Modulation of GAS7 expression and / or activity for the modulation of viral replication.
Modulating GAS7 expression in macrophages addresses the limitations of current antiviral therapies by effectively suppressing viral replication across multiple viruses, offering safe and broad-spectrum control, and enabling vaccine production.
Patent Information
- Application Number
- JP2025555129
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-03-23
- Filing Date
- 2024-03-22
- Publication Date
- 2026-04-14
AI Technical Summary
Current antiviral therapies, such as recombinant type I interferon, have undesirable side effects and fail to effectively suppress viral replication across multiple viruses, particularly in lymphoid organs, necessitating the development of safe, broad-spectrum antiviral agents that can operate independently of the interferon pathway.
Modulating the expression and/or activity of Growth Arrest-Specific Protein 7 (GAS7) in macrophages to control viral replication, which is effective against a wide range of viruses, including DNA and RNA viruses, by enhancing or reducing GAS7 levels to inhibit or promote viral replication as needed.
GAS7 modulation in macrophages provides effective viral control, reducing viral replication by up to 500% and is suitable for preventing, treating, or producing vaccines for various viral infections and diseases, including HIV and influenza, with minimal toxicity.
Smart Images

Figure 2026511495000002 
Figure 2026511495000003 
Figure 2026511495000004
Abstract
Description
Technical Field
[0001] Field of the Invention: The present invention resides in the field of medicine, particularly virology.
[0002] Background of the Invention: Antiviral therapies with broad activity against multiple viruses can be life-saving for patients, particularly when no targeted therapy is available, as is the case for some viral pathogens. Administration of recombinant type I interferon can act as a broad antiviral treatment but is plagued by undesirable side effects. Under this situation, activation of alternative intracellular antiviral mechanisms can achieve viral control without excessive inflammation.
[0003] Macrophages (Mφ) are important for the detection and elimination of pathogens and also serve as a niche for replication for multiple infectious pathogens. This delicate balance between viral replication and the antiviral response has not been well elucidated at the molecular level. Considering the ever-present threat posed by emerging viral pathogens, addressing this problem is physiologically important. Also, patients infected with known human viruses such as the human immunodeficiency virus remain at high risk of developing conditions resulting from residual viral replication even under antiretroviral therapy.
[0004] Viral replication is the process by which a virus (DNA or RNA) hijacks and uses the mechanisms of an infected cell in order to reproduce. Type I interferon (IFN) has been shown to be the most important innate antiviral cytokine in vertebrates. Nearly all cells in the body respond to exposure to IFN through the rapid induction of a complex transcriptional program involving more than 300 IFN-stimulated gene (ISG) genes, which makes cells resistant to viral replication. Most cells can also respond to viral infection by secreting IFN, warning neighboring cells, and suppressing the spread of the virus. However, each vertebrate species remains infected with multiple viruses despite having an intact IFN response. Viral survival depends on the virus's ability to replicate and proliferate within the host, and then requires mechanisms for the virus to evade or disrupt the host IFN response. The ways in which viruses negate the host's IFN system are diverse and represent important determinants of pathogenicity.
[0005] Therefore, there remains a need to identify novel host targets that will encompass a broad range of action. In particular, there is a need for antiviral agents that would be effective in suppressing viral replication independently of the interferon pathway. Furthermore, there is a need for antiviral agents that are safe, i.e., non-toxic even with long-term administration. Such antiviral agents would be particularly effective for long-term treatment, especially due to their penetration into various lymphoid organs that serve as viral reservoirs (e.g., peripheral lymphoid organs and mesenteric ganglia).
[0006] Growth arrest-specific protein 7 (GAS7) is primarily expressed in terminally differentiated brain cells, and preferentially in mature cerebellar Purkinje neurons. GAS7 was initially described as playing a putative role in neurogenesis. Diseases associated with GAS7 include primary open-angle glaucoma and normal-tension glaucoma. Gene ontology (GO) annotations related to this gene include the activity of DNA-binding transcription factors and actin filament-binding activity. Gas7 is also expressed in myeloid cells (including dendritic cells and macrophages). However, the role of GAS7 in regulating viral infections has been completely unstudied.
[0007] Summary of the invention: The present invention is defined by the claims. In particular, the present invention relates to the modulation of GAS7 expression and / or activity for modulating viral replication within a macrophage population.
[0008] Detailed description of the invention: The inventors demonstrate that GAS7 enables macrophage control of viral infection even in the absence of a functional type I interferon response. This suggests that GAS7 expression confers protection of cells from ongoing viral replication.
[0009] Therefore, the first object of the present invention relates to a method for modulating viral replication in a subject's cell population, comprising the step of modulating the expression and / or activity of GAS7 in the cell population.
[0010] In some embodiments, the subject may be human or any other animal (e.g., birds and mammals) (e.g., domestic animals, e.g., cats and dogs; livestock and farm animals, e.g., horses, cattle, pigs, chickens, etc.). Typically, the subject is a mammal (this includes non-primates (e.g., camels, donkeys, zebras, cattle, pigs, horses, goats, sheep, cats, dogs, rats, and mice) and primates (e.g., monkeys, chimpanzees, and humans)). In some embodiments, the subject is an animal other than a human. In some embodiments, the subject is a farm animal or pet. In some embodiments, the subject is human. In some embodiments, the subject is an infant. In some embodiments, the subject is a child. In some embodiments, the subject is an adult. In some embodiments, the subject is an elderly person. In some embodiments, the subject is a premature infant.
[0011] In some embodiments, the cell population is a population of macrophages. In some embodiments, the cell population is a population of dendritic cells. In some embodiments, the cell population is a population of neurons.
[0012] As used herein, the term “viral replication” encompasses the entire viral replication cycle. In particular, the term includes the main replication steps of retroviruses described in this application, including the entry of the virus into a cell, the integration of the viral genome into the host cell’s DNA, and the maturation of the virus.
[0013] Viruses that fall within the scope of the present invention include DNA viruses and RNA viruses (riboviruses), particularly viruses that cause cellular dysfunction such as immunodeficiency (e.g., AIDS), respiratory failure (e.g., SARS (Severe Acute Respiratory Syndrome) and SARS-CoV (coronavirus)-2), neuronal dysfunction (e.g., rabies), or epithelial dysfunction (e.g., hemorrhagic fever). More specifically, the virus is selected from the following families: - Coronavirus family, especially coronavirus genus, e.g., SARS virus or SARS-CoV-2 virus; - Retroviruses, especially lentivirus retroviruses, and oncovirus retroviruses, such as HTLV-1 (human T-cell leukemia virus type 1) virus; - Viruses of the Flaviviridae family, especially the Flavivirus genus (this includes, in particular, dengue virus, Zika virus, yellow fever virus, and viruses that cause viral encephalitis, such as West Nile virus, Japanese encephalitis virus, and St. Louis encephalitis virus); or in particular, viruses of the Hepacivirus genus, such as hepatitis C virus; - Orthomyxovirus (this includes influenza viruses such as H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, and H10N7); - Paramyxoviridae, especially Morbillivirus, especially measles virus, and respiratory viruses (including Sendai virus (SeV) and human parainfluenza virus), and especially viruses of the Pneumovirus genus, such as human respiratory syncytial virus and metapneumovirus; -Viruses of the Reoviridae family, especially the rotavirus genus; -Viruses of the Picornaviridae family, especially those of the Enterovirus genus, such as poliovirus and viruses that cause viral meningitis, and non-enveloped viruses such as coxsackievirus, viruses of the Aphthous virus genus, especially aphthous fever virus, and viruses of the Rhinovirus genus; or viruses of the Hepatovirus genus, especially those of the Hepatovirus genus; - Filoviridae, especially Ebola virus or Marburg virus; - Arenaviridae family, especially Lassa virus; -Viruses of the Rhabdoviridae family, especially the Rhabdovirus genus (including rabies virus) and the Vediclovirus genus (including vesicular stomatitis virus); viruses of the Togaviridae family, especially the Rubivirus genus (including rubella virus) and the Alphavirus genus (including Sindbisvirus); viruses of the Poxviridae family, especially vaccinia virus and smallpox virus; - Herpesviridae, especially herpes type 1 or 2 (HSV-1 or HSV-2), varicella-zoster virus; and Hepadnaviridae, such as hepatitis B virus; hepatitis D virus; -or Hepaviridae, such as hepatitis E virus.
