Agent and method for inhibiting the growth of Bacteroides stercoli, and agent and method for enhancing sensitivity to immune checkpoint inhibitors
Agarooligosaccharides and 3,6-anhydro-L-galactose inhibit Bacteroides stercoris growth and enhance sensitivity to immune checkpoint inhibitors, addressing low responsiveness in individuals with high fecal levels and improving therapeutic outcomes.
Patent Information
- Application Number
- JP2024182128
- Authority / Receiving Office
- JP · JP
- Patent Type
- Patents
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2025-12-17
- Estimated Expiration
- 2044-10-17
AI Technical Summary
Individuals with high fecal levels of Bacteroides stercoris exhibit low responsiveness to immune checkpoint inhibitors, limiting the effectiveness of these drugs, while those with low levels show high responsiveness, indicating a need to suppress Bacteroides stercoris growth to enhance sensitivity to immune checkpoint inhibitors, limiting the effectiveness of these drugs.
Utilization of agarooligosaccharides, 3,6-anhydro-L-galactose, and/or oligosaccharides with 3,6-anhydro-L-galactose at the reducing end to inhibit Bacteroides stercoris growth and enhance sensitivity to immune checkpoint inhibitors.
Inhibits Bacteroides stercoris growth and enhances sensitivity to immune checkpoint inhibitors, potentially improving response rates and therapeutic effects, while being safe.
Smart Images

Figure 0007787529000001_ABST
Abstract
Description
[Technical Field]
[0001] The present invention relates to an agent and method for inhibiting the growth of Bacteroides stercolis, and an agent and method for enhancing sensitivity to immune checkpoint inhibitors. [Background technology]
[0002] Bacteroides stercoris is a Gram-negative, obligately anaerobic, non-spore-forming bacillus. The genus Bacteroides, to which this bacterium belongs, is a predominant group of bacteria that resides in the body, such as the oral cavity, digestive tract, and reproductive tract, and constitutes the bacterial flora. Currently, 39 species are known (Non-Patent Document 1). Bacteroides can cause opportunistic infections and bacteremia (Non-Patent Document 2). However, it has also been shown that they activate total IgA production in the intestinal lamina propria (Non-Patent Document 3), and two species of this genus (B. dorei and B. vulgatus) have anti-obesity and anti-arteriosclerosis effects (Non-Patent Document 4). Bacteroides are reported to be both beneficial and harmful bacteria.
[0003] On the other hand, it has been reported that Bacteroides stercolis was significantly increased in stool samples from patients with diabetic nephropathy compared to healthy controls (Non-Patent Document 5), and that it was more abundant in stool samples from children with severe hand, foot, and mouth disease than in children with mild disease (Non-Patent Document 6), suggesting a link between the bacteria and disease or poor health.
[0004] Furthermore, it has recently been reported that hepatocellular carcinoma patients with high fecal counts of Bacteroides stercoli did not respond to combined treatment with atezolizumab (an immune checkpoint inhibitor) and bevacizumab (an angiogenesis inhibitor), while those with low fecal counts responded well (Non-Patent Document 7). Immune checkpoint inhibitors are drugs that inhibit the activity of immune checkpoint molecules (a group of molecules that negatively regulate immune responses). In recent years, they have been approved for use in various cancer treatments and are being used clinically. However, immune checkpoint inhibitors generally have a response rate of approximately 30%, limiting the number of patients who can benefit from the drug, which is a major issue. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] List of Prokaryotic names with Standing in Nomenclature (LPSN)>Genus Bacteroides, [online] [Searched on July 29, 2020], Internet<URL:https: / / www.bacterio.net / genus / bacteroides> [Non-patent document 2] Suzuki, D. et al., Bacteroides and Parabacteroides bacteremia: Clinical characteristics of 138 cases over a 7-year period at Kameda General Hospital, Japanese Journal of Clinical Microbiology, Vol. 27, No. 3, 2017 [Non-patent document 3] Akira Hosono, Bacteroides and Immunity, Journal of Intestinal Microbiology 27:203-209, 2013 [Non-patent document 4] Kobe University, Kobe University News Site > News Top > Category > Press Release, 2021.10.28 A new relationship between intestinal bacteria and obesity, focusing on brown adipose tissue, elucidated [online] [Retrieved July 29, 2024], Internet<https: / / www.kobe-u.ac.jp / ja / news / article / 2021_10_28_02 / > [Non-patent document 5] Lili Zhang et al., Alterations of the Gut Microbiota in Patients with Diabetic Nephropathy, Microbiol Spectr. 