Agents and methods for inhibiting the proliferation of Bacteroides stercolis, and agents and methods for enhancing sensitivity to immune checkpoint inhibitors.
Agarooligosaccharides and 3,6-anhydro-L-galactose inhibit Bacteroides stercoris growth, enhancing immune checkpoint inhibitor sensitivity and improving therapeutic outcomes.
Patent Information
- Application Number
- JP2024182128
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2026-04-30
- Estimated Expiration
- 2044-10-17
AI Technical Summary
Individuals with high levels of Bacteroides stercoris in their feces show low responsiveness to immune checkpoint inhibitors, limiting their therapeutic efficacy, while those with low levels respond well, indicating a need to suppress the bacterium's growth to enhance drug sensitivity and address associated diseases.
The use of agarooligosaccharides and 3,6-anhydro-L-galactose or oligosaccharides with a reducing end to inhibit Bacteroides stercoris growth and enhance sensitivity to immune checkpoint inhibitors.
Suppresses Bacteroides stercoris growth and enhances sensitivity to immune checkpoint inhibitors, improving therapeutic efficacy and quality of life by increasing drug response rates and reducing disease severity.
Smart Images

Figure 2026071940000001_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to an agent and a method for suppressing the growth of Bacteroides stercoris, and an agent and a method for enhancing the sensitivity to immune checkpoint inhibitors.
Background Art
[0002] Bacteroides stercoris is a Gram-negative obligate anaerobic non-spore-forming bacillus. The genus Bacteroides to which this bacterium belongs is a resident in vivo in the oral cavity, digestive tract, genital organs, etc., and is one of the dominant bacterial flora that constitutes the flora, and currently 39 species are known (Non-Patent Document 1). The genus Bacteroides causes opportunistic infections and bacteremia (Non-Patent Document 2), but also activates the total IgA production in the intestinal mucosa lamina propria (Non-Patent Document 3), and two species of this genus (B. dorei and B. vulgatus) are shown to have an obesity-suppressing effect and an arteriosclerosis-suppressing effect (Non-Patent Document 4), and both sides of bad bacteria and good bacteria have been reported.
[0003] On the other hand, regarding Bacteroides stercoris, it has been reported that it was significantly increased in the fecal specimens of patients with diabetic nephropathy compared with healthy control groups (Non-Patent Document 5), and in the fecal specimens of children with severe hand, foot, and mouth disease, it was increased more than that of children with mild disease (Non-Patent Document 6), suggesting an association with diseases or unhealthy states.
[0004] Furthermore, it has recently been reported that patients with high levels of Bacteroides stercolis in their feces do not respond to combination therapy with atezolizumab (an immune checkpoint inhibitor) and bevacizumab (an angiogenesis inhibitor), while those with low levels of this bacterium do respond (Non-Patent Literature 7). Immune checkpoint inhibitors are drugs that inhibit the function of immune checkpoint molecules (a group of molecules that negatively regulate the immune response), and in recent years, they have been approved for use in various cancer treatments and are used in clinical practice. However, immune checkpoint inhibitors generally have a response rate of about 30%, and the fact that they are effective in only a limited number of patients remains a major challenge. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] List of Prokaryotic names with Standing in Nomenclature (LPSN)>Genus Bacteroides, [online] [Searched on July 29, 2020], Internet<URL:https: / / www.bacterio.net / genus / bacteroides> [Non-Patent Document 2] Daisuke Suzuki et al., Bacteroides and Parabacteroides bacteremia: Clinical characteristics of 138 cases over 7 years at Kameda Medical Center, Japanese Journal of Clinical Microbiology, Vol. 27 No. 3, 2017. [Non-Patent Document 3] Akira Hosono, Bacteroides and Immunity, Journal of Intestinal Microbiota 27:203-209, 2013. [Non-Patent Document 4] Kobe University, Kobe University News Site > News Top > Category > Press Release, October 28, 2021: Unraveling a new link between gut bacteria and obesity, focusing on brown adipose tissue. [online] [Retrieved July 29, 2024], Internet<https: / / www.kobe-u.ac.jp / ja / news / article / 2021_10_28_02 / > [Non-Patent Document 5] Lili Zhang et al., Alterations of the Gut Microbiota in Patients with Diabetic Nephropathy, Microbiol Spectr. 