Cluiveromyces marcianus strain and its use

The Kluyveromyces marxianus strain AMCC31343, developed via mutagenesis, addresses the limitation of single flavor production by Kluyveromyces marxianus strains, achieving enhanced aroma profiles in food products through increased production of phenylethyl acetate, phenylethyl alcohol, and acetoin, while maintaining high temperature tolerance.

JP2026516529APending Publication Date: 2026-05-25ANGEL YEAST CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025567925
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-19
Filing Date
2024-06-20
Publication Date
2026-05-25

AI Technical Summary

Technical Problem

Kluyveromyces marxianus strains in prior art produce relatively single flavor substances or at low concentrations, failing to meet the diverse flavor needs in food applications.

Method used

Development of Kluyveromyces marxianus strain AMCC31343, obtained through ARTP mutagenesis, which enhances the production of flavor substances like phenylethyl acetate and phenylethyl alcohol by up to 15.9% and 25.9%, respectively, and introduces new aromas such as acetoin and 2,3-butanedione.

Benefits of technology

The strain AMCC31343 generates a high concentration of various flavor substances, including acetoin and phenylethyl alcohol, effectively enhancing the aroma profiles in products like bread and yogurt, and maintaining high temperature tolerance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026516529000008
    Figure 2026516529000008
  • Figure 2026516529000009
    Figure 2026516529000009
  • Figure 2026516529000010
    Figure 2026516529000010
Patent Text Reader

Abstract

This invention relates to the Kluyveromyces marxianus strain and its use, wherein the Kluyveromyces marxianus strain is Kluyveromyces marxianus AMCC30648, deposited with the China Center for the Preservation of Typical Cultures (CCTCC) with deposit number CCTCC NO:M 20222108, or Kluyveromyces marxianus AMCC31343, deposited with the China Center for the Preservation of Typical Cultures (CCTCC) with deposit number CCTCC NO:M 20222111. The Kluyveromyces marxianus strain is characterized by producing a variety of flavor substances at high concentrations. It can be used in fields such as brewing, beverages, and bakeries.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microorganisms, and specifically relates to Kluyveromyces marxianus strain and its use.

Background Art

[0002] Kluyveromyces marxianus is one of the non-traditional yeasts commonly isolated from fermented traditional dairy products, beer wort and grapes. Kluyveromyces marxianus has the abilities of enzyme production, high temperature resistance, high safety, a wide substrate application range, and can produce aromatic compounds such as ethyl acetate, imparting a unique aroma to products. It is a microorganism that is relatively widely used in the food industry and is recognized as harmless to the human body.

Summary of the Invention

Problems to be Solved by the Invention

[0003] In the prior art, Kluyveromyces marxianus produces relatively single flavor substances or the content of the produced flavor substances is low, unable to meet the needs.

Means for Solving the Problems

[0006] Preferably, the ITS gene sequence of the Cluyveromyces marcianus AMCC30648 strain is shown in Sequence ID No. 1.

[0007] Preferably, the ITS gene sequence of the Cluyveromyces marcianus AMCC31343 strain is shown in Sequence ID No. 2.

[0008] In a second embodiment, the present invention provides a method for the fermentation production of a Cluyberomyces marcianus fungal agent, the method comprising the step of culturing the Cluyberomyces marcianus strain.

[0009] Preferably, the manufacturing method is Step (1) involves amplifying and culturing the aforementioned Kluiveromyces marsianus strain, The process includes step (2), which involves adding the product obtained in step (1) to a culture medium and fermenting it under conditions of 26-42°C.

[0010] Preferably, the culture medium is a liquid medium or a solid medium.

[0011] In a third embodiment, the present invention provides a fungal agent containing the above-mentioned Cluyveromyces marcianus strain.

[0012] Preferably, the microbial agent is obtained by the fermentation production method described above.

[0013] In a fourth embodiment, the present invention provides the use of the aforementioned Cluyberomyces marcianus strain or the aforementioned fungal agent in fermentation.