2022 Jul-Aug; 10(4): e00324-22. Published online 2022 Jul 14. doi: 10.1128 / spectrum.00324-22 [Non-patent document 6] Shen, C., Xu, Y., Ji, J. et al. Intestinal microbiota has important effect on severity of hand foot and mouth disease in children. BMC Infect Dis 21, 1062 (2021). https: / / doi.org / 10.1186 / s12879-021-06748-7 [Non-Patent Document 7] Tadashi Fujii, Teiji Kuzuya, Nobuhiro Kondo, Kohei Funasaka, Eizaburo Ohno, Yoshiki Hirooka and Takumi Tochio. Altered intestinal Streptococcus anginosus and 5α-reductase gene levels in patients with hepatocellular carcinoma and elevated Bacteroides stercoris in atezolizumab / bevacizumab non-responders. Journal of Medical Microbiology 2024;73:001878. DOI 10.1099 / jmm.0.001878. Published 06 September 2024 Summary of the Invention [Problem to be solved by the invention]
[0006] Based on the aforementioned relationship that individuals with high fecal levels of Bacteroides stercoli have low responsiveness to immune checkpoint inhibitors, while individuals with low fecal levels have high responsiveness, the present inventors believed that suppressing the number of bacteria in the body would enhance sensitivity to the drug, improve response rates, or enhance the therapeutic effects of the drug. Furthermore, suppressing the number of bacteria would contribute to the prevention and improvement of diseases and ill health conditions associated with the onset or worsening of these diseases and ill health conditions. Specifically, the present invention aims to provide a technology that can effectively suppress the growth of Bacteroides stercoli and a technology that can enhance sensitivity to immune checkpoint inhibitors. [Means for solving the problem]
[0007] As a result of extensive research, the present inventors have found that agarooligosaccharides, 3,6-anhydro-L-galactose, and / or oligosaccharides having agarooligosaccharides at the reducing end thereof can inhibit the growth of Bacteroides stercoli and reduce its presence in bacterial flora. Based on this finding, the present inventors have completed the following inventions.
[0008] (1) A first embodiment of the growth inhibitor of Bacteroides stercoli according to the present invention contains agarooligosaccharide as an active ingredient.
[0009] (2) The immune checkpoint inhibitor sensitivity enhancer according to the present invention contains agarooligosaccharide as an active ingredient.
[0010] (3) The growth inhibitor of Bacteroides stercoli according to the present invention may be used to enhance sensitivity to immune checkpoint inhibitors.
[0011] (4) In the present invention, the agarooligosaccharide may contain agarobiose.
[0012] (5) A second embodiment of the growth inhibitor of Bacteroides stercoli according to the present invention comprises, as an active ingredient, 3,6-anhydro-L-galactose or an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end.
[0013] (6) The method of the present invention for inhibiting the growth of Bacteroides stercoli comprises the step of having a human or animal ingest agarooligosaccharide, 3,6-anhydro-L-galactose, and / or an oligosaccharide having ... at its
[0014] (7) The method of the present invention for enhancing sensitivity to an immune checkpoint inhibitor comprises the step of ingesting agarooligosaccharide, 3,6-anhydro-L-galactose, and / or an oligosaccharide having ... or an oligosaccharide having agarooligosaccharide, 3,6-anhydro-L-galact
[0015] The present invention may be practiced outside of medical practice. [Effects of the Invention]
[0016] According to the present invention, the proliferation of Bacteroides stercolis can be inhibited in vivo.
[0017] According to the present invention, sensitivity to immune checkpoint inhibitors can be enhanced, which can contribute to improving the response rate or the therapeutic effect of the target disease, and ultimately to improving the quality of life of patients.