2022 Jul-Aug; 10(4): e00324-22. Published online 2022 Jul 14. doi: 10.1128 / spectrum.00324-22 [Non-Patent Document 6] Shen, C., Xu, Y., Ji, J. et al. Intestinal microbiota has important effect on severity of hand foot and mouth disease in children. BMC Infect Dis 21, 1062 (2021). https: / / doi.org / 10.1186 / s12879-021-06748-7 [Non-Patent Document 7] Tadashi Fujii, Teiji Kuzuya, Nobuhiro Kondo, Kohei Funasaka, Eizaburo Ohno, Yoshiki Hirooka and Takumi Tochio. Altered intestinal Streptococcus anginosus and 5α-reductase gene levels in patients with hepatocellular carcinoma and elevated Bacteroides stercoris in atezolizumab / bevacizumab non-responders. Journal of Medical Microbiology 2024;73:001878. DOI 10.1099 / jmm.0.001878. Published 06 September 2024 [Overview of the project] [Problems that the invention aims to solve]
[0006] Based on the aforementioned relationship that individuals with a high amount of Bacteroides stercolis in their feces have low responsiveness to immune checkpoint inhibitors, and those with a low amount of the bacterium have high responsiveness, the inventors of this invention hypothesized that suppressing the number of this bacterium in the body would enhance sensitivity to the drug, improve response rates, or enhance the therapeutic effect of the drug. Furthermore, they hypothesized that suppressing the number of this bacterium would contribute to the prevention or improvement of diseases and ill health conditions in which this bacterium is involved in the onset or exacerbation of these conditions. In other words, the present invention aims to provide a technology that can effectively suppress the proliferation of Bacteroides stercolis and a technology that can enhance sensitivity to immune checkpoint inhibitors. [Means for solving the problem]
[0007] As a result of diligent research, the inventors have found that agarooligosaccharides, 3,6-anhydro-L-galactose, and / or oligosaccharides having these as reducing ends can suppress the growth of Bacteroides stercolis and reduce its relative abundance in the microbial community. Based on these findings, the inventors have completed the following inventions.
[0008] (1) The first embodiment of the growth inhibitor of Bacteroides stercolis according to the present invention comprises agarooligosaccharide as an active ingredient.
[0009] (2) The immune checkpoint inhibitor sensitivity enhancer according to the present invention comprises agarooligosaccharide as an active ingredient.
[0010] (3) The growth inhibitor of Bacteroides stercolis according to the present invention may be used to enhance sensitivity to immune checkpoint inhibitors.
[0011] (4) In the present invention, the agarooligosaccharide may contain agarobiose.
[0012] (5) A second embodiment of the growth inhibitor of Bacteroides stercolis according to the present invention comprises 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end as an active ingredient.
[0013] (6) A method for inhibiting the proliferation of Bacteroides stercolis according to the present invention comprises the step of administering agarooligosaccharide, 3,6-anhydro-L-galactose and / or oligosaccharide having the same at its reducing end to a human or animal.
[0014] (7) A method for enhancing sensitivity to an immune checkpoint inhibitor according to the present invention comprises the step of administering agarooligosaccharide, 3,6-anhydro-L-galactose and / or oligosaccharide having the same at its reducing end to a human or animal.
[0015] The present invention may be implemented in ways other than medical procedures. [Effects of the Invention]
[0016] According to the present invention, in vivo, the growth of Bacteroides stercoris can be suppressed.
[0017] According to the present invention, the sensitivity to immune checkpoint inhibitors can be enhanced. Thereby, it can contribute to an improvement in the efficacy rate or the therapeutic effect of the target disease, and thus an improvement in the quality of life (Quality of life) of the patient.
[0018] In addition, the agarooligosaccharide used as an active ingredient in the present invention is an oligosaccharide made from agar that has been ingested as a food since ancient times, and its safety is extremely high. Therefore, according to the present invention, the growth of Bacteroides stercoris can be suppressed or the sensitivity of immune checkpoint inhibitors can be enhanced without any concerns about safety and side effects.
