Methods for manufacturing genome-edited plants
By incorporating histone acetyltransferase and site-specific nuclease expression cassettes, the method enhances genome editing efficiency in plants, addressing the challenge of low efficiency in introducing mutations into multiple target genes.
Patent Information
- Application Number
- JP2024171148
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-09-30
- Publication Date
- 2026-04-09
AI Technical Summary
Existing genome editing technologies in plants suffer from low efficiency, particularly when attempting to introduce mutations into multiple target genes simultaneously, limiting the effectiveness of genetic modifications.
Introduce a histone acetyltransferase expression cassette and a site-specific nuclease expression cassette into plants, utilizing histone acetyltransferases such as AtHAC1, AtHAC12, AtHAF2, or AtHAM2 to enhance genome editing efficiency by modifying target amino acid residues in histones.
The method significantly improves genome editing efficiency, allowing for higher success rates in introducing mutations into target genes, particularly when multiple genes are involved.
Smart Images

Figure 2026061863000001 
Figure 2026061863000002
Abstract
Description
Technical Field
[0001] The present invention relates to a method for producing a genome-edited plant and the like.
Background Art
[0002] In plants, conventionally, improvements and modifications have been made by traditional breeding, molecular breeding, genetic recombination, etc. Thereby, for example, it is possible to improve and modify plant traits such as yield, environmental adaptability, disease resistance, insect resistance, growth rate, etc.
[0003] In recent years, genome editing technology using site-specific nucleases has attracted attention as a new plant breeding technology. As one such technology, the CRISPR / Cas system is known. Typically, by introducing a Cas protein and a guide RNA, target genes can be mutated in various animals and plants.
[0004] In genome editing technology, improvement of its efficiency is desired. In particular, when trying to mutate multiple genes simultaneously, if the efficiency is low, it is impossible to introduce mutations into all target genes simultaneously.
[0005] Specificities of acetylation sites have been reported for various histone acetyltransferases in Arabidopsis thaliana (Non-Patent Documents 1 to 3). However, the effects of histone acetyltransferases on genome editing have not been investigated.
Prior Art Documents
Non-Patent Documents
[0006]
Non-Patent Document 1
Non-Patent Document 2
[0007] Addressing the challenges of low genome editing efficiency and low efficiency in producing plants with mutations introduced into target genes, this research aims to provide plant genome editing technology with higher genome editing efficiency. [Means for solving the problem]
[0008] In view of the above problems, the inventors conducted diligent research and found that a method for producing genome-edited plants, which includes introducing a histone acetyltransferase expression cassette and a site-specific nuclease expression cassette into plants, can solve the above problems. Based on this finding, the inventors furthered their research and completed the present invention. That is, the present invention encompasses the following aspects.
[0009] Item 1. A method for producing genome-edited plants, comprising introducing a histone acetyltransferase expression cassette and a site-specific nuclease expression cassette into a plant.
[0010] Item 2. The method for producing the product according to Item 1, wherein the histone acetyltransferase is an enzyme that acetylates at least one target amino acid residue selected from the group consisting of H3K9, H3K14, H4K5, H4K8, H4K12, and H4K16.
[0011] Item 3. The manufacturing method according to Item 2, wherein the target amino acid residues are at least two.
[0012] Item 4. The method for producing a product according to any one of items 1 to 3, wherein the histone acetyltransferase is AtHAC1, AtHAC12, AtHAF2, AtHAM2, AtGCN5, AtHAG2, AtHAM1, or AtHAC5, or an ortholog thereof.
[0013] Item 5. The method for producing a protein according to Item 4, wherein the histone acetyltransferase is a protein having histone acetylation activity, comprising an amino acid sequence having 40% or more identity with the amino acid sequence shown in any of SEQ ID NOs: 1 to 8.
[0014] Item 6. The manufacturing method described in Item 5, wherein the identity is 90% or more.
[0015] Item 7. The method for producing a method according to any one of items 4 to 6, wherein the histone acetyltransferase is AtHAC1 or an ortholog thereof.
[0016] Item 8. The method for producing a product according to any one of items 1 to 7, wherein the site-specific nuclease is a nuclease that forms a complex with guide RNA.
[0017] Item 9. A composition for use in the manufacturing method described in any one of Items 1 to 8, comprising a site-specific nuclease expression cassette and / or a histone acetyltransferase expression cassette.
[0018] Item 10. A plant genome editing kit comprising a site-specific nuclease expression cassette and a histone acetyltransferase expression cassette. [Effects of the Invention]
[0019] According to the present invention, it is possible to provide a plant genome editing technology with higher genome editing efficiency. [Brief explanation of the drawing]
[0020] [Figure 1]The results of Test Example 1 are shown. The vertical axis represents the relative value of the genome editing efficiency, the horizontal axis represents the HAT encoded by the HAT expression vector, and "HAT(-)" represents the case where an empty vector is introduced instead of the HAT expression vector. The p-value in the graph is the p-value by the student's t-test. [Figure 2] The results of Test Example 2 are shown. The vertical axis represents the relative value of the genome editing efficiency, the horizontal axis represents the HAT encoded by the HAT expression vector, and "HAT(-)" represents the case where an empty vector is introduced instead of the HAT expression vector. ** indicates that the p-value by the Dunnett test is less than 0.01, and *** indicates that the p-value by the same test is less than 0.001.
Mode for Carrying Out the Invention
[0021] [[ID=IO]] In this specification, the expressions "containing" and "comprising" include the concepts of "containing", "comprising", "substantially consisting of", and "consisting only of".
[0022] In one aspect, the present invention relates to a method for producing a genome-edited plant (which may also be referred to as "the production method of the present invention" in this specification), which includes introducing a histone acetyltransferase expression cassette and a site-specific nuclease expression cassette into a plant. This will be described below.
