CA-IX aptamers and their diagnostic and therapeutic uses

Abstract

The present invention provides nucleic acid aptamers, derivatives and conjugates thereof that bind to carbonic anhydrase IX (CA-IX), and their use as diagnostic tools, particularly for imaging of organs and tissues that express CA-IX, or as therapeutic agents for the prevention or treatment of diseases associated with CA-IX.

Description

[Technical field]

[0001] The present invention provides nucleic acid aptamers that bind to carbonic anhydrase IX (CA-IX), their derivatives and conjugates, and their use as diagnostic tools (particularly for imaging of organs and tissues expressing CA-IX) or as therapeutic agents for the prevention or treatment of CA-IX-related diseases. [Background technology]

[0002] Aptamers Recently, functional oligonucleotide-based biomolecules called aptamers have attracted great interest as potential alternatives to antibodies. The technique of aptamer selection has attracted the attention of the scientific community because of its application in disease diagnosis and treatment.

[0003] Oligonucleotide aptamers are about 20 to about 80 bases in size (8 to 25 kDa), and their structure involves intramolecular interactions (Levy-Nissenbaum E. et al., Trends Biotechnol. 2008, 26(8), 442-449). Aptamers bind to targets through interactions between aromatic compounds, base pairing by hydrogen ligation, van der Waals interactions, and electrostatic interactions between charged groups or hydrogen bonds. As a result, aptamers undergo conformational changes after target recognition and biomolecular interaction.

[0004] These biological, physical and chemical properties make these oligonucleotides effective recognition tools for diagnosis and therapy. The application of aptamers in the biological field is mainly limited due to degradation by ribozymes. Chemical modifications are necessary to protect them from nucleases, improve their thermal stability and their pharmacokinetic properties.

[0005] Modifications include exchanging the 2'-OH of ribose to a 2'-F or 2'-NH2 group to improve the stability of the aptamer in the cellular environment. Other modifications of aptamers include capping the termini with small molecules such as amines, phosphate groups, or thymidine or other unnatural base residues (Gao S. et al, Anal. Bioanal. Chem. 2016, 408(17), 4567-4573).

[0006] Aptamers are selected in vitro by the Systematic Evolution of Ligands by EXponential enrichment (SELEX) method, which was described simultaneously by Tuerk and Gold (Science, 1990, 249, 505-510) and Ellington and Szostak (Nature, 1990, 346, 818-822). The SELEX method involves the progressive selection of aptamers by repeated cycles of binding, elution, and amplification of ligands from a random nucleic acid library to select sequences with higher binding affinity to a selected target.

[0007] A new application of this technology, called "cell-SELEX", has been developed to select aptamers that bind to specific target cells (de Franciscis V. et al., Methods Mol Biol., 2016, 1380, 33-46). Selection parameters can be easily manipulated to obtain more efficient aptamers for different conditions (e.g., pH, temperature, buffer composition, etc.) (Radom F. et al, Biotechnol. Adv. 2013, 31(8), 1260-1274). The traditional SELEX method includes several modifications, such as affinity chromatography, capillary electrophoresis, and membrane filtration, to maximize affinity and specificity and increase the speed and success rate of selection of specific aptamers (Stoltenburg R et al, Biomol. Eng. 2007, 24(4), 381-403). The properties of the selected oligonucleotides are identified using a variety of physical, chemical, and biological assays (Song KM et al, Sensors, 2012, 12(1), 612-631). Once selected, they can be synthesized in large quantities by chemical reactions with high precision and reproducibility. These chemical methods are more cost-effective than the production of antibodies.

[0008] The relatively small size of aptamers, when compared to antibodies, facilitates their chemical synthesis and possible modifications. They are biocompatible and have low immunogenicity in vivo. They have high selectivity and the ability to bind and recognize specific targets, with affinity constants (Kd) at nanomolar levels, lower than antibodies, which generally have milli / micromolar Kd. Also, their very small molecular weight allows them to penetrate tissues quickly and efficiently and distinguish between extracellular or intracellular domains of proteins that antibodies cannot (Gopinath SC et al, J. Gen. Virol., 2006, 87(3), 479-487).

[0009] The high target affinity / selectivity, cost-effectiveness, chemical versatility and safety of aptamers make them particularly suitable for molecular imaging, as they are superior to traditional peptide or protein-based ligands. Indeed, aptamers are amendable for chemical modification for long-term stability and bioconjugation to various moieties, and are therefore considered to be highly useful as specific imaging agents (e.g., optical, magnetic resonance, nuclear, computed tomography, ultrasound and multimodality imaging), as well as therapeutic agents.