Brief Description of the Drawings
[0019] [Figure 1] It is a figure excerpted and cited from Fig. 3(c) of Non-Patent Document 7, and is a bar graph showing the average value of the relative amount (stercoris-level) of Bacteroides stercoris in the feces of the atezolizumab / bevacizumab response group (R) and the non-response group (NR). [Figure 2] It is a bar graph showing the absorbance (OD660) of the culture solution in which Bacteroides stercoris was cultured in the presence of agarooligosaccharide (AOS) or sucrose (Suc). In the figure, the plots show the measured values of each sample. [Figure 3]A table showing 20 microbial strains that make up the human commensal bacteria DNA cocktail (product name "DNA-Mock-003", lot 240101ND, NBRC). This table was cited from the product datasheet of this product (National Institute of Technology and Evaluation, HOME>Biotechnology>Microorganisms and Industrial Use>Microbiome>NBRC Human Commensal Microbial Cocktail, [online][searched on July 29, 2024], Internet <URL: https: / / www.nite.go.jp / nbrc / industry / microbiome / cocktail20220113.html><URL: https: / / www.nite.go.jp / data / 000152907.pdf>). [Figure 4] A bar graph showing the absorbance (OD660) of the culture broth obtained by co-culturing Bacteroides stercoris and the human commensal bacteria DNA cocktail in the absence (sample 1) or presence (sample 2) of agar oligosaccharide. In the figure, the plots indicate the measured values of each specimen.
Mode for Carrying Out the Invention
[0020] Hereinafter, the present invention will be described in detail.
[0021] Agarooligosaccharides are even-numbered oligosaccharides consisting of repeating units of the disaccharide agarobiose, which is composed of D-galactose and 3,6-anhydro-L-galactose. Examples of agarooligosaccharides include the smallest unit, the disaccharide agarobiose, the tetrasaccharide agarotetraose, the hexasaccharide agarohexaose, the octasaccharide agarooctaose, and the decasaccharide agarodecaose. In the present invention, agarooligosaccharides contain at least one of these oligosaccharides, and may consist of one type or two or more types. For example, agarooligosaccharides may consist only of agarobiose, or they may contain agarooligosaccharides other than agarobiose. Examples of agarobiose content in agarooligosaccharides in this case include 1-100% by mass, 10-100% by mass, 20-100% by mass, 30-100% by mass, 40-100% by mass, and 50-100% by mass.
[0022] Agarooligosaccharides are oligosaccharides having 3,6-anhydro-L-galactose at their reducing end. Therefore, the active ingredient of the present invention may be 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end. In this case, the number of sugars in the oligosaccharide can be exemplified by disaccharides to octasaccharides, 2 to decasaccharides, 2 to dodecsaccharides, etc.
[0023] Agarooligosaccharides can be commercially available (agar oligosaccharides), or they can be manufactured according to conventional methods. A common method for producing agarooligosaccharides is, for example, the hydrolysis of agar. Hydrolysis can be carried out using either acid or enzymes.
[0024] Examples of acid decomposition methods include using a solid acid as described in Japanese Patent Publication No. 4796697, using mineral acids such as sulfuric acid or hydrochloric acid, or using organic acids such as acetic acid or citric acid; any of these methods is acceptable. Acid decomposition yields even-numbered sugars having 3,6-anhydro-L-galactopyranose as the reducing end.
[0025] Furthermore, examples of enzymatic degradation methods include degradation by α-agarase and degradation by β-agarase. Using α-agarase, as with acid degradation, even-numbered sugars with 3,6-anhydro-L-galactopyranose at the reducing end can be obtained. Degradation by α-agarase can be carried out, for example, by the method described in Japanese Patent Application Publication H2-65789.
[0026] The hydrolyzed agar product may be used as is, as agarooligosaccharide, or it may be purified and its pH adjusted before use. Examples of purification methods include filtration using filter paper or activated carbon. The agarooligosaccharide solution obtained from the hydrolysis treatment may be used in liquid form, or, if necessary, it may be used in powder form by vacuum freeze-drying or other methods.
[0027] Agar is a dehydrated and dried mucilage extracted from red algae such as Gelidium and Gracilaria, and mainly contains the polysaccharides agarose and agaropectin. In addition to agar, other substances containing agarose and agaropectin can be used as raw materials for agarooligosaccharide production. Specifically, examples of such substances include solutions obtained by hot water extraction of red algae from families such as Gelidaceae, Gracilaceae, and Ixeriaceae, which are the raw materials for agar. Examples of red algae from the Gelidaceae family include Gastrodia elata, Orientalus japonica, Ophiopogon, Heliotropium spp., Gracilaria japonica, and Ixeriaceae; examples of red algae from the Gracilaceae family include Gracilaria japonica and Ophiopogon spp., and examples of red algae from the Ixeriaceae family include Ixeris spp. and Styrax japonica. These red algae can be used individually or in combination of two or more types.