[0023] The histone acetyltransferase expression cassette is not particularly limited as long as it includes a nucleotide sequence necessary for expressing histone acetyltransferase, specifically, for producing a histone acetyltransferase protein.
[0024] It should be noted that there is a misspelling in "[[ID=IO]]", which should be "". This has been translated as is according to the requirements.Histone acetyltransferases are enzymes that have acetylation activity against endogenous histones in plant cells, and are not particularly limited in that respect. The target amino acid residue of a histone acetyltransferase (the amino acid residue that the enzyme acetylates) may be an amino acid residue in histone H3 or an amino acid residue in histone H4. Various target amino acid residues are known, such as H3K9, H3K14, H4K5, H4K8, H4K12, and H4K16. In these notations, H3 and H4 refer to histone H3 and histone H4, K refers to a lysine residue, and the number following K indicates the amino acid position from the N-terminus of that lysine residue. For example, H3K9 means the lysine residue that is the 9th amino acid residue from the N-terminus of histone H3. The target amino acid residue of a histone acetyltransferase can be a single type or a combination of two or more types. In a preferred embodiment of the present invention, from the viewpoint of genome editing efficiency, and particularly from the viewpoint of genome editing efficiency in plants, it is preferable that the target amino acid residues be at least two, at least three, or at least four.
[0025] Various plant-derived histone acetyltransferases can be used as histone acetyltransferases. Examples of histone acetyltransferases include AtHAC1 (wild-type amino acid sequence is SEQ ID NO: 1), AtHAC12 (wild-type amino acid sequence is SEQ ID NO: 2), AtHAF2 (wild-type amino acid sequence is SEQ ID NO: 3), AtHAM2 (wild-type amino acid sequence is SEQ ID NO: 4), AtGCN5 (wild-type amino acid sequence is SEQ ID NO: 5), AtHAG2 (wild-type amino acid sequence is SEQ ID NO: 6), AtHAM1 (wild-type amino acid sequence is SEQ ID NO: 7), or AtHAC5 (wild-type amino acid sequence is SEQ ID NO: 8), or orthologues of any of these. Among these, from the viewpoint of genome editing efficiency, especially genome editing efficiency in plants, AtHAC1, AtHAC12, AtHAF2, or AtHAM2, or orthologues of any of these are preferred, and AtHAC1 or its orthologue is particularly preferred.
[0026] There are no particular restrictions on orthologs, but examples include soybeans (Glycine max), tomatoes (Solanum lycopersicum), corn (Zea mays), and rice (Oryza sativa).
[0027] In soybeans, the wild-type amino acid sequence of the AtHAC1 ortholog is SEQ ID NO: 13, the wild-type amino acid sequence of the AtHAC12 ortholog is SEQ ID NO: 14, the wild-type amino acid sequence of the AtHAF2 ortholog is SEQ ID NO: 15, the wild-type amino acid sequence of the AtHAM2 ortholog is SEQ ID NO: 16, the wild-type amino acid sequence of the AtGCN5 ortholog is SEQ ID NO: 17, the wild-type amino acid sequence of the AtHAG2 ortholog is SEQ ID NO: 18, the wild-type amino acid sequence of the AtHAM1 ortholog is SEQ ID NO: 19, and the wild-type amino acid sequence of the AtHAC5 ortholog is SEQ ID NO: 20.
[0028] In tomatoes, the wild-type amino acid sequence of the AtHAC1 ortholog is SEQ ID NO: 21, the wild-type amino acid sequence of the AtHAC12 ortholog is SEQ ID NO: 22, the wild-type amino acid sequence of the AtHAF2 ortholog is SEQ ID NO: 23, the wild-type amino acid sequence of the AtHAM2 ortholog is SEQ ID NO: 24, the wild-type amino acid sequence of the AtGCN5 ortholog is SEQ ID NO: 25, the wild-type amino acid sequence of the AtHAG2 ortholog is SEQ ID NO: 26, the wild-type amino acid sequence of the AtHAM1 ortholog is SEQ ID NO: 27, and the wild-type amino acid sequence of the AtHAC5 ortholog is SEQ ID NO: 28.
[0029] In maize, the wild-type amino acid sequence of the AtHAC1 ortholog is SEQ ID NO: 29, the wild-type amino acid sequence of the AtHAC12 ortholog is SEQ ID NO: 30, the wild-type amino acid sequence of the AtHAF2 ortholog is SEQ ID NO: 31, the wild-type amino acid sequence of the AtHAM2 ortholog is SEQ ID NO: 32, the wild-type amino acid sequence of the AtGCN5 ortholog is SEQ ID NO: 33, the wild-type amino acid sequence of the AtHAG2 ortholog is SEQ ID NO: 34, the wild-type amino acid sequence of the AtHAM1 ortholog is SEQ ID NO: 35, and the wild-type amino acid sequence of the AtHAC5 ortholog is SEQ ID NO: 36.
[0030] In rice, the wild-type amino acid sequence of the AtHAC1 ortholog is SEQ ID NO: 37, the wild-type amino acid sequence of the AtHAC12 ortholog is SEQ ID NO: 38, the wild-type amino acid sequence of the AtHAF2 ortholog is SEQ ID NO: 39, the wild-type amino acid sequence of the AtHAM2 ortholog is SEQ ID NO: 40, the wild-type amino acid sequence of the AtGCN5 ortholog is SEQ ID NO: 41, the wild-type amino acid sequence of the AtHAG2 ortholog is SEQ ID NO: 42, the wild-type amino acid sequence of the AtHAM1 ortholog is SEQ ID NO: 43, and the wild-type amino acid sequence of the AtHAC5 ortholog is SEQ ID NO: 44.
[0031] Histone acetyltransferases may have mutations, as long as they possess histone acetylation activity. Examples of mutations include substitutions, deletions, and insertions, with substitutions being preferred, and conservative substitutions being particularly preferred.