[0010] CA-IX Carbonic anhydrase IX (CA-IX) is a zinc metalloenzyme present on the cell surface. It is a member of the large family of carbonic anhydrases (CAs), enzymes that catalyze the reversible conversion of carbon dioxide to protons and bicarbonate, resulting in a decrease in pH.

[0011] So far, 16 CA isoforms have been characterized in mammals, which differ in their subcellular localization, catalytic activity, sensitivity to various inhibitors, and tissue-specific distribution. Among them, CA-IX is a marker of tumor hypoxic response, since its gene expression is promoted by a master regulator of hypoxia, called hypoxia-inducible factor 1 (HIF-1), which is thought to be involved in maintaining the acidic environment of hypoxic cells (Wykoff et al., Cancer Res. 2000, 60, 7075-7083). Tumor hypoxia, mainly due to poor perfusion and anemia, is one of the key factors inducing the emergence of cell clones with aggressive and treatment-resistant phenotypes that lead to rapid progression and poor prognosis in several types of cancer. In fact, cancer cells survive in a harsh environment in which their gene expression (especially of genes involved in pH control) is altered.

[0012] CA-IX plays an important role in the growth and metastasis of many tumors (e.g., kidney, cervical, colon, prostate, breast, and head and neck cancers) because its catalytic activity contributes to a decrease in extracellular pH (pHe), which creates an acidic microenvironment that enhances cancer cell proliferation and invasion.

[0013] Many studies have shown that CA-IX, unlike other CAs, is expressed only in a small number of normal tissues (i.e., intestinal and gastric mucosa, gallbladder, testis) and is overexpressed in many types of cancer cells. Therefore, targeting CA-IX with specific tools opens up a new and important field for improving conventional treatment and early diagnosis and prognosis of malignant tumors.

[0014] A major problem faced in the selection of CA-IX targeting moieties, especially anti-CA-IX aptamers, concerns how to specifically target CA-IX in its active state. Classes of CA-IX targeting agents developed so far for imaging and / or therapeutic applications include monoclonal antibodies (e.g., G250, M75, etc.) or mini-antibodies (e.g., A3 and CC7, etc.) and small compounds such as inorganic ions, sulfonamide-based compounds, phenols and coumarins. Several of these agents are currently in clinical development.

[0015] In particular, monoclonal antibodies (mab) M75 and G250 are the first solutions developed to target the CA-IX enzyme. Mab M75 binds to the proteoglycan-like (PG-like) domain of CA-IX at the N-terminus of the target, whereas mab G250 interacts with the catalytic domain of CA-IX. 124 A chimeric version of G250 labeled with I (designated cG250) was developed for the detection of clear cell renal cell carcinoma (ccRCC).

[0016] Although monoclonal antibodies have usually been considered the ligands of choice for most tumor targeting applications, it has become clear that they are subject to a number of disadvantages. Indeed, antibodies have a slow and inefficient penetration into tumors, a long retention in the blood, necessitating the use of long-lived radioisotopes and imaging at late time points, exposing the patient to a high radiation burden. 124 I-cG250 does not reach a tumor / blood ratio suitable for imaging until 2–7 days after injection into the patient. Furthermore, monoclonal antibodies can be immunogenic, preventing repeated administration for routine diagnostic procedures.

[0017] These issues can be circumvented by using small molecules: unlike larger molecules, they are rapidly cleared from the blood circulation and reach a tumor-to-blood ratio suitable for imaging at an earlier time point, allowing physicians to obtain diagnostic information much more quickly than with antibody-based contrast agents.

[0018] Among small compounds targeting CA-IX, the best-studied and most robust class of inhibitors are sulfonamides, due to their high affinity, availability, and ease of chemical manipulation. However, despite some of them being promising drugs, concerns remain about off-target toxicity due to interactions with intracellular CAs and other extracellular CAs, such as CA-XII, which is expressed not only in tumors but also in normal tissues.