[0028] The sugar composition of agarooligosaccharides can be confirmed by liquid chromatography, including high-performance liquid chromatography, as shown in the examples described later. Furthermore, this allows for the fractionation of agarooligosaccharides with desired sugar content, such as only agarobiose, only agarotetraose, or only agarohexaose, and the adjustment of the sugar composition of the agarooligosaccharides for use.
[0029] 3,6-Anhydro-L-galactose can be obtained from commercially available reagents, or it can be produced by conventional methods. An example of such a method is the method described in Japanese Patent No. 4007760. Specifically, 450 μl of a 100 mM aqueous solution of agarobiose is mixed with 50 μl of 10-fold concentrated phosphate-buffered saline and 50 μl of a 10 units / μl β-galactosidase phosphate-buffered saline solution, and the mixture is reacted at 37°C for 1 hour. 5 ml of a 1-butanol:ethanol = 1:1 mixture is added to this reaction solution, and insoluble matter is precipitated by centrifugation. The resulting supernatant is subjected to column chromatography using a silica gel column, with 1-butanol:ethanol:water = 5:5:1 as the eluent and chromatographed at 0.3 kg / cm² using a compressor. 2 The mixture is pressurized and separated. By dividing the mixture into 7 ml portions, for example, fractions 14 through 17 can be obtained, each containing high-purity 3,6-anhydro-L-galactose. These fractions are collected and dried under reduced pressure to obtain 3,6-anhydro-L-galactose.
[0030] Non-patent document 7 states the following: First, the efficacy of the drug treatment was evaluated in hepatocellular carcinoma patients receiving combination therapy with atezolizumab (an immune checkpoint inhibitor) and bevacizumab (an angiogenesis inhibitor) according to the Response Evaluation Criteria in Solid Tumors guidelines. Patients who met the criteria for Complete Response (100% disappearance of cancer) or Partial Response (30% or more disappearance of tumor) were designated as the response group (Atz / Bev R). Patients who did not meet the response criteria were designated as the non-response group (NR). Using total DNA extracted from stool samples from 11 patients in the response group and 11 patients in the non-response group as a template, the relative amount of Bacteroides stercolis was measured by quantitative PCR. As shown in Figure 1, the level of Bacteroides stercolis (relative amount of Bacteroides stercolis) was significantly higher in the non-response group (NR) than in the response group (R).
[0031] According to the report in Non-Patent Document 7, individuals with a high proportion of Bacteroides stercolis in their bodies do not respond to immune checkpoint inhibitors, while those with a low proportion of this bacterium do respond. In other words, the number of Bacteroides stercolis bacteria can be used as an indicator to predict susceptibility to immune checkpoint inhibitors, and it can be said that reducing the number of this bacterium in the body can enhance susceptibility to immune checkpoint inhibitors.
[0032] "Inhibiting the growth" of Bacteroides stercolis includes not only reducing the number of bacteria (decreasing their proportion in the bacterial community), but also maintaining the number of bacteria at a similar level, or, even if the number of bacteria increases, the increase is smaller compared to when the active ingredient of the present invention (agarooligosaccharide, 3,6-anhydro-L-galactose, or oligosaccharides having this at their reducing end) is not used. Furthermore, inhibiting growth and inhibiting the number of bacteria are synonymous.
[0033] Whether or not the growth of Bacteroides stercolis can be inhibited can be confirmed by conventional methods. For example, if the bacterium is isolated, the active ingredient can be added to the culture medium, and the number of bacteria can be checked by turbidity analysis or similar methods, compared to when the ingredient is not added.
[0034] Furthermore, if Bacteroides stercolis is not isolated (for example, in samples such as feces or bodily fluids, a cocktail bacterial solution containing multiple bacterial species, or a human intestinal tract model), an example can be given of a method in which, for instance, the whole genomic DNA of bacteria extracted from the sample is used as a template to amplify bacterial-derived 16S rDNA by polymerase chain reaction (PCR), the amplified product is decoded by next-generation sequencing (NGS), the bacterial species and abundance are identified based on a 16S database, the abundance ratio of this bacterium is determined, and the results are compared, both when the active ingredient of the present invention is ingested or exposed to the sample and when it is not. In addition, quantitative PCR can be performed on the whole genomic DNA of bacteria using primers specific to Bacteroides stercolis. When confirming the number of this bacterium by PCR, since the amount of gene purified from the sample (purification efficiency) is not constant, it is preferable to calculate the proportion (abundance ratio, occupancy rate) of this bacterium to the total number of bacteria or the amount of template DNA and make a judgment based on that proportion.
