Regulation of apolipoprotein (a) expression

ISIS681257, a GalNAc-conjugated antisense compound, addresses the limitations of existing apo(a) treatments by providing enhanced potency and duration for reducing Lp(a) levels, facilitating less frequent and lower dose administration for treating cardiovascular diseases.

JP7834686B2Active Publication Date: 2026-03-24IONIS PHARMACEUTICALS INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2023083529
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Priority Date
2015-11-06
Filing Date
2023-05-19
Publication Date
2026-03-24
Estimated Expiration
2036-11-07

AI Technical Summary

Technical Problem

Current treatments for cardiovascular diseases associated with elevated Lp(a) levels are limited, and existing antisense compounds targeting apo(a) show inadequate potency and duration of action when administered to humans.

Method used

The use of ISIS681257, a nucleic acid with a specific base sequence and a 5-10-5 gapmer motif conjugated with GalNAc, effectively reduces apo(a)mRNA and plasma Lp(a) levels in humans, offering significantly higher potency and longer duration compared to unmodified oligonucleotides.

Benefits of technology

ISIS681257 achieves a more than 30-fold improvement in apo(a)mRNA and plasma Lp(a) reduction in humans, allowing for less frequent dosing and potentially reducing treatment costs and adverse events.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007834686000012
    Figure 0007834686000012
  • Figure 0007834686000013
    Figure 0007834686000013
  • Figure 0007834686000014
    Figure 0007834686000014
Patent Text Reader

Abstract

To provide oligomeric compounds with conjugate groups targeting apolipoprotein(a).SOLUTION: Provided is an oligomeric compound for use in treating or preventing a disease or condition in a human, the oligomeric compound being ISIS 681257, the treatment comprising administering at most 500 mg of the oligomeric compound to the human during a dosing period.SELECTED DRAWING: Figure 1A
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence List This application is filed together with an electronic sequence listing. The sequence listing was created on November 3, 2016. The resulting file is 4KB in size, named BIOL0283WOSEQ_ST25.txt. The information in this electronic sequence listing is incorporated herein by reference in its entirety. It will be done. [Background technology]

[0002] The principle behind antisense technology is that antisense compounds hybridize with target nucleic acids. The purpose is to regulate the amount, activity, and / or function of the target nucleic acid. For example, in some cases Antisense compounds alter the transcription or translation of their target. Regulation is based, for example, on the degradation or occupation of target mRNA (occupancy-basic This can be achieved by inhibition. An example of regulation of RNA target function by degradation is: RN of target RNA during hybridization with DNA-like antisense compounds This is degradation by ase H. Another example of gene expression regulation by targeted degradation is RNA interference. This is RNAi. RNAi utilizes the RNA-induced silencing complex (RISC). This refers to antisense-mediated gene silencing via a mechanism involving RNA targeting function. Further examples of regulation are those based on occupation-based mechanisms, which are naturally mediated by microRNAs. This is the mechanism by which it is used. microRNAs are R that encode proteins. It is a small non-coding RNA that regulates NA expression. Antisense compounds are micro When it binds to RNA, the binding of that microRNA to its messenger RNA target is The microRNA mimetic is inhibited, thereby hindering the function of microRNA. This can enhance the innate function of microRNAs. Certain antisense compounds , alters pre-mRNA splicing. Regardless of the specific mechanism, anti-mRNA Due to their sequence specificity, these compounds are used as tools for target validation and gene functionalization. Furthermore, as a therapeutic agent that selectively regulates the expression of genes involved in the pathogenesis of disease, it is attractive. It has become such.

[0003] Antisense technology is an effective means of regulating the expression of one or more specific gene products. Therefore, it is unparalleled in its usefulness in numerous applications of treatment, diagnosis, and research. Antisense compounds can be found to have nuclease resistance, pharmacokinetic properties, or affinity to target nucleic acids. Chemically modified nucleosides can be introduced to enhance one or more properties, such as compatibility. Vitravene® (homivircene; Isis Ph) is a thicens compound. Developed by Armaceuticals Inc. (Carlsbad, CA), It was the first antisense drug to receive marketing authorization from the U.S. Food and Drug Administration (FDA) in 1998. Currently, there are treatments for cytomegalovirus (CMV)-induced retinitis in AIDS patients. That's how it is.