[0032] In this specification, "conservative substitution" means that an amino acid residue is substituted for an amino acid residue having a similar side chain. For example, substitutions between amino acid residues having basic side chains, such as lysine, arginine, and histidine, are considered conservative substitutions. Other examples of conservative substitutions include: amino acid residues with acidic side chains, such as aspartic acid and glutamic acid; amino acid residues with non-charged polar side chains, such as asparagine, glutamine, serine, threonine, tyrosine, and cysteine; amino acid residues with non-polar side chains, such as glycine, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan; amino acid residues with branched chains, such as valine, isoleucine, and leucine; and amino acid residues with aromatic side chains, such as tyrosine, phenylalanine, and tryptophan.
[0033] Preferred specific examples of histone acetyltransferases include: A protein comprising an amino acid sequence having 40% or more (preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, even more preferably 80% or more, particularly preferably 90% or more, particularly more preferably 95% or more, especially preferably 99% or more, and 100% or less) identity with the amino acid sequence represented by any of SEQ ID NOs: 1 to 8, and having histone acetylation activity. A protein comprising an amino acid sequence having 40% or more (preferably 50% or more, more preferably 60% or more, even more preferably 70% or more, even more preferably 80% or more, particularly preferably 90% or more, particularly more preferably 95% or more, especially preferably 99% or more, and 100% or less) identity with the amino acid sequence represented by any of SEQ ID NOs: 1 to 44, and having histone acetylation activity. These are some examples.
[0034] In this specification, "identity" of amino acid sequences refers to the degree of agreement between two or more comparable amino acid sequences. Therefore, the higher the agreement between two amino acid sequences, the higher their identity or similarity. The level of amino acid sequence identity can be determined, for example, using the sequence analysis tool FASTA and its default parameters. Alternatively, it can be determined using the BLAST algorithm by Karlin and Altschul (KarlinS, Altschul SF. "Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes" Proc Natl Acad Sci USA. 87:2264-2268 (1990), KarlinS, Altschul SF. "Applications and statistics for multiple high-scoring segments in molecular sequences." Proc Natl Acad Sci USA. 90:5873-7 (1993)). Programs called blastp and tblastn have been developed based on this BLAST algorithm. The specific methods for these analyses are publicly known and can be found on the National Center of Biotechnology Information (NCBI) website (http: / / www.ncbi.nlm.nih.gov / ). Furthermore, the "identity" of the base sequence is defined in accordance with the above.
[0035] Histone acetyltransferases may have known protein tags, signal sequences, enzyme proteins, etc. attached to them, as long as they possess histone acetylation activity. Examples of protein tags include avidin tags, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, and PA tags. Examples of signal sequences include nuclear localization signals.
[0036] The histone acetylation activity and target amino acid residues of histone acetyltransferase can be measured and determined in vitro using recombinant proteins as described in Non-Patent Document 3.
[0037] The histone acetyltransferase expression cassette contains the histone acetyltransferase coding sequence.
[0038] In this specification, "coding sequence" means a nucleotide sequence that codes for the amino acid sequence of a protein, and is not particularly limited to that extent.
[0039] From the viewpoint of enabling the expression cassette to express histone acetyltransferase mRNA on its own, it is preferable that the histone acetyltransferase expression cassette includes a promoter upstream of the coding sequence (on the 5' side of the sense strand). Examples of promoters include the UBQ promoter, CaMV35S promoter, and NOS promoter. Furthermore, promoters of genes that are expressed in a tissue-specific and / or time-specific manner can also be used.
[0040] Site-specific nuclease expression cassettes are not particularly limited, as long as they contain the nucleotide sequence necessary to express a site-specific nuclease, specifically, to produce a site-specific nuclease.
[0041] Site-specific nucleases are not particularly limited as long as they are nucleases that can specifically cleave a target site on genomic DNA and produce a cleavage fragment. Examples of site-specific nucleases include Cas proteins, zinc finger nucleases (ZFNs), or TAL effector nucleases (TALENs). ZFNs are fusion proteins of several zinc finger motifs that recognize specific bases and a DNA cleavage effector domain. TALENs are fusion proteins of a Transcription Activator Like (TAL) effector and a DNA cleavage effector domain. Site-specific nucleases can also be composed of other additional targeting technologies, such as meganucleases or leucine zippers. Preferably, site-specific nucleases are nucleases that form a complex with guide RNA. Such nucleases can bind to a target site having a base sequence complementary to the base sequence of the guide RNA and cleave that target site. Cas proteins are a typical example of such nucleases.
[0042] The Cas protein is not particularly limited as long as it is used in the CRISPR / Cas system. For example, various types of Cas proteins can be used that can bind to a target site on genomic DNA while in a complex with guide RNA and cleave that target site. Cas proteins are known to originate from various organisms, such as the Cas9 protein (Type II) from S. pyogenes, the Cas protein (Type IA) from S. solfataricus, the Cas protein (Type I) from H. walsbyi, the Cas protein (Type ID) from Microcystis aeruginosa, the Cas protein (Type IE) from E. coli, the Cas protein (Type IF) from E. coli, the Cas protein (Type IF) from P. aeruginosa, the Cas9 protein (Type II) from S. thermophilus, the Cas9 protein (Type II) from S. agalactiae, the Cas9 protein from S. aureus, the Cas9 protein from N. meningitidis, the Cas9 protein from T. denticola, the Cas9 protein from Abyssicoccus albus, the Cpf1 protein (Type VA) from F. novicida, and Eubacterium. Examples include the MAD7 protein (VA type) derived from rectale. Among these, Cas9 protein is preferred, and Cas9 protein endogenously present in bacteria belonging to the genus Streptococcus is preferred. Information on the amino acid sequences and coding sequences of various Cas proteins can be easily obtained from various databases such as NCBI.