[0019] WO2014 / 128258 describes CA-IX targeting compounds (e.g. antibody cG250) for use in the treatment of cancer, and methods for the diagnosis, prediction and / or classification of cancer disease, including quantifying CA-IX expression and determining a CA-IX score. WO2011 / 139375 discloses novel antibodies and fragments thereof that bind to CA-IX and are useful for the diagnosis and treatment of cancer diseases associated with hypoxia and / or increased CA-IX activity. CN107648620 and Zhu L. et al, Int. J. Nanomedicine, 2018, 13, 6481-6495 disclose targeted ultrasound nanobubbles carrying CA-IX aptamers immobilized on the lipid monolayer outer shell of the nanoparticles; such compounds can penetrate tumor vasculature and be used for ultrasound molecular imaging of tumor parenchymal cells. WO2012 / 027493 describes a non-invasive method for detecting cancer cells in vivo by administering to a subject one or more targeted imaging probes that specifically bind to targets selected from CA-IX, CA-XII, etc. Aptamers are mentioned as possible targeting probes, but no examples of specific isolated oligonucleotides are reported. Summary of the Invention [Problem to be solved by the invention]

[0020] Despite these efforts, there remains a need to develop CA-IX binding agents characterized by high and specific affinity for their targets for diagnostic and / or therapeutic use. [Means for solving the problem]

[0021] The present invention is based on the identification of RNA aptamer sequences that specifically target the carbonic anhydrase IX (CA-IX) enzyme with high affinity. Considering the upregulation of CA-IX in many types of cancer as a marker of hypoxia, the anti-CA-IX aptamers of the present invention are useful for rapid cancer diagnosis and staging in terms of more effective therapeutic treatment, as well as for detecting and following the response to systemic and targeted treatment of disseminated metastatic disease.

[0022] In particular, the aptamers of the present invention solve the problem by specifically recognizing the target at the site where it is physiologically present, i.e. on the cell surface where CA-IX is expressed, demonstrating their suitability for use in vivo: indeed, it was found that the aptamers described herein are able to directly bind to cells overexpressing CA-IX on their surface. To that end, the cell-SELEX method was applied to the specific selection of aptamers that bind to CA-IX expressed on the cell surface.

[0023] A library of 2'-fluoropyrimidine modified RNA molecules was assayed for binding to COS7 cells transiently transfected with human CA-IX (COS7-CAIX). The selection method consisted of repeated cycles of: 1. incubation of the aptamer library with COS7 cells for a counter-selection step; 2. recovery of non-binding sequences and incubation with COS7-CAIX cells for a selection step; 3. recovery and amplification of bound sequences. After repeated selection steps, the final pool of RNA molecules was cloned and sequences showing the highest COS7-CA-IX binding were isolated and their affinity for the target was determined. [Brief description of the drawings]

[0024] [Figure 1] Binding assessment of CA-IX purified proteins by ELONA assay. Absorbance at 450 nm for SAM-1.T1 and SAM-2.T1 (left panel) and anti-HSA polyclonal antibody (right panel). [Diagram 2] Stability of SAM-1.T1 and SAM-2.T1 aptamers in human serum: a) SAM-1.T1 and b) SAM-2.T1 samples harvested at various times were loaded onto a denaturing gel (upper panel), c) bands were quantified by the ImageJ program (lower panel). The first line of both gels shows the sequence not treated with human serum to properly estimate the size of the samples. [Diagram 3]Kd assessment of HSA by ELONA assay. Absorbance at 450 nm for (a) SAM-1.T1, (b) SAM-2.T1, and (c) anti-HSA polyclonal antibody. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0025] In a first aspect, the present invention provides two aptamers or derivatives thereof capable of binding to carbonic anhydrase IX (CA-IX) and comprising an RNA sequence selected from UCGAAUGAACCAAGGUUCCUCGGC (SEQ ID NO: 1) and UUCGUGCCGCUGAGUGCGUACGGGC (SEQ ID NO: 2).

[0026] In one embodiment, the aptamer has a length of up to 100 nucleotides. Specific RNA sequences corresponding to SEQ ID NO:1 and SEQ ID NO:2, of 24 and 25 nucleotides, respectively, were obtained by shortening two initially selected 84mer aptamers to obtain small sequences useful for imaging and therapy.

[0027] In a preferred embodiment, the RNA aptamer defined above is characterized by being resistant to nucleases. In a more preferred embodiment, the RNA aptamer defined above is characterized by all pyrimidine residues being modified with 2'-F (fluoropyrimidine).

[0028] In another more preferred embodiment, the RNA aptamer defined above is capable of binding to a binding moiety such as biotin.

[0029] A preferred aptamer of the present invention consists of SEQ ID NO: 1 or SEQ ID NO: 2. More preferred is an aptamer consisting of SEQ ID NO: 1.

