holliday junction resolution is also largely unknown and likely occurs through multiple pathways involving many different proteins / enzymes, either in different cell types or at different cell cycle stages. For example, the first step is recognition of the cruciform structure by a protein or protein complex. This binding, which may be involved in the nuclear localization described above, is thought to require a small amount of DNA unwinding to allow the next enzymatic step. In some embodiments, the first enzymatic activity results in cleavage of the structure (see, e.g., Figures 10-11). After cleavage, a linear molecule is thought to be formed through a ligation process. It is believed that there are several DNA topoisomerases and / or DNA ligases that may be involved in this process. It is believed that there are several processes / pathways by which this may occur. DNA protein kinase (DNA-PK) is thought to be involved in these pathways, converting the circular non-viral vectors of the present disclosure into a linear form. In particular, DNA-PK is thought to be involved in the non-homologous end joining (NHEJ) reaction and is thought to be part of a large multiprotein complex.

[0152] In some embodiments, other homology-mediated pathways may be involved in the formation of concatemers (see, eg, Figure 11).

[0153] Pharmaceutical compositions containing circular non-viral DNA vectors Another aspect of the present disclosure relates to a composition comprising one or more circular non-viral DNA vectors, for example, a circular non-viral DNA vector having at least 95%, 96%, 97%, 98%, or 99% identity to any one of SEQ ID NOs:28 to 30, 38, 40 to 48, and 72 to 73.

[0154] In some embodiments, the present disclosure provides a composition comprising one or more of the circular non-viral DNA vectors described herein and a carrier therefor (e.g., a pharmaceutically acceptable carrier). The composition is, if desired, a physiologically acceptable (e.g., pharmaceutically acceptable) composition comprising a carrier, e.g., a physiologically (e.g., pharmaceutically) acceptable carrier, and a non-viral DNA vector. Any suitable carrier can be used within the context of the present disclosure, and such carriers are well known in the art, including any of the carriers described above.

[0155] In some embodiments, non-viral DNA vectors can be formulated with a delivery vehicle. In some embodiments, the delivery vehicle is a lipid-based delivery vehicle. In some embodiments, the delivery vehicle is a lipid nanoparticle. As used herein, the term "lipid nanoparticle" or "LNP" refers to any lipid composition that can be used to deliver a therapeutic product, including, but not limited to, liposomes or vesicles in which an aqueous volume is encapsulated by an amphiphilic lipid bilayer or a lipid-enveloped interior containing a therapeutic product, or lipid aggregates or micelles in which a lipid-encapsulated therapeutic product is contained within a relatively disordered lipid mixture.

[0156] In some embodiments, lipid nanoparticles include lipid-based compositions comprising a solid lipid core stabilized by a surfactant. In some embodiments, the core lipid can be a mixture of fatty acids, acylglycerols, waxes, and these surfactants. In some embodiments, biological membrane lipids such as phospholipids, sphingomyelin, bile salts (sodium taurocholate), and sterols (cholesterol) can be used as stabilizers.

[0157] In some embodiments, lipid nanoparticles can be formed using defined ratios of various lipid molecules, including, but not limited to, defined ratios of one or more cationic lipids, anionic lipids, or neutral lipids. In some embodiments, the lipid nanoparticles can encapsulate molecules, such as the disclosed non-viral DNA vectors, within their outer membrane shell and subsequently contact target cells to deliver the encapsulated molecules (e.g., the disclosed non-viral DNA vectors) to the host cell cytoplasm. In some embodiments, the lipid nanoparticles can be modified or functionalized, including on their surfaces, with non-lipid molecules (e.g., CD3, CD4, CD8, CD19, CD20, CD22, CD38, CD47, CD117, transferrin, ApoE, folate, etc.). In some embodiments, the lipid nanoparticles can be modified to specifically bind to one or more receptors (e.g., one or more receptors, two or more receptors, three or more receptors, four or more receptors, etc.) on the surface of target cells. By "specifically bind" is meant that the lipid nanoparticles bind to receptors on the surface of target cells with an affinity that is at least 2-fold greater than that of receptors on the surface of non-target cells, e.g., at least 3-fold, 4-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, 25-fold, 50-fold, or 100-fold greater. Cell surface receptors to which the modified lipid nanoparticles can bind include, but are not limited to, integrins, transferrin receptors type 1 and type 2, EGF receptor, VEGF receptor, NGF receptor, CD3, CD4, CD7, CD8, CD19, CD20, CD22, CD33, CD43, CD38, CD56, CD69, asialoglycoprotein receptor (ASGPR), N-acetyl-D-galactose (GalNAc) receptor, folate receptor, and sigma receptor. In some embodiments, the first targeting ligand and / or the second targeting ligand binds to the asialoglycoprotein receptor (ASGPR) or the GalNAc receptor. Thus, in some embodiments, the modified lipid nanoparticles specifically bind to ASGPR receptors or GalNAc receptors on the surface of hepatocytes.In some embodiments, the targeting ligand used to modify the lipid nanoparticles is a carbohydrate or carbohydrate conjugate. Carbohydrate-based targeting ligands include, but are not limited to, glucose, multivalent glucose, fucose, D-mannose, multivalent mannose, lactose, multivalent lactose, D-galactose, multivalent galactose, GalNAc, multivalent GalNAc (e.g., GalNAc2 and GalNAc3), acetylgalactosamine, N-acetylglucosamine, glycosylated polyamino acids, and lectins. The term multivalent indicates the presence of one, two, three, or four monosaccharide units. These monosaccharide subunits may be linked to each other via glycosidic linkages or to a scaffolding molecule. In some embodiments, the lipid nanoparticles may be unilamellar (unilamellar) or multilamellar (multilamellar). In some embodiments, the lipid nanoparticles may be complexed with nucleic acids. Unilamellar lipid nanoparticles may be complexed with nucleic acids, where the nucleic acids are present in the aqueous interior. In some embodiments, multilamellar lipid nanoparticles may be complexed with nucleic acids, where the nucleic acid is present in the aqueous interior or interlamellarly formed or sandwiched between lamellae.

[0158] In some embodiments, liposome particles can be formed from a mixture of zwitterionic lipids, cationic lipids, and anionic lipids, which can be saturated or unsaturated, such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) (zwitterionic, saturated), 1,2-dilinoleyoxy-3-dimethylaminopropane (DlinDMA) (cationic, unsaturated), and / or 1,2-dimyristoyl-rac-glycerol (DMG) (anionic, saturated). In some embodiments, liposomes will typically include a helper lipid. Useful helper lipids include zwitterionic lipids such as DPPC, DOPC, DSPC, dodecylphosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine (DOPE), and 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPyPE), sterols such as cholesterol, and PEGylated lipids such as PEG-DMPE (PEG-conjugated 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)]) or PEG-DMG (PEG-conjugated 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol). In some embodiments, suitable PEGylated lipids include PEG2K-DMPE (PEG-conjugated 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]) or PEG2K-DMG (PEG-conjugated 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol-2000).In some embodiments, LNPs used with the non-viral DNA vectors of the present disclosure include a combination of a zwitterionic lipid capable of forming liposomes and, optionally, at least one cationic lipid (such as N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAPBis(2-methacryloyl)oxyethyl disulfide (DSDMA), 2,3-dioleyloxy-1-(dimethylamino)propane (DODMA), 1,2-dilinoleyoxy-3-dimethylaminopropane (DLinDMA), N,N-dimethyl-3-aminopropane (DLenDMA)).

[0159] In some embodiments, the lipid nanoparticles have an average diameter ranging from about 20 nm to about 300 nm, e.g., from about 20 nm to about 250 nm, from about 30 nm to about 200 nm, from about 40 nm to about 180 nm, from about 50 nm to about 150 nm, from about 60 nm to about 140 nm, etc. The particle size of the lipid nanoparticles can be determined by quasi-elastic light scattering, for example, using a Malvern Zetasizer Nano ZS (Malvern, UK) system, or by electron microscopy, for example, using an FEI Quanta 200 scanning electron microscope or an FEI Tecnai Twin 120 kV transmission electron microscope.

[0160] Examples of LNPs are described by Schoeenmaker et al., "mRNA-lipid nanoparticle COVID-19 vaccines: Structure and stability," Int J Pharm. 2021 May 15;601:120586, the disclosure of which is incorporated herein by reference in its entirety. Other exemplary LNPs are described by Eygeris et al., "Chemistry of Lipid Nanoparticles for RNA Delivery," Acc Chem Res. 2022 Jan 4;55(1):2-12. doi: 10.1021 / acs.accounts.lc00544. Epub 2021 Dec 1. PMID: 34850635, the disclosure of which is incorporated herein by reference in its entirety. Still other suitable LNPs for use with the non-viral DNA vectors of the present disclosure are described in U.S. Patent Application Publication No. 2021 / 0371877, U.S. Patent Application Publication No. 2022 / 0175968, U.S. Patent Application Publication No. 2022 / 0042035, and U.S. Patent Application Publication No. 2022 / 0062409, the disclosures of which are incorporated herein by reference in their entireties.