[0004] New chemical modifications have improved the potency and effectiveness of antisense compounds, and oral The possibility of delivery has been found, and furthermore, subcutaneous administration has been improved, reducing the possibility of side effects, and patients This leads to improved convenience. Chemical modifications that increase the potency of antisense compounds are This allows for the administration of lower doses, thereby reducing the potential for toxicity and the overall cost of treatment. Modifications that increase resistance to degradation delay clearance from the body. By doing so, the frequency of administration is reduced. Different types of chemical modifications are combined in a single compound. By combining these methods, the effectiveness of the compound can be further optimized.

[0005] Lipoproteins are spherical, micelle-like particles composed of proteins, phospholipids, and cholesterol. Acylglycerol and cholesteryl surrounded by the amphiphilic coating of the ole It consists of a nonpolar ester core. Lipoproteins are based on their functional and physical properties. chylomicrons, very low-density lipoproteins (VLDL), intermediate-density lipoproteins ( There are five types of lipoproteins: IDL, low-density lipoprotein (LDL), and high-density lipoprotein (HDL). They are classified into a wide range of categories. Chylomicrons transport dietary lipids from the intestines to tissues. VLDL, IDL, and LDL are all triacylglycerols and cholesterol. It transports cholesterol from the liver to tissues. HDL transports endogenous cholesterol from tissues to the liver.

[0006] Lipoprotein particles undergo a continuous metabolic process and possess variable properties and composition. The density of a polyprotein is such that the density of its outer coating is lower than the density of its inner core. Therefore, it increases without an increase in particle size. The protein components of lipoproteins are They are known as apolipoproteins. In various human lipoproteins, at least Nine apolipoproteins are distributed in considerable quantities.

[0007] Lipoprotein (a) [Lp(a)] particles were identified about 50 years ago, and one a Polypoprotein B (apoB) proteins form a single apolipota via disulfide bonds. Either extremely unique LDL particles bound to protein (a) [apo(a)] protein is composed of. Apo(a) protein has a high degree of homology with plasminogen, especially within the kringle IV type 2 repeat domain. The level of circulating Lp(a) is inversely proportional to the number of kringle IV type 2 variable repeats present in the molecule, and when both alleles are co-expressed within an individual, it may exhibit a heterozygous plasma isoform profile (Kraft et al., Eur J Hum Genet, 1996;4(2):74 - 87). These kringle repeats in apo(a) may be the factors for its prothrombotic and antifibrinolytic properties, and are considered to have the potential to enhance atherosclerotic progression. Apo(a) is transcriptionally regulated by IL-6, and in a study of rheumatoid arthritis patients treated with an IL-6 inhibitor (tocilizumab), plasma levels decreased by 30% after 3 months of treatment (Schultz et al., PLoS One 2010;5:e143 28).

[0008] Apo(a) preferentially binds to oxidized phospholipids and has been shown to promote vascular inflammation (Bergmark et al., J Lipid Res 2008;49:22 30 - 2239; Tsimikas et al., Circulation. 2009 ;119(13):1711 - 1719).

[0009] Furthermore, studies have shown that Lp(a) particles can stimulate endothelial permeability, induce the expression of plasminogen activator inhibitor type 1, and activate the secretion of macrophage interleukin 8.