[0043] The Cas protein may be a wild-type double-strand break Cas protein or a nickase-type Cas protein. Double-strand break Cas proteins typically contain a domain involved in target strand cleavage (HNH domain) and a domain involved in non-target strand cleavage (RuvC domain). Examples of nickase-type Cas proteins include proteins that have mutations in one of these two domains of a double-strand break Cas protein that impair its cleavage activity (for example, reducing its cleavage activity to 1 / 2, 1 / 5, 1 / 10, 1 / 100, or 1 / 1000 or less). Examples of such mutations include, for instance, if the double-strand break type Cas protein is a Cas9 protein derived from S. pyogenes, mutations such as a mutation in the 10th amino acid from the N-terminus (aspartic acid) to alanine (D10A: mutation within the RuvCI domain), a mutation in the 840th amino acid from the N-terminus (histidine) to alanine (H840A: mutation within the HNH domain), a mutation in the 863rd amino acid from the N-terminus (asparagine) to alanine (N863A: mutation within the HNH domain), a mutation in the 762nd amino acid from the N-terminus (glutamic acid) to alanine (E762A: mutation within the RuvCII domain), and a mutation in the 986th amino acid from the N-terminus (aspartic acid) to alanine (D986A: mutation within the RuvCIII domain).
[0044] Cas proteins may have amino acid sequence mutations (e.g., substitutions, deletions, insertions, additions, etc.) as long as their activity is not impaired. From this viewpoint, Cas proteins may consist of an amino acid sequence that has, for example, 85% or more, preferably 90% or more, more preferably 95% or more, and even more preferably 98% or more identity with the amino acid sequence of a wild-type double-strand break Cas protein or a nickase-type Cas protein based on the wild-type double-strand break Cas protein, and may also be proteins that have activity (activity to bind to a target site on genomic DNA in a complex with guide RNA and cleave the target site). Alternatively, from a similar viewpoint, the Cas protein may consist of an amino acid sequence in which one or more amino acids (e.g., 2 to 100, preferably 2 to 50, more preferably 2 to 20, even more preferably 2 to 10, even more preferably 2 to 5, particularly preferably 2) are substituted, deleted, added, or inserted (preferably conservative substitutions) from the amino acid sequence of a wild-type double-strand break Cas protein or a nickase-type Cas protein based on the wild-type double-strand break Cas protein, and is a protein having activity (activity to bind to a target site of genomic DNA in a complex with guide RNA and cleave the target site). The above "activity" can be evaluated in vitro or in vivo according to or in accordance with known methods.
[0045] Site-directed nucleases may have known protein tags, signal sequences, enzyme proteins, or other proteins attached to them, as long as they possess the "activity" described above. Examples of protein tags include avidin tags, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, and PA tags. Examples of signal sequences include nuclear localization signals. Examples of enzyme proteins include various histone modifying enzymes and deaminonases.
[0046] Site-specific nuclease expression cassettes contain site-specific nuclease coding sequences.
[0047] From the viewpoint of enabling the expression cassette to express site-specific nuclease mRNA on its own, it is preferable that the site-specific nuclease expression cassette contains a promoter upstream of the coding sequence (on the 5' side of the sense strand). The promoter is similar to the promoter that a histone acetyltransferase expression cassette may have.
[0048] If the site-specific nuclease is a nuclease that forms a complex with guide RNA, it is preferable to further introduce a guide RNA expression cassette in the production method of the present invention. The site-specific nuclease expression cassette and the guide RNA expression cassette may be located within the same molecule (polynucleotide) or within separate molecules, but the former allows for more efficient expression of the site-specific nuclease and guide RNA within the same cell, thereby further increasing the efficiency of genome editing.
[0049] The guide RNA expression cassette contains the guide RNA coding sequence.
[0050] The guide RNA coding sequence is not particularly limited as long as it is a nucleotide sequence that codes for guide RNA.
[0051] The guide RNA is not particularly limited as long as it is used in the CRISPR / Cas system, and various types can be used, for example, those that can bind to a target site on genomic DNA and also bind to the Cas protein, thereby guiding the Cas protein to the target site on genomic DNA.
[0052] In this specification, the target site is a region on genomic DNA consisting of a DNA strand (non-target strand) consisting of a PAM (Protospacer Adjacent Motif) sequence and a sequence of about 17 to 30 base pairs (preferably 18 to 25 base pairs, more preferably 19 to 22 base pairs, and particularly preferably 20 base pairs) adjacent to its 5' or 3' side, and its complementary DNA strand (target strand).
[0053] The PAM sequence varies depending on the type of Cas protein used. For example, the PAM sequence corresponding to the Cas9 protein (Type II) from S. pyogenes is 5'-NGG, the PAM sequence corresponding to the Cas protein (Type IA) from S. solfataricus is 5'-CCN / 5'-TCN, the PAM sequence corresponding to the Cas protein (Type IB) from H. walsbyi is 5'-TTC, the PAM sequence corresponding to the Cas protein (Type IE) from E. coli is 5'-ARG, the PAM sequence corresponding to the Cas protein (Type IF) from E. coli is 5'-CC, the PAM sequence corresponding to the Cas protein (Type IF) from P. aeruginosa is 5'-CC, the PAM sequence corresponding to the Cas9 protein (Type II) from S. thermophilus is 5'-NNAGAA, the PAM sequence corresponding to the Cas9 protein (Type II) from S. agalactiae is 5'-NGG, the PAM sequence corresponding to the Cas9 protein (Type II) from S. aureus is 5'-NNGRRT, and N. The PAM sequence corresponding to the Cas9 protein from meningitidis is 5'-NNNNGATT, the PAM sequence corresponding to the Cas9 protein from T. denticola is 5'-NAAAAC, the PAM sequence corresponding to the Cas9 protein from A. albus is 5'-NNACG, the PAM sequence corresponding to the Cpf1 protein (VA type) from F. novicida is 5'-TTTV, and the PAM sequence corresponding to the MAD7 protein (VA type) from Eubacterium rectale is 5'-TTTV. In the above PAM sequences, N represents any base, R represents A or G, and V represents A, G, or C.