[0018] Furthermore, the agarooligosaccharides used as active ingredients in the present invention are oligosaccharides derived from agar, which has been consumed as a food since ancient times, and are extremely safe. Therefore, according to the present invention, it is possible to inhibit the growth of Bacteroides stercoli or enhance the sensitivity to immune checkpoint inhibitors without concerns about safety or side effects. [Brief explanation of the drawings]
[0019] [Figure 1] This is an excerpt from Fig. 3(c) of Non-Patent Document 7, and is a bar graph showing the average relative amount (stercolis level) of Bacteroides stercoli in the feces of the atezolizumab / bevacizumab responder (R) and non-responder (NR). [Figure 2] 1 is a bar graph showing the absorbance (OD660) of the culture medium in which Bacteroides stercoli was cultured in the presence of agarooligosaccharides (AOS) or sucrose (Suc). In the figure, the plot shows the measured value for each sample. [Figure 3]This table shows the 20 microbial strains that make up the Human Resident Microbial DNA Cocktail (product name "DNA-Mock-003", lot 240101ND, NBRC). This table was taken from the product data sheet (National Institute of Technology and Evaluation, HOME > Biotechnology > Microorganisms and Industrial Use > Microbiome > NBRC Human Resident Microbial Cocktail, [online] [searched July 29, 2024], Internet). <URL: https: / / www.nite.go.jp / nbrc / industry / microbiome / cocktail20220113.html><URL: https: / / www.nite.go.jp / data / 000152907.pdf> ). [Figure 4] 1 is a bar graph showing the absorbance (OD660) of the culture medium in which Bacteroides stercoli was co-cultured with a cocktail of DNA from human commensal bacteria in the absence (Sample 1) or presence (Sample 2) of agarooligosaccharides. In the figure, the plots show the measured values for each sample. DETAILED DESCRIPTION OF THE INVENTION
[0020] The present invention will be described in detail below.
[0021] Agarooligosaccharides are even-numbered oligosaccharides consisting of repeating units of agarobiose, a disaccharide composed of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharides include the smallest unit, the disaccharide agarobiose, the tetrasaccharide agarotetraose, the hexasaccharide agarohexaose, the octasaccharide agarooctaose, and the decasaccharide agarodecaose. In the present invention, agarooligosaccharides contain at least one of these oligosaccharides, and may consist of one type or two or more types. For example, agarooligosaccharides may consist solely of agarobiose, or may contain agarooligosaccharides other than agarobiose. In this case, the content of agarobiose in the agarooligosaccharide may be, for example, 1 to 100% by mass, 10 to 100% by mass, 20 to 100% by mass, 30 to 100% by mass, 40 to 100% by mass, or 50 to 100% by mass.
[0022] Agarooligosaccharides are oligosaccharides having 3,6-anhydro-L-galactose at the reducing end. Therefore, the active ingredient of the present invention may be 3,6-anhydro-L-galactose or an oligosaccharide having 3,6-anhydro-L-galactose at the reducing end. In this case, the number of sugars in the oligosaccharide may be, for example, 2 to 8 sugars, 2 to 10 sugars, or 2 to 12 sugars.
[0023] Agaroligosaccharides can be commercially available agarooligosaccharides (agar oligosaccharides), or can be produced by conventional methods. A typical method for producing agarooligosaccharides is, for example, a method of hydrolyzing agar. Hydrolysis can be performed using either an acid or an enzyme.
[0024] Examples of acid decomposition methods include those using solid acids as described in Japanese Patent No. 4796697, mineral acids such as sulfuric acid and hydrochloric acid, and organic acids such as acetic acid and citric acid, but any method can be used. Acid decomposition can produce an even-numbered sugar having 3,6-anhydro-L-galactopyranose at the reducing end.
[0025] Enzymatic degradation methods include degradation with α-agarase and degradation with β-agarase. As with acid degradation, α-agarase can be used to obtain even-numbered sugars having 3,6-anhydro-L-galactopyranose at the reducing end. Degradation with α-agarase can be carried out, for example, by the method described in Japanese Patent Application Publication No. H2-65789.
[0026] The agar hydrolysate may be used as agarooligosaccharides directly, or may be purified or pH-adjusted before use. Purification methods include filtration using filter paper or activated carbon. The agarooligosaccharide solution obtained by hydrolysis may be used in liquid form, or, if necessary, may be powdered by vacuum freeze-drying or other methods.