[0010] ​​​​​​It has also been suggested (Koschinsky and Marcovina, Curr O (Pin: Lipidol 2004;15:167-174). Importantly, recent research Genetic studies have shown that Lp(a) is associated with myocardial infarction, stroke, peripheral vascular disease, and abdominal aortic aneurysm. It has been identified as an independent risk factor (Rifai et al., Clin). Chem 2004;50:1364-71;Erqou et al.,JAMA 2 009;302:412-23;Kamstrup et al.,Circulati (on 2008;117:176-84). Furthermore, recent early-onset coronary artery disease (PROCA) In the RDIS study, Clarke et al. (NEJM (200) 9)361;2518-2528) shows the relationship between coronary heart disease and plasma Lp(a) concentration. Strongly independent associations were described. In addition, Solfrizzi et al. found that serum Lp(a (Sol) suggested that an increase in ) may be related to an increased risk of Alzheimer's disease (AD). frizzi et al.,J Neurol Neurosurg Psychia try 2002,72:732-736. Currently, in clinical practice, treating cardiovascular diseases Examples of indirect apo(a) inhibitors used for treatment include aspirin, niaspan, and mipomel. Sen, anacetrapib, epirotirome, and lomitapide are among the drugs mentioned. These were found to be plasma Lp(a) levels of 18%, 39%, 32%, and 36%, respectively. It reduces by 43% and 17%. Furthermore, the clinic uses Lp(a) particles containing apo(a). Lp(a) apheresis is used to reduce it.

[0011] Until now, the treatment of cardiovascular disease has been based on directly targeting the apo(a) level. Treatment strategies have been limited. Ribozyme oligonucleotides (US 5,877,02 No. 2) and antisense oligonucleotide (WO2005 / 000201; WO200 3 / 014397;WO2013 / 177468;US20040242516;US Special Licenses No. 8,138,328, No. 8,673,632, and No. 7,259,150; Merki et al., J Am Coll Cardiol 2011;57:1 611-1621; Each publication is referred to in its entirety) has been developed, No commercial use of the discrepancy is permitted.

[0012] WO2014 / 179625 targets APO(a), including ISIS681257. The document discloses antisense compounds.

[0013] Tsimikas et al. (Lancet.2015 Oct 10;386:1472-8 3) is an antisense compound that targets human apo(a): ISIS494372(IS Phase 1 randomized, double-blind, placebo-based study using IS-APO(a)Rx (also known as IS-APO(a)Rx). The results of the controlled trial are disclosed.

[0014] RNAse H-dependent (gapmer) antisense synthesis of apo(a) targeted compounds One chemical modification used to improve the activity of the compound in vivo was GalNA This is linkage to conjugate groups such as C clusters. Linkage to conjugate groups is non It has been shown to improve in vivo efficacy in human subjects, for example, WO Conjugates to GalNAc clusters as disclosed in 2014 / 179620 This includes the use of a modified RNAse H-dependent (gapmer) antisense compound. Previously, R conjugated to GalNAc clusters achieved target reduction. NAse H-dependent (gapmer) antisense compounds have not been tested in humans.

[0015] This includes patients at high risk of cardiovascular events due to chronically elevated plasma Lp(a) levels. In humans, a novel drug capable of potently and selectively reducing apo(a) levels There are still unmet medical needs in this area. [Overview of the project]

[0016] This disclosure relates to the cardiovascular events in humans, particularly those resulting from chronically elevated plasma Lp(a) levels. By administering ISIS681257 to high-risk individuals, human disease or The present invention provides a method for treating the disease. ISIS681257 has the following structure and contains its salts. nothing. [ka]

[0017] An example of ISIS681257 salt is shown below. [ka]

[0018] ISIS681257 is a nucleic acid with the base sequence TGCTCCGTTGGTGCTTGTTC( Sequence ID 1), contains a 5-10-5 gapmer motif and a GalNAc conjugate. It includes modified oligonucleotides. As shown in this disclosure, ISIS681257 is It has primary benefits in the treatment of humans. When administered to humans, ISIS681257 has the effect of It reduces apo(a)mRNA and plasma Lp(a) in terms of both its strength and duration of action. It is particularly effective in causing this. As shown by the data provided herein, IS IS681257 has the same nucleic acid base sequence and the same 5-10-5 gapmer motif. However, compared to modified oligonucleotides lacking the GalNAc conjugate, in humans... It shows an increase of more than 30 times in this case. ISIS681257 is apo(a)mRNA and blood It results in a significant reduction in plasma Lp(a) and is administered once a week, once a month, once every two months, or every three months. This allows for a single effective dose.