[0014] In some embodiments, the virus is a human retrovirus, particularly a human lentivirus, more specifically a human immunodeficiency (HIV) virus, such as HIV-1 or HIV-2, preferably HIV-1. In some embodiments, the virus is a primate retrovirus, particularly a primate lentivirus, more specifically a primate immunodeficiency virus (SIV), such as SIVmac251 or SIVmac239 virus. In some embodiments, the virus is a human herpesvirus, particularly a herpes simplex virus (HSV), such as HSV-1 or HSV-2. In some embodiments, the virus is a measles virus. In some embodiments, the virus is a Sindbis virus, a Zika virus, or a varicella stomatitis virus. In some embodiments, the virus is an orthomyxovirus, particularly an influenza virus. In some embodiments, the virus is a coxsackievirus.
[0015] A further object of the present invention relates to a method for reducing the replication ability of a virus in a cell population, comprising the step of increasing the expression and / or activity of GAS7 in the cell population.
[0016] The expression “reduces replication ability” as used herein with reference to viral phenotypes means that when the step of increasing GAS7 expression and / or activity is performed, the virus grows to a lower titer compared to the same virus grown without the step of increasing GAS7 expression and / or activity. In some embodiments, the replication ability of the virus in a cell population is reduced by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 100%, or at least about 200%, or at least about 300%, or at least about 400%, or at least about 500%.
[0017] In some embodiments, the ability to prevent, reduce, and / or suppress viral replication is achieved in vitro. Prevention or suppression of viral replication may be partial or complete.
[0018] In some embodiments, the ability to prevent, reduce, and / or suppress viral replication is achieved in vivo. Prevention or suppression of viral replication may be partial or complete. In some embodiments, the methods disclosed herein are performed to prevent, reduce, and / or suppress viral replication in a subject who is infected with or susceptible to viral infection. In particular, the methods are especially suited for the prevention and / or treatment of viral infections.
[0019] As used herein, the terms “viral infection” or “infected with a virus” mean that the animal or human has been exposed to a pathogenic RNA virus or DNA virus, which has attached itself to one or more cells of the host, and subsequently penetrated (or is likely to penetrate) into the cells(s) and exerted (or is likely to exert) an adverse effect on at least one cell of the animal or human. In particular, such a viral infection may develop into a clinical manifestation of an induced disease group or a group of diseases associated with the infection. Therefore, “viral infection” within the scope of this invention includes the very early stages of viral contamination, as well as the very late and intermediate stages of viral contamination. For example, in the case of HIV, infection develops in several stages, which may occur sequentially over time. Four distinct periods are particularly distinguished: (1) the initial infection, which corresponds to the period of seroconversion of antibodies after contamination, which may or may not be symptomatic (in 50-75% of cases); followed by (2) an incubation period, then (3) a period of mild symptoms, and finally (4) a period of severe immunosuppression or acquired immunodeficiency syndrome, which is generally symptomatic and commonly accompanied by numerous opportunistic infections. Therefore, the term “viral infection” also includes any clinical signs, symptoms, or diseases that occur in an animal or human (patient) after contamination of the animal or patient with the virus as described in this application. Thus, “viral infection” includes both the contamination with the virus and the various pathological conditions resulting from the contamination with the virus.
[0020] Viral infections that fall within the scope of the present invention particularly include the group consisting of viral encephalitis, viral meningitis, aphthous fever, influenza, yellow fever, respiratory viral infections, such as those caused by SARS or SARS-CoV-2 (including in particular coronavirus disease-19 (COVID-19)), infantile diarrhea, particularly infantile diarrhea caused by rotavirus, hemorrhagic fever, particularly hemorrhagic fever caused by Ebola virus, dengue virus and Lassa virus, polio, rabies, measles, rubella, chickenpox, smallpox, herpes zoster, genital herpes, hepatitis, particularly types A, B, C, D and E, leukemia and paralysis caused by HTLV-1 (human T-cell leukemia virus type 1), and infections caused by HIV virus, more specifically HIV-1 or HIV-2, or simian immunodeficiency virus (including in particular acquired immunodeficiency syndrome (AIDS)). In particular, viral infections are brain viral infections.
[0021] As used herein, the terms “prevention” or “preventing viral infection” refer to any degree of delay in the time of onset of clinical signs or symptoms of viral infection, and any degree of suppression of the severity of clinical signs or symptoms of viral infection (including, but not limited to, complete prevention of viral infection). This requires that the methods disclosed herein be carried out in subjects who may be contaminated with the virus before any clinical signs or symptoms of the disease appear. Prophylactic interventions may be administered before or at the time of exposure of the animal or human to the virus causing the viral infection. Such prophylactic administrations play a role in preventing and / or reducing the severity of any subsequent infections.
[0022] As used herein, the term “treatment” is understood to mean the therapeutic effect produced in an animal or human when the active substance is administered to the animal or human at the time of or after contamination with the virus. The methods disclosed herein may be performed during the initial infection period, during the asymptomatic period, or after the appearance of clinical signs or symptoms of the disease. In some embodiments, the methods disclosed herein are performed during the initial infection period. In some embodiments, the methods disclosed herein are performed after the initial infection period, i.e., during the chronic period (which may be asymptomatic or after the appearance of clinical signs or symptoms of the disease). In some embodiments, the therapeutic intervention is performed as quickly as possible, within 24 hours or 48 hours after the animal or human is exposed to the virus. The treatment includes any therapeutic effect obtained by performing the methods disclosed herein, as well as improvement in the condition of the animal or patient, along with improvement in clinical signs or symptoms observed in the animal or patient. The term includes, in particular, the effects obtained as a result of suppressing viral replication and / or suppressing virus-induced cell death and inflammation. Accordingly, the term “treatment” encompasses the slowing, reduction, interruption, and cessation of viral infection and / or its adverse consequences; treatment does not necessarily require the complete elimination of all clinical signs and symptoms of the disease, nor does it necessarily require the complete elimination of the virus. The methods disclosed herein may be performed (prevention) on animals or humans at risk of developing a viral infection, or (treatment) after viral contamination has occurred, particularly after the manifestation of the first clinical signs or symptoms of the disease, for example, after a virus-specific protein or antibody has been detected in the blood of the animal or patient.