[0035] When quantifying Bacteroides stercoris by PCR, specific primers can be designed based on publicly available sequence information to identify a portion of the genomic DNA (stercoris-conserved region) that is conserved in this bacterium but not in other species of the genus Bacteroides. For example, the genome of the reference strain of Bacteroides stercoris, Bacteroides stercoris ATCC 43183, is publicly available under accession number GenBank: CP102262.1.
[0036] As a conserved region of Bacteroides stercolis, for example, Non-Patent Literature 7 identifies a partial sequence of the DNA sequence of the heparinase gene possessed by this bacterium (SEQ ID NO: 1). Then, as specific primers for this bacterium, a forward primer corresponding to positions 488-513 in SEQ ID NO: 1 (SEQ ID NO: 2, underlined in SEQ ID NO: 1) and a reverse primer corresponding to positions 603-626 in SEQ ID NO: 1 (SEQ ID NO: 3, underlined in SEQ ID NO: 1) are used (Non-Patent Literature 7; METHODS, Primer design). In other words, Non-Patent Literature 7 quantifies Bacteroides stercolis by quantifying a partial sequence of the heparinase gene. In the present invention, this bacterium can also be quantified using such specific primers.
[0037] [Sequence ID 1] Heparinase gene from Bacteroides stercoris ATCC 43183 (length 2322 nucleotides), accession number: GenBank: CP102262.1 (genome): 550432-552753 (relevant region of the heparinase gene) ATGAAAAAAAGTATCCTATTTATCACGAGTTTTTTCCTCTGTTTTTTCTGTCTGAAAAGTAATGCGCAACAAAGCAGGCCAGAGGTTACCTGGGAGAATATGGAAGGCGTCACAGTACCCATTCCGCCGCAAGTACACCCCCGGCTTTATGTACGCTCCGCCGATTTGCCCGATTTAAAGAAACGCATGGAACACCCGCATGTAAAGGAAGTTCTGGCTACCCTGAACAAATTGGGCAAAGAC CGTACTCCCGAAGAAGAGGCAAAAGTCAAGGACAGAGGGTTCCGCTACTACTTTGAAATGCGTGGCGTGACCAGCCGCGTACAAGTGCAGGCACTCGACTATCTGGTGTATGGCGACAAGAAACAGGCCAGAGAGCGCCATTACCGCCATGCTGGACACGCTTCAGAACGTCAATTACGGAACAAAAGGTGATTTGTCGCGTGCCAGCGGTGTAATGCTCACCTGCGGTGCAATGGTATATGACT GGTGCTACGACCAGATGAAAGAATCC GAAAAGAAAGCTTACATAGAATCTTTCATCCGCATAGCCAAAACAATGGAATGCGGCTATCCCCCACGCAACAACGAACCGATTGCCGG GCACTCCAGCGAATGGATGATACT
[0038] Primers for amplifying the stercolis-conserved region of the heparinase gene. [SEQ ID NO. 2] Forward primer (heparinas_Synbio_F2); 5'-GGTGCTACGACCAGATGAAAGAATCC-3' [SEQ ID NO: 3] Reverse primer (heparinas_Synbio_R2); 5'- AGTATCATCCATTCGCTGGAGTGC -3'
[0039] In the present invention, "sensitivity to immune checkpoint inhibitors" refers to the degree to which the drug is effective in the target patient (how easily the drug works). "Enhancing sensitivity to immune checkpoint inhibitors" includes not only increasing the degree to which the drug is effective, but also maintaining the degree of effectiveness at a similar level, or, even if the degree of effectiveness decreases, the decrease is smaller compared to when the active ingredient of the present invention is not used.
[0040] As mentioned above, immune checkpoint inhibitors are drugs that suppress the function of immune checkpoint molecules. Immune checkpoint molecules are a group of molecules that negatively regulate the immune response, and specific examples include PD-L1, PD-L2, CTLA-4, PD-1, LAG-3, TIM-3, BTLA, TIGIT, VISTA / PD-1H, CD96, NIKG2A, KIR, CD4, CD8, CD19, CD28, CD80 / 86, B7, Galectin-9, HVEM, MHC-II, TCR, B7-H3, and B7-H4.