[0014] In a fifth embodiment, the present invention provides the use of the aforementioned Cluyberomyces marcianus strain or the aforementioned fungal agent in the fermentation of dairy products, the fermentation production of alcoholic beverages, or the fermentation of noodle products.

[0015] In a sixth embodiment, the present invention provides a fabric containing the above-mentioned Cluyberomyces marcianus strain or the above-mentioned fungal agent.

[0016] Preferably, the dough contains one or more of the following: acetoin, phenylethyl alcohol, isoamyl acetate, phenylethyl acetate, ethyl acetate, ethyl caprylate, and phenylethyl isobutyrate.

[0017] In a seventh embodiment, the present invention provides a prepared dough characterized by containing the above-mentioned Cluyveromyces marcianus strain or the above-mentioned fungal agent.

[0018] Preferably, the prepared mixture contains one or more of the following: acetoin, phenylethyl alcohol, isoamyl acetate, phenylethyl acetate, ethyl acetate, ethyl caprylate, and phenylethyl isobutyrate.

[0019] Preferably, the mass ratio of the Cluyberomyces marcianus strain, wheat flour, and water in the prepared dough is 0.1-5:200-500:500-1000.

[0020] In the eighth embodiment, the present invention provides a noodle product, wherein the fermentation agent for the noodle product includes the aforementioned Cluyberomyces marcianus strain or the aforementioned fungal agent.

[0021] Preferably, the noodle product contains one or more combinations of acetoin, phenylethyl alcohol, and 2,3-butanedione.

[0022] In a ninth embodiment, the present invention provides a fermentation liquid, the fermentation agent of the fermentation liquid comprising the aforementioned Cluyberomyces marcianus strain or the aforementioned fungal agent.

[0023] Preferably, the fermentation broth contains phenylethyl acetate, phenylethyl alcohol, ethyl acetate, isoamyl acetate, farnesol, phenylethyl isobutyrate, and ethyl caprylate.

[0024] In a tenth aspect, the present invention provides a liquor, and the fermentation agent for the liquor contains the above-mentioned Kluyveromyces marxianus strain or the above-mentioned agent.

Advantages of the Invention

[0025] The Kluyveromyces marxianus strain provided by the present invention is characterized by generating various flavor substances and having a high concentration. It can be used in application fields such as brewing, beverages, and bakeries. When noodles are produced using the strain provided by the present invention, acetoin having a butter fragrance, and phenylethyl alcohol, phenylethyl acetate, etc. having a fruit fragrance can be generated.

[0026] Microorganism deposit information The Kluyveromyces marxianus AMCC30648 strain (Kluyveromyces marxianus AMCC30648) in the present invention was deposited at the China Center for Type Culture Collection (CCTCC) on December 30, 2022, with the deposit number CCTCC NO: M 20222108, and the deposit address: Wuhan University, China, postal code: 430072, mobile phone: 027 - 68754052

[0027] The Kluyveromyces marxianus AMCC31343 strain (Kluyveromyces marxianus AMCC31343) provided by the present invention was deposited at the China Center for Type Culture Collection (CCTCC) on December 30, 2022, with the deposit number CCTCC NO: M 20222111, and the deposit address: Wuhan University, China, postal code: 430072, mobile phone: 027 - 68754052

Brief Description of the Drawings

[0028] [Figure 1]This figure shows the colony morphology of the Cluiveromyces marsianus strain AMCC30648. [Figure 2] This figure shows a microscopic observation of the Cluiveromyces marsianus strain AMCC30648. [Figure 3] This figure shows the colony morphology of the Cluiveromyces marsianus strain AMCC31343. [Figure 4] This figure shows a microscopic observation of the Cluyberomyces marsianus strain AMCC31343. [Figure 5] This chart compares the flavor substance content in fermented dough from Cluyveromyces marsianus strain AMCC31343 with that of a commercially available strain. A shows a comparison of acetoin content, and B shows a comparison of phenylethyl alcohol content. [Figure 6] This chart compares the flavor substance content in fermented steamed buns made from the Cluyveromyces marsianus strain AMCC31343 with that of commercially available strains. A shows a comparison of acetoin content, and B shows a comparison of phenylethyl alcohol content. [Modes for carrying out the invention]