[0023] In some embodiments, the methods disclosed herein are performed in an animal or a human before, during, or after the animal or human is exposed to the virus. Intervention after exposure to the virus may be performed at any time, but is preferably performed as soon as possible after exposure, particularly within 48 hours after the animal or human is exposed to the virus. Further, it is possible to envision multiple consecutive interventions to increase the expression and / or activity of GAS7 in order to enhance the beneficial effects of treatment. Before an animal or a human is exposed to the virus, in order to increase the chance of cure, or at least extend the average lifespan of the animal or human, or for prophylactic effect and / or during exposure to the virus, and / or after exposure to the virus, particularly within 48 hours after the animal or human is exposed to the virus, it is possible to perform one or more consecutive interventions.
[0024] The methods disclosed herein can be used for the prevention and / or treatment of viral infection during the initial infection period and / or during the chronic period (which may be asymptomatic or after the appearance of clinical signs or symptoms of the disease). An animal or a human infected with the virus may be in the initial infection period or in the chronic period. The methods disclosed herein can also be used to interfere with, reduce, and / or suppress viral replication in an animal or a human infected with the virus during the initial infection period and / or during the chronic period (which may be asymptomatic or after the appearance of clinical signs or symptoms of the disease).
[0025] A further object of the present invention relates to a method for increasing the ability of a virus to replicate in a cell population, the method comprising the step of reducing the expression and / or activity of GAS7 in the cell population.
[0026] As used herein, the term "increased replicative ability" with respect to a viral phenotype refers to the virus growing to a lower titer when a step of increasing the expression and / or activity of GAS7 is performed, compared to the same virus grown without performing a step of increasing the expression and / or activity of GAS7. In some embodiments, the methods disclosed herein will increase the replicative ability of a virus in a cell by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 100%, or at least about 200%, or at least about 300%, or at least about 400%, or at least about 500%.
[0027] In some embodiments, the methods disclosed herein can be used for the production of a certain amount of virus. In particular, the methods disclosed herein are particularly suitable for the production of vaccines.
[0028] In some embodiments, the methods disclosed herein include: i) infecting the cell population with the virus, and ii) reducing the expression and / or activity of GAS7 in the infected cell population.
[0029] According to the present invention, any viral strain may be used. Preferably, the viral strain corresponds to a clinical isolate of at least one circulating pathogenic viral strain. In some embodiments, the clinical isolate can be engineered into a fast-growing strain by genetic reassortment with a fast-growing master strain, or by serially passaging the clinical isolate in a continuous mammalian cell line while selecting for fast-growing mutants.
[0030] Typically, infection of cells with influenza virus is carried out at a multiplicity of infection (m.o.i) of about 0.0001 to 10, preferably 0.002 to 0.5.
[0031] According to the present invention, any population of macrophages, dendritic cells, or neurons may be used. For example, mammalian cell populations include, but are not limited to, cells derived from humans, dogs, cats, cattle, horses, sheep, pigs, goats, and rabbits. In some embodiments, the cell population is a human cell population. In some embodiments, the cells are cell lines. Typically, the cells are certified in accordance with WHO requirements for vaccine production. Requirements for certification of such cell lines include characterization with respect to lineage, growth characteristics, immunological markers, susceptibility to viruses, oncogenicity, and at least one of preservation conditions, as well as characterization by testing in animals, eggs, and cell culture media. It is preferable to establish a complete characterization of the cell line to be used. Data that may be used to characterize the cell lines to be used in the present invention include (a) information on its origin, lineage and passage history; (b) information on its growth and morphological characteristics; (c) distinctive features, such as biochemical, immunological and cytogenetic patterns, that enable the cells to be recognized particularly clearly among other cell lines; and (d) results of oncogenicity tests. Preferably, the passage level or population doubling of the cell lines used should be kept as low as possible.Examples of macrophage cell lines suitable for carrying out the present invention include the IPKM cell line (Masujin, K., Kitamura, T., Kameyama, Ki et al. An immortalized porcine macrophage cell line competent for the isolation of African swine fever virus. Sci Rep 11, 4759 (2021)) or the RAW264.7 cell line (Taciak B, Bialasek M, Braniewska A, Sas Z, Sawicka P, Kiraga L, Rygiel T, Krol M. Evaluation of phenotypic and functional stability of RAW 264.7 cell line through serial passages. PLoS One. 2018 Jun 11;13(6):e0198943).
[0032] Typically, cell populations are cultured in standard commercially available culture media, such as Dulbecco's Modified Eagle Medium supplemented with serum (e.g., 10% fetal bovine serum), or in serum-free media, under controlled humidity and carbon dioxide concentrations suitable for maintaining a buffered pH to neutral (e.g., pH 7.0–7.2). Optionally, the medium may contain antibiotics to prevent bacterial growth, such as penicillin or streptomycin, and / or additional nutrients, such as L-glutamine, sodium pyruvate, non-essential amino acids, or additional nutrients to promote desirable growth characteristics.
[0033] Cell populations for virus production may be cultured in serum-containing medium or in serum-free medium. In some cases, it is desirable to grow the cells under serum-free conditions, for example, for the preparation of purified virus. Cells may be cultured in small amounts of medium, e.g., less than 25 ml, in culture tubes or flasks, or in large flasks, in rotating bottles, or on microcarrier beads (e.g., DEAE-dextran microcarrier beads, e.g., Dormacell, Pfeifer & Langen; Superbeads, Flow Laboratories; styrene copolymer-tri-methylamine beads, e.g., Hillex, SoloHill, Ann Arbor) in flasks, bottles, or reaction culture media. Microcarrier beads are small spheres (within the range of 100-200 μm in diameter) that provide a large surface area per unit volume of cell culture medium for adherent cell growth. For example, 1 liter of medium may contain more than 20 million microcarrier beads, providing a growth surface area of more than 8000 square centimeters. For the commercial production of viruses, such as for vaccine production, it is often desirable to culture cells in a bioreactor or fermenter. Bioreactors with capacities ranging from less than 1 liter to more than 100 liters are available. Examples include the Cyto3 bioreactor (Osmonics, Minnetonka, Minnesota); the NBS bioreactor (New Brunswick Scientific, Edison, New Jersey); and experimental and commercial-scale bioreactors from B. Braun Biotech International (Melsungen, Germany).
[0034] Cells in a culture medium can be grown under conditions acceptable for viral replication and construction. In some embodiments, cells can be cultured at a temperature below approximately 37°C, preferably equal to or below approximately 35°C. Cell culture is carried out in principle at a controlled pH, preferably in the range of pH 6.6 to pH 7.8, and particularly in the range of pH 6.8 to pH 7.3. Furthermore, the oxygen partial pressure can be advantageously controlled, in which case it is generally 25% to 95%, particularly 35% to 60% (based on air saturation).
[0035] After culturing for a period suitable for enabling viral replication to high titers, the virus can be recovered. Typically, the virus can be recovered from the culture medium in which infected (transfected) cells were grown. Typically, the crude medium is clarified before virus concentration. Common methods include filtration, ultrafiltration, density gradient ultracentrifugation, adsorption and elution on barium sulfate, and centrifugation. For example, the crude medium from the infected culture can first be clarified by centrifugation at, for example, 1000-2000 × g for a sufficient time to remove cell fragments and other large particulate matter, for example, 10-30 minutes. Alternatively, the medium can be filtered through a 0.8 μm cellulose acetate filter to remove intact cells and other large particulate matter. In some cases, the clarified medium supernatant is then pelletized by centrifugation at, for example, 15,000 × g for about 3-5 hours. After resuspending the virus pellet in a suitable buffer such as pH 7.4 STE (0.01 M Tris hydrochloride; 0.15 M NaCl; 0.0001 M EDTA) or phosphate-buffered saline (PBS), the virus is concentrated by density gradient centrifugation with sucrose (60%–12%) or potassium tartrate (50%–10%). Either a continuous or stepwise gradient is appropriate, e.g., a 12%–60% sucrose gradient (four 12% steps). The gradient is centrifuged at a rate and for a sufficient amount of time to concentrate the virus into a visible band for recovery. Alternatively, for most large-scale commercial applications, the virus is separated from the density gradient using a zonal centrifuge rotor operating in continuous mode. If desired, the recovered virus can be stored at -80°C in the presence of sucrose-phosphate-glutamate (SPG) as a stabilizer.