[0019] Unconjugated compound (nucleic acid base sequence TGCTCCGTTGGTGCTT) ISIS similarly possesses GTTC (SEQ ID NO: 1) and the 5-10-5 gapmer motif. 494372 and a compound conjugated with GalNAc (ISIS681257) In previous experiments concerning both, the GalNAc-conjugated compound was found to be as follows (according to this specification). The efficacy in humans was significantly lower than that observed after the first dose in humans as reported. , and / or it was suggested that the duration of action was significantly short, as shown herein The clinical results of ISIS681257 are astonishing (for example, WO2014 / 1 Examples 89, 100 and 108 of 79625 and Tsimikas et al., (See Lancet, 2015 Oct 10;386:1472-83). ISIS49 Previous experiments on both 4372 and ISIS681257 showed that GalNAc was conjugated We demonstrated that the high in vivo potency of the compound in mice yields benefits. However, these previous experiments revealed an unexpected improvement of more than 30 times in humans. It was not expected, and was not anticipated. In the previous experiment, ISIS681257 was a human In Lancegenic Apo(a) mice, compared to ISIS494372, approximately 13 It showed a twofold improvement in potency (at baseline plasma Lp(a) levels) (ISIS68125). 7 ED50=0.8mg / kg / week; ISIS494372 ED50=11mg / k (g / week). ISIS494372 and ISIS68125 observed in human Phase 1 clinical trials. The improvement in potency between 7 and 7 was, surprisingly, observed for the same pair of compounds in mice. The improvement rate was more than twice as high as anticipated, which was unexpected. These were surprising results. In light of this, the compound conjugated with GalNAc (ISIS681257 When used to treat humans, the GalNAc-conjugated compound (and its salts) In the case of the patient, the dose and / or frequency of administration may be lower than predicted based on previous in vivo studies. It can be given. For example, Viney, et al. Lancet, 2016, Se See p 2016;388:2239-53. This is in human treatment 1 More than one very important improvement, such as reduced treatment costs, improved patient compliance, and pharmaceuticals. Risk of potential adverse events due to reduced dosage and / or lower dose regimens of the drug. This could potentially lead to a reduction in waste.

[0020] This disclosure provides the following non-limiting embodiments.

[0021] Embodiment 1: Oligo for use in the treatment or prevention of diseases or conditions in humans The oligomer compound is ISIS681257, and the treatment This includes administering an oligomer compound of 500 mg or less to a human during the treatment period. Ligomer compounds.

[0022] Embodiment 2: The treatment involves administering an oligomeric compound of 250 mg or less to a human during the drug administration period. An oligomeric compound for use according to Embodiment 1, including administration.

[0023] Embodiment 3: The treatment involves administering 100 mg or less of an oligomeric compound to a human during the drug administration period. An oligomeric compound for use according to Embodiment 1, including administration.

[0024] Embodiment 4: The treatment involves administering an oligomer compound of 50 mg or less to a human during the drug administration period. An oligomeric compound for use according to Embodiment 1, including the provision of an oligomer compound.

[0025] Embodiment 5: The treatment involves administering 25 mg or less of an oligomeric compound to a human during the medication period. An oligomeric compound for use according to Embodiment 1, including the provision of an oligomer compound.

[0026] Embodiment 6: The treatment involves administering 15 mg or less of an oligomeric compound to a human during the drug administration period. An oligomeric compound for use according to Embodiment 1, including the provision of an oligomer compound.

[0027] Embodiment 7: The use described in any of Embodiments 1 to 6, wherein the medication period is 3 months. Oligomer compounds for this purpose.

[0028] Embodiment 8: The use described in any of Embodiments 1 to 6, wherein the medication period is 2 months. Oligomer compounds for this purpose.

[0029] Embodiment 9: The use described in any of Embodiments 1 to 6, wherein the medication period is one month. Oligomer compounds for this purpose.

[0030] Embodiment 10: The use described in any of Embodiments 1 to 6, wherein the medication period is 4 weeks. Oligomer compounds for use in this purpose.

[0031] Embodiment 11: The use described in any of Embodiments 1 to 6, wherein the medication period is 3 weeks. Oligomer compounds for use in this purpose.

[0032] Embodiment 12: The use described in any of Embodiments 1 to 6, wherein the medication period is 2 weeks. Oligomer compounds for use in this purpose.