[0029] The strain provided in this invention is obtained by performing ARTP mutagenesis selection on the flavor-enhancing Kluyveromyces marcianus AMCC30648 strain, which was isolated and identified. Compared to the parent strain, the Kluyveromyces marcianus AMCC31343 strain provided in this invention has a 15.9% increase in the content of phenylethyl acetate, a 25.9% increase in the content of phenylethyl alcohol, and a 144.6% increase in the content of phenylethyl alcohol, which are flavor substances produced by the Kluyveromyces marcianus AMCC31343 strain provided in this invention can be used in various fields such as the production of flavored bread and the fermentation of flavored yogurt, and its effects are remarkable.

[0030] The composition of the culture medium components in the example is as follows: YPD medium: 10g yeast extract powder, 20g glucose, 20g peptone, 20g agar, 1000mL water, sterilized at 115°C for 30min; Tables 1 and 2 show the sources of the reagents and equipment used in the examples of the present invention.

[0031] Reagent Information Table [Table 1]

[0032] Equipment information table [Table 2]

[0033] (Example 1: Acquisition of Cluiveromyces marsianus strain AMCC31343) Fermented dairy products from Shannan City, Tibet Autonomous Region, China were dissolved in sterile water and mixed uniformly. The bacterial suspension was then aspirated and diluted 10 times in a series. -5 , 10 -6A bacterial suspension was prepared, spread onto YPD medium, and incubated at 30°C for 40 hours. Slides were prepared, and the yeast morphology was observed under a microscope. Simultaneously, the characteristics of single colonies on the plates were observed. A strain exhibiting typical yeast colony characteristics was isolated, streaked, purified, inoculated onto YPD slant medium, and stored at 4°C. Observation revealed that one strain's colony had a cheese-like texture, a milky white color, a smooth surface, and an oval, elongated microscopic morphology. Microscopic observation confirmed that it reproduced by budding. The yeast strain genome was extracted, and ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3) (sequence number 3) and ITS4 (5'-TCCTCCGCTTATTGATATGC-3') (sequence number 4) were used as primers. The PCR program involved pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 55°C for 45 s, extension at 72°C for 90 s for 30 cycles, and finally extension at 72°C for 10 min. This was used to amplify the yeast internal transcription spacer (ITS) sequence. After detection by 1% gel electrophoresis and sequencing, the sequence was compared with the sequence on GenBank using Blast analysis. If the sequence similarity exceeded 99%, it was considered the same species. Based on the results combined with morphological analysis and molecular biological identification, the strain was identified as Kluyveromyces marcianus. The strain is Kluyveromyces marxianus AMCC30648. Figure 1 shows the colony morphology of Kluyveromyces marxianus AMCC30648, and Figure 2 shows a microscopic observation of Kluyveromyces marxianus AMCC30648. This Kluyveromyces marxianus AMCC30648 strain was deposited with the China Center for the Preservation of Typical Cultures (CCTCC) on December 30, 2022, with deposit number CCTCC NO:M 20222108.

[0034] The ITS sequence of the *Cluiveromyces marsianus* strain AMCC30648 is shown in Sequence ID No. 1.