[0036] The method of the present invention is particularly useful for the production of viral vaccines. The resulting replicated virus can be concentrated as described above and then inactivated or attenuated using any method well known in the art. The inactivated viral vaccine of the present invention is typically provided by inactivating the replicated virus of the present invention using known methods, such as, but not limited to, treatment with formalin or β-propiolactone. The types of inactivated vaccines that can be used in the present invention may include complete virus (WV) vaccines or subvirion (SV) virus vaccines. WV vaccines contain intact and inactivated viruses, while SV vaccines contain purified viruses that have been destroyed by solubilizing the lipid-containing viral envelope with a surfactant, followed by chemical inactivation of residual viruses. Attenuated live viral vaccines using the replicated virus of the present invention can be used to prevent or treat viral infections according to the steps of known methods: attenuation is preferably achieved in one step by introducing an attenuated gene derived from an attenuated donor virus into a replicated isolate or gene-reassorted virus according to known methods. To rescue infectious viruses possessing these mutant genes, other attenuating mutations may be introduced into the viral gene by site-directed mutagenesis. These attenuating mutations may be introduced into non-coding regions of the genome, or into coding regions. Thus, novel donor viruses possessing attenuating mutations introduced by site-directed mutagenesis can be created. It is preferable that such attenuated viruses maintain genes derived from replicated viruses that encode antigenic determinants substantially similar to those of the original clinical isolate. This is because the goal of an attenuated vaccine is to provide substantially the same antigenicity as the original clinical isolate of the virus, while simultaneously reducing infectivity to the extent that the vaccine minimizes the chance of inducing serious pathological conditions in vaccinated mammals.
[0037] Attenuated or inactivated replicated viruses can then be formulated into a vaccine composition. The vaccine composition of the present invention, suitable for inoculation or parenteral or oral administration, comprises attenuated or inactivated viruses and optionally further comprises sterile aqueous or nonaqueous solutions, suspensions, and emulsions. The composition may further contain adjuvants or excipients as known in the art. When the vaccine composition of the present invention is used for administration to an individual, it may further contain salts, buffers, adjuvants, or other substances desirable to improve the efficacy of the composition. Adjuvants are substances that can be used to enhance a specific immune response. Typically, the adjuvant and the composition are mixed before being presented to the immune system or presented separately to the same site in the mammal being immunized.
[0038] As used herein, the term "GAS7" has its general meaning in the art and refers to the growth arrest-specific protein 7 encoded by the GAS7 gene. The term is also known as KIAA0394 or MGC1348. The exemplary amino acid sequence of GAS7 is shown by SEQ ID NO: 1. [ka]
[0039] Typically, modulation of GAS7 expression and / or activity can be carried out by any means known in the art.
[0040] In some embodiments, the methods disclosed herein involve the use of one or more agents(s) that increase the expression and / or activity of GAS7.
[0041] In some embodiments, the methods disclosed herein involve the use of one or more agents(s) that reduce the expression and / or activity of GAS7.
[0042] As used herein, the term “agent” means a compound, a mixture of compounds, a biological macromolecule, or an extract made from a biological material such as cells or tissues of bacteria, plants, fungi, or animals, particularly mammals, suspected to possess therapeutic properties. According to the present invention, the term “agent” includes GAS7 itself, its variants (e.g., negative dominants), or polynucleotides encoding GAS7 or its variants. The agent may be purified, substantially purified, or partially purified. The expression and / or activity of GAS7 may be measured by any assay known in the art, which typically includes those described in the examples.
[0043] As used herein, the expression “agent that increases the expression and / or activity of GAS7” means any agent capable of increasing the expression and / or activity of GAS7 in a cell population by at least about 10%, or at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 100%, or at least about 200%, or at least about 300%, or at least about 400%, or at least about 500%, compared to the expression and / or activity measured in the absence of the agent. Conversely, the expression "agents that reduce the expression and / or activity of GAS7" refers to any agent capable of reducing the expression and / or activity of GAS7 in a cell population by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 200%, at least about 300%, at least about 400%, or at least about 500% compared to the expression and / or activity measured in the absence of the agent.
[0044] In some embodiments, the agent is a low molecular weight organic compound. As used herein, the term “low molecular weight organic compound” refers to any molecule of a size comparable to organic compounds commonly used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). The preferred size range for low molecular weight organic compounds is from about 10 Da to about 5000 Da, more preferably up to 2000 Da, and most preferably up to about 1000 Da.
[0045] In some embodiments, the agent that increases the expression and / or activity of GAS7 is either i) a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, or ii) a polynucleotide encoding such a polypeptide.
[0046] In some embodiments, the agent that reduces the expression and / or activity of GAS7 is either i) a polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO: 1, or ii) a polynucleotide encoding such a polypeptide, wherein the polypeptide or polynucleotide is a dominant-negative polypeptide or polynucleotide of GAS7.
[0047] As used herein, the term “polypeptide” has its general meaning in the art and refers to an amino acid polymer of any length. Such polymer may contain modified amino acids. The term also encompasses amino acid polymers that are modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other operation or modification, such as conjugation with a labeling component. Within the definition, for example, polypeptides containing one or more amino acid analogs (e.g., unnatural amino acids, such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine) as well as other modifications known in the art.
[0048] The "identity rate" between two sequences used herein is a function of the number of identical positions shared by the sequences (i.e., identity rate % = number of identical positions / total number of positions × 100), taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences. The comparison of sequences and the determination of the identity rate between two sequences can be achieved using mathematical algorithms such as those described below. The identity rate between two amino acid sequences can be determined using the Needleman-Wunsch algorithm (Needleman, Saul B. & Wunsch, Christian D. (1970). "A general method applicable to the search for similarities in the amino acid sequence of two proteins." Journal of Molecular Biology. 48 (3): 443-53.). The identity rate between two nucleotides or amino acid sequences may also be determined using algorithms such as EMBOSS Needle (pairwise alignment; available at www.ebi.ac.uk). For example, EMBOSS Needle can be used with the BLOSUM62 matrix, a "gap open penalty" of 10, a "gap extend penalty" of 0.5, a false "end gap penalty," a "end gap open penalty" of 10, and a "end gap extend penalty" of 0.5. Generally, the "identity rate" is a function of the number of matching positions divided by the number of positions being compared and multiplied by 100. For example, if 6 out of 10 sequence positions are identical between two sequences being compared after alignment, the identity rate is 60%. The identity rate % is typically determined against the full length of the query sequence on which the analysis is performed. Two molecules having the same primary amino acid sequence or nucleic acid sequence are identical regardless of any chemical and / or biological modifications.According to the present invention, a first amino acid sequence having at least 90% identity with respect to a second amino acid sequence means that the first sequence has 90;91;92;93;94;95;96;97;98;99 or 100% identity with respect to the second amino acid sequence.