[0027] Agar is a dehydrated and dried mucilage extracted from red seaweeds such as Gelidium and Gracilaria, and contains the polysaccharides agarose and agaropectin as its main components. In addition to agar, substances containing agarose and agaropectin can also be used as raw materials for producing agarooligosaccharides. Specific examples of such substances include solutions obtained by hot water extraction of red algae from the Gelidaceae, Gracilaria, and Gracilaria families, which are the raw materials for agar. Examples of red algae from the Gelidaceae family include Acanthus nigricans, Acanthus nigricans, Acanthus nigricans, Acanthus obscurus, and Acanthus japonica. Examples of red algae from the Gracilaria family include Gracilaria gracilaria and Gracilaria sieboldii. Examples of red algae from the Gracilaria family include Acanthus gistus and Acanthus sieboldii. These red algae can be used alone or in combination of two or more.
[0028] The sugar composition of agarooligosaccharides can be confirmed by liquid chromatography, including high performance liquid chromatography, as shown in the Examples below. This allows agarooligosaccharides with a desired number of sugars, such as agarobiose only, agarotetraose only, or agarohexaose only, to be fractionated and used after adjusting the sugar composition of the agarooligosaccharides.
[0029] 3,6-Anhydro-L-galactose can be prepared using commercially available reagents or by standard methods. Examples of such methods include the method described in Japanese Patent No. 4007760. Specifically, 450 μL of a 100 mM aqueous solution of agarobiose was mixed with 50 μL of 10x phosphate-buffered saline and 50 μL of 10 units / μL β-galactosidase phosphate-buffered saline, and the resulting mixture was allowed to react at 37°C for 1 hour. 5 mL of a 1:1 mixture of 1-butanol and ethanol was added to the reaction mixture, and the mixture was centrifuged to precipitate insoluble matter. The resulting supernatant was subjected to column chromatography using a silica gel column, and the mixture was compressed at 0.3 kg / cm using a compressor with a 5:5:1 mixture of 1-butanol, ethanol, and water as the eluent. 2 The mixture is pressurized to 100°C and separated. By separating the fractions so that each fraction is 7 ml, a liquid containing highly purified 3,6-anhydro-L-galactose can be obtained, for example, in fractions 14 to 17. These fractions can be collected and evaporated to dryness under reduced pressure to obtain 3,6-anhydro-L-galactose.
[0030] Non-Patent Document 7 discloses the following: First, for hepatocellular carcinoma patients receiving combined drug therapy with atezolizumab (an immune checkpoint inhibitor) and bevacizumab (an angiogenesis inhibitor), the efficacy of the drug therapy was evaluated according to the Response Evaluation Criteria in Solid Tumors guidelines. Patients who achieved a complete response (100% disappearance of cancer) or a partial response (30% or more disappearance of tumor) were classified as the responder group (Atz / Bev R). Patients who did not qualify as a responder were classified as the non-responder group (NR). Using total DNA extracted from fecal samples of 11 responders and 11 non-responders as templates, the relative amount of Bacteroides stercoli was measured by quantitative PCR. As shown in Figure 1, the level of Bacteroides stercoli (relative amount of Bacteroides stercoli) was significantly higher in the non-responder group (NR) than in the responder group (R).
[0031] According to the report in Non-Patent Document 7, immune checkpoint inhibitors are ineffective in those with a high proportion of Bacteroides stercoli in their bodies, while immune checkpoint inhibitors are effective in those with a low proportion of this bacterium. In other words, the number of Bacteroides stercoli can be used as an index to predict sensitivity to immune checkpoint inhibitors, and reducing the number of this bacterium in the body can enhance sensitivity to immune checkpoint inhibitors.
[0032] "Suppressing the growth" of Bacteroides stercoli not only means reducing the number of bacteria (reducing the proportion of bacteria in the bacterial flora), but also includes maintaining the number of bacteria at a similar level or increasing the number of bacteria but reducing the degree of increase to a smaller extent compared to when the active ingredient of the present invention (agarooligosaccharide, 3,6-anhydro-L-galactose, or an oligosaccharide having 3,6-anhydro-L-galactose at its reducing end) is not used. Furthermore, suppressing growth and suppressing the number of bacteria are synonymous.
[0033] Whether or not the growth of Bacteroides stercolis can be inhibited can be confirmed by a conventional method. For example, if the bacterium is isolated, the active ingredient may be added to the culture medium, and the number of bacteria may be confirmed by a turbidity method or the like, in comparison with a case where the active ingredient is not added.