[0054] Guide RNA has a sequence (sometimes called a crRNA (CRISPR RNA) sequence) that is involved in binding to a target site on genomic DNA. This crRNA sequence binds complementaryly (preferably complementary and specific) to a sequence of the target strand excluding the complementary sequence of the PAM sequence, thereby enabling the guide RNA to bind to the target site on genomic DNA.
[0055] Furthermore, "complementary" binding includes not only binding based on perfect complementarity (A and T, and G and C), but also binding based on a degree of complementarity that allows for hybridization under stringent conditions. Stringent conditions can be determined based on the melting temperature (Tm) of the nucleic acid to which the complex or probe is bound, as taught in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques Methods in Enzymology, Vol. 152, Academic Press, San Diego CA). For example, typical washing conditions after hybridization include conditions of approximately "1×SSC, 0.1%SDS, 37°C". It is preferable that the hybridized state is maintained even after washing under such conditions. While not particularly limited, more stringent hybridization conditions include washing conditions of approximately "0.5×SSC, 0.1%SDS, 42°C", and even more stringent hybridization conditions include washing conditions of approximately "0.1×SSC, 0.1%SDS, 65°C".
[0056] Specifically, the crRNA sequence that binds to the target sequence has, for example, 90% or more, preferably 95% or more, more preferably 98% or more, even more preferably 99% or more, and especially preferably 100% identity with the non-target strand.
[0057] Regarding guide RNA, if it contains a sequence involved in binding to the Cas protein (sometimes called a tracrRNA (trans-activating crRNA) sequence), this tracrRNA sequence can bind to the Cas protein, thereby guiding the Cas protein to its target site in the genomic DNA.
[0058] The tracrRNA sequence is not particularly restricted. Typically, a tracrRNA sequence is an RNA sequence of about 50-100 nucleotides in length that can form multiple (usually three) stem-loops, and its sequence varies depending on the type of Cas protein used. Various known sequences can be used as tracrRNA sequences, depending on the type of Cas protein used.
[0059] Guide RNA typically contains the crRNA sequence and tracr RNA sequence described above. The guide RNA may be a single-stranded RNA (sgRNA) containing both the crRNA and tracr RNA sequences, or it may be an RNA complex formed by the complementary binding of RNA containing the crRNA sequence and RNA containing the tracr RNA sequence.
[0060] The histone acetyltransferase expression cassette and the site-specific nuclease expression cassette may be located within the same molecule (polynucleotide) or within separate molecules.
[0061] Polynucleotides containing expression cassettes may contain other base sequences besides those mentioned above. Other base sequences include, for example, drug resistance genes, reporter protein coding sequences, their expression cassettes; protein tag coding sequences; signal coding sequences; origins of replication; and elemental sequences of binary vectors used in Agrobacterium assays (e.g., left boundary region, right boundary region, etc.).
[0062] Examples of drug resistance genes include chloramphenicol resistance genes, tetracycline resistance genes, neomycin resistance genes, erythromycin resistance genes, spectinomycin resistance genes, kanamycin resistance genes, hygromycin resistance genes, and puromycin resistance genes.
[0063] Reporter proteins are not particularly limited and include, for example, luminescent proteins that emit light (produce color) in reaction with a specific substrate, or fluorescent proteins that emit fluorescence when excited by light. Examples of luminescent proteins include luciferase, β-galactosidase, chloramphenicol acetyltransferase, and β-glucuronidase, while examples of fluorescent proteins include GFP, Azami-Green, ZsGreen, GFP2, HyPer, Sirius, BFP, CFP, Turquoise, Cyan, TFP1, YFP, Venus, ZsYellow, Banana, KusabiraOrange, RFP, DsRed, AsRed, Strawberry, Jred, KillerRed, Cherry, HcRed, and mPlum. Furthermore, reporter proteins also include fusion proteins of luminescent (chromogenic) proteins or fluorescent proteins with other proteins (e.g., seed-specific proteins), as well as proteins to which known protein tags, known signal sequences, etc., have been added to luminescent (chromogenic) proteins or fluorescent proteins.
[0064] Examples of protein tags include avidin tags, His tags, FLAG tags, Halo tags, MBP tags, HA tags, Myc tags, V5 tags, and PA tags.
[0065] The polynucleotide containing the expression cassette may be single-stranded or double-stranded. It may also be linear or circular. Furthermore, the polynucleotide containing the expression cassette includes not only DNA and RNA, but also those that have undergone known chemical modifications, as exemplified below. To prevent degradation by hydrolytic enzymes such as nucleases, the phosphate residue of each nucleotide may be replaced with a chemically modified phosphate residue such as phosphorothioate (PS), methylphosphonate, or phosphorodithionate. In addition, the hydroxyl group at position 2 of the sugar (ribose) of each ribonucleotide may be replaced with -OR (where R represents, for example, CH3(2'-O-Me), CH2CH2OCH3(2'-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.). Furthermore, the base portion (pyrimidine, purine) may be chemically modified, for example, by introducing a methyl group or cationic functional group at the 5th position of the pyrimidine base, or by substituting the carbonyl group at the 2nd position with a thiocarbonyl group. In addition, the phosphate portion or hydroxyl portion may be modified with, for example, biotin, an amino group, a lower alkylamine group, or an acetyl group, but is not limited to these. Also, the term "polynucleotide" includes not only natural nucleic acids but also BNA (Bridged Nucleic Acid), LNA (Locked Nucleic Acid), PNA (Peptide Nucleic Acid), etc.