[0049] In some embodiments, the polypeptide (including a dominant-negative polypeptide) is fused with a heterologous moiety. In some embodiments, the heterologous moiety is a cell-permeable peptide. As used herein, the term “cell-permeable peptide” refers to a short peptide, for example, containing 5 to 50 amino acids, that can readily cross biological membranes and facilitate the cellular uptake of various molecular cargoes in vitro and / or in vivo. In some embodiments, the heterologous polypeptide is an internal migration sequence derived from either the homeodomain / penetratin (Antp) protein (amino acids 43 to 58) of the Drosophila Antennapedia or the transactivating transcription activator of HIV-1.
[0050] As used herein, the term “polynucleotide” refers to nucleotide polymers of any length, including ribonucleotides, deoxyribonucleotides, their analogues, or mixtures thereof. The term refers to the primary structure of a molecule. Therefore, the term includes triple-stranded, double-stranded, and single-stranded deoxyribonucleic acid ("DNA") and triple-stranded, double-stranded, and single-stranded ribonucleic acid ("RNA"). It also includes polynucleotides in modified forms, for example, by alkylation and / or capping, as well as unmodified polynucleotides. More specifically, the term “polynucleotide” includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose) (including tRNA, rRNA, hRNA, siRNA, and mRNA) (whether spliced or unspliced), any other type of polynucleotide that is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing a normucleotidic backbone, such as polyamides (e.g., peptide nucleic acid “PNA”) and polymorpholinopolymers, and other synthetic sequence-specific nucleic acid polymers (where the polymer contains nucleic acid bases in a configuration that allows for base pairing and base stacking, as seen in DNA and RNA). In some embodiments, polynucleotides include mRNA. In other embodiments, mRNA is synthetic mRNA. In some embodiments, synthetic mRNA includes at least one non-natural nucleic acid base. In some embodiments, all nucleic acid bases of a particular class are substituted with non-native nucleic acid bases (for example, all uridines in the polynucleotides disclosed herein may be substituted with non-native nucleic acid bases, such as 5-methoxyuridine). In some embodiments, the polynucleotide (e.g., synthetic RNA or synthetic DNA) contains only native nucleic acid bases, i.e., A, C, T, and G in the case of synthetic DNA, or A, C, T, and U in the case of synthetic RNA.
[0051] As used herein, the term “dominant-negative” in the context of the mechanism of action of a protein or genetic phenotype means a mutant or mutant polypeptide, or a polynucleotide encoding a mutant or mutant polypeptide, that substantially prevents the corresponding polypeptide having wild-type function from performing its wild-type function.
[0052] In some embodiments, the polynucleotide of the present invention is messenger RNA (mRNA).
[0053] In some embodiments, polynucleotides are inserted into vectors such as plasmids, cosmids, episomes, artificial chromosomes, phages, or viral vectors. Typically, the vector is a viral vector, which may be an adeno-associated virus (AAV), retrovirus, bovine papillomavirus, adenovirus vector, lentiviral vector, vaccinia virus, polyomavirus, or infectious virus. Typically, the vector of the present invention includes “regulatory sequences,” which collectively refer to promoter sequences, polyadenylation signals, transcription termination factor sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRESs"), enhancers, etc., which collectively give rise to replication, transcription, and translation of the coding sequence in recipient cells. Not all of these regulatory sequences are always necessary, as long as the selected coding sequence can be replicated, transcribed, and translated in a suitable host cell. Another nucleic acid sequence is a “promoter” sequence, used herein in its usual sense, which refers to a nucleotide region containing a DNA regulatory sequence, where the regulatory sequence originates from a gene capable of binding to RNA polymerase and initiating transcription of a downstream (3' direction) coding sequence. Transcription promoters may include “inducible promoters” (expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), “repressive promoters” (expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and “constitutive promoters.”
[0054] In some embodiments, the polypeptide or polynucleotide of the present invention may be conjugated to at least one other molecule. Typically, the molecule is selected from the group consisting of polynucleotides, polypeptides, lipids, lectins, carbohydrates, vitamins, cofactors, and drugs.
[0055] In some embodiments, the polypeptide or polynucleotide of the present invention is formulated together with a lipidoid. The synthesis of the lipidoid has been well described (see Mahon et al., Bioconjug Chem. 2010 21:1448-1454; Schroeder et al., J Intern Med. 2010 267:9-21; Akinc et al., Nat Biotechnol. 2008 26:561-569; Love et al., Proc Natl Acad Sci USA. 2010 107:1864-1869; Siegwart et al., Proc Natl Acad Sci US A. 2011 108:12996-3001). These lipidoids have been used in rodents and non-human primates to efficiently deliver double-stranded small interfering RNA molecules (see Akinc et al., Nat Biotechnol. 2008 26:561-569; Frank-Kamenetsky et al., Proc Natl Acad Sci USA. 2008 105:11915-11920; Akinc et al., Mol Ther. 2009 17:872-879; Love et al., Proc Natl Acad Sci USA. 2010 107:1864-1869; Leuschner et al., Nat Biotechnol. 2011 29:1005-1010), and this disclosure describes their formulation and use in the delivery of polynucleotides.
[0056] In some embodiments, the polypeptides or polynucleotides of the present invention are formulated using one or more lipid-based structures, including but not limited to liposomes, lipoplexes, or lipid nanoparticles (Paunovska, Kalina, David Loughrey, and James E. Dahlman. "Drug delivery systems for RNA therapeutics." Nature Reviews Genetics (2022): 1-16).
[0057] Liposomes are artificially prepared vesicles that may be composed primarily of lipid bilayers and can be used as delivery vehicles for the administration of pharmaceutical formulations. Liposomes can be of various sizes, including, but are not limited to, multilamellar vesicles (MLVs) (which may be several hundred nanometers in diameter and may contain a series of concentric bilayers separated by narrow aqueous compartments), small single lamellar vesicles (SUVs) (which may be less than 50 nm in diameter), and large single lamellar vesicles (LUVs) (which may be 50–500 nm in diameter). The design of liposomes may include, but are not limited to, opsonins or ligands to improve liposome adhesion to unhealthy tissues or to activate events such as, but are not limited to, endocytosis. Liposomes may contain low or high pH to improve the delivery of pharmaceutical formulations. As a non-limiting example, liposomes such as synthetic membrane vesicles are prepared by methods, apparatus, and instruments described in U.S. Patent Publications US20130177638, US20130177637, US20130177636, US20130177635, US20130177634, US20130177633, US20130183375, US20130183373, and US20130183372. In some embodiments, the liposomes are formed from liposomes capable of delivering small molecule drugs such as 1,2-dioleyloxy-N,N-dimethylaminopropane (DODMA) liposomes, DiLa2 liposomes from Marina Biotech (Bothell, Washington), 1,2-dilinoleyloxy-3-dimethylaminopropane (DLin-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), and MC3 (as described in US20100324120), and DOXIL® from Janssen Biotech (Horsham, Pennsylvania).The polypeptide or polynucleotide of the present invention can be encapsulated in liposomes, and / or it may be contained in an aqueous core which may then be encapsulated in liposomes (see International Publications WO2012031046, WO2012031043, WO2012030901 and WO2012006378, and U.S. Patent Publications US20130189351, US20130195969 and US20130202684).