[0035] Mutagenesis using ARTP (atmospheric pressure, room temperature plasma) was performed on the Kluiveromyces marcianus AMCC30648 strain, and the mutagenesis conditions were as follows. The processing distance was 2 mm, processing power was 120 W, gas flow rate was 10 SLM, spot volume was 10 μL, and processing times were 0 s, 30 s, 60 s, 90 s, 120 s, 150 s, and 180 s, respectively. After processing, the samples were shaken for 1 minute in a vortex shaker, diluted, and inoculated onto YPD plates. They were cultured at 30°C for 24 hours, and the plate colonies were counted to create a lethal curve. Single colonies with a lethality of 85% to 99% were extracted and inoculated onto YPD plates for liquid fermentation. They were cultured at 30°C and 180 rpm for 20 hours, and flavor substances in the fermentation supernatant were detected by GC-MS. Combined with biomass analysis and comparison, a mutant strain with a 15% increase in the concentration of phenylethyl acetate and phenylethyl alcohol compared to the parent strain was selected and named Kluyveromyces marxianus AMCC31343. The colonies of Cluyberomyces marsianus strain AMCC31343 have a uniform texture, are milky white in color, have a smooth surface, and exhibit an oval shape under microscopic observation. Microscopic observation confirmed that they reproduce by budding. Figure 3 shows the colony morphology of Cluyberomyces marsianus strain AMCC31343, and Figure 4 shows the microscopic observation of Cluyberomyces marsianus strain AMCC31343. This Cluyberomyces marsianus strain AMCC31343 was deposited with the China Center for the Preservation of Typical Cultures (CCTCC) on December 30, 2022, with deposit number CCTCC NO:M 20222111.

[0036] Using ITS5(5'-GGAAGTAAAAGTCGTAACAAGG-3') (sequence number 3) and ITS4(5'-TCCTCCGCTTATTGATATGC-3') (sequence number 4) as primers, the PCR program involved pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, annealing at 55°C for 45 s, extension at 72°C for 90 s for 30 cycles, and finally extension at 72°C for 10 min. This was used to amplify the internal transcription spacer (ITS) sequence of yeast, followed by detection and sequencing by 1% gel electrophoresis. The ITS sequence of Cluyberomyces marcianus strain AMCC31343 is shown in Sequence Number 2.CCTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGATTATGAATGAATAGATTACTGGGGGAATCGTCTGAACAAGGCCTGCGCTTAATTGCGCGGCCAGTTCTTGATTCTCTGCTATCAGTTTTCTATTTCTCATCCTAAACACAATGGAGTTTTTTCTCTATGAACTACTTCCCTGGAGAGCTCGTCTCTCCAGTGGACATAAACACAAACAATATTTTGTATTATGAAAAACTATTATACTATAAAATTTAATATTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATATGTATTGTGAATTGCAGATTTTCGTGAATCATCAAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAACCTTTGGGTTTGGTAGTGAGTGATACTCGTCTCGGGTTAACTTGAAAGTGGCTAGCCGTTGCCATCTGCGTGAGCAGGGCTGCGTGTCAAGTCTATGGACTCGACTCTTGCACATCTACGTCTTAGGTTTGCGCCAATTCGTGGTAAGCTTGGGTCATAGAGACTCATAGGTGTTATAAAGACTCGCTGGTGTTTGTCTCCTTGAGGCATACGGCTTTAACCAAAACTCTCAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA。

[0037] (Analysis of the growth status of Kluyveromyces marxianus AMCC31343 strain in Example 2) (1) Growth curve analysis: Cluyberomyces marsianus strain AMCC31343 and the parent strain Cluyberomyces marsianus strain AMCC30648 were inoculated into test tubes containing 5 mL of YPD liquid medium and cultured at 30°C and 180 rpm for 24 hours. They were then inoculated again into 100-well culture plates containing 300 μL of YPD liquid medium at a 3% inoculation rate. A Bioscreen C apparatus was prepared and set up for measurement, with parameters set to 30°C, 24 hours, and 600 nm wavelength. Data was measured every 30 minutes, and then the growth curve was measured. OD600 nm Growth was defined as an increase rate exceeding 50%. (ii) Biomass analysis: Cluyberomyces marsianus strain AMCC31343 and the parent strain Cluyberomyces marsianus strain AMCC30648 were inoculated into test tubes containing 5 mL of YPD liquid medium and incubated at 30°C and 180 rpm for 24 hours. They were then inoculated at a 0.5% dose into 300 mL of YPD liquid medium in Erlenmeyer flasks and incubated at 30°C and 180 rpm for 24 hours. μ is the maximum specific growth rate, and the calculation formula is as follows: μ = (InOD2 - InOD1) / (t2 - t1) OD1 - Initiation of logarithmic growth phase OD2 - End of logarithmic growth phase

[0038] Comparison of growth status of Cluyberomyces marcianus strain AMCC31343 and the parent strain. [Table 3]

[0039] As is clear from the results in Table 3, under 30°C conditions, the maximum specific growth rate and OD value of Cluiveromyces marsianus AMCC31343 and Cluiveromyces marsianus AMCC30648 were not significantly different compared to AMCC30648, and the biomass index increased by 3.8%.