[0034] Furthermore, when Bacteroides stercolis is not isolated (e.g., from specimens such as feces or body fluids, cocktail bacterial solutions containing multiple bacterial species, or human intestinal models), a method can be used in which bacterial 16S rDNA is amplified by polymerase chain reaction (PCR) using the total genomic DNA of the bacteria extracted from the sample as a template, and the amplified product is decoded by next-generation sequencing (NGS). The bacterial species and abundance are identified based on a 16S database, and the abundance ratio of this bacterium is determined and compared between specimens in which the active ingredient of the present invention has been ingested or contacted. Alternatively, quantitative PCR can be performed on the total genomic DNA of the bacteria using primers specific to Bacteroides stercolis. When determining the number of this bacterium by PCR, because the amount of gene purified from the specimen (purification efficiency) is not constant, it is preferable to calculate the proportion of this bacterium (abundance ratio, occupancy) in the total number of bacteria or the amount of template DNA and make a judgment based on this proportion.
[0035] When quantifying Bacteroides stercoris by PCR, specific primers can be designed based on a partial sequence of genomic DNA (stercoris conserved region) that is conserved in this bacterium but not in other species of the genus Bacteroides, identified based on published sequence information. For example, the genome of the type strain of Bacteroides stercoris, Bacteroides stercoris ATCC 43183, is publicly available under the GenBank accession number CP102262.1.
[0036] For example, Non-Patent Document 7 identifies a partial sequence of the DNA sequence (SEQ ID NO: 1) of the heparinase gene possessed by this bacterium as a conserved region in Bacteroides stercoris. Then, as primers specific to this bacterium, a forward primer (SEQ ID NO: 2, underlined in SEQ ID NO: 1) corresponding to positions 488 to 513 in SEQ ID NO: 1 and a reverse primer (SEQ ID NO: 3, underlined in SEQ ID NO: 1) corresponding to positions 603 to 626 in SEQ ID NO: 1 are used (Non-Patent Document 7; METHODS, Primer design). That is, Non-Patent Document 7 quantifies Bacteroides stercoris by quantifying the partial sequence of the heparinase gene. In the present invention, this bacterium can also be quantified using such specific primers.
[0037] [SEQ ID NO: 1] Heparinase gene from Bacteroides stercoris ATCC 43183 (length: 2322 bases), Accession No.: GenBank: CP102262.1 (genome): 550432-552753 (corresponding portion of heparinase gene) ATGAAAAAAAGTATCCTATTTATCACGAGTTTTTTCCTCTGTTTTTTCTGTCTGAAAAGTAATGCGCAACAAAGCAGGCCAGAGGTTACCTGGGAGAATATGGAAGGCGTCACAGTACCCATTCCGCCGCAAGTACACCCCCGGCTTTATGTACGCTCCGCCGATTTGCCCGATTTAAAGAAACGCATGGAACACCCGCATGTAAAGGAAGTTCTGGCTACCCTGAACAAATTGGGCAAAGAC CGTACTCCCGAAGAAGAGGCAAAAGTCAAGGACAGAGGGTTCCGCTACTACTTTGAAATGCGTGGCGTGACCAGCCGCGTACAAGTGCAGGCACTCGACTATCTGGTGTATGGCGACAAGAAACAGGCCAGAGAGCGCCATTACCGCCATGCTGGACACGCTTCAGAACGTCAATTACGGAACAAAAGGTGATTTGTCGCGTGCCAGCGGTGTAATGCTCACCTGCGGTGCAATGGTATATGACT GGTGCTACGACCAGATGAAAGAATCC GAAAAGAAAGCTTACATAGAATCTTTCATCCGCATAGCCAAAACAATGGAATGCGGCTATCCCCCACGCAACAACGAACCGATTGCCGG GCACTCCAGCGAATGGATGATACT
[0038] <Primers for amplifying the stercoris conserved region of the heparinase gene> [SEQ ID NO: 2] Forward primer (heparinas_Synbio_F2); 5'-GGTGCTACGACCAGATGAAAGAATCC-3' [SEQ ID NO: 3] Reverse primer (heparinas_Synbio_R2); 5'- AGTATCATCCATTCGCTGGAGTGC -3'
[0039] In the present invention, "sensitivity to an immune checkpoint inhibitor" refers to the degree to which the drug is effective in a subject to administration (how effective the drug is). "Enhancing sensitivity to an immune checkpoint inhibitor" includes not only increasing the degree to which the drug is effective, but also maintaining the same level of efficacy or, even if the degree of efficacy decreases, the degree of decrease is smaller than when the active ingredient of the present invention is not used.