[0033] Embodiment 13: The use described in any of Embodiments 1 to 6, wherein the medication period is one week. Oligomer compounds for use in this purpose.

[0034] Embodiment 14: The treatment involves administering a unit dose containing 125 mg or less of the oligomer compound. An oligomer compound for use as described in any of the prior embodiments, including the following:

[0035] Embodiment 15: The treatment involves administering a unit dose containing 100 mg or less of the oligomer compound. An oligomer compound for use as described in any of the prior embodiments, including the following:

[0036] Embodiment 16: The treatment involves administering a unit dose containing 75 mg or less of the oligomer compound. An oligomeric compound for use as described in any of the prior embodiments, including the above.

[0037] Embodiment 17: The treatment involves administering a unit dose containing 50 mg or less of the oligomer compound. An oligomeric compound for use as described in any of the prior embodiments, including the above.

[0038] Embodiment 18: The treatment involves administering a unit dose containing 25 mg or less of the oligomer compound. An oligomeric compound for use as described in any of the prior embodiments, including the above.

[0039] Embodiment 19: The treatment involves administering a unit dose containing 15 mg or less of the oligomer compound. An oligomeric compound for use as described in any of the prior embodiments, including the above.

[0040] Embodiment 20: The treatment involves administering a unit dose containing 1 mg or more of the oligomer compound. An oligomeric compound for use according to any one of embodiments 14 to 19, comprising the above.

[0041] Embodiment 21: The treatment involves administering a unit dose containing 2.5 mg or more of the oligomer compound. An oligomer compound for use according to Embodiment 20, which includes the following:

[0042] Embodiment 22: The treatment involves administering a unit dose containing 5 mg or more of the oligomer compound. An oligomeric compound for use according to Embodiment 20, comprising the above.

[0043] Embodiment 23: The treatment is administered in units of 75 mg to 85 mg, and optionally in units of 80 mg. Oligo for use according to any of embodiments 14 to 22, including administering a certain amount - Compound.

[0044] Embodiment 24: The treatment is administered in units of 55 mg to 65 mg, and optionally in units of 60 mg. Oligo for use according to any of embodiments 14 to 22, including administering a certain amount - Compound.

[0045] Embodiment 25: The treatment is administered in units of 35 mg to 45 mg, and optionally in units of 40 mg. Oligo for use according to any of embodiments 14 to 22, including administering a certain amount - Compound.

[0046] Embodiment 26: The treatment is administered in units of 25 mg to 35 mg, optionally with a unit dose of 30 mg. Oligo for use according to any of embodiments 14 to 22, including administering a certain amount - Compound.

[0047] Embodiment 27: The treatment is administered in units of 15 mg to 25 mg, optionally 20 mg. Oligo for use according to any of embodiments 14 to 22, including administering a certain amount - Compound.

[0048] Embodiment 28: The treatment is administered in units of 5 mg to 15 mg, or optionally 10 mg. The oligomer for use according to any one of embodiments 14 to 22, which includes administering the oligomer. compound.

[0049] Embodiment 29: The treatment involves administering a unit dose not exceeding 1 to a human during the medication period. An oligomeric compound for use according to any one of embodiments 14 to 28, comprising the above.

[0050] Embodiment 30: The treatment involves administering a unit dose not exceeding 2 to a human during the medication period. An oligomeric compound for use according to any one of embodiments 14 to 28, comprising the above.

[0051] Embodiment 31: The treatment involves administering a unit dose not exceeding 3 to a human during the medication period. An oligomeric compound for use according to any one of embodiments 14 to 28, comprising the above.

[0052] Embodiment 32: The treatment involves administering a unit dose not exceeding 4 to a human during the medication period. An oligomeric compound for use according to any one of embodiments 14 to 28, comprising the above.

[0053] Embodiment 33: The treatment involves administering a unit dose not exceeding 5 to a human during the medication period. An oligomeric compound for use according to any one of embodiments 14 to 28, comprising the above.

[0054] Embodiment 34: The treatment involves administering a unit dose not exceeding 6 to a human during the medication period. An oligomeric compound for use according to any one of embodiments 14 to 28, comprising the above.