[0040] (Example 3: Temperature tolerance analysis of Cluyveromyces marsianus AMCC31343 strain) Cluyberomyces marcianus strain AMCC31343 and the parent strain Cluyberomyces marcianus strain AMCC30648 were each inoculated into test tubes containing 5 mL of YPD liquid medium and incubated at 30°C and 180 rpm for 24 hours. They were then inoculated again into 100-well culture plates containing 300 μL of YPD liquid medium at a 1% inoculation rate. A Bioscreen C apparatus was prepared and set up for measurement, with parameters set to 37°C, 24 hours, and 600 nm wavelength. Data was measured every 30 minutes, and then growth curves were measured (μ is the maximum relative growth rate, the calculation formula is the same as above). The 42°C temperature tolerance test was consistent with the steps above.

[0041] Growth data of Cluyberomyces marcianus strain AMCC31343 and the parent strain under different temperature conditions. [Table 4]

[0042] As is clear from the results, the Kluiveromyces marcianus AMCC31343 strain showed no significant difference in maximum specific growth rate or OD value at 37°C and 42°C compared to the parent strain, indicating that both strains possess high-temperature tolerance.

[0043] (Example 4: Analysis of volatile components in the fermentation supernatant) Cluyberomyces marcianus strain AMCC31343 and the parent strain Cluyberomyces marcianus strain AMCC30648 were inoculated into 5 mL of YPD liquid medium in test tubes and incubated at 30°C and 180 rpm for 20 hours. Then, a 0.5% inoculation was placed in 300 mL of YPD liquid medium in an Erlenmeyer flask and incubated at 30°C and 180 rpm for another 20 hours. The mixture was then centrifuged, the supernatant was collected, filtered through a 0.22 μm filter, and 10 mL of the filtrate was taken. 20 μL of internal standard solution (n-butyl acetate) was added to equalize the solution. The mixture was then mixed with a flow ratio of 40:1, the inlet temperature was 250°C, the detector temperature was 250°C, and an AT.LZP-930 baijiu column was used for chromatography. The column was initially maintained at 50°C for 2 minutes, then increased to 110°C at a rate of 5°C / min for 0 minutes, then increased to 130°C at a rate of 3°C / min for 0 minutes, and finally increased to 230°C at a rate of 15°C / min for 2 minutes. Volatile component analysis was performed, and the content of flavor substance components was compared to the parent strain, as shown in Table 5 below.

[0044] Comparative measurement of flavor substances in Cluyveromyces marcianus strain AMCC31343 and its parent strain using GC-MS. [Table 5]

[0045] As is clear from the results in Table 5, the main flavor substances detected in the fermentation liquid were esters and alcohols. Of these, phenylethyl acetate and phenylethyl alcohol mainly exhibited a rose aroma, while ethyl acetate, isoamyl acetate, farnesol, phenylethyl isobutyrate, and ethyl caprylate exhibited fruity aromas such as pear and banana. The increase in isoamyl acetate content in the fermentation liquid of Cluyveromyces marcianus AMCC31343 was the largest, increasing by 145% compared to the parent strain, and the content of phenylethyl acetate was the highest, increasing by 16% compared to the parent strain.