[0041] Examples of immune checkpoint inhibitors include antibodies against the above-mentioned immune checkpoint molecules (monoclonal antibodies, polyclonal antibodies). More specifically, examples of immune checkpoint inhibitors include anti-CTLA-4 antibodies (e.g., Ipilimumab, Tremelimumab), anti-PD-1 antibodies (e.g., Nivolumab, Pembrolizumab), anti-PD-L1 antibodies (e.g., Atezolizumab, Durvalmab, Avelumab), anti-LAG-3 antibodies, anti-Tim-3 antibodies, and anti-TIGIT antibodies.
[0042] It has become clear that cancer cells evade the immune system by utilizing the host's immune checkpoint molecules, and immune checkpoint inhibitors have traditionally been used in cancer treatment. The immune checkpoint inhibitor according to the present invention may also be used for cancer treatment.
[0043] The active ingredient of the present invention (agarooligosaccharide, 3,6-anhydro-L-galactose, or oligosaccharide having this at its reducing end) can be used, for example, in a form administered to humans or animals. More specific modes of use can be appropriately determined depending on the target of administration, application site, purpose of use, etc. For example, the mode and route of administration only needs to ensure that the active ingredient reaches the part where Bacteroides stercolis lives. Specifically, examples include oral administration, placement under the tongue (sublingually) or between the gums and cheek, insertion into the rectum (transrectally) or vagina (transvaginally), etc.
[0044] The amount of active ingredient to be ingested (dosage) can also be appropriately set depending on the target recipient, the form of the product, and the purpose. Specifically, examples of intake amounts for adults include 0.01 mg / kg body weight or more, 0.1 mg / kg body weight or more, 1 mg / kg body weight or more, 5 mg / kg body weight or more, 10 mg / kg body weight or more, 1000 mg / kg body weight or less, 800 mg / kg body weight or less, 600 mg / kg body weight or less, 400 mg / kg body weight or less, 200 mg / kg body weight or less, 100 mg / kg body weight or less, and 10 mg / kg body weight or less per day.
[0045] The active ingredient may be used as is in the form of food, beverages, supplements, pharmaceuticals, quasi-drugs, animal feed, etc., or it may be used as a raw material for food, beverages, supplements, pharmaceuticals, quasi-drugs, animal feed, etc., in combination with other ingredients. These products can be manufactured using the active ingredient as a raw material by methods known to those skilled in the art.
[0046] The amount of active ingredients in a product can also be set appropriately depending on the form and use of the product. Specifically, examples of amounts that can be set include 0.0001% by mass or more, 0.001% by mass or more, 0.01% by mass or more, 0.1% by mass or more, 100% by mass or less, 90% by mass or less, 80% by mass or less, 70% by mass or less, 60% by mass or less, 50% by mass or less, 40% by mass or less, 35% by mass or less, 30% by mass or less, 10% by mass or less, and 5% by mass or less.
[0047] The present invention will be described below based on examples. However, the technical scope of the present invention is not limited to the features shown in these examples. [Examples]
[0048] <Example 1> Preparation of agarooligosaccharides 50g of agar ("Ultra Agar AX-30" by Ina Food Industry Co., Ltd.) was added to 1000g of purified water and heated to dissolve. Then, 2g of concentrated sulfuric acid was added and the mixture was stirred at 90°C for 3 hours. After adjusting the pH to 3.5 with sodium hydroxide, the mixture was treated with activated carbon and then filtered through filter paper to collect the filtrate. This was further filtered through a 0.1μm pore size filter to collect the filtrate, and then powdered by vacuum freeze-drying to obtain agarooligosaccharide powder.
[0049] The composition of the prepared agarooligosaccharide was measured using high-performance liquid chromatography (Prominence® HPLC system (Shimadzu Corporation)). The measurement conditions were as follows: two columns (TSKgel® α-2500, Tosoh Corporation) connected in series, solvent H2O, flow rate 0.3 ml / min, temperature 60°C, elution, and detection by RI (differential refraction). The results were as follows (values are mass%). In this example, the composition containing the following 2-10 sugars is referred to as "agarooligosaccharide (AOS)". Disaccharide (agarobioses): 31.5 Tetrasaccharide (agarotetraose): 30.1 Hexasaccharide (agarohexaose): 21.2 8 sugars (agarooctaose): 11.6 Decasaccharide (agarodecaose): 5.6
[0050] <Example 2> Growth inhibitory effect of Bacteroides stercolis: Evaluation by turbidity (1)Culture conditions etc. The culture medium used was RF medium (*), which was a modified version of Brain-Heart Infusion medium (Thermo Scientific). Anaerobic culture was performed by static culture at 37°C using the anaerobic culture kit "Anelopack" (Mitsubishi Gas Chemical). *RF medium composition: 1L Brain-Heart Infusion medium, 5g yeast extract, 5g K2HPO4, 8g glucose, 0.5g L-cysteine hydrochloride, 1g Tween 80, 0.005g hemin, 0.002g vitamin K1, 0.001g resazurin sodium, 0.025g acetate, 0.01g MgSO2·7H2O, pH 6.8.