[0161] The non-viral DNA vectors of the present disclosure can also be formulated with one or more polymers. A variety of polymers or copolymers can be adapted as vehicles for the non-viral DNA vectors of the present disclosure. Exemplary polymeric materials include poly(D,L lactic-co-glycolic acid) (PLGA), poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(L-lactic-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), PLGA-b-poly(ethylene glycol)-PLGA (PLGA-bPEG-PLGA), and the like. A), PLLA-bPEG-PLLA, PLGA-PEG-maleimide (PLGA-PEG-mal), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lactide), poly(D,L-lactide-co-PPO-co-D,L-lactide), polyalkyl cyanoacrylate, polyurethane, poly-L-lysine (PLL), hydroxypropyl methacrylate (HP MA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone, polysiloxanes, polystyrene (PS), polyurethanes, alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, derivatized celluloses such as nitrocellulose, hydroxypropyl cellulose, and carboxymethyl cellulose, poly(methyl (meth)acrylate) (PMMA), poly(ethyl (meth)acrylate),Polymers of acrylic acid such as poly(butyl (meth)acrylate), poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) (polyacrylic acid), and copolymers and mixtures thereof; polydioxides; Examples of polymer-based systems include sanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarate, polyoxymethylene, poloxamers, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, polyvinylpyrrolidone, polyorthoesters, polyphosphazenes, poly(β-aminoesters) (PBAE), and polyphosphoesters, as well as mixtures and / or block copolymers of two or more such polymers. Polymer-based systems can also include cyclodextrin polymer (CDP)-based nanoparticles, such as CDP-adamantane (AD)-PEG conjugates and CDP-AD-PEG-transferrin conjugates.

[0162] Non-limiting examples of polymer particle systems for delivery of non-viral DNA vectors that have been disclosed include those described in U.S. Pat. No. 5,543,158, U.S. Pat. No. 6,007,845, U.S. Pat. No. 6,254,890, U.S. Pat. No. 6,998,115, U.S. Pat. No. 7,727,969, U.S. Pat. No. 7,427,394, U.S. Pat. No. 8,323,698, U.S. Pat. No. 8,071,082, U.S. Pat. No. 8,105,652, U.S. Patent Application Publication No. 2008 / 026888, and the like. 063, U.S. Patent Application Publication No. 2009 / 0298710, U.S. Patent Application Publication No. 2010 / 0303723, U.S. Patent Application Publication No. 2011 / 0027172, U.S. Patent Application Publication No. 2011 / 0065807, U.S. Patent Application Publication No. 2012 / 0156135, U.S. Patent Application Publication No. 2014 / 0093575, and International Publication No. WO 2013 / 090861, the disclosures of which are incorporated herein by reference in their entireties.

[0163] In some embodiments, non-viral DNA vectors can be formulated as pharmaceutically acceptable nanocapsules. Nanocapsules generally can stably and reproducibly entrap compounds (Henry-Michelland et al., 1987; Quintanar-Guerrero et al., 1998; Douglas et al., 1987). To avoid side effects caused by intracellular polymer overload, such ultrafine particles (approximately 0.1 μm in size) should be designed using polymers that can be degraded in vivo. The present invention contemplates the use of biodegradable polyalkyl-cyanoacrylate nanoparticles that meet these requirements. Such particles can be readily prepared as described (Couvreur et al., 1980; Couvreur, 1988; zur Muhlen et al., 1998; Zambaux et al. 1998; Pinto-Alphandry et al., 1995; and U.S. Pat. No. 5,145,684, which are specifically incorporated herein by reference in their entirety).

[0164] In some embodiments, pharmaceutical compositions comprising the non-viral DNA vectors of the present disclosure and suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (see U.S. Pat. No. 5,466,468, the disclosure of which is incorporated herein by reference in its entirety). In all cases, the form must be sterile and fluid enough to allow easy syringability. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and / or vegetable oils.

[0165] In some embodiments, the non-viral DNA vector may be administered to a patient by a physical method such as electroporation, sonoporation with microbubbles, sonoporation without microbubbles, magnetofection, hydroporation, photoporation, mechanical massage, jet injection, biolistic (gene gun), hydrodynamic injection, needle injection, or microinjection.

[0166] Treatment method The present disclosure also relates to administering to a patient in need of treatment a therapeutically effective amount of a circular non-viral DNA vector capable of expressing one or more transgenes or a pharmaceutical composition comprising a circular non-viral DNA vector capable of expressing one or more transgenes.

[0167] In some embodiments, the present disclosure relates to treating conditions or diseases associated with bone defects characterized by a lack of or insufficient amounts of functional alkaline phosphatase. Another aspect of the present disclosure relates to methods of treating hypophosphatasia in a mammal, e.g., a human, in need thereof. Another aspect of the present disclosure relates to methods of treating, alleviating, or preventing symptoms of hypophosphatasia in a mammal, e.g., a human.

[0168] Hypophosphatasia (HPP) is a rare, inherited skeletal disorder, with an incidence of 1 in 100,000 births in its most severe form. The disorder is caused by loss-of-function mutations in the gene encoding tissue-nonspecific alkaline phosphatase (TNALP). Patients with HPP exhibit a variety of striking symptoms, ranging from tooth loss or osteomalacia (rickets) to the near-total absence of bone mineralization in utero. Many patients with HPP exhibit skeletal deformities, dwarfism, muscle and bone pain, motor impairment, and premature tooth loss. Perinatal-onset or infantile-onset HPP may also be characterized by rachitic chest deformities, vitamin B6-dependent epilepsy, and failure to thrive. HPP, particularly in children younger than 6 months of age, is often fatal due to respiratory failure, and survival rates at 1 year of age are low.

[0169] In some embodiments, the methods of the present disclosure provide for the treatment of hypophosphatasia in a mammal. As used herein, the terms "treatment," "treating," and the like refer to obtaining a desired pharmacological and / or physiological effect. In some embodiments, the effect is therapeutic, i.e., the effect partially or completely cures the disease and / or adverse symptoms resulting from the disease. In some embodiments, a composition comprising a "therapeutically effective amount" of a non-viral DNA vector is administered to a subject in need of treatment. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result.

[0170] In some embodiments, hypophosphatasia can be treated by administering a therapeutically effective amount of a pharmaceutical composition comprising a circular, non-viral DNA vector comprising one or more nucleic acid sequences encoding TNALP or a polypeptide having an amino acid sequence encoding TNALP (see, e.g., SEQ ID NOs: 28-30, 38, 40-48, and 72-73). In other embodiments, treating, alleviating, or preventing symptoms of hypophosphatasia in a mammal comprises administering a therapeutically effective amount of a pharmaceutical composition comprising a circular, non-viral DNA vector comprising one or more nucleic acid sequences encoding TNALP or a polypeptide having an amino acid sequence encoding TNALP (see, e.g., SEQ ID NOs: 28-30, 38, 40-48, and 72-73).

[0171] In some embodiments, the therapeutically effective amount may vary depending on factors such as the medical condition, age, sex, and weight of the individual.

[0172] The methods provided herein can be practiced by administering a pharmaceutical composition via any suitable route of administration. The route of administration can be local or systemic. Exemplary routes of administration include, for example, nasal, pulmonary, inhalation, intraarterial, intradermal, intralesional, intramuscular, intraperitoneal, intravenous, intrathecal, intravesical, parenteral, rectal, subcutaneous, and transmucosal. In some embodiments, the non-viral DNA vector is administered in a suitably formulated pharmaceutical composition disclosed herein subcutaneously, intraocularly, intravitreal, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or nasal inhalation, or by direct injection into one or more cells, tissues, or organs. Administration methods may also include those described in U.S. Patent Nos. 5,543,158, 5,641,515, and 5,399,363, each of which is incorporated herein by reference in its entirety.

[0173] In some embodiments, a subject in need of treatment is treated for a specified period of time. In some embodiments, the treatment period is from about 1 week to about 10 years. In some embodiments, the treatment period is from about 1 week to about 5 years. In some embodiments, the treatment period is from about 1 week to about 1 year. In some embodiments, the treatment period is from about 1 week to about 6 months. In some embodiments, the treatment period is from about 1 week to about 3 months. In some embodiments, the treatment period is from about 1 week to about 1 month. In some embodiments, the treatment period is from about 3 months to about 5 years. In some embodiments, the treatment period is from about 6 months to about 5 years. In some embodiments, the treatment period is from about 1 year to about 5 years.