[0046] (Example 5: Analysis of flavor components of fermented wheat flour) The control strain is a commercially available low-sugar active dried yeast (5g / packet), and the bacterial species used in this product is Saccharomyces cerevisiae. 1. Preparation of the prepared dough: Cluyberomyces marsianus strain AMCC31343 and the control strain were inoculated at a 1% dose into Erlenmeyer flasks containing 300g of wheat flour and 700g of water, and incubated at 30°C and 200rpm for 24h, 48h, and 60h, respectively. 2. Preparation of the steamed buns: Add 60g of the prepared dough to an Erlenmeyer flask containing 300g of flour and 105g of water, knead until smooth, and once the dough has risen sufficiently, steam it in a 100°C steamer for 15 minutes. The dough and bun samples prepared at 24h, 48h, and 60h were centrifuged, the supernatant was collected, filtered through a 0.22 μm filtration medium, and 10 mL of the filtrate was taken. 20 μL of internal standard solution (n-butyl acetate) was added and mixed uniformly. A volatile component analysis was performed according to the following chromatographic conditions: flow ratio 40:1, inlet temperature 250°C, detector temperature 250°C, AT.LZP-930 baijiu column, initial column temperature 50°C maintained for 2 min, rising to 110°C at a rate of 5°C / min for 0 min, rising to 130°C at a rate of 3°C / min for 0 min, and rising to 230°C at a rate of 15°C / min for 2 min. Figure 5 and Table 6 show the content of flavor substances in the fermented dough, and Figure 6 and Table 7 show the content of flavor substances in the fermented bun. The analytical comparison of flavor components is as follows.

[0047] Comparison of the main flavor components of Cluyveromyces marcianus AMCC31343 strain in fermented dough. [Table 6]

[0048] Comparison of the main flavor components of Cluyveromyces marsianus AMCC31343 strain in fermented steamed buns. [Table 7]

[0049] As is clear from the results in Figure 5 and Table 6, at the fermentation stage, most of the flavor substances produced by the Cluyveromyces marcianus AMCC31343 strain are alcohols and esters, mainly phenylethyl alcohol, ethyl acetate, and acetoin. Of these, phenylethyl alcohol exhibits a rose aroma, ethyl acetate exhibits a fruity aroma, and acetoin exhibits a buttery taste. The concentration changes of the main flavor substances also differ with increasing fermentation time. In the initial stage (24h) of the fermented dough, the content of each flavor substance was low. As the fermentation time increased, by the mid-stage (48h), the phenylethyl alcohol content of strain AMCC31343 gradually increased, while acetoin reached its highest concentration. By the final stage (60h), the flavor substances in the fermented dough of the commercially available strain began to decrease, while the phenylethyl alcohol content of strain AMCC31343 remained high, 38% higher than that of the commercially available strain. The ethyl acetate content increased by 374% compared to the commercially available strain, and the acetoin content increased by 1535% compared to the commercially available strain.

[0050] As is clear from the flavor substance analysis results of fermented steamed buns in Figure 6 and Table 7, in steamed buns produced at different fermentation times, the acetoin concentration of the commercially available strain was relatively low and the content continued to decrease, while the acetoin content of the Kluyberomyces marcianus AMCC31343 strain continued to increase. Of these, the Kluyberomyces marcianus AMCC31343 strain was able to produce 2,3-butanedione, which has a creamy aroma, at different fermentation times, while this flavor substance was not detected in the commercially available strain. In steamed buns obtained after 60 hours of fermentation, the amount of this substance produced by the Kluyberomyces marcianus AMCC31343 strain was 107 times higher than that of the commercially available strain. Therefore, flavor powders and other related products prepared with the Kluyberomyces marcianus AMCC31343 strain have a superior flavor in long-term fermentation and can impart butter, rose, and fruit aromas to the product.

[0051] The foregoing are merely preferred embodiments of the present invention and do not limit the invention in any way. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the invention are all within the scope of protection of the present invention.

[0052] (Note) (Note 1) It is a strain of Cluiveromyces marcianus, and it is This is strain Kluyveromyces marxianus AMCC30648, deposited with the China Center for the Preservation of Typical Cultures (CCTCC), with deposit number CCTCC NO:M 20222108. Alternatively, a Kluyveromyces marxianus strain characterized by being strain AMCC31343, deposited with the China Center for the Preservation of Typical Cultures (CCTCC), with deposit number CCTCC NO:M 20222111.