[0040] As mentioned above, immune checkpoint inhibitors are drugs that suppress the action of immune checkpoint molecules. Immune checkpoint molecules, as mentioned above, refer to a group of molecules that negatively regulate immune responses, and specific examples include PD-L1, PD-L2, CTLA-4, PD-1, LAG-3, TIM-3, BTLA, TIGIT, VISTA / PD-1H, CD96, NIKG2A, KIR, CD4, CD8, CD19, CD28, CD80 / 86, B7, Galectin-9, HVEM, MHC-II, TCR, B7-H3, and B7-H4.
[0041] Examples of immune checkpoint inhibitors include antibodies (monoclonal antibodies, polyclonal antibodies) against the above-mentioned immune checkpoint molecules. More specific examples of immune checkpoint inhibitors include anti-CTLA-4 antibodies (ipilimumab, tremelimumab, etc.), anti-PD-1 antibodies (nivolumab, pembrolizumab, etc.), anti-PD-L1 antibodies (atezolizumab, durvalmab, avelumab, etc.), anti-LAG-3 antibodies, anti-Tim-3 antibodies, and anti-TIGIT antibodies.
[0042] It has been found that cancer cells evade immunity by utilizing host immune checkpoint molecules, and immune checkpoint inhibitors have conventionally been used in cancer treatment. The immune checkpoint inhibitor of the present invention may be used for cancer treatment.
[0043] The active ingredients of the present invention (agarooligosaccharides, 3,6-anhydro-L-galactose, or oligosaccharides having 3,6-anhydro-L-galactose at the reducing end) can be used, for example, in a form that can be ingested by humans or animals. More specific modes of use can be appropriately determined depending on the subject to be ingested, the application site, the purpose of use, etc. For example, the mode and route of ingestion may be any that allows the active ingredient to reach the site where Bacteroides stercoli inhabits. Specific examples include oral ingestion, placement under the tongue (sublingually) or between the gums and cheek, and insertion into the rectum (transrectally) or vagina (transvaginally).
[0044] The intake amount (dosage) of the active ingredient can also be set appropriately depending on the subject to be ingested, the form of the product, the purpose, etc. Specific examples of intake amounts include, for example, 0.01 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1 mg / kg body weight or more, 5 mg / kg body weight or more, 10 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less, 100 mg / kg body weight or less, and 10 mg / kg body weight or less per day for an adult.
[0045] The active ingredient may be used as it is in the form of food and drink, supplements, pharmaceuticals, quasi-drugs, feed, etc., or may be used by blending it with other ingredients as an ingredient in food and drink, supplements, pharmaceuticals, quasi-drugs, feed, etc. These products can be produced by methods known to those skilled in the art using the active ingredient as a raw material.
[0046] The content of the active ingredient in the product can also be appropriately set depending on the form and use of the product. Specific examples of the content include 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, and 5% by mass or less.
[0047] The present invention will be described below based on examples, but the technical scope of the present invention is not limited to the features shown in these examples. [Example]
[0048] Example 1: Preparation of agarooligosaccharides 50 g of agar ("Ultra Agar AX-30" manufactured by Ina Food Industry Co., Ltd.) was added to 1000 g of purified water and heated to dissolve, after which 2 g of concentrated sulfuric acid was added and stirred at 90°C for 3 hours. The pH was adjusted to 3.5 with sodium hydroxide, and the mixture was treated with activated carbon. The filtrate was then filtered through a filter paper and the filtrate was collected. This was then further filtered through a filter with a pore size of 0.1 μm, and the filtrate was powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.