[0174] Each dose can be administered over any suitable period of time. In some embodiments, the dose is administered as a bolus dose. In some embodiments, the dose is administered over a period of about 1 minute to about 4 hours. In some embodiments, the dose is administered over a period of about 1 minute to about 2 hours. In some embodiments, the dose is administered over a period of about 1 minute to about 1 hour. In some embodiments, the dose is administered over a period of about 1 minute to about 30 minutes. In some embodiments, the dose is administered over a period of about 1 minute to about 15 minutes.

[0175] As described herein, the circular non-viral DNA vector is suitable for re-administration. In some embodiments, the circular non-viral DNA vector is re-administered for a period ranging from about 2 weeks to about 5 years. In some embodiments, the pharmaceutical composition is administered according to a specific frequency. In some embodiments, the frequency is daily, every 2 days, every 3 days, every 4 days, every 5 days, every 6 days, every 7 days, every 8 days, every 9 days, every 10 days, every 11 days, every 12 days, every 13 days, or every 14 days. In some embodiments, the frequency is every 3 weeks, every 4 weeks, every 5 weeks, every 6 weeks, every 7 weeks, every 8 weeks, every 9 weeks, every 10 weeks, every 11 weeks, or every 12 weeks. In some embodiments, the frequency is every 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, 13 months, 14 months, 15 months, 16 months, 17 months, or 18 months, hi some embodiments, the frequency is every 2 years, 3 years, 4 years, or 5 years. [Example]

[0176] Example 1 - In vitro resolution of reporter non-viral DNA constructs in iPSC-derived hepatocytes In Figure 5, non-dividing iPSC-derived hepatocytes transfected with a circular non-viral DNA vector of the present disclosure containing an RFP / GFP reporter (SEQ ID NO: 32) showed simultaneous expression of GFP and RFP on day 3 and primarily RFP expression on day 8. The data suggested that circular non-viral DNA vectors containing cruciform structures can resolve to a linear form in non-dividing primary human iPSC-derived hepatocytes.

[0177] A reporter system was developed to assess the resolution of circular nonviral DNA vectors into linearized forms upon introduction into mammalian cells. Circular molecules express both red fluorescent protein (RFP) and green fluorescent protein (GFP), whereas GFP expression is abrogated in circular forms generated through mRNA splicing across the cruciform DNA structure, resulting in linearized molecules expressing only RFP.

[0178] method Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm Corporation. On day 0, plating medium was prepared according to Fujifilm's recommendations by adding 1.5 mL of B27 supplement, 0.15 mL of 10 μg / mL oncostatin stock solution, 1.5 μL of 5 mM dexamethasone stock solution, 37.5 μL of 25 μg / mL gentamicin, and 1.5 mL of iCell Hepatocytes 2.0 medium supplement to 72 mL of RPMI medium.

[0179] The plating medium was filtered through a 0.22 μm PES filter unit. On day 1, an iCell Hepatocytes 2.0 cryovial was removed from the liquid nitrogen storage tank. The cryovial was immersed in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, the contents of the iCell Hepatocytes 2.0 cryovial were gently transferred into a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. The cell suspension was centrifuged at 200 × g for 3 minutes at room temperature. The supernatant was carefully aspirated under vacuum. 2 mL of 37°C plating medium was slowly added with a wide-bore pipette to resuspend the cell pellet. Hepatocytes were seeded into prewarmed collagen-coated 24 / 48-well plates. The medium was refreshed daily from days 1 to 7, and every other day from day 8 onwards.

[0180] TransIT-LT1 Reagent and non-viral vector DNA complexes were prepared according to the manufacturer's recommendations (Mirus). The TransIT-LT1 Reagent:DNA complexes were added dropwise to various regions of the wells. The culture vessel was gently rocked back and forth to ensure uniform distribution of the TransIT-LT1 Reagent:DNA complexes.

[0181] result 5 demonstrates that iPSC-derived hepatocytes transfected with a circular non-viral DNA reporter vector of the present disclosure (SEQ ID NO: 32) containing an RFP / GFP reporter exhibited simultaneous expression of GFP and RFP on day 3, but primarily RFP expression on day 8. The data suggested that circular non-viral DNA vectors containing cruciform structures could be resolved to a linear form in non-dividing primary human iPSC-derived hepatocytes.

[0182] Example 2 - Durable in vitro gene expression of firefly luciferase DNA constructs in iPSC-derived hepatocytes Transfection of a circular, non-viral DNA vector of the present disclosure encoding TNALP (M014-SEQ ID NO: 30) led to strong bioluminescence emission in iPSC-derived hepatocytes starting on day 3, and this signal was maintained from day 12 to day 21, whereas the relative light units (RLU) from cells transfected with a control circular, non-viral DNA vector of the present disclosure encoding TNALP (P021-SEQ ID NO: 31) significantly decreased starting on day 7, as shown in Figure 6. A circular, non-viral DNA vector of the present disclosure containing a luciferase reporter gene showed robust and durable luciferase expression, whereas the same control construct carrying an antibiotic resistance gene was much less potent and did not persist.

[0183] method Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm Corporation. On day 0, plating medium was prepared according to Fujifilm's recommendations by adding 1.5 mL of B27 supplement, 0.15 mL of 10 μg / mL oncostatin stock solution, 1.5 μL of 5 mM dexamethasone stock solution, 37.5 μL of 25 μg / mL gentamicin, and 1.5 mL of iCell Hepatocytes 2.0 medium supplement to 72 mL of RPMI medium.

[0184] The plating medium was filtered through a 0.22 μm PES filter unit. On day 1, an iCell Hepatocytes 2.0 cryovial was removed from the liquid nitrogen storage tank. The cryovial was immersed in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, the contents of the iCell Hepatocytes 2.0 cryovial were gently transferred into a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. The cell suspension was centrifuged at 200 × g for 3 minutes at room temperature. The supernatant was carefully aspirated under vacuum. 2 mL of 37°C plating medium was slowly added with a wide-bore pipette to resuspend the cell pellet. Hepatocytes were seeded into prewarmed collagen-coated 24 / 48-well plates. The medium was refreshed daily from days 1 to 7, and every other day from day 8 onwards.

[0185] TransIT-LT1 Reagent and non-viral vector DNA complexes were prepared according to the manufacturer's recommendations (Mirus). The TransIT-LT1 Reagent:DNA complexes were added dropwise to various regions of the wells. The culture vessel was gently rocked back and forth to ensure uniform distribution of the TransIT-LT1 Reagent:DNA complexes.

[0186] To read bioluminescence non-invasively, a stock solution of luciferin substrate was added to the cell plate to reach a final concentration of 5 mM, and then the RLU from each well of the plate was measured by a Molecular Devices iD5 plate reader.

[0187] Example 3 - Durable gene expression of TNALP DNA constructs in iPSC-derived hepatocytes in vitro 7, non-dividing iPSC-derived hepatocytes transfected with a circular, non-viral DNA vector of the present disclosure (M012-SEQ ID NO:28) containing a nucleic acid encoding TNALP and also containing a double inverted repeat exhibited higher ALP secretion compared to hepatocytes transfected with a circular, non-viral DNA vector (M013-SEQ ID NO:29) containing a nucleic acid encoding TNALP and also containing a series of single inverted repeats with no intervening heterologous sequence. Cells transfected with both inverted repeat-containing constructs exhibited higher ALP secretion than cells transfected with a control TNALP construct (P020-SEQ ID NO:33) containing an ampicillin resistance gene.

[0188] method Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm Corporation. On day 0, plating medium was prepared according to Fujifilm's recommendations by adding 1.5 mL of B27 supplement, 0.15 mL of 10 μg / mL oncostatin stock solution, 1.5 μL of 5 mM dexamethasone stock solution, 37.5 μL of 25 μg / mL gentamicin, and 1.5 mL of iCell Hepatocytes 2.0 medium supplement to 72 mL of RPMI medium.

[0189] The plating medium was filtered through a 0.22 μm PES filter unit. On day 1, an iCell Hepatocytes 2.0 cryovial was removed from the liquid nitrogen storage tank. The cryovial was immersed in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, the contents of the iCell Hepatocytes 2.0 cryovial were gently transferred into a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. The cell suspension was centrifuged at 200 × g for 3 minutes at room temperature. The supernatant was carefully aspirated under vacuum. 2 mL of 37°C plating medium was slowly added with a wide-bore pipette to resuspend the cell pellet. Hepatocytes were seeded into prewarmed collagen-coated 24 / 48-well plates. The medium was refreshed daily from days 1 to 7, and every other day from day 8 onwards.