[0053] (Note 2) The strain described in Appendix 1, characterized in that the ITS gene sequence of the Cluyberomyces marcianus AMCC30648 strain is shown in Sequence ID No. 1.

[0054] (Note 3) The strain described in Appendix 1, characterized in that the ITS gene sequence of the Cluyberomyces marcianus AMCC31343 strain is shown in Sequence ID No. 2.

[0055] (Note 4) A method for fermenting a Kluiveromyces marsianus fungal agent, characterized by comprising the step of culturing a Kluiveromyces marsianus strain described in any one of the appendices 1 to 3.

[0056] (Note 5) Step (1) involves amplifying and culturing a Kluiveromyces marcianus strain described in any one of the appendices 1 to 3, Step (2) involves adding the product obtained in step (1) to a culture medium and fermenting it under conditions of 26-42°C. Preferably, the culture medium is a liquid culture medium or a solid culture medium, as described in Appendix 4.

[0057] (Note 6) A fungicide characterized by containing the Kluiveromyces marcianus strain described in any one of the appendices 1 to 3.

[0058] (Note 7) The microbial agent according to Appendix 6, characterized in that it is obtained by a fermentation manufacturing method described in Appendix 4 or 5.

[0059] (Note 8) Use of the Kluiveromyces marcianus strain described in any one of the appendices 1-3 or the fungal agent described in appendice 6 or 7 during fermentation.

[0060] (Note 9) Use of the Cluyberomyces marcianus strain described in any one of Appendix 1 to 3 or the fungal agent described in Appendix 6 or 7 in the fermentation of dairy products, the fermentation production of alcoholic beverages, or the fermentation of noodle products.

[0061] (Note 10) A fabric characterized by containing the Cluyveromyces marcianus strain described in any one of the appendices 1 to 3, or the fungal agent described in appendice 6 or 7.

[0062] (Note 11) The fabric according to Appendix 10, characterized in that the fabric contains one or more of the following: acetoin, phenylethyl alcohol, isoamyl acetate, phenylethyl acetate, ethyl acetate, ethyl caprylate, and phenylethyl isobutyrate.

[0063] (Note 12) A dough characterized by containing the Kluiveromyces marcianus strain described in any one of the appendices 1 to 3, or the fungal agent described in appendice 6 or 7.

[0064] (Note 13) The prepared dough according to Appendix 12, characterized in that the prepared dough contains one or more of the following: acetoin, phenylethyl alcohol, isoamyl acetate, phenylethyl acetate, ethyl acetate, ethyl caprylate, and phenylethyl isobutyrate.

[0065] (Note 14) The prepared dough according to Appendix 12 or 13, characterized in that the mass ratio of the Cluyberomyces marcianus strain, wheat flour, and water in the prepared dough is 0.1-5:200-500:500-1000.

[0066] (Note 15) A noodle product characterized in that the fermentation agent for the noodle product contains the Kluiveromyces marcianus strain described in any one of the appendices 1 to 3 or the fungal agent described in appendice 6 or 7.

[0067] (Note 16) The noodle product according to Appendix 15, characterized in that the noodle product contains one or more combinations of acetoin, phenylethyl alcohol, and 2,3-butanedione.

[0068] (Note 17) A fermented liquid characterized in that the fermenting agent of the fermented liquid contains the Kluiveromyces marcianus strain described in any one of the appendices 1 to 3 or the agent described in appendice 6 or 7.

[0069] (Note 18) The fermentation liquid according to Appendix 17, characterized in that it contains phenylethyl acetate, phenylethyl alcohol, ethyl acetate, isoamyl acetate, farnesol, phenylethyl isobutyrate, and ethyl caprylate.

[0070] (Note 19) Alcohol, characterized in that the fermentation agent of the alcohol contains the Kluiveromyces marcianus strain described in any one of the appendices 1 to 3 or the fungal agent described in appendice 6 or 7.