[0049] The composition of the prepared agarooligosaccharides was measured using high-performance liquid chromatography (Prominence® HPLC system (Shimadzu Corporation)). Measurement conditions were as follows: two columns (TSKgel® α-2500, Tosoh Corporation) connected in series, elution with H2O as solvent, flow rate of 0.3 ml / min, temperature of 60°C, and detection by RI (differential refractive index). The results were as follows (values are mass %, the same applies below). In this example, a composition containing the following disaccharides to decasaccharides is referred to as "agarooligosaccharides (AOS)." Disaccharide (agarobiose): 31.5 Tetrasaccharide (agarotetraose): 30.1 Hexasaccharide (agarohexaose): 21.2 8 sugars (agarooctaose): 11.6 Decasaccharide (agarodecaose): 5.6
[0050] Example 2: Growth inhibitory effect of Bacteroides stercoli: Evaluation by turbidity (1)Culture conditions etc. The culture medium used was RF medium*, a modified version of Brain-Heart Infusion medium (Thermo Scientific). Anaerobic culture was performed using the Anaeropack anaerobic culture kit (Mitsubishi Gas Chemical) by static culture at 37°C. *Composition of RF medium: 1L Brain-Heart Infusion medium, 5g yeast extract, 5g K2HPO4, 8g glucose, 0.5g L-cysteine hydrochloride, 1g Tween 80, 0.005g hemin, 0.002g vitamin K1, 0.001g resazurin sodium, 0.025g acetate, 0.01g MgSO2·7H2O, pH 6.8.
[0051] (2) Cultivation in the presence of agarooligosaccharides Bacteroides stercoris JCM 9496 (Microbial Materials Development Laboratory, BioResource Research Center, RIKEN) (sometimes referred to as the "BS strain") was anaerobically cultured in RF medium for 23.5 hours, and this was used as the seed culture medium. Four types of main culture media were prepared: RF medium (Sample 1), RF medium supplemented with agarooligosaccharides to a final concentration of 0.1% (Sample 2) or 0.2% (Sample 3), and RF medium supplemented with sucrose to a final concentration of 0.5% (Sample 4). Each main culture medium was dispensed into deep well plates (AxyGen Scientific, CA, USA) at 0.4 mL per well, and 20 μL of a 10-fold diluted seed culture medium was inoculated into each well and cultured anaerobically for 44 hours (main culture). Hereinafter, the culture solutions obtained by main culture using Samples 1 to 4 are referred to as Samples 1 to 4.
[0052] (3) Measurement of bacterial count by turbidity method After the main culture, 20 μL of the culture medium was sampled and diluted 10-fold by adding 180 μL of water. The absorbance (OD660) of the diluted culture medium was measured using a microplate reader (Wako SUNRISE Rainbow). The RF medium was also diluted 10-fold and measured. The RF medium measurement was subtracted from the culture medium measurement, and this was multiplied by 10 to obtain the absorbance of the culture medium. The absorbance was calculated as the average of eight samples for each sample. Statistical analysis between groups was performed using the Mann-Whitney test using the medical statistical analysis software GraphPad Prism (GraphPad Software), with a P<0.05 being considered significant. The results are shown in Figure 2.
[0053] As shown in Figure 2, the absorbance (OD660) of the culture medium was 1.03 for Sample 1 (main culture in RF medium), while it was 1.25 for Sample 2 (main culture in sucrose-containing medium), both of which were higher than Sample 1. On the other hand, the absorbances of Sample 3 (main culture in 0.1% AOS-containing medium) and Sample 4 (main culture in 0.2% AOS-containing medium) were 0.06 and 0.07, respectively, both of which were significantly lower than Sample 1. In other words, the absorbance of the culture medium of Bacteroides stercoli decreased in the presence of agarooligosaccharides. These results demonstrated that agarooligosaccharides can inhibit the growth of Bacteroides stercoli.
[0054] Example 3: Growth inhibitory effect of Bacteroides stercoli: Evaluation based on abundance ratio (1) Cultivation in the presence of agarooligosaccharides Culture conditions were as described in Example 2(1). The BS strain was anaerobically cultured in RF medium for 23.5 hours, and this was used as the BS seed mother liquor. A human commensal bacterial DNA cocktail (product name "DNA-Mock-003", lot 240101ND, National Biotechnology Center (NBRC), National Institute of Technology and Evaluation) (sometimes referred to as the "cocktail strain") was anaerobically cultured in RF medium for 23.5 hours, and this was used as the cocktail seed mother liquor. The cocktail strains were a mixture of 20 strains shown in Figure 3 from the microbial strains held by the NBRC, with each strain containing an equal number of copies of genomic DNA. The 20 strains are species known to inhabit the human intestine, oral cavity, skin, etc. Shotgun sequencing of the cocktail strains confirmed that each strain was detected at a detection rate of approximately 5% (Tourlousse, DM, Narita, K., Miura, T. et al. Characterization and demonstration of mock communities as control reagents for accurate human microbiome community measurements. Microbiology Spectrum, 10(2): e01915-21.).