[0058] In some embodiments, the polynucleotides of the present invention are formulated using stabilized plasmid-lipid particles (SPLPs) or stabilized nucleic acid-lipid particles (SNALPs), which have been previously described and shown to be suitable for oligonucleotide delivery in vitro and in vivo (Wheeler et al. Gene Therapy. 1999 6:271-281; Zhang et al. Gene Therapy. 1999 6:1438-1447; Jeffs et al. Pharm Res. 2005 22:362-372; Morrissey et al., Nat Biotechnol. 2005 2:1002-1007; Zimmermann et al., Nature. 2006 441:111-114; Heyes et al. J Contr Rel. 2005 107:276-287; Semple et al. Nature Biotech. 2010). 28:172-176; Judge et al. J Clin Invest. 2009 119:661-673; deFougerolles Hum Gene Ther. 2008 19:125-132; see U.S. Patent Publication US20130122104). The original manufacturing method by Wheeler et al. was a surfactant dialysis method, which was later improved by Jeffs et al. and is called the spontaneous vesicle formation method. Liposome formulations consist of 3-4 lipid components in addition to polynucleotides. For example, liposomes contain, but are not limited to, 55% cholesterol, 20% distearoylphosphatidylcholine (DSPC), 10% PEG-S-DSG, and 15% dioleyloxy-N,N-dimethylaminopropane (DODMA), as described by Jeffs et al.As another example, certain liposomal formulations contain, but are not limited to, 48% cholesterol, 20% DSPC, 2% PEG-c-DMA, and 30% cationic lipids, where the cationic lipids may be 1,2-distearyloxy-N,N-dimethylaminopropane (DSDMA), DODMA, DLin-DMA, or 1,2-dilinolenyloxy-3-dimethylaminopropane (DLenDMA), as described by Heyes et al.
[0059] In some embodiments, the polynucleotides of the present invention are formulated within lipid nanoparticles, such as those described in International Publication WO2012170930. Lipid nanoparticle formulations typically include lipids, particularly ionizable cationic lipids, and further include neutral lipids, sterols, and molecules that can reduce particle aggregation, such as PEG (polyethylene glycol) or PEG-modified lipids. Lipids may be selected from, but are not limited to, DLin-DMA, DLin-K-DMA, 98N12-5, C12-200, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, PLGA, PEG, PEG-DMG, PEGylated lipids, and amino alcohol lipids. In some embodiments, the lipids are cationic lipids, such as, but are not limited to, DLin-DMA, DLin-D-DMA, DLin-MC3-DMA, DLin-KC2-DMA, DODMA, and amino alcohol lipids. Amino alcohol cationic lipids may be lipids produced by the methods described and / or described in U.S. Patent Publication US20130150625. Non-limiting examples include cationic lipids such as 2-amino-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy-2-{[(9Z,2Z)-octadeca-9,12-diene-1-yloxy]methyl}propan-1-ol (compound 1 of US20130150625); 2-amino-3-[(9Z)-octadecé-9-en-1-yloxy]-2-{[(9Z)-octadecé-9-en-1-yloxy]methyl}propan-1-ol (compound 2 of US20130150625); 2-amino-3 -[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-2-[(octyloxy)methyl]propan-1-ol (compound 3 in US20130150625), and 2-(dimethylamino)-3-[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]-2-{[(9Z,12Z)-octadeca-9,12-diene-1-yloxy]methyl}propan-1-ol (compound 4 in US20130150625); or any pharmaceutically acceptable salt or stereoisomer thereof.The nanoparticle formulations of this disclosure may be coated with surfactants or polymers to improve particle delivery. In some embodiments, the nanoparticles are coated with hydrophilic coatings, including but not limited to PEG coatings and / or coatings having a neutral surface charge. Hydrophilic coatings may help deliver nanoparticles with larger loads, including but not limited to polynucleotides in the central nervous system. As a non-limiting example, nanoparticles containing hydrophilic coatings and methods for producing such nanoparticles are described in U.S. Patent Application Publication US20130183244.
[0060] In some embodiments, agents that reduce the expression and / or activity of GAS7 are molecules that partially or completely block, inhibit, or neutralize the biological activity or expression of GAS7. Such agents may be any type of molecule that interferes with GAS7-related signaling within a cell population, for example, by reducing the transcription or translation of the nucleic acid encoding GAS7, or by inhibiting or blocking the GAS7 polypeptide, or both. Examples of agents that reduce the expression and / or activity of GAS7 include, but are not limited to, antisense polynucleotides, interfering RNA, catalytic RNA, RNA-DNA chimeras, GAS7-specific aptamers, anti-GAS7 antibodies, GAS7-binding fragments of anti-GAS7 antibodies, GAS7-binding small molecules, GAS7-binding peptides, and other polypeptides that specifically bind to GAS7 (including, but are not limited to, GAS7-binding fragments of one or more GAS7 ligands fused to one or more additional domains, as may be the case). Other examples include the use of endonucleases such as CRISPR-endonucleases (e.g., CAS9) that have guide RNA molecules designed to reduce GAS7 expression.
[0061] A further object of the present invention relates to a method for screening for agents that can reduce the replication ability of a virus in a cell population, comprising the steps of: i) contacting a cell population with a plurality of test substances; and ii) selecting a group of substances that can increase the expression and / or activity of GAS7 in the cell population.
[0062] A further object of the present invention relates to a method for screening for agents that can increase the replication ability of a virus in a cell population, comprising the steps of: i) contacting a cell population with a plurality of test substances; and ii) selecting a group of substances that can reduce the expression and / or activity of GAS7 in the cell population.