[0051] (2) Culturing in the presence of agarooligosaccharides Bacteroides stercoris JCM 9496 (Microbial Materials Development Laboratory, BioResource Research Center, RIKEN) (sometimes referred to as "BS strain") was cultured anaerobically in RF medium for 23.5 hours, and this was used as the starter culture. Meanwhile, four types of culture media were prepared: RF medium (Sample 1), RF medium to which agarooligosaccharide was added to a final concentration of 0.1% by mass (Sample 2) or 0.2% by mass (Sample 3), and RF medium to which sucrose was added to a final concentration of 0.5% by mass (Sample 4). These were used as the main culture media. Each of the main culture media was dispensed into Deep Well Plates (AxyGen Scientific, CA, USA) at a rate of 0.4 mL / well, and 20 μL of the 10-fold diluted starter culture was inoculated into each well, followed by 44 hours of anaerobically cultured incubation (main culture). Hereinafter, the culture solutions obtained using Samples 1-4 are referred to as Samples 1-4.
[0052] (3) Measurement of bacterial count by turbidity method 20 μL of the culture medium after the main culture was collected and diluted 10-fold by adding 180 μL of water. The absorbance (OD660) of the diluted culture medium was measured using a microplate reader (Wako SUNRISE Rainbow). The RF medium was similarly diluted 10-fold and measured. The absorbance of the culture medium was obtained by subtracting the value of the RF medium from the value of the culture medium and multiplying the result by 10. The absorbance of each sample was calculated as the average of 8 samples. Statistical analysis between groups was performed using the Mann-Whitney U test with the medical statistical analysis software GraphPad Prism (GraphPad Software), with P<0.05 considered statistically significant. The results are shown in Figure 2.
[0053] As shown in Figure 2, the absorbance (OD660) of the culture medium was 1.03 for sample 1 (main culture in RF medium), while that of sample 2 (main culture in sucrose-containing medium) was 1.25, which was higher than that of sample 1. On the other hand, the absorbances of sample 3 (main culture in AOS 0.1% medium) and sample 4 (main culture in AOS 0.2% medium) were 0.06 and 0.07, respectively, which were significantly lower than those of sample 1. In other words, the absorbance of the culture medium of Bacteroides stercolis decreased in the presence of agarooligosaccharides. From these results, it became clear that agarooligosaccharides can suppress the growth of Bacteroides stercolis.
[0054] <Example 3> Growth inhibitory effect of Bacteroides stercolis: Evaluation by abundance ratio (1) Culturing in the presence of agarooligosaccharides The culture conditions were as described in Example 2(1). The BS strain was cultured anaerobically in RF medium for 23.5 hours to obtain the BS seed liquor. In addition, a human commensal bacteria DNA cocktail (product name "DNA-Mock-003", lot 240101ND, National Institute of Technology and Evaluation Biotechnology Center (NBRC)) (sometimes referred to as the "cocktail strain") was cultured anaerobically in RF medium for 23.5 hours to obtain the cocktail seed liquor. The cocktail strain is a mixture of 20 microbial strains from the NBRC, as shown in Figure 3, with equal amounts of each strain's genomic DNA copy number. These 20 strains are known to inhabit the human intestines, oral cavity, skin, etc. Cocktail strains have been confirmed to have a detection rate of approximately 5% per strain in evaluation by shotgun sequencing (Tourlousse, DM, Narita, K., Miura, T. et al. Characterization and demonstration of mock communities as control reagents for accurate human microbiome community measurements. Microbiology Spectrum, 10(2): e01915-21.).