[0190] TransIT-LT1 Reagent and non-viral vector DNA complexes were prepared according to the manufacturer's recommendations (Mirus). The TransIT-LT1 Reagent:DNA complexes were added dropwise to various regions of the wells. The culture vessel was gently rocked back and forth to ensure uniform distribution of the TransIT-LT1 Reagent:DNA complexes.

[0191] At various time points, the cell culture medium was removed and the ALP activity in the cell culture medium was determined by an ALP colorimetric assay performed on a Molecular Devices plate reader iD5.

[0192] Example 4 - Sustained hepatic luciferase expression from luciferase-containing constructs in adult mice A circular, non-viral DNA vector encoding a luciferase reporter according to the present disclosure (M014-SEQ ID NO: 30) exhibited sustained bioluminescence signals from mouse liver tissue harvested from weeks 1 through 4 and 5 after dosing by hydrodynamic tail vein injection (15 μg per mouse), whereas mice injected with a control luciferase plasmid exhibited background levels of luminescence, as shown in Figure 8A. Furthermore, analysis of DNA copy number per diploid cell revealed that the M014 construct was maintained in mouse liver tissue for one month, while the copy number of the control luciferase plasmid (P021-SEQ ID NO: 31) in mouse liver cells declined significantly from weeks 1 through 5, as shown in Figure 8B.

[0193] method Adult mice (strain: BALB / c) aged 9 to 11 weeks were ordered from Jackson Laboratory. Prior to the start of the study, animals were randomly assigned to groups using a random number generator. Nonviral DNA vector constructs were administered to adult mice via hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 80 mL / kg. Luciferase activity and nonviral DNA vector copy number were measured ex vivo in liver tissue at several terminal timepoints.

[0194] To measure the DNA copy number of constructs according to the present disclosure, approximately 25 mg of each liver lobe from each animal was harvested and stored below -65°C before performing ddPCR assays on a Biorad ddPCR system. Primers / probes targeting the polyA region of the non-viral DNA vector construct were used to measure the copy number of the non-viral DNA vector construct, while mouse RPP30 was used as a reference gene.

[0195] For luciferase, the remaining tissue from each liver lobe was stored below −65°C for lysate generation / luciferase. Bioluminescence was measured from liver lysates after homogenization using the Spectra Max Glo Steady-Luc Reporter Assay Kit.

[0196] Example 5 - Comparison of ALP levels in mice treated with a circular non-viral DNA vector expressing TNALP and a lentiviral vector expressing TNALP Figure 9 shows the number of 1 x 106 mice transduced with a lentiviral vector expressing TNALP (SEQ ID NO: 34) in mice (n=3) administered a circular non-viral DNA vector (M013 - SEQ ID NO: 29) containing a nucleic acid encoding TNALP. 6 Figure 1 shows that similar plasma ALP levels were found in mice treated with 1000-HTLV-1 cells (transduced hematopoietic stem / progenitor cells 2 weeks after dosing) compared to mice treated with 1000-HTLV-1 cells (transduced hematopoietic stem / progenitor cells 2 weeks after dosing).

[0197] method Adult mice (strain: B6129SF2 / J) aged 9 to 11 weeks were ordered from Jackson Laboratory. Prior to the start of the study, animals were randomly assigned to groups using a random number generator. Nonviral DNA vector constructs were administered to adult mice via hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 80 mL / kg. Luciferase activity and nonviral DNA vector copy number were measured in the liver at several terminal time points.

[0198] To measure the copy number of the DNA vector, 25 mg of each liver lobe from each animal was harvested and stored below -65°C, followed by ddPCR assays in a Biorad ddPCR system. Primers / probes targeting the polyA region of the non-viral DNA vector construct were used to measure the copy number of the non-viral DNA vector construct, while mouse RPP30 was used as a reference gene.

[0199] At various time points, plasma samples were taken from the animals and stored below −65° C. before ALP measurements were performed. ALP concentrations were determined by a colorimetric assay performed on a Molecular Devices plate reader iD5.

[0200] Example 6 - Generation of constructs according to the present disclosure In some embodiments, circular non-viral DNA vectors can be generated from a parental plasmid (e.g., pUC or pMB1) that contains both a marker gene and a high-copy-number origin of replication between two loxP sites by "Cre-lox recombination." Cre recombinase can be induced through metabolic control in bacterial cells harboring the parental plasmid. In this case, recombination generates two topologically unlinked circular, supercoiled DNA molecules, each containing a single loxP site. One of the resulting circular, supercoiled DNA molecules contains the marker gene and a high-copy-number origin of replication, while the other contains the circular non-viral DNA vector of the present disclosure.

[0201] In some embodiments, other LoxP sites, such as Lox511, Lox5171, Lox2272, M2, M3, M7, M11, Lox71, Lox66, LoxPsym, etc., can be used to generate non-viral DNA vectors from parental DNA plasmids. In some embodiments, other recombinases, such as PhiC31, λ integrase, and Flp recombinase, can be used to generate non-viral DNA vectors. In some embodiments, recombinases, such as Cre, PhiC31, λ integrase, and Flp recombinase, can be recombinantly produced and directly applied to purified parental plasmid DNA to generate non-viral DNA vectors. In some embodiments, marker genes include genes encoding kanamycin resistance, spectinomycin resistance, streptomycin resistance, carbenicillin resistance, bleomycin resistance, erythromycin resistance, polymyxin B resistance, tetracycline resistance, or chloramphenicol resistance, among others. In some embodiments, the origin of replication includes sequences from pMB1, pBR322, ColE1, p15A, pSC101, or F1.

[0202] Example 7 - Sustained hepatic mouse SEAP expression from mouse SEAP constructs in adult mice Circular non-viral DNA vectors using the EF1α promoter and TBG promoter encoding a mouse SEAP reporter (M027 and M032—SEQ ID NO: 74 and SEQ ID NO: 75), respectively, showed sustained high plasma SEAP activity in mouse samples collected from day 1 to day 190 after dosing by hydrodynamic tail vein injection (15 μg per mouse) (FIGS. 12A and 12B). Analysis of DNA copy number per diploid cell revealed that two constructs according to the present disclosure (M027—SEQ ID NO: 74 and M032—SEQ ID NO: 75) were maintained in mouse liver for 189 days (FIG. 12C).

[0203] method Adult mice (strain: BALB / c) aged 9 to 11 weeks were ordered from Charles River Laboratories. Prior to the start of the study, animals were randomly assigned to groups using a random number generator. Nonviral DNA vector constructs were administered to adult mice via hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 100 mL / kg. At several terminal time points, SEAP activity was measured in plasma samples, and nonviral DNA vector copy numbers were measured in liver tissue samples.

[0204] To measure the copy number of constructs according to the present disclosure, 25 mg of each liver lobe from each animal was harvested and stored below -65°C before performing ddPCR assays on a BioRad ddPCR system using primers / probes targeting the polyA regions of the reference genes.

[0205] At various time points, plasma samples were taken and stored below −65° C. before performing the SEAP assay. SEAP activity was determined by the SEAP fluorescence assay performed on a Molecular Devices plate reader iD5.

[0206] Example 8 - Nuclear entry of constructs according to the present disclosure To examine the extent to which cruciform structures affect nuclear entry and retention, postmitotic, non-dividing iPSC-derived hepatocytes transfected with a fluorescently labeled circular, non-viral DNA vector (M012, SEQ ID NO: 28) containing a nucleic acid encoding TNALP and also containing a double inverted repeat showed a higher number of Forsythia per nucleus on days 1, 3, and 6 compared with hepatocytes transfected with a circular, non-viral DNA vector (M013, SEQ ID NO: 29) containing a nucleic acid encoding TNALP and also containing a series of single inverted repeats without any intervening heterologous sequence (DD-ITR construct) and a control TNALP construct (M022, SEQ ID NO: 33) containing an ampicillin resistance gene (Figure 14B). The number of Forsythia per nucleus correlated with the ALP activity of the culture medium (Figure 14C).

[0207] method Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm Corporation. On day 0, plating medium was prepared by adding 1.5 mL of B27 supplement, 0.15 mL of a 10 μg / mL oncostatin stock solution, 1.5 μL of a 5 mM dexamethasone stock solution, 37.5 μL of 25 μg / mL gentamicin, and 1.5 mL of iCell Hepatocytes 2.0 medium supplement to 72 mL of RPMI, as recommended by Fujifilm Corporation.