[0055] The BS seed mother liquor and the cocktail seed mother liquor were each diluted 10-fold and mixed in equal amounts to prepare a mixed seed mother liquor. Two types of medium were prepared as main culture media: RF medium (Sample 1) and RF medium supplemented with agarooligosaccharides to a final concentration of 0.2% by mass (Sample 2). Each main culture medium was dispensed into deep well plates (AxyGen Scientific, CA, USA) at 0.4 mL per well, after which 20 μL of the mixed seed mother liquor was inoculated and cultured anaerobically for 23.5 hours (main culture). Hereinafter, the culture solutions obtained by main culture using Sample 1 and Sample 2 are referred to as Sample 1 and Sample 2, respectively.
[0056] (3) Measurement of bacterial count by turbidity method The absorbance of the culture solution after the main culture was measured by the method described in Example 2(3). The average absorbance was calculated by averaging four specimens for each sample. The results are shown in Figure 4. As shown in Figure 4, the absorbance (OD660) of the culture solution was 3.24 for Sample 1 (main culture in RF medium) and 2.98 for Sample 2 (main culture in AOS-containing medium), and there was no significant difference between the two (ns). In other words, there was no significant difference in the total number of bacteria in the presence of agarooligosaccharides compared to their absence.
[0057] (4) Comprehensive analysis of bacterial flora After the main culture, the culture medium was diluted 10-fold, and a 0.5 mL aliquot was incubated at 70°C for 10 minutes. The samples were then disrupted using zirconia beads at 4,300 rpm for 2 minutes in a FastPrep FP100A device (MP Biomedicals). The mixture was centrifuged at 15,000 rpm for 1 minute, and the supernatant was collected and used as total bacterial DNA. Using total bacterial DNA as a template, PCR was performed using universal primers (SEQ ID NOS: 4 and 5) to amplify the V3-V4 region of bacterial 16S rDNA (Takahashi S, et al., (2014) Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 9(8): e105592. Published: August 21, 2014). Forward primer (Pro341F): 5'-CCTACGGGNBGCASCAG-3' (SEQ ID NO: 4) Reverse primer (Pro805R): 5'-GACTACNVGGGTATCTAATCC-3' (SEQ ID NO: 5)
[0058] The PCR-amplified products were then sequenced by next-generation sequencing (NGS). NGS was performed using the Illumina MiSeq platform (Illumina) and MiSeq Reagent Kit ver. 3 (Illumina) using a paired-end method (2 × 300 bp). The sequences were analyzed using the EzBioCloud 16S database and the 16S Microbiome Pipeline (EzBioCloud 16S-based MTP app, https: / / www.EZbiocloud.net) to identify species and determine their abundance (occupancy). The abundance was calculated as the percentage of the number of reads for each bacterial species relative to the total number of reads. This NGS analysis was performed by Seibu Giken Co., Ltd.
[0059] As a result, the abundance ratio of Bacteroides stercoli was 18.66% in Sample 1 (main culture in RF medium), while it was 1.84% in Sample 2 (main culture in AOS-containing medium), which was significantly lower than Sample 1. In other words, the abundance ratio of Bacteroides stercoli decreased in the presence of agarooligosaccharides. This result demonstrated that agarooligosaccharides can suppress the growth of Bacteroides stercoli even in a bacterial flora environment where a considerable amount of multiple other bacterial species are present.
Claims
1. A growth inhibitor of Bacteroides stercoris, containing agarooligosaccharide as an active ingredient.
2. An immune checkpoint inhibitor sensitivity enhancer that uses agarooligosaccharide as its active ingredient.
3. The agent according to claim 1, which is used to enhance sensitivity to immune checkpoint inhibitors.
4. The agent according to claim 1 or 2, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.
5. A method for inhibiting the growth of Bacteroides stercoris in a living body (excluding medical procedures), comprising the step of having a human or animal ingest agarooligosaccharides.
6. A method (excluding medical procedures) for enhancing sensitivity to immune checkpoint inhibitors, comprising the step of ingesting agarooligosaccharides to humans or animals.
Citation Information
Patent Citations
Composition for adjusting enterobacterial flora
JP2017163980A