[0063] The present invention will be further illustrated by the following drawings and embodiments. However, these embodiments and drawings should not be construed as limiting the scope of the present invention. [Brief explanation of the drawing]
[0064] drawing: Figure 1. Gas7 restricts viral replication of various viruses within macrophages. [Figure 1A] A - Diagram of the experimental procedure. Monocytes were isolated from human blood and transduced using lentiviral particles encoding control or GAS7-targeted shRNA. Monocytes were differentiated into macrophages in culture medium for 6 days and infected with the specified virus. After infection, the dynamics of viral amplification were measured by automated microscopy (incubation) and flow cytometry. The viral titer in the supernatant (SN) was measured by the Vero plaque assay. The decoy IFNAR receptor R18R was added under most conditions as indicated to block type I interferon signaling. [Figure 1B]B - Left panel (top and bottom) - Amplification of HSV-1 (VP26GFP-positive) in infected macrophages (MOI 1) was evaluated by measuring the total GFP intensity over time using incubators. The bottom panel shows representative incubator images of GFP-positive infected cells 1 day after infection. Right panel (top) - Percentage of GFP-positive infected cells 24 hours post-infection (pi), measured by flow cytometry. Right panel (bottom) - Viral titer (pfu / ml) of supernatant derived from infected cells, determined by VERO plaque assay (representative plaque images are shown). All data are representative of independent experiments performed using macrophages differentiated from monocytes selected from n=5 healthy donors. B18R was added to all cultures to block type I interferon signaling. [Figure 1C] C - Left panel (top and bottom) - Amplification (MOI 1) of measles (MS GFP-positive) within infected macrophages was evaluated by incubating and measuring the total GFP intensity over time. The bottom panel is a representative incubator image of a GFP-positive infected cell 3 days after infection. Right panel (top) - Percentage of GFP-positive infected cells 48 hours post-infection (pi), measured by flow cytometry. Right panel (bottom) - Viral titer (pfu / ml) of supernatant derived from infected cells determined by VERO plaque assay (representative plaque images are shown). All data are representative of independent experiments performed using macrophages differentiated from monocytes selected from n=5 healthy donors. B18R was added to all cultures to block type I interferon signaling. [Figure 1D]D - Left panel (top and bottom) - Amplification of Sindbis (SINV GFP-positive) in infected macrophages (MOI 10) was evaluated by incubating cells and measuring the total GFP intensity over time. The bottom panel shows representative incubating cells of GFP-positive infected cells 1 day after infection. Right panel (top) - Percentage of GFP-positive infected cells at 24 hours post-infection (pi), measured by flow cytometry. Right panel (bottom) - Viral titer (pfu / ml) of supernatant derived from infected cells determined by VERO plaque assay (representative plaque photographs are shown). All data are representative of independent experiments performed using macrophages differentiated from monocytes selected from n=5 healthy donors. B18R was added to all cultures to block type I interferon signaling. [Figure 1E] E - Top panel (right and left) - Amplification (MOI 1) of vesicular stomatitis virus (VSV GFP-positive) within infected macrophages was evaluated by incubating and measuring the total GFP intensity over time. The left panel shows a representative incubating image of a GFP-positive infected cell 2 days after infection. Bottom panel - Viral titer (pfu / ml) of supernatant derived from infected cells determined by VERO plaque assay (representative plaque images are shown). All data are representative of independent experiments performed using macrophages differentiated from monocytes selected from n=5 healthy donors. B18R was added to all cultures to block type I interferon signaling. [Figure 1F]Amplification (MOI 0.2) of HIV-1 (NL4.3 ΔNef GFP-positive) and HIV-2 (ROD9 ΔNef GFP-positive) within F-infected macrophages was evaluated by measuring the total GFP intensity over time using incubators (upper graph). The lower panel shows representative incubators of GFP-positive infected cells 6 days after infection. In particular, small differences between GAS7 shRNA and control shRNA regarding HIV-1 amplification disappeared with the addition of B18R, indicating that in the absence of GAS7, type I interferon is produced in the culture medium in response to HIV-1. In contrast, the addition of B18R to culture medium exposed to HIV-2 had no effect on the viral amplification dynamics. [Figure 1G] G - Top panel - Amplification of Sendai (wild-type) in infected macrophages (0.04 hemagglutinin units / mL) was evaluated by microscopic observation of syncytial formation and cell death rate (63 hours after infection). The bottom panel shows quantitative reverse transcription PCR analysis of the expression of three viral genes (matrix protein, macro protein, and phosphorylated protein). B18R was added to all cultures to block type I interferon signaling. [Figure 1H] H-Top panel-The dynamics of Zyka (wild-type) infection within macrophages (MOI 3) were evaluated by flow cytometry after intracellular immunostaining for E protein 2, 4, and 6 days after infection. The bottom left panel shows cell mortality, and the bottom right panel shows viral titer (pfu / ml) of supernatant derived from infected cells determined by VERO plaque assay (representative plaque images are shown). All data are representative of independent experiments performed using macrophages differentiated from monocytes selected from n=5 healthy donors. B18R was added to all cultures to block type I interferon signaling. B18R was added to all cultures to block type I interferon signaling. [Figure 1I]I - Top panel - The dynamics of influenza (H3N2) infection in macrophages (MOI 0.5) were evaluated by flow cytometry after intracellular immunostaining for HA protein 8, 16, and 24 hours after infection. The lower left panel shows cellular mortality % (Aqua staining), and the lower right panel shows viral titer (pfu / ml) of supernatant derived from infected cells determined by VERO plaque assay (representative plaque images are shown). All data are representative of independent experiments performed using macrophages differentiated from monocytes selected from n=5 healthy donors. B18R was added to all cultures to block type I interferon signaling.
[0065] Examples: method cell Blood residue from cell isolation therapy derived from healthy adult donors was obtained from Etablissement Francais du Sang (EFS). All donors signed informed consent for the use of their blood for research purposes. Peripheral blood mononuclear cells were isolated by Ficol Park gradient centrifugation (GE Healthcare), and the purified monocyte population was isolated using CD14-positive magnetic beads (Milteny Biotech). To obtain monocyte-derived macrophages (MDM), cells were differentiated for 6 days in untreated petri dishes in MDM medium containing RPMI1640 (Gibco, Life Technologies) supplemented with 5% fetal bovine serum, 5% human serum antibody (Sigma-A), antibiotics, non-essential amino acids, sodium pyruvate (Gibco), and 50 ng / ml macrophage colony-stimulating factor (M-CSF, Milteny Biotech).
[0066] Virus production Particles encoding lentiviral shRNA were produced by transfection of 293FT cells in a T300 flask using a plasmid mix consisting of 5 μg CMV-VSVG (pMD2.G; 12259; Adgene), 11 μg packaging plasmid PSPAX2 (12260; Adgene), 0.6 μg Vpx-Vpr plasmid (laboratory cloned), and 16 μg Gas7-targeting shRNA (GCCCAGTCCAAATGGTTTGAA) encoding plasmid (pLKO.1), or a scrambled control purchased from Sigma. All plasmids were mixed in 5 ml Opti-MEM medium (Gibco) and 464 μl PEImax transfection reagent (Polysciences), and then added to 293FT cells for OVN. The transfection medium was removed, and MDM medium was added 24–48 hours prior to collection for lentiviral titer measurement using the GHOST X4R5 reporter cell line. The lentivirus was filtered through a 0.45 μm pore and stored at -80°C until use.
[0067] HIV-1 NL4-3 GFP and HIV-2 ROD9 GFP were produced, and their titers were measured using a 28.4 μg plasmid mix containing HIV proviral DNA, following similar protocols. HSV-1 VP26-GFP (KOS strain) virus was grown and amplified in VERO cells. Measles virus (MVSchw-ATU2-GFP strain) was provided by the Frederic Tangy Laboratory. Zika virus (pMR766 molecular clone) and Sindbis GFP virus (pTR339 molecular clone) were produced by reverse gene systems and kindly provided by Enzo Poirier. H3N2 influenza A virus (X31 strain) was provided by Sebastian Amigorena's team.
[0068] In vitro transduction and infection of human macrophages derived from monocytes Monocytes were transduced using 8 ml of collected lentivirus products and 8 μg / ml of protamine (Sigma-A). After 48 hours, 2 μg / mL of puromycin was added to differentiating macrophages to select successfully transformed cells. Cells were collected for the experiment on day 6 of differentiation.
[0069] Transduced macrophages were detached from petri dishes using acetase (Stem Cell Technologies) and placed in untreated 48-well plates. After 1 day, they were infected with either HSV-1 VP26-GFP, measles GFP, or VSV GFP at a MOI of 1. H3N2 influenza A infection was performed at a MOI of 0.5, Zika infection at a MOI of 3, and Sindbis GFP infection at a MOI of 10. Infection with all these viruses was performed according to the same protocol: incubation for 2 hours in fetal bovine serum-free RPMI medium at 37°C with intermittent shaking. The cells were then rinsed with 1x PBS and overlaid with fresh MDM medium.
[0070] Monocyte-derived macrophages seeded in MDM medium were infected with HIV by adding either HIV-1 NL4-3-GFP at an MOI of 1.0 or HIV-2 ROD9-GFP at an MOI of 1.0. After 16 hours, the culture medium was replaced, and the infection was allowed to progress for a further 8 days.