[0208] After thawing iCell Hepatocytes 2.0 medium supplement (1 x 3.0 mL), the plating medium was filtered through a 0.22 μm PES filter unit. On day 1, an iCell Hepatocytes 2.0 cryovial was removed from the liquid nitrogen storage tank. The cryovial was immersed in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, the contents of the iCell Hepatocytes 2.0 cryovial were gently transferred into a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. The cell suspension was centrifuged at 200 x g for 3 minutes at room temperature. After carefully aspirating the supernatant, the cell pellet was resuspended using 2 mL of warm plating medium using a wide-bore pipette. Hepatocytes were seeded into pre-warmed collagen-coated 24 / 48-well plates.

[0209] Transfection reagent was purchased from FuGENE, and DNA transfection was performed according to the manufacturer's recommendations.

[0210] At various time points, cell culture medium was removed and ALP levels were determined by ALP colorimetric assay performed on a Molecular Devices plate reader iD5.

[0211] Cells were fixed on days 1, 3, and 6 post-transfection, stained with DAPI, and mounted for confocal imaging. DAPI staining (blue) represents the nucleus, while green forsythia represents the constructs of the present disclosure in both the nucleus and cytoplasm within the cells (Figure 14A).

[0212] Images were analyzed using ImagePro 11 smart segmentation. Nuclear regions of interest (ROIs) were segmented at 58 μm in the blue channel. 2 A minimum area cutoff of 0.04 μm was used to identify ROIs containing constructs of the present disclosure. 2 Only forsythia containing constructs of the present disclosure located within the nucleus were counted.

[0213] An average of 400 cells were analyzed per condition. Data are graphed as the average number of Forsythia per nucleus for each condition. Three criteria (nuclear area, number of Forsythia, and % area of Forsythia in the nucleus) were used to remove outliers from the data set.

[0214] Example 9 - In vitro gene expression of reporter constructs with various cruciform structures in iPSC-derived hepatocytes Figure 13A shows that transfection of a circular non-viral DNA vector with an improved cruciform structure (M056 - SEQ ID NO: 73) using FuGENE- or SM102-based lipid nanoparticle formulations resulted in higher ALP levels in the culture medium of iPSC-derived hepatocytes on day 3 than a circular non-viral DNA vector with an improved cruciform structure (M012 - SEQ ID NO: 30). Neither the circular non-viral DNA vector using FuGENE- or SM102-based lipid nanoparticle formulations induced significant toxicity in iPSC-derived human hepatocytes, as shown in Figure 13B.

[0215] method Non-dividing iPSC-derived human hepatocytes were purchased from Fujifilm Corporation. On day 0, plating medium was prepared by adding 1.5 mL of B27 supplement, 0.15 mL of a 10 μg / mL oncostatin stock solution, 1.5 μL of a 5 mM dexamethasone stock solution, 37.5 μL of 25 μg / mL gentamicin, and 1.5 mL of iCell Hepatocytes 2.0 medium supplement to 72 mL of RPMI, as recommended by Fujifilm Corporation.

[0216] After thawing iCell Hepatocytes 2.0 medium supplement (1 x 3.0 mL), the plating medium was filtered through a 0.22 μm PES filter unit. On day 1, an iCell Hepatocytes 2.0 cryovial was removed from the liquid nitrogen storage tank. The cryovial was immersed in a 37°C water bath for exactly 3 minutes. Using a 2 mL serological pipette, the contents of the iCell Hepatocytes 2.0 cryovial were gently transferred into a 15 mL centrifuge tube containing 10 mL of 37°C plating medium. The cell suspension was centrifuged at 200 x g for 3 minutes at room temperature. After carefully aspirating the supernatant, the cell pellet was resuspended using 2 mL of warm plating medium using a wide-bore pipette. Hepatocytes were seeded into pre-warmed collagen-coated 24 / 48-well plates.

[0217] Prepare FuGene or SM-102-based lipid nanoparticle transfection reagent and non-viral vector DNA complexes according to the supplier's recommendations. Add the transfection reagent:DNA complexes (prepared in step A) dropwise to different areas of the wells. Gently rock the culture vessel back and forth and side to side to evenly distribute the transfection reagent:DNA complexes.

[0218] On day 3, cell culture medium was removed and ALP levels were determined by ALP colorimetric assay performed on a Molecular Devices plate reader iD5.

[0219] Example 10 - In vitro gene expression of reporter constructs with and without cruciform structures in human primary hepatocytes and cynomolgus monkey primary hepatocytes Transfection of a construct of the present disclosure containing luciferase DNA with an improved cruciform structure (SEQ ID NO: 73) resulted in significantly higher luciferase levels than control luciferase DNA without a cruciform structure (SEQ ID NO: 74) in primary human hepatocytes (Figure 15A) and primary cynomolgus monkey hepatocytes (Figure 15B) at day 3 using an SM102-based lipid nanoparticle formulation.

[0220] method Primary human hepatocytes (Lonza) and primary cynomolgus monkey hepatocytes (GIBCO) were seeded at 80,000 and 70,000 cells per well in duplicate wells of a collagen type I-coated 96-well plate on day 0. One day after seeding, constructs of the present disclosure and control constructs were delivered via LNP mix.

[0221] Prepare an SM-102-based lipid mix (SM102, DSPC, N / P ratio 6, 1.5% DMG-PEG2K) and mix the DNA with the lipid mix using a pipette. Add the lipid mix:DNA complex dropwise to various areas of the well. Gently rock the culture vessel back and forth and side to side to distribute the lipid-DNA mix evenly.

[0222] Endpoint luciferase activity was measured in cell lysates of primary human hepatocytes (FIG. 16A) and primary cynomolgus monkey hepatocytes (FIG. 16B) at day 6 after LNP delivery using Molecular Devices' Glo Steady-Luc kit, respectively.

[0223] Example 11 - Enhanced hepatic luciferase expression from firefly luciferase constructs in adult mice A circular non-viral DNA vector containing a firefly luciferase reporter (SEQ ID NO: 73) showed higher expression of luciferase activity compared to a control firefly luciferase construct (SEQ ID NO: 73) in mouse liver tissues harvested from days 7 and 14 after dosing via tail vein-based hydrodynamic injection (15 μg per mouse) (FIG. 16).

[0224] method Adult mice (strain: BALB / c) aged 9 to 11 weeks were ordered from Charles River Laboratories. Prior to the start of the study, animals were randomly assigned to groups using a random number generator. Nonviral DNA vector constructs were administered to adult mice via hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 100 mL / kg. Firefly luciferase activity was measured in liver samples on days 7 and 14.

[0225] On days 7 and 14, mice were euthanized and liver samples were collected and stored below -65°C before bioluminescence measurements were determined by a bioluminescence assay performed on a Molecular Devices plate reader iD5.

[0226] Example 12 - Comparison of in vitro gene expression of DNA constructs encoding cynomolgus monkey soluble TNALP transgenes and chemically modified mRNA in primary human hepatocytes (i) A construct of the present disclosure containing cynomolgus monkey soluble TNALP DNA with an improved cruciform structure (SEQ ID NO: 43) and (ii) chemically modified mRNA encoding the same transgene were delivered to primary human hepatocytes using an SM102-based lipid nanoparticle formulation. ALP activity from the construct of the present disclosure in the culture medium increased from day 1 to day 3 and was then maintained from day 3 to day 6. Concurrently, ALP activity in cells transfected with the mRNA continued to decrease from day 1 to day 5 and disappeared by day 6 (Figure 17).

[0227] method Primary human hepatocytes (Lonza) were seeded at 80,000 cells per well in duplicate wells of a collagen type I-coated 96-well plate on day 0. One day after seeding, constructs of the present disclosure and control constructs were delivered via LNP mix.

[0228] Prepare an SM-102-based lipid mix (SM102, DSPC, N / P ratio 6, 1.5% DMG-PEG2K) and mix the DNA with the lipid mix using a pipette. Add the lipid mix:DNA complex dropwise to various areas of the well. Gently rock the culture vessel back and forth and side to side to distribute the lipid-DNA mix evenly.

[0229] Between days 1 and 6, cell culture medium was removed and ALP levels were determined by ALP fluorescence assay performed on a Molecular Devices plate reader iD5.

[0230] Example 13 - In vitro co-localization of constructs according to the present disclosure with PARP1 Figure 18 shows representative confocal images of 293T cells transfected with a fluorescently labeled construct according to the present disclosure (M012-SEQ ID NO: 28). Cells were stained with anti-PARP1-AF647 (purple). The region of PARP1 overlapped with the construct according to the present disclosure, suggesting that PARP1 may be involved in the intracellular pathway following transfection of the construct according to the present disclosure.

[0231] method A construct according to the present disclosure (M012-SEQ ID NO: 28) was labeled with a green fluorescent DNA conjugation reagent before transfection. The transfection reagent was purchased from FuGENE, and DNA transfection followed the manufacturer's recommendations.