[0066] In one embodiment, the polynucleotide containing the expression cassette is a single-stranded polynucleotide (e.g., mRNA). In another embodiment, the polynucleotide containing the expression cassette is a double-stranded polynucleotide (e.g., a vector such as a binary vector).
[0067] A polynucleotide containing an expression cassette may constitute a vector. The type of vector is not particularly limited and includes, for example, plasmid vectors; Agrobacterium binary vectors; plant virus vectors, etc. In addition to vectors suitable for introduction into plants or plant cells, as described above, a vector for transferring a polynucleotide containing an expression cassette into such a vector (for example, an entry clone vector for a gateway®) can also be given as an example. In one embodiment, the present invention relates to a vector (preferably a plant genome editing vector) comprising a polynucleotide containing an expression cassette.
[0068] Polynucleotides containing expression cassettes can be easily prepared according to known genetic engineering techniques. For example, they can be prepared using PCR, restriction enzyme digestion, DNA ligation, in vitro transcription, etc. Alternatively, they can be easily prepared by incorporating the necessary sequences (e.g., histone acetyltransferase coding sequences, site-specific nuclease coding sequences, etc.) into various commercially available plant virus vectors (binary vectors, etc.).
[0069] In this specification, the term "plant" is not particularly limited. Examples of plants include a wide range of plants, such as mosses, ferns, gymnosperms, magnolias of the angiosperms, monocots, and eudicots (roses I, roses II, chrysanthemums I, chrysanthemums II and their outgroups). More specific examples of plants include: tomatoes, bell peppers, chili peppers, eggplants, tobacco, torbams and other eggplant species; cucumbers, pumpkins, melons, watermelons and other gourd species; cabbage, broccoli, Chinese cabbage and other leafy greens; celery, parsley, lettuce and other raw and spicy vegetables; onions, leeks, garlic and other allium species; strawberries, melons and other fruit vegetables; taproots such as radishes, turnips, carrots, and burdock; tubers such as taro, cassava, potatoes, sweet potatoes, and yams; grains such as rice, corn, wheat, sorghum, barley, rye, buckwheat and other grains; and legumes such as soybeans, adzuki beans, mung beans, cowpeas, green beans, peanuts, peas, and broad beans. Examples include: tender vegetables such as asparagus, spinach, and Japanese parsley; flowers such as lisianthus, stock, carnation, and chrysanthemum; grasses such as bentgrass and Korean lawn grass; oil crops such as rapeseed, peanut, rapeseed, tung tree, sesame, and perilla; fiber crops such as cotton and rush; fodder crops such as clover, dent corn, and alfalfa; deciduous fruit trees such as apples, pears, grapes, and peaches; citrus fruits such as Satsuma mandarins, oranges, lemons, and grapefruits; and woody plants such as azaleas, rhododendrons, cedars, poplars, and rubber trees.
[0070] A plant can be a whole plant or a plant cell. Examples of introduction sites in a plant include the stem apex, flowers (especially egg cells, pollen, etc., within the flower), leaves, and roots.
[0071] There are no particular restrictions on the method of introduction, and it can be appropriately selected depending on the type of object to be introduced and the target of introduction. Examples of introduction methods include Agrobacterium methods such as the floral dip method and the floral spray method; particle gun method; and virus-mediated nucleic acid delivery.
[0072] A more specific example of the implementation method is shown below.
[0073] One example of an introduction method (Introduction Example 1) is a method that includes the step of preparing a plasmid containing a promoter (e.g., T7 promoter, T3 promoter, 35S promoter, etc.) and a sequence of polynucleotides containing an expression cassette downstream thereof (step a1). If the plasmid obtained in step a1 is a Ti plasmid containing a promoter that has transcriptional activation ability in plant cells, such as the 35S promoter, then the method can be carried out by introducing the plasmid obtained in step a1 into Agrobacterium and culturing it (step b1), and inoculating the culture solution obtained in step b1 into plants (e.g., infiltration method, toothpick inoculation method, aspiration injection method, etc.) (step c1). Alternatively, instead of steps b1 and c1, the method can be carried out by including a step of inoculating the plasmid obtained in step a1 into plants (e.g., grinding inoculation method, particle gun method, etc.) (step c2). Alternatively, instead of step c1, the method can be carried out by including a step of performing a method such as the leaf disc method, inflorescence infiltration method, or reduced-pressure filtration method (step c3). These methods allow the target protein to be produced from plasmids or T-DNA introduced into the plant.
[0074] When nucleic acids are introduced into cells, their expression begins after translocation to the nucleus, and the translated nuclease then translocates to the nucleus and cleaves the genomic DNA. Subsequently, mutations occur during the repair process, resulting in genome-edited cells. In the case of proteins, genome editing occurs when they translocate to the nucleus (organelle) via a nuclear localization signal (which may also be an organelle localization signal) and cleave the DNA. Genome editing is applicable not only to genes encoded in the nuclear genome but also to genes in organelles (intracellular organelles such as chloroplasts and mitochondria). In this case, the localization signal for each organelle may be linked to the nuclease before introduction, or a promoter that is expressed only in each organelle may be used to link to the nuclease.
[0075] After introduction, culturing the plants for a certain period of time induces the expression of site-specific nucleases within the plants, leading to genome editing. The culturing period is, for example, 1 to 30 days.
[0076] The method of cultivation is not particularly limited. For example, if the plant is a plant body or a part thereof growing in a growing environment, it can simply continue growing as is. If the plant is a plant body or a part thereof separated from the growing environment, or if it has been separated from a plant body, the object should be cultured in an appropriate environment (for example, a humid environment or an environment where a constant temperature is maintained).