[0055] The BS seed liquor and the cocktail seed liquor were each diluted 10-fold and then mixed in equal volumes to prepare the mixed seed liquor. Two types of culture media were prepared: RF medium (Sample 1) and RF medium to which agarooligosaccharide was added to a final concentration of 0.2% by mass (Sample 2). These were used as the main culture media. After dispensing 0.4 mL / well of each culture medium into Deep Well Plates (AxyGen Scientific, CA, USA), 20 μL of the mixed seed liquor was inoculated into each well, and the wells were cultured anaerobically for 23.5 hours (main culture). Hereinafter, the culture solutions obtained using Sample 1 and Sample 2 will be referred to as Sample 1 and Sample 2, respectively.
[0056] (3) Measurement of bacterial count by turbidity method The absorbance of the culture medium after the main culture was measured using the method described in Example 2(3). However, the average absorbance was calculated as the average of four samples for each sample. The results are shown in Figure 4. As shown in Figure 4, the absorbance (OD660) of the culture medium was 3.24 for sample 1 (main culture in RF medium) and 2.98 for sample 2 (main culture in AOS-containing medium), and there was no significant difference between the two (ns). In other words, there was no significant difference in the total number of bacteria in the presence of agarooligosaccharides compared to the absence of agarooligosaccharides.
[0057] (4) Comprehensive analysis of the bacterial community The culture medium after the initial culture was diluted 10-fold, and 0.5 mL was taken and incubated at 70°C for 10 minutes. Subsequently, it was disrupted using zirconia beads in a FastPrep FP100A instrument (MP Biomedicals) at 4300 rpm for 2 minutes. This was then centrifuged at 15000 rpm for 1 minute, and the supernatant was collected to obtain total bacterial DNA. Using the total bacterial DNA as a template, PCR was performed using the universal primers of Sequence ID No. 4 and 5 below to amplify the V3-V4 region of bacterial 16S rDNA (Takahashi S, et al., (2014) Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing. PLoS ONE 9(8): e105592. Published: August 21, 2014). Forward primer (Pro341F): 5'-CCTACGGGNBGCASCAG-3' (SEQ ID NO: 4) Reverse primer (Pro805R): 5'-GACTACNVGGGTATCTAATCC-3' (SEQ ID NO: 5)
[0058] Next, the nucleotide sequences of the PCR amplification products were decoded using next-generation sequencing (NGS). NGS was performed using the paired-end sequencing method (2 × 300 bp) with the Illumina MiSeq platform (Illumina) and MiSeq Reagent Kit ver. 3 (Illumina). The decoded nucleotide sequences were analyzed using the EzBioCloud 16S database and the 16S microbiome pipeline (EzBioCloud 16S-based MTP app, https: / / www.EZbiocloud.net) to identify the species at the classification level and determine their relative abundance (occupancy rate). The relative abundance was calculated as a percentage of the total number of reads for each bacterial species. This NGS analysis was performed by Biotechnology Research Institute Co., Ltd.
[0059] As a result, the proportion of Bacteroides stercolis was 18.66% in sample 1 (main culture in RF medium), while it was significantly lower in sample 2 (main culture in AOS-containing medium) at 1.84%. In other words, the proportion of Bacteroides stercolis decreased in the presence of agarooligosaccharides. From these results, it became clear that agarooligosaccharides can suppress the growth of Bacteroides stercolis even in a bacterial community environment where a considerable amount of other bacterial species are present.
Claims
1. A growth inhibitor for Bacteroides stercoris, containing agarooligosaccharide as the active ingredient.
2. An immune checkpoint inhibitor sensitivity enhancer containing agarooligosaccharide as its active ingredient.
3. The agent according to claim 1, used to enhance sensitivity to immune checkpoint inhibitors.
4. The agent according to claim 1 or claim 2, wherein the agarooligosaccharide is an agarooligosaccharide containing agarobiose.
5. A growth inhibitor for Bacteroides stercoris, comprising 3,6-anhydro-L-galactose or an oligosaccharide having it at its reducing end as an active ingredient.
6. A method for suppressing the proliferation of Bacteroides stercoris in a living organism (excluding medical procedures), comprising the step of administering agarooligosaccharide, 3,6-anhydro-L-galactose, and / or oligosaccharides having these as reducing ends to a human or animal.
7. A method for enhancing sensitivity to immune checkpoint inhibitors (excluding medical procedures), comprising the step of administering agarooligosaccharides, 3,6-anhydro-L-galactose, and / or oligosaccharides having these as reducing ends to a human or animal.
Citation Information
Patent Citations
Composition for adjusting enterobacterial flora
JP2017163980A