[0232] 293T cells were fixed 3 days after transfection, stained with DAPI and anti-PARP1 antibody, and mounted for confocal imaging. Purple represents PARP1, DAPI staining (blue) represents nuclei, and green represents the construct according to the present disclosure within the cells (FIG. 18).

[0233] Example 14 - Immunomodulatory effects of constructs according to the present disclosure To examine the extent to which the cruciform structure and cassette gene influence the immune response, adult mice (n=7 per group) were dosed three times with three different constructs: (i) a circular non-viral DNA vector (M013-SEQ ID NO: 29) carrying a human TNALP transgene with a single inverted repeat containing no intervening heterologous sequence, with a high CpG content, a bone tag, and an Ig-Fc domain (FIG. 19A); (ii) a circular non-viral DNA vector according to the present disclosure carrying a human TNALP transgene with an improved cruciform structure (FIG. 19B). (iii) a circular non-viral DNA vector according to the present disclosure having cynomolgus monkey TNALP with an improved cruciform structure (SEQ ID NO: 43), but without the CpG content in the transgene and the encoding of the cruciform tag and Ig-Fc domain in the gene cassette, to increase TNALP protein expression and reduce the immunostimulatory properties of the DNA (FIG. 19C). Plasma alkaline phosphatase activity from a DNA construct with a single inverted repeat cruciform structure without an intervening heterologous sequence was modest and not durable, likely resulting in the generation of a humoral or cellular immune response against the inflammatory transgene product or transgene-expressing cells, and did not demonstrate rechallengeability. Plasma ALP activity from a construct according to the present disclosure with an improved cruciform structure revealed increased efficacy, more durable transgene expression, and re-dosing ability due to entry of the cytoplasmic DNA signaling (CDS) pathway, likely mediated by the cGAS-STING pathway. Optimization of the gene expression cassette in this construct further improved plasma protein secretion and reduced immune responses, resulting in the highest levels of ALP activity observed.

[0234] method Adult mice (strain: BALB / c) aged 9 to 11 weeks were ordered from Charles River Laboratories. Animals were randomly assigned to groups using a random number generator before the start of the study. Nonviral DNA vector constructs were administered to adult mice via hydrodynamic tail vein injection at a dose of 15 μg per animal in a volume of 100 mL / kg, three times at 3-week intervals.

[0235] At various time points, plasma samples were taken and stored below −65° C. before ALP assay. ALP activity was determined by TNALP fluorescence assay performed on a Molecular Devices plate reader iD5.

[0236] Additional Embodiments In some embodiments, the disclosure relates to an amino acid sequence having at least 85% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 91% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 92% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 93% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 94% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 95% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 96% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 97% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 98% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having at least 99% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the disclosure relates to an amino acid sequence having any one of SEQ ID NOs: 19-27.

[0237] In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 85% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 90% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 91% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 92% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 93% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 94% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 95% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 96% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 97% identity to any one of SEQ ID NOs: 19-27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 98% identity to any one of SEQ ID NOs: 19-27.In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having at least 99% identity to any one of SEQ ID NOs: 19 to 27. In some embodiments, the present disclosure relates to a circular, non-viral DNA vector comprising a nucleic acid sequence encoding an amino acid having any one of SEQ ID NOs: 19 to 27.

[0238] In some embodiments, the disclosure relates to a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 86% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 87% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 88% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 89% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 28 through 73.In some embodiments, the disclosure relates to a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 28 through 73. In some embodiments, the disclosure relates to a nucleic acid sequence having any one of SEQ ID NOs: 28 through 73.

[0239] A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 82% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 83% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 84% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 86% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 87% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 88% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 89% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs: 28 to 30.A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 28 to 30. A circular, non-viral DNA vector comprising any one of SEQ ID NOs: 28 to 30.

[0240] A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 81% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 82% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 83% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 84% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 86% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 87% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 88% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 89% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 91% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs: 72 to 73.A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 93% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs: 72 to 73. A circular, non-viral DNA vector comprising a nucleic acid sequence having any one of SEQ ID NOs: 72 to 73.

[0241] In some embodiments, the isolated circular non-viral DNA vector comprises a first portion consisting essentially of an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter, and a second portion capable of forming at least one cruciform structure, wherein the second portion consists essentially of at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by a non-repetitive nucleotide sequence having at least three nucleotides.

[0242] In some embodiments, the isolated circular non-viral DNA vector consists essentially of a first portion consisting essentially of an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter, and a second portion capable of forming at least one cruciform structure, wherein the second portion consists essentially of at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by a non-repetitive nucleotide sequence having at least three nucleotides.

[0243] In some embodiments, the isolated circular non-viral DNA vector comprises a first portion consisting of an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter, and a second portion capable of forming at least one cruciform structure, wherein the second portion consists of at least two inverted repeat sequences, and the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least three nucleotides.

[0244] In some embodiments, the isolated circular non-viral DNA vector comprises a first portion consisting of an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter, and a second portion capable of forming at least one cruciform structure, wherein the second portion consists of at least two inverted repeat sequences, and wherein the at least two inverted repeat sequences are separated by a non-repetitive nucleotide sequence having at least three nucleotides.

[0245] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications, and non-patent literature referenced herein and / or listed in the Application Data Sheet are hereby incorporated by reference in their entirety. Aspects of the embodiments can be modified, and concepts from the various patents, applications, and publications employed, if desired, to provide still further embodiments.

[0246] While the present disclosure has been described with reference to several exemplary embodiments, it should be understood that those skilled in the art can devise numerous other modifications and embodiments which would fall within the spirit and scope of the principles of the present disclosure. More particularly, reasonable variations and modifications may be made in the component parts and / or arrangements of the subject combinations and arrangements within the scope of the foregoing disclosure, the drawings, and the appended claims without departing from the spirit of the present disclosure.

Claims

1. (a) a first portion comprising an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; (b) a second portion capable of forming at least one cruciform structure, the second portion comprising at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by a non-repetitive nucleotide sequence having at least three nucleotides; An isolated circular non-viral DNA vector comprising:

2. 2. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector is substantially free of CpG sequences.

3. 2. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector contains less than about 400 CpGs per vector.

4. 2. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector contains less than about 300 CpGs per vector.

5. 2. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector comprises less than about 150 CpGs per vector.

6. 2. The isolated circular non-viral DNA vector of claim 1, wherein the non-viral DNA vector comprises less than about 50 CpGs per vector.

7. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 5 nucleotides.

8. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 10 nucleotides.

9. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 15 nucleotides.

10. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the non-repetitive nucleotide sequence comprises at least 20 nucleotides.

11. 7. The isolated circular non-viral DNA vector of claim 1, wherein the unique nucleotide sequence having at least 3 nucleotides encodes at least a portion of a bacterial origin of replication.

12. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a heterologous gene or a part of a heterologous gene.

13. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial suppressor tRNA.

14. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial RNAi repressor.

15. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the unique nucleotide sequence having at least 3 nucleotides encodes an antisense RNA.

16. The isolated circular non-viral DNA vector of any one of claims 1 to 6, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial operator sequence.

17. 17. The isolated circular non-viral DNA vector of claim 16, wherein the bacterial operator sequence comprises a lac operator.

18. 17. The isolated circular non-viral DNA vector of claim 16, wherein the bacterial operator sequence comprises a tet operator.

19. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the non-viral DNA vector lacks a drug resistance gene.

20. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the non-viral DNA vector comprises one or more recombination sites.

21. 21. The isolated circular non-viral DNA vector of claim 20, wherein the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB and attP sites, their product sites attL or attR, or alternative recombination target sites derived from these sites.

22. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the non-viral DNA vector is substantially double-stranded.

23. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the non-viral DNA vector is substantially supercoiled.

24. 24. The isolated circular non-viral DNA vector of claim 23, wherein the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions.

25. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the non-viral DNA vector is non-immunogenic.

26. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences is derived from a nucleic acid sequence present in one or more AAV serotypes.

27. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences comprises a nucleotide sequence having at least 85% identity to any one of SEQ ID NO:1 to SEQ ID NO:

18.

28. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences comprises a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 1 to 18.

29. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein each of the inverted repeat sequences comprises a nucleotide sequence having at least 95% identity to any one of SEQ ID NOs: 1 to 18.

30. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the non-viral DNA vector does not contain a DD element.

31. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein said non-repetitive nucleotide sequence having at least 3 nucleotides has a nucleotide sequence having at least 85% identity to any one of SEQ ID NOs: 58 to 59.

32. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein said non-repetitive nucleotide sequence having at least 3 nucleotides has a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 58 to 59.

33. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein said non-repetitive nucleotide sequence having at least 3 nucleotides has a nucleotide sequence having at least 95% identity to any one of SEQ ID NOs: 58 to 59.

34. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein said non-repetitive nucleotide sequence having at least three nucleotides has a nucleotide sequence having any one of SEQ ID NO:58 to SEQ ID NO:

59.

35. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a first nucleic acid sequence having at least 90% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:

18.

36. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a first nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having at least 95% identity to any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:

18.

37. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a first nucleic acid sequence having any one of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, or SEQ ID NO:17, a second nucleic acid sequence having any one of SEQ ID NOs:58-59, and a third nucleic acid sequence having any one of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, or SEQ ID NO:

18.

38. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence having at least 90% identity to any one of SEQ ID NO: 35 and SEQ ID NO:

60.

39. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence having at least 95% identity to any one of SEQ ID NO: 35 and SEQ ID NO:

60.

40. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence having at least 97% identity to any one of SEQ ID NO: 35 and SEQ ID NO:

60.

41. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence having at least 99% identity to any one of SEQ ID NO: 35 and SEQ ID NO:

60.

42. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the second portion comprises a nucleic acid sequence having any one of SEQ ID NO: 35 and SEQ ID NO:

60.

43. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, AlAT, anti-CD19-anti-CD3, and ABCB11.

44. 10. The isolated circular non-viral DNA vector of any one of the preceding claims, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

45. (a) a first portion comprising an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; (b) a second portion capable of forming at least one cruciform structure, the second portion having the formula X-Y-X', where X and X' are each inverted repeat sequences, and Y comprises a nucleotide sequence that is non-repeated and has at least 3 nucleotides; An isolated circular non-viral DNA vector comprising:

46. 46. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector is substantially free of CpG sequences.

47. 46. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 400 CpGs per vector.

48. 46. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 300 CpGs per vector.

49. 46. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 150 CpGs per vector.

50. 46. The isolated circular non-viral DNA vector of claim 45, wherein the non-viral DNA vector comprises less than about 50 CpGs per vector.

51. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y comprises at least 5 nucleotides.

52. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y comprises at least 10 nucleotides.

53. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y comprises at least 15 nucleotides.

54. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y comprises at least 20 nucleotides.

55. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y encodes at least a portion of a bacterial origin of replication.

56. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y encodes a heterologous gene or a portion of a heterologous gene.

57. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y encodes a bacterial suppressor tRNA.

58. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y encodes a bacterial RNAi repressor.

59. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y encodes an antisense RNA.

60. 51. The isolated circular non-viral DNA vector of any one of claims 45 to 50, wherein Y encodes a bacterial operator sequence.

61. 61. The isolated circular non-viral DNA vector of claim 60, wherein the bacterial operator sequence comprises a lac operator.

62. 61. The isolated circular non-viral DNA vector of claim 60, wherein the bacterial operator sequence comprises a tet operator.

63. The isolated circular non-viral DNA vector of any one of claims 45 to 62, wherein the non-viral DNA vector lacks a drug resistance gene.

64. 64. The isolated circular non-viral DNA vector of any one of claims 45 to 63, wherein the non-viral DNA vector comprises one or more recombination sites.

65. 65. The isolated circular non-viral DNA vector of claim 64, wherein the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB and attP sites, their product sites attL or attR, or alternative recombination target sites derived from these sites.

66. 66. The isolated circular non-viral DNA vector of any one of claims 45 to 65, wherein the non-viral DNA vector is substantially double-stranded.

67. 67. The isolated circular non-viral DNA vector of any one of claims 45 to 66, wherein the non-viral DNA vector is substantially supercoiled.

68. 68. The isolated circular non-viral DNA vector of claim 67, wherein the substantially supercoiled non-viral DNA vector comprises one or more negatively supercoiled regions.

69. The isolated circular non-viral DNA vector of any one of claims 45 to 68, wherein the non-viral DNA vector is non-immunogenic.

70. 70. The isolated circular non-viral DNA vector of any one of claims 45 to 69, wherein X and X' are derived from nucleic acid sequences present in one or more AAV serotypes.

71. 70. The isolated circular non-viral DNA vector of any one of claims 45 to 69, wherein X and X' each comprise a nucleotide sequence having at least 85% identity to any one of SEQ ID NOs: 1 to 18.

72. 70. The isolated circular non-viral DNA vector of any one of claims 45 to 69, wherein X and X' each comprise a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 1 to 18.

73. 70. The isolated circular non-viral DNA vector of any one of claims 45 to 69, wherein X and X' each comprise a nucleotide sequence having at least 95% identity to any one of SEQ ID NOs: 1 to 18.

74. The isolated circular non-viral DNA vector of any one of claims 45 to 73, wherein the non-viral DNA vector does not contain a DD element.

75. 75. The isolated circular non-viral DNA vector of any one of claims 45 to 74, wherein Y has a nucleotide sequence having at least 85% identity to any one of SEQ ID NOs: 58 to 59.

76. 75. The isolated circular non-viral DNA vector of any one of claims 45 to 74, wherein Y has a nucleotide sequence having at least 90% identity to any one of SEQ ID NOs: 58 to 59.

77. 75. The isolated circular non-viral DNA vector of any one of claims 45 to 74, wherein Y has a nucleotide sequence having at least 95% identity to any one of SEQ ID NOs: 58 to 59.

78. 75. The isolated circular non-viral DNA vector of any one of claims 45 to 74, wherein Y has a nucleotide sequence having any one of SEQ ID NOs: 58 to 59.

79. 79. The isolated circular non-viral DNA vector of any one of claims 45 to 78, wherein Y does not comprise a bacterial origin of replication or any part thereof.

80. 79. The isolated circular non-viral DNA vector of any one of claims 45 to 78, wherein the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but the bacterial origin of replication or the portion of the bacterial origin of replication is not included in the second portion.

81. 79. The isolated circular non-viral DNA vector of any one of claims 45 to 78, wherein the non-viral DNA vector comprises a bacterial origin of replication or a portion of a bacterial origin of replication, but the bacterial origin of replication or the portion of the bacterial origin of replication is not included in Y.

82. 82. The isolated circular non-viral DNA vector of any one of claims 45 to 81, wherein the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, AlAT, anti-CD19-anti-CD3, and ABCB11.

83. 82. The isolated circular non-viral DNA vector of any one of claims 45 to 81, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

84. An isolated circular non-viral DNA vector comprising the following elements operably linked in a 5' to 3' direction: (i) a first repeat sequence, (ii) a non-repeated nucleotide sequence having at least three nucleotides, (iii) a second repeat sequence, and (iv) an expression cassette.

85. 85. The isolated circular non-viral DNA vector of claim 84, wherein the non-viral DNA vector comprises less than about 150 CpGs per vector.

86. 85. The isolated circular non-viral DNA vector of claim 84, wherein the non-viral DNA vector comprises less than about 50 CpGs per vector.

87. 85. The isolated circular non-viral DNA vector of Claim 84, wherein the expression cassette comprises one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter.

88. 88. The isolated circular non-viral DNA vector of any one of claims 84 to 87, wherein the unique nucleotide sequence comprises at least 5 nucleotides.

89. 88. The isolated circular non-viral DNA vector of any one of claims 84 to 87, wherein the non-repetitive nucleotide sequence comprises at least 10 nucleotides.

90. 88. The isolated circular non-viral DNA vector of any one of claims 84 to 87, wherein the non-repetitive nucleotide sequence comprises at least 15 nucleotides.

91. 88. The isolated circular non-viral DNA vector of any one of claims 84 to 87, wherein the non-repetitive nucleotide sequence comprises at least 20 nucleotides.

92. 92. The isolated circular non-viral DNA vector of any one of claims 84 to 91, wherein the unique nucleotide sequence having at least 3 nucleotides encodes at least a portion of a bacterial origin of replication.

93. 92. The isolated circular non-viral DNA vector of any one of claims 84 to 91, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a heterologous gene or a portion of a heterologous gene.

94. 92. The isolated circular non-viral DNA vector of any one of claims 84 to 91, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial suppressor tRNA.

95. 92. The isolated circular non-viral DNA vector of any one of claims 84 to 91, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial RNAi repressor.

96. 92. The isolated circular non-viral DNA vector of any one of claims 84 to 91, wherein the unique nucleotide sequence having at least 3 nucleotides encodes an antisense RNA.

97. 92. The isolated circular non-viral DNA vector of any one of claims 84 to 91, wherein the unique nucleotide sequence having at least 3 nucleotides encodes a bacterial operator sequence.