[0077] The presence or absence of genome editing can be confirmed using nucleic acids obtained from the target material, according to known methods, such as the T7 Endonuclease I assay, CAPS (cleaved amplified polymorphic sequence) analysis, or methods for detecting mutations in the base sequence around the genome editing site (around the site-specific nuclease cleavage site) (e.g., methods using primers designed for predicted mutation locations, sequencing analysis, etc.).
[0078] The manufacturing method of the present invention makes it possible to produce genome-edited plants.
[0079] Furthermore, the genome editing technology of the present invention is expected to enable the acquisition of genome-edited germ cells. By obtaining the next generation of plants from these germ cells, it is possible to obtain plants in which all cells are genome-edited.
[0080] In one embodiment, the present invention relates to a composition for use in the production method of the present invention, comprising a site-specific nuclease expression cassette and / or a histone acetyltransferase expression cassette. In another embodiment, the present invention relates to a plant genome editing kit comprising a site-specific nuclease expression cassette and a histone acetyltransferase expression cassette.
[0081] The composition is not particularly limited as long as it contains the expression cassette described above, and may contain other components as needed. Other components include, but are not particularly limited, bases, carriers, solvents, dispersants, emulsifiers, buffers, stabilizers, excipients, binders, disintegrants, lubricants, thickeners, humectants, colorants, fragrances, chelating agents, etc. The plant genome editing composition may optionally contain a polynucleotide containing a guide RNA expression cassette. It may also optionally contain a donor polynucleotide.
[0082] The kit is not particularly limited insofar as it includes the expression cassette described above, and may optionally include other materials, reagents, and equipment necessary for carrying out the plant genome editing method of the present invention, such as nucleic acid delivery reagents and buffers. As other materials necessary for carrying out the plant genome editing method of the present invention, the plant genome editing kit may optionally include a polynucleotide containing a guide RNA expression cassette. It may also optionally include a donor polynucleotide. [Examples]
[0083] The present invention will be described in detail below based on examples, but the present invention is not limited to these examples.
[0084] Example Test 1: Genome Editing Test 1 We introduced site-directed nuclease expression cassettes and histone acetyltransferase (HAT) expression cassettes into Arabidopsis thaliana protoplasts and evaluated the genome editing efficiency. Specifically, the procedure was as follows.
[0085] <1-1. Construction of HAT expression vector> Specificity of acetylation sites has been reported for various HATs in Arabidopsis thaliana (Non-Patent Documents 1-3). Of these, AtHAM2, which specifically acetylates H4K5, was selected. A vector expressing AtHAM2 (amino acid sequence: SEQ ID NO: 4, coding sequence: SEQ ID NO: 12) under a high-expression promoter (CmYLCV promoter) was constructed using Golden Gate Assembly.
[0086] <1-2. Construction of genome editing tool expression vectors> To evaluate the impact of HAT-mediated epigenetic manipulation on genome editing, we used the sites described in "Epigenetic features drastically impact CRISPR-Cas9 efficacy in plants" (Plant Physiol. 2022, 28;190(2):1153-1164) as target sites. We constructed a genome editing tool expression vector expressing Cas9 protein and a guide sequence that recognizes MC site 4 (MC site 4: GTTTTCTCGCACTTAAGCTC (SEQ ID NO: 45)), one of the multicopy CRISPR sites (MC sites) designed for a single guide RNA to recognize multiple locations on the genome.
[0087] <1-3. Isolation of protoplasts from Arabidopsis thaliana leaves> For the isolation of protoplasts from the true leaves of Arabidopsis thaliana, Arabidopsis thaliana plants 3-4 weeks old after sowing were used. Arabidopsis thaliana leaves were cut into 2 mm wide strips using a scalpel, immersed in 10 mL of enzyme solution (Digestion buffer [0.4 M mannitol, 20 mM MES (pH 5.7), 20 mM KCl, 10 mM CaCl2], 1% Cellulase R-10, 0.25% Macerozyme R-10), and then left to stand under reduced pressure (-0.08 MPa) for 20 minutes. After incubation in the dark at 23°C for 4 hours with shaking every hour, the enzyme solution containing the protoplasts was filtered through a nylon mesh (100 μm, BD Falcon) to remove leaf tissue fragments. The cells were washed three times with 10 ml of W5 buffer [0.125 M NaCl, 0.125 M CaCl2, 5 mM KCl, 2 mM MES (pH 5.7)], and then allowed to stand on ice for 30 minutes. Afterward, the W5 buffer was replaced with MMg buffer [0.4 M mannitol, 15 mM MgCl2, 4 mM MES (pH 5.7)], and the cell count was measured using a hemocytometer under a light microscope at 3.5 × 10⁶ cells. 5 The concentration was adjusted to cells / ml.
[0088] <1-4. Gene transfer into protoplasts> Gene transfer into protoplasts is performed using the polyethylene glycol calcium method (PEG / Ca 2+ The procedure was performed according to the following method. 5 μl (5 μg) of genome editing tool expression vector solution, 5 μl (5 μg) of HAT expression vector solution, and 35 μl of protoplast suspension were added to the wells of a 96-well plate and mixed. 45 μl of PEG solution [40% PEG #4000 (Sigma-Aldrich), 0.2 M mannitol, 0.1 M CaCl2] was slowly added, and the mixture was stirred for 15 seconds using a vortex mixer (SPEED 800 / min). -1 The protoplasts were incubated at room temperature for 10 minutes, then washed five times with 200 μl of W5 buffer. The washed protoplasts were incubated in the dark at 23°C for 2 days.
[0089] <1-5. Evaluation of genome editing efficiency> The efficiency of genome editing was evaluated using the CAPS (cleaved amplified polymorphic sequencing) method, which determines the presence or absence of genome editing by analyzing the difference in the cleavage pattern during restriction enzyme digestion, as restriction enzyme sites within the target site disappear due to genome editing. In this study, MC sites 4-8 of MC site 4 were analyzed.