[0030] Aptamer modification The aptamers of the invention can be modified, for example, to enhance resistance to nucleases, to modulate pharmacokinetics, or to be conjugated to a diagnostic or therapeutic moiety. Preferably, the RNA aptamer of the present invention has at least one or all of the pyrimidine residues modified with 2'-fluoro. Moreover, the modification may include chemical substitution at a position preferably selected from the group consisting of the sugar, phosphate and base of the nucleic acid. In some embodiments, the modification is selected from the group consisting of biotinylation, incorporation of a fluorescent label, incorporation of a modified nucleotide, 2'-pyrimidine modification, 3'-position capping, conjugation with a linker, conjugation with a compound or drug, conjugation with a cytotoxic moiety, and labeling with a fluorophore, a radioisotope, an ultrasound contrast agent or a reporter moiety. The position of the modification can be changed depending on the type of moiety that is bound to the aptamer. For example, the aptamer sequence can be modified at the 3' end and / or the 5' end.

[0031] In a preferred embodiment, the aptamer is linked to biotin, for example, biotinylated at the 3' end, as shown in formula (I) below. [ka]

[0032] The aptamers of the present invention, appropriately labeled or conjugated with a reporter or therapeutic moiety, can be used to diagnose, treat or visualize CA-IX-related conditions, disorders, dysfunctions, conditions or diseases, particularly cancer diseases. Exemplary applications include the diagnosis or treatment of cancer diseases associated with the expression of CA-IX, such as kidney cancer, cervical cancer, colon cancer, prostate cancer, breast cancer and head and neck cancer, as well as heart failure.

[0033] In certain embodiments of the invention, aptamers labeled with reporter moieties can be used for imaging of body tissues or organs expressing CA-IX, particularly tumor parenchymal tissue.

[0034] Suitable imaging techniques include magnetic resonance imaging, positron emission tomography (PET), computed tomography (CT), ultrasound, photoacoustic imaging (PAI), near-infrared fluorescence (NIRF), and single-photon emission computed tomography (SPECT).

[0035] For imaging applications, the reporter moiety linked to the aptamer is generally selected from: a molecule capable of generating a fluorescent signal, such as fluorescein; FITC; an Alexa dye; a Cy dye; a DyLight dye; an IRDye dye or a VivoTag dye; an optical moiety comprising an agent that can be used to generate a contrast or signal using optical imaging; a magnetic moiety comprising a chelator for a magnetic resonance agent capable of forming a stable complex with a paramagnetic metal ion; a radiolabeled moiety; an X-ray moiety that can be used to generate a contrast or signal using X-ray imaging, such as an iodized organic molecule or a chelate of a heavy metal ion; an ultrasound imaging moiety that can be used to generate a contrast or signal using ultrasound targeted microbubbles; and a photoacoustic imaging moiety comprising an agent compatible with photoacoustic imaging.

[0036] The aptamer and the reporter moiety or label can be linked, either covalently or non-covalently, optionally via a suitable linker or spacer, including peptides, amino acids, or nucleic acids. Additionally, the aptamer and the reporter moiety or label can be linked using labeling systems, including biotin / avidin, biotin / streptavidin, biotin / neutravidin, or digoxigenin (DIG) systems.

[0037] In a further aspect, the present invention provides a composition comprising at least one aptamer as defined herein and one or more suitable pharma- ceutically acceptable carriers, excipients, diluents and / or additives. The components of the composition can vary depending on the intended use, whether diagnostic, therapeutic or imaging. For example, the composition can further comprise one or more therapeutic compounds and / or one or more imaging agents.

[0038] In one embodiment, the composition is used for imaging target tissues with CA-IX and comprises an aptamer conjugated or labeled with a reporter moiety as defined above. The composition is, for example, in the form of liposomes or nanoparticles and is suitable for various types of administration. In one embodiment, the composition is suitable for parenteral administration, preferably intravenous or subcutaneous administration. This composition can be used to visualize CA-IX-expressing tissues or organs, such as tumor parenchymal tissue.

[0039] Additionally, kits are provided that comprise in one or more containers at least one aptamer of the invention, preferably labeled or conjugated with a reporter or therapeutic moiety.