Claims

1. It is a strain of Cluiveromyces marsianus, and it is This is strain Kluyveromyces marxianus AMCC30648, deposited with the China Center for the Preservation of Typical Species Cultures (CCTCC), with deposit number CCTCC NO: M 20222108. Alternatively, a Kluyveromyces marxianus strain characterized by being Kluyveromyces marxianus AMCC31343, deposited with the China Center for the Preservation of Typical Cultures (CCTCC), with deposit number CCTCC NO: M 20222111.

2. The strain according to claim 1, characterized in that the ITS gene sequence of the Cluyberomyces marsianus AMCC30648 strain is shown in Sequence ID No.

1.

3. The strain according to claim 1, characterized in that the ITS gene sequence of the Cluyberomyces marsianus AMCC31343 strain is shown in Sequence ID No.

2.

4. A method for fermenting a Cluyberomyces marsianus fungal agent, characterized by comprising the step of culturing the Cluyberomyces marsianus strain described in any one of claims 1 to 3.

5. Step (1) of amplifying and culturing the Kluiveromyces marsianus strain described in any one of claims 1 to 3, Step (2) involves adding the product obtained in step (1) to a culture medium and fermenting it under conditions of 26-42°C. Preferably, the culture medium is a liquid culture medium or a solid culture medium, characterized in that the method of production according to claim 4.

6. A fungicide characterized by containing the Kluiveromyces marcianus strain described in any one of claims 1 to 3.

7. The microbial agent according to claim 6, characterized in that it is obtained by including the fermentation production method described in claim 4 or 5.

8. Use of the Cluyberomyces marcianus strain described in any one of claims 1 to 3 or the fungal agent described in claim 6 or 7 in fermentation.

9. Use of the Cluyberomyces marcianus strain described in any one of claims 1 to 3 or the fungal agent described in claim 6 or 7 in the fermentation of dairy products, the fermentation production of alcoholic beverages, or the fermentation of noodle products.

10. A fabric characterized by containing the Kluiveromyces marcianus strain described in any one of claims 1 to 3 or the fungal agent described in claim 6 or 7.

11. The fabric according to claim 10, characterized in that the fabric contains one or more of the following: acetoin, phenylethyl alcohol, isoamyl acetate, phenylethyl acetate, ethyl acetate, ethyl caprylate, and phenylethyl isobutyrate.

12. A dough characterized by containing the Kluiveromyces marcianus strain described in any one of claims 1 to 3 or the fungal agent described in claim 6 or 7.

13. The prepared dough according to claim 12, characterized in that the prepared dough contains one or more of the following: acetoin, phenylethyl alcohol, isoamyl acetate, phenylethyl acetate, ethyl acetate, ethyl caprylate, and phenylethyl isobutyrate.

14. The prepared dough according to claim 12 or 13, characterized in that the mass ratio of the Kluyberomyces marsianus strain, wheat flour, and water in the prepared dough is 0.1 to 5:200 to 500:500 to 1000.

15. A noodle product characterized in that the fermentation agent for the noodle product contains the Kluiveromyces marcianus strain described in any one of claims 1 to 3 or the fungal agent described in claim 6 or 7.

16. The noodle product according to claim 15, characterized in that the noodle product contains one or more combinations of acetoin, phenylethyl alcohol, and 2,3-butanedione.

17. A fermented liquid characterized in that the fermenting agent of the fermented liquid contains the Kluiveromyces marcianus strain described in any one of claims 1 to 3 or the fungal agent described in claim 6 or 7.

18. The fermentation liquid according to claim 17, characterized in that the fermentation liquid contains phenylethyl acetate, phenylethyl alcohol, ethyl acetate, isoamyl acetate, farnesol, phenylethyl isobutyrate, and ethyl caprylate.

19. Alcohol, characterized in that the fermentation agent for the alcohol contains the Kluiveromyces marcianus strain described in any one of claims 1 to 3 or the microbial agent described in claim 6 or 7.