[0071] Infection with GFP-positive virus was monitored by measuring the integrated intensity of green fluorescence over time in images taken every two hours at 20x magnification using Incucyte® imaging. The infection dynamics of wild-type virus were performed by flow cytometry staining at various time points ranging from 6 hours to 6 days after infection. In short, infected macrophages were detached after treatment with accutase and stained at 4°C in 1x PBS, 0.5% bovine serum albumin, and 0.1% sodium azide with the following antibodies: FITC rabbit polyclonal anti-flavivirus antibody and mouse monoclonal anti-hemagglutinin antibody conjugated to APC. After washing and subsequent fixation in 4% paraformaldehyde, cell acquisition was performed using NovoSite 3000 (Agilent). Flow data were analyzed using FlowJo.
[0072] result: Our research using GAS7 shows that its expression within macrophages restricts the replication of viral pathogens belonging to all major viral groups. We demonstrate that the antiviral activity of GAS7 exists even under conditions where the classical antiviral response mediated by type I interferon is neutralized. This suggests that GAS7 may be involved in the activation of macrophage autophagy through an uncharacterized mechanism that we are currently investigating. In particular, we show that in human monocyte-derived macrophages, silencing of GAS7 boosts the replication of several viral pathogens representing most relevant viral groups (Figures 1A-1I). These include the retroviruses HIV-1 and HIV-2 (Figure 1F), the RNA viruses Zika virus (positive-sense single-stranded RNA) (Figure 1H), Sindbis virus (positive-sense single-stranded RNA) (Figure 1D), Sendai virus (negative-sense single-stranded RNA) (Figure 1G), VSV virus (vesicular stomatitis virus) (negative-sense single-stranded RNA) (Figure 1E), and measles virus (negative-sense single-stranded RNA) (Figure 1C), influenza virus (H3N2) (Figure 1I), and the DNA virus HSV-1 (double-stranded DNA) (Figure 1B). Importantly, the antiviral activity of GAS7 is present even under conditions where type I interferon is neutralized by the addition of the B18R protein (which efficiently blocks the type I receptor). Furthermore, we demonstrate that by forcing macrophages to overexpress GAS7, they are further protected from HIV-1 infection compared to cells expressing normal levels of this factor.
[0073] References: Throughout this application, various references describe the latest technology in the field to which the present invention belongs. The disclosures of these references are incorporated into this disclosure by reference.
Claims
1. A method for modulating viral replication in a subject's cell population, comprising the step of modulating the expression and / or activity of GAS7 in the cell population.
2. The method according to claim 1, wherein the subject is a human or any other animal.
3. The method according to claim 1 or 2, wherein the cell population is selected from the group consisting of macrophages, dendritic cells, or neurons.
4. The aforementioned viruses belong to the following family: - Coronavirus family, especially coronavirus genus, e.g., SARS virus or SARS-CoV-2 virus; - Retroviruses, particularly lentiviruses and oncoviruses, such as HTLV-1 virus; - Viruses of the Flaviviridae family, particularly the Flavivirus genus, which include in particular dengue virus, Zika virus, yellow fever virus, and viruses that cause viral encephalitis, such as West Nile virus, Japanese encephalitis virus, and St. Louis encephalitis virus; or in particular viruses of the Hepacivirus genus, such as hepatitis C virus; - Orthomyxoviruses, which include influenza viruses (H1N1, H1N2, H2N2, H2N3, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N6, H5N8, H5N9, H6N1, H6N2, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, and H10N7, etc.); - Viruses of the Paramyxoviridae family, especially those of the Morbillivirus genus, particularly measles virus, and respiratory viruses including Sendai virus (SeV) and human parainfluenza virus, and viruses of the Pneumovirus genus, such as human respiratory syncytial virus and metapneumovirus; - Viruses of the Reoviridae family, especially the rotavirus genus; - Viruses of the Picornaviridae family, especially the Enterovirus genus, such as poliovirus and viruses that cause viral meningitis, and non-enveloped viruses such as coxsackievirus, aphthous fever virus, and rhinovirus; or especially viruses of the Hepatovirus genus, such as hepatitis A virus; - Filoviridae, especially Ebola virus or Marburg virus; - Arenaviridae family, especially Lassa virus; - Rhabdoviridae, particularly viruses of the genus Rhabdovirus, including rabies virus, and viruses of the genus Vediclovirus, including vesicular stomatitis virus; Togaviridae, particularly the genus Rubivirus, including rubella virus, and the genus Alphavirus, including Sindbisvirus; Poxviridae, particularly vaccinia virus and smallpox virus; - Herpesviridae, especially herpes type 1 or 2, varicella-zoster virus; and Hepadnaviridae, such as hepatitis B virus; hepatitis D virus; - Or the Hepaviridae family, for example, hepatitis E virus The method according to any one of claims 1 to 3, wherein the virus is selected from among.
5. The method according to any one of claims 1 to 3, wherein the virus is a human retrovirus, particularly a human lentivirus, more specifically a human immunodeficiency (HIV) virus, such as HIV-1 or HIV-2, preferably HIV-1.
6. A method for reducing the viral replication ability in a cell population, comprising the step of increasing the expression and / or activity of GAS7 in the cell population, according to any one of claims 1 to 5.
7. The method according to claim 6, comprising using one or more agents(s) that increase the expression and / or activity of GAS7.
8. The method according to claim 7, wherein the agent that increases the expression and / or activity of GAS7 is i) a polypeptide comprising an amino acid sequence having at least 90% identity with an amino acid sequence such as that shown in SEQ ID NO: 1, fused to a cell-permeable peptide, or ii) a polynucleotide encoding such a polypeptide.
9. A method for increasing the replication ability of a virus in a cell population, comprising the step of reducing the expression and / or activity of GAS7 in the cell population, according to any one of claims 1 to 5.
10. The method according to claim 9, wherein the agent that reduces the expression and / or activity of GAS7 is i) a polypeptide comprising an amino acid sequence having at least 90% identity with an amino acid sequence such as that shown in SEQ ID NO: 1, fused to a cell-permeable peptide, or ii) a polynucleotide encoding such a polypeptide, wherein the polypeptide or polynucleotide is a dominant-negative polypeptide or polynucleotide of GAS7.
11. The method according to claim 9, wherein the agent that reduces the expression and / or activity of GAS7 is a molecule that partially or completely blocks, inhibits, or neutralizes the biological activity or expression of GAS7.
12. The method according to claim 11, wherein the agent for reducing the expression and / or activity of GAS7 comprises, but is not limited to, an antisense polynucleotide, interfering RNA, catalytic RNA, RNA-DNA chimera, GAS7-specific aptamer, anti-GAS7 antibody, GAS7-binding fragment of anti-GAS7 antibody, GAS7-binding small molecule, GAS7-binding peptide, and other polypeptides that specifically bind to GAS7 (including, but not limited to, GAS7-binding fragments of one or more GAS7 ligands fused to one or more additional domains, as may be the case).
13. The method according to claim 11, wherein the agent that reduces the expression and / or activity of GAS7 is an endonuclease such as a CRISPR endonuclease (e.g., CAS9) having a designed guide RNA molecule.
14. Use of the method according to any one of claims 6 to 8 for the prevention or treatment of viral infection in a subject for which such use is required.
15. Use of the method according to any one of claims 9 to 13 for vaccine production.
16. A method for screening agents that can reduce the replication ability of a virus in a cell population, comprising the steps of: i) contacting a cell population with a plurality of test substances; and ii) selecting a substance(s) that can increase the expression and / or activity of GAS7 in the cell population.
17. A method for screening agents that can increase the replication ability of a virus in a cell population, comprising the steps of: i) contacting a cell population with a plurality of test substances; and ii) selecting a substance(s) that can reduce the expression and / or activity of GAS7 in the cell population.