[0090] Protoplast suspensions, which had been left standing at 23°C in the dark for two days after gene introduction, were centrifuged at 50×g at 25°C for 5 minutes, and the supernatant was removed. Genomic DNA was then extracted using the plant tissue DNA Ver.1 protocol on a GENE PREP STAR PI-480α (KURABO) automated DNA separator. The obtained genomic DNA was used as a template for PCR amplification using KOD FX Neo. Subsequently, the PCR products were restricted enzyme-treated and electrophoresed using MultiNA (Shimadzu). Based on the obtained signal intensity, the ratio (restriction enzyme uncleaved band) / (total PCR products) was calculated to determine the genome editing efficiency. To account for the variability of genome editing efficiency by PCR, three PCR tests were performed for each experiment, and the average value of the CAPS analysis results was used as the measurement for that experiment. The experiment was repeated three times, and the average value was evaluated as the genome editing efficiency.
[0091] <1-6.Results / Discussion> The results are shown in Figure 1. It was found that co-introduction of the HAT expression vector improved genome editing efficiency.
[0092] Example Test 2. Genome Editing Test 2 HAT expression vectors expressing AtHAC1 (amino acid sequence: SEQ ID NO: 1, coding sequence: SEQ ID NO: 9), AtHAC12 (amino acid sequence: SEQ ID NO: 2, coding sequence: SEQ ID NO: 10), and AtHAF2 (amino acid sequence: SEQ ID NO: 3, coding sequence: SEQ ID NO: 11) were constructed, and the experiment was conducted in the same manner as in Experiment Example 1, except that MC sites 4-7 of MC site 4 were analyzed in order to evaluate genome editing efficiency.
[0093] The results are shown in Figure 2. It was found that co-introducing other HAT expression vectors also improved genome editing efficiency.
[0094] Example Test 3. Genome Editing Test 3 We introduced site-directed nuclease expression cassettes and histone acetyltransferase (HAT) expression cassettes into tomatoes and evaluated the genome editing efficiency. Specifically, the procedure was as follows.
[0095] <3-1. Construction of HAT expression vector> Using Golden Gate Assembly, we constructed a vector that expresses AtHAC1 (amino acid sequence: SEQ ID NO: 1, coding sequence: SEQ ID NO: 9) under a high-expression promoter (CmYLCV promoter).
[0096] <3-2. Construction of genome editing tool expression vectors> As expression vectors for genome editing tools, we constructed a vector expressing a guide RNA targeting the promoter region of the SHR gene (Solyc02g092370) and a modified MAD7 nuclease (WO2023027041A1), as well as a vector containing the sequence of a fluorescent protein reporter.
[0097] <3-3. Genetic introduction into tomatoes> Leaves were removed from Solanum lycopersicum cv. Moneymaker seedlings 10 days after sowing, and gene App TM Using this method, genome editing tool expression vectors and HAT expression vectors were introduced into seedling-derived tissues.
[0098] <3-4. Evaluation of genome editing efficiency> Genome editing (indels) was detected using the T7E1 assay. Genomic DNA was extracted from the leaves of newly emerging shoots in both wild-type plants and introduced tissues. Genome extraction was performed according to the Plant Tissue DNA Ver.1 protocol using the GENE PREP STAR PI-480α (KURABO) automated DNA separation system. The obtained genomic DNA was used as a template to PCR-amplified the target sequence using KOD FX Neo. Subsequently, the PCR products were treated with T7 Endonuclease I (NEB) and subjected to electrophoresis.
[0099] Two independent trials were conducted from gene transfer to evaluation (Trial 1: n=76 without HAT expression vector, n=34 with HAT expression vector. Trial 2: n=34 without HAT expression vector, n=38 with HAT expression vector). The average genome editing efficiency (percentage of individuals in which indels were detected by the T7E1 assay) was calculated.
[0100] <3-5.Results / Discussion> The average genome editing efficiency was 3.8% without the HAT expression vector, while the average genome editing efficiency with the HAT expression vector was 7.5%. It was thought that the histone acetylation induced by the introduction of the HAT expression vector improved the genome editing efficiency.
Claims
1. A method for producing genome-edited plants, comprising introducing a histone acetyltransferase expression cassette and a site-specific nuclease expression cassette into plants.
2. The method for producing the product according to claim 1, wherein the histone acetyltransferase is an enzyme that acetylates at least one target amino acid residue selected from the group consisting of H3K9, H3K14, H4K5, H4K8, H4K12, and H4K16.
3. The production method according to claim 2, wherein the target amino acid residues are at least two.
4. The method for producing the product according to claim 1, wherein the histone acetyltransferase is AtHAC1, AtHAC12, AtHAF2, AtHAM2, AtGCN5, AtHAG2, AtHAM1, or AtHAC5, or an ortholog thereof.
5. The method for producing a protein according to claim 4, wherein the histone acetyltransferase is a protein having histone acetylation activity, comprising an amino acid sequence having 40% or more identity with the amino acid sequence shown in any of SEQ ID NOs: 1 to 8.
6. The manufacturing method according to claim 5, wherein the aforementioned identity is 90% or more.
7. The method for producing the product according to claim 4, wherein the histone acetyltransferase is AtHAC1 or an ortholog thereof.
8. The method for producing the product according to claim 1, wherein the site-specific nuclease is a nuclease that forms a complex with guide RNA.
9. A composition for use in the manufacturing method according to any one of claims 1 to 8, comprising a site-specific nuclease expression cassette and / or a histone acetyltransferase expression cassette.
10. A plant genome editing kit containing a site-specific nuclease expression cassette and a histone acetyltransferase expression cassette.