98. 98. The isolated circular non-viral DNA vector of claim 97, wherein the bacterial operator sequence comprises a lac operator.

99. 98. The isolated circular non-viral DNA vector of claim 97, wherein the bacterial operator sequence comprises a tet operator.

100. The isolated circular non-viral DNA vector of any one of claims 84 to 99, wherein the non-viral DNA vector lacks a drug resistance gene.

101. 101. The isolated circular non-viral DNA vector of any one of claims 84 to 100, wherein the non-viral DNA vector comprises one or more recombination sites.

102. 102. The isolated circular non-viral DNA vector of claim 101, wherein the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB and attP sites, their product sites attL or attR, or alternative recombination target sites derived from these sites.

103. The isolated circular non-viral DNA vector of any one of claims 84 to 102, wherein the non-viral DNA vector is non-immunogenic.

104. The isolated circular non-viral DNA vector of any one of claims 84 to 103, wherein the non-viral DNA vector is substantially double-stranded.

105. The isolated circular non-viral DNA vector of any one of claims 84 to 104, wherein the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, anti-CD19-anti-CD, and ABCB11.

106. 105. The isolated circular non-viral DNA vector of any one of claims 84 to 104, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

107. (a) a first portion comprising an expression cassette comprising one or more nucleic acid sequences encoding one or more therapeutic proteins, wherein each of the one or more nucleic acid sequences encoding the one or more therapeutic proteins is operably linked to a promoter; (b) a second portion capable of forming at least one cruciform structure, the second portion comprising at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by at least a portion of a bacterial origin of replication; An isolated circular non-viral DNA vector comprising:

108. 108. The isolated circular non-viral DNA vector of claim 107, wherein the non-viral DNA vector comprises less than about 150 CpGs per vector.

109. 108. The isolated circular non-viral DNA vector of claim 107, wherein the non-viral DNA vector comprises less than about 50 CpGs per vector.

110. The isolated circular non-viral DNA vector of any one of claims 107 to 109, wherein the non-viral DNA vector lacks a drug resistance gene.

111. The isolated circular non-viral DNA vector of any one of claims 107 to 110, wherein the non-viral DNA vector comprises one or more recombination sites.

112. 112. The isolated circular non-viral DNA vector of claim 111, wherein the one or more recombination sites are selected from the group consisting of LoxP sites, FRT sites, attB and attP sites, their product sites attL or attR, or alternative recombination target sites derived from these sites.

113. The isolated circular non-viral DNA vector of any one of claims 107 to 112, wherein the non-viral DNA vector is non-immunogenic.

114. The isolated circular non-viral DNA vector of any one of claims 107 to 113, wherein the one or more therapeutic proteins are selected from the group consisting of ALPL, PCSK9, PCSK7, SerpinA1, ABCB4, ATP7B, anti-CD19-anti-CD, and ABCB11.

115. 114. The isolated circular non-viral DNA vector of any one of claims 107 to 113, wherein the one or more therapeutic proteins is alkaline phosphatase or a variant thereof.

116. The isolated circular non-viral DNA vector of any one of claims 107 to 115, wherein the non-viral DNA vector further comprises an S / MAR element.

117. The isolated circular non-viral DNA vector of any one of claims 107 to 116, wherein the non-viral DNA vector further comprises an insulator element.

118. The isolated circular non-viral DNA vector of any one of claims 107 to 117, wherein the expression cassette further comprises a polyadenylation site downstream of the one or more nucleic acid sequences encoding the one or more therapeutic proteins.

119. (a) Formula (IA) to Formula (IE): [A] ｖ -[B]-[C] ｗ -[R] ｑ -([D] ｘ -[E] ｙ ) ｚ (IA)、 [A]-[B]-[C]-[R] ｑ -([D] ｘ -[E] ｙ ) (IB)、 ([A]-[B])-([D] ｘ -[E] ｙ ) ｚ (IC)、 ([A]-[]])-([E] ｙ ) (ID), [A][[]][[] ｑ -([E] ｙ ) (I)、 (In the formula, A comprises an amino acid sequence encoding a secretory signal peptide, B contains amino acids encoding alkaline phosphatase, C comprises an amino acid sequence encoding a GPI anchor, R is -(M ｏ (Fc)N ｐ )-, wherein M and N each independently contain between 1 and 6 amino acids, Fc is an Fc domain, and o and p are each independently 0, 1, or 2; D comprises an amino acid sequence having between 4 and 6 amino acids, or F(G) ｔ F, where each F is the same amino acid, G is an amino acid sequence having 3, 4, or 5 amino acids, and t is an integer ranging from 2 to 5; E comprises an amino acid sequence having between 1 and 8 amino acids, q is 0 or 1; v is 0 or 1; w is 0 or 1; x is 0 or an integer ranging from 1 to 6; y is 0 or an integer ranging from 1 to 16, and z is 0 or an integer ranging from 1 to 6. a first part comprising an expression cassette comprising a nucleic acid sequence encoding a polypeptide having any one of: (b) a second portion capable of forming at least one cruciform structure, the second portion comprising at least two inverted repeat sequences, the at least two inverted repeat sequences being separated by a non-repetitive nucleotide sequence having at least three nucleotides; An isolated circular non-viral DNA vector comprising:

120. When v is 1, w is 0, q is 1, o is 1, p is 1, N is diamino acid-DI-, M is diamino acid-L-K-, [B] comprises SEQ ID NO: 11, Fc comprises SEQ ID NO: 130, and x is 0, then [E] ｙ The isolated circular non-viral DNA vector of claim 119, provided that does not contain 10 to 16 consecutive aspartic acid residues.

121. 120. The isolated circular non-viral DNA vector of claim 119, wherein E comprises three amino acids.

122. 120. The isolated circular non-viral DNA vector of claim 119, wherein E is -D-S-S-.

123. 120. The isolated circular non-viral DNA vector of claim 119, wherein E is -D-S-S- and y ranges from 1 to 16.

124. 120. The isolated circular non-viral DNA vector of claim 119, wherein E is -D-S-S-, y is 6, z is 1, q is 0, and x is 0, and in other embodiments E is -D-S-S-, y is 6, z is 1, q is 0, and x is 2.

125. 120. The isolated circular non-viral DNA vector of claim 119, wherein E is -D-S-S-, y is 6, z is 1, x is 2, and q is 1.

126. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 80% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

127. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 85% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

128. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 90% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

129. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 92% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

130. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 94% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

131. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 95% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

132. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 96% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

133. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 97% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

134. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 98% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

135. An isolated circular non-viral DNA vector having a nucleic acid sequence having at least 99% identity to any one of SEQ ID NOs:28 to 30, SEQ ID NO:38, SEQ ID NOs:40 to 48, and SEQ ID NOs:72 to 73.

136. An isolated circular non-viral DNA vector having a nucleic acid sequence having any one of SEQ ID NOs:28 to 30, 38, 40 to 48, and 72 to 73.

137. A pharmaceutical composition comprising any one of the isolated circular non-viral DNA vectors of any one of claims 1 to 136 and a pharmaceutically acceptable carrier or excipient.

138. 138. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated with a lipid-based delivery vehicle.

139. 138. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated as a lipid nanoparticle.

140. 138. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated as a lipid nanoparticle.

141. 138. The pharmaceutical composition of claim 137, wherein the pharmaceutical composition is formulated with one or more polymers.

142. 142. A method of treating a patient in need thereof, comprising administering to said patient a pharmaceutical composition according to any one of claims 137 to 141.

143. 143. The method of claim 142, wherein the pharmaceutical composition is administered weekly.

144. 143. The method of claim 142, wherein the pharmaceutical composition is administered monthly.

145. 143. The method of claim 142, wherein the pharmaceutical composition is administered every two months.

146. 143. The method of claim 142, wherein the pharmaceutical composition is administered every six months.

147. 143. The method of claim 142, wherein the pharmaceutical composition is administered annually.

148. 126. A method of treating hypophosphatasia, comprising administering to a patient in need thereof a therapeutically effective amount of the isolated circular, non-viral DNA vector of any one of claims 119 to 125 or a pharmaceutical composition comprising the isolated circular, non-viral DNA vector of any one of claims 119 to 125.

149. 126. A method of treating, alleviating, or preventing a symptom of hypophosphatasia, comprising administering to a patient in need thereof a therapeutically effective amount of the isolated circular, non-viral DNA vector of any one of claims 119 to 125 or a pharmaceutical composition comprising the isolated circular, non-viral DNA vector of any one of claims 119 to 125.

150. 126. Use of the isolated circular non-viral DNA vector of any one of claims 119 to 125 in the treatment of hypophosphatasia.

Images