[0040] Brief Description of the Sequence Listing SEQ ID NO:1 is a short aptamer sequence of 24 nucleotides designated SAM-2.T1: 5'-UCGAAUGAACCAAGGUUCCUCGGC-3'; SEQ ID NO:2 is a short aptamer sequence of 25 nucleotides designated SAM-1.T1: 5'-UUCGUGCCGCUGAGUGCGUACGGGC-3' Shows. EXAMPLES

[0041] Device RT-qPCR was performed with a StepOne® Plus Real-Time PCR System (Applied Biosystems). Gel visualization was performed with a Gel Doc EZ System (Bio-Rad). ELONA data was obtained with a Multiskan® FC Microplate Photometer (ThermoFisher Scientific).

[0042] [Table 1]

[0043] Example 1: Selection and preparation of anti-CA-IX aptamers choice: RNA sequences against CA-IX were screened from a non-naive library of 84 nt fragments following the cell-SELEX approach, which involves cycles of counter-selection / selection steps of pre-enriched aptamer pools for affinity to CA on COS7-WT and transiently transfected COS7-CA-IX cells, respectively, generating selection pressure at each round. The enriched pool was incubated on cells in acidic conditions (in the presence of 60 mM MES buffer) to achieve the extracellular pH (~6.8) maintained by CA-IX. Before each round of cell-SELEX, the pool was transcribed using a mutant form of T7 RNA polymerase capable of incorporating 2'-fluoropyrimidines into the RNA sequence. A counter-selection step was performed on COS7-WT cells to avoid the selection of aptamers that recognize proteins normally expressed on COS7 cells. The selection step was performed on transiently transfected COS7-CA-IX cells to select for aptamers specific for the target. In each cycle, the pool of 2'-fluoropyrimidine RNA sequences was first incubated on COS7-WT cells at 37°C, and then the unbound 2'-fluoropyrimidine RNA sequences were incubated on COS7-CA-IX cells. After several washes, the sequences were recovered by total RNA extraction. At the end of the cell-SELEX protocol, the final cycle was cloned and the samples were sequenced. The obtained sequences were analyzed for enrichment and binding assays by RT-qPCR were performed to select sequences that could bind to COS7-CA-IX cells. Essentially, after the DNA sequences were amplified and transcribed, the RNA sequences were pretreated with 200 μg / mL yeast tRNA and then incubated on COS7-WT and COS7-CA-IX cells at 37°C for 15 min under acidic conditions at a final concentration of 100 nM. After incubation, the cells were washed three times with PBS and collected in TRIsure reagent. An RNA sequence used as a reference control was spotted at each point for normalization. The fold was calculated by comparing the binding value of COS7-CA-IX to COS7-WT cells. Six sequences representing couples or groups of identical sequences were screened. The experiment was repeated three times and the one with the highest fold was selected for further analysis. To obtain shorter sequences useful for imaging applications, we truncated the original 84-mer molecule and selected shorter sequences corresponding to sequence number 1 (SAM-2.T1) and sequence number 2 (SAM-1.T1) by isolating the more structured regions and ensuring that each of the shorter sequences maintained the folding of the corresponding portion of the longer aptamer.In Example 2 below, truncated sequences were assessed for retention of binding ability.

[0044] Preparation: Next, the selected aptamers of the present invention are obtained by artificial synthesis. For example, they are synthesized by solid-phase synthesis using an RNA synthesizer according to methods well known in the art. Then, they are bound to biotin at the 3' end of the sequence. The RNA sequence was conjugated to commercially available biotin at the 3' end after insertion of a C6-amino linker (3'-C6-NH2). The linker was inserted at the 3' end phosphate by condensation with a C6 aliphatic diamine under base catalysis. The resulting free NH2 moiety was coupled with biotin-NHS ester to form an amide covalent bond. Biotin-NHS ester was dissolved in high-quality anhydrous DMF or DMSO and the reaction was carried out at room temperature in 0.1-0.2 M sodium bicarbonate buffer (pH 8.3). Purification was performed by PAGE followed by HPLC.

[0045] Example 2: Binding and affinity of aptamers SAM-1.T1 and SAM-2.T1 to CA-IX positive cells To ensure that the short aptamers SAM-1.T1 (SEQ ID NO:2) and SAM-2.T1 (SEQ ID NO:1) contain the active site of the original molecule and maintain high binding and affinity for COS7-CA-IX cells, binding assays were performed in duplicate to compare the sequence binding ability of COS7-CA-IX to COS7-WT cells. COS7 cells were seeded and transfected with human CA-IX cDNA. After 24 hours, RNA sequences were incubated at a final concentration of 100 nM on COS7-WT and COS7-CA-IX for 15 minutes under acidic conditions at 37°C. Samples were analyzed by RT-qPCR to quantify the amount of bound aptamer and the fold increase over COS7-WT cells was calculated. The fold increase was 1.3 and 2.4 for aptamers SAM-1.T1 and SAM-2.T1, respectively, confirming their ability to bind to the target CA-IX in its physiological conformation on the cell surface membrane.

[0046] Example 3: Binding assay of aptamers SAM-1.T1 and SAM-2.T1 to human CA-IX purified protein In yet another experiment, the binding of aptamers SAM-1.T1 (SEQ ID NO: 2) and SAM-2.T1 (SEQ ID NO: 1) was examined. Biotinylated aptamers SAM-1.T1 and SAM-2.T1 were tested against human CA-IX purified protein to confirm their ability to recognize the target. Sequences SAM-1.T1 and SAM-2.T1, 200 nM, were biotinylated at the 3' end and incubated in 96-well microtiter high-binding plates pre-coated with 50 nM human CA-IX purified protein or uncoated (blank). In each experiment, anti-CA-IX antibody was used as a positive control. The samples were then analyzed in the ELONA assay. The results, shown in Figure 1, indicate that both aptamers bind to the CA-IX human protein in a similar manner to the anti-CA-IX antibody.

[0047] Example 4: Stability of aptamers SAM-1.T1 and SAM-2.T1 in human serum To evaluate their resistance to enzymatic degradation, the aptamers SAM-1.T1 and SAM-2.T1 were tested for stability in human serum. They were incubated in 87% human serum at 37°C. The experiment was performed in triplicate. Samples were collected at different times (T0, 1, 2, 4, 8, 12, 24, 48, 72 hours), incubated with proteinase K at 37°C for 1 hour to degrade serum proteins, and loaded onto a denaturing gel. The results reported in Figure 2 show that the SAM-1.T1 and SAM-2.T1 aptamers are highly stable in human serum, with the SAM-1.T1 aptamer remaining stable for up to 24 h and the SAM-2.T1 aptamer remaining stable for over 72 h.

[0048] Example 5: Binding affinity of aptamers SAM-1.T1 and SAM-2.T1 to HSA An ELONA assay was performed to evaluate the binding of SAM-1.T1 and SAM-2.T1 aptamers to human serum albumin (HSA). Biotinylated SAM-1.T1 and SAM-2.T1 aptamers were incubated at increasing concentrations (10-100-1000 nM) on 96-well microtiter high-binding plates pre-coated with 25 nM HSA or uncoated (blank). No aptamer binding was detected under any of the conditions used, indicating that SAM-1.T1 and SAM-2.T1 aptamers do not react with HSA up to 1000 nM. In each experiment, an anti-HSA biotinylated polyclonal antibody was used as a positive control. The results are shown in Figure 3.

Claims

1. An RNA aptamer that specifically binds to carbonic anhydrase IX (CA-IX), comprising a sequence selected from SEQ ID NO:1 and SEQ ID NO:2, wherein all pyrimidine residues are modified to 2'-fluoropyrimidines.

2. The aptamer according to claim 1, characterized in that it has a length of up to 100 nucleotides.

3. The aptamer of claim 1, comprising the sequence of SEQ ID NO:1, in which all pyrimidine residues are modified to 2'-fluoropyrimidines.

4. The aptamer of claim 1, comprising the sequence of SEQ ID NO:2, in which all pyrimidine residues are modified to 2'-fluoropyrimidines.

5. An aptamer described in any one of claims 1 to 4, which is biotinylated at the 3' end.

6. The aptamer according to any one of claims 1 to 5 for use in the diagnosis or visualization of a cancer disease which correlates with the expression of CA-IX.

7. The aptamer of claim 6 , wherein the cancer disease is selected from renal cancer, cervical cancer, colon cancer, prostate cancer, breast cancer and head and neck cancer.

8. The aptamer of claim 6, wherein said diagnosis or visualization comprises imaging of a body tissue or organ expressing CA-IX.

9. A diagnostic or imaging composition comprising an aptamer as defined in any one of claims 1 to 8 and pharma- ceutically acceptable carriers and excipients.

10. The composition according to claim 9 for use in imaging organs and tissues expressing CA-IX.

11. 11. The composition of claim 10, wherein the imaging is based on magnetic resonance imaging, positron emission tomography (PET), computed tomography (CT), ultrasound, photoacoustic imaging (PAI), near infrared fluorescence (NIRF), or single photon emission computed tomography (SPECT).

Images