[0055] Embodiment 35: (i) The treatment involves administering an oligomeric compound of 100 mg or less during the medication period. Embodiment 1 to include administering to a human, and (ii) the duration of the medication is 3 months. 34. Oligomer compounds for use as described in any of the above.

[0056] Embodiment 36: (i) The treatment involves administering an oligomeric compound of 100 mg or less during the medication period. (ii) administering to a human, wherein the duration of the medication is 3 months, and (iii) Embodiments in which the treatment includes administering to a human being a unit dose not exceeding 1 during the course of treatment. Oligomer compounds for use as described in 35.

[0057] Embodiment 37: The treatment involves administering 75 mg to 85 mg, optionally 80 mg, during the medication period. Embodiment 35 or Embodiment 36, which includes administering the ligomer compound to a human. Oligomer compounds.

[0058] Embodiment 38: (i) The treatment involves administering an oligomeric compound of 100 mg or less during the medication period. Embodiments 1 to 2000 include administering the drug to a human, and (ii) the duration of the drug administration is 2 months. 34. Oligomer compounds for use as described in any of the above.

[0059] Embodiment 39: (i) The treatment involves administering an oligomeric compound of 100 mg or less during the medication period. (ii) administering to a human, wherein the duration of the medication is 2 months, and (iii) Embodiments in which the treatment includes administering to a human being a unit dose not exceeding 1 during the course of treatment. Oligomer compounds for use as described in 38.

[0060] Embodiment 40: The treatment involves administering 75 mg to 85 mg, optionally 80 mg, during the medication period. Embodiment 38 or Embodiment 39, which includes administering a ligomer compound to a human. Oligomer compounds.

[0061] Embodiment 41: (i) The treatment involves administering an oligomeric compound of 100 mg or less during the medication period. Embodiments 1 to 1, which include administering the drug to a human, and (ii) the duration of the drug administration is one month. 34. Oligomer compounds for use as described in any of the above.

[0062] Embodiment 42: (i) The treatment involves administering an oligomeric compound of 100 mg or less during the medication period. (ii) administering to a human, wherein the duration of the medication is one month, and (iii) Embodiments in which the treatment includes administering to a human being a unit dose not exceeding 1 during the course of treatment. Oligomer compounds for use as described in 41.

[0063] Embodiment 43: The treatment involves administering 75 mg to 85 mg, optionally 80 mg, during the medication period. Embodiment 41 or Embodiment 42, which includes administering the ligomer compound to a human. Oligomer compounds.

[0064] Embodiment 44: (i) The treatment involves administering an oligomeric compound at a dose of 75 mg or less during the medication period. Embodiments 1 to 3 include administration to a human, and (ii) the duration of such administration is one month. 4. An oligomeric compound for use as described in any of the above.

[0065] Embodiment 45: (i) The treatment involves administering an oligomeric compound at a dose of 75 mg or less during the medication period. (ii) the duration of the medication is one month, and (iii) the Embodiment 4 includes administering a unit dose not exceeding 1 to a person during the course of treatment. Oligomer compounds for use as described in 4.

[0066] Embodiment 46: The treatment involves administering 55 mg to 65 mg, optionally 60 mg, during the medication period. Embodiment 44 or Embodiment 45, which includes administering the ligomer compound to a human. Oligomer compounds.

[0067] Embodiment 47: (i) The treatment involves administering an oligomeric compound of 50 mg or less during the medication period. Embodiments 1 to 3 include administration to a human, and (ii) the duration of such administration is one week. 4. An oligomeric compound for use as described in any of the above.

[0068] Embodiment 48: (i) The treatment involves administering an oligomer compound of 50 mg or less during the medication period. (ii) the duration of the medication is one week, and (iii) the Embodiment 4 includes administering a unit dose not exceeding 1 to a person during the course of treatment. Oligomer compounds for use as described in 7.

[0069] Embodiment 49: The treatment involves administering 35 mg to 45 mg, optionally 40 mg, during the medication period. Embodiment 47 or Embodiment 48, which includes administering the ligomer compound to a human. Oligomer compounds.

[0070] Embodiment 50: The treatment involves administering 25 mg to 35 mg, optionally 30 mg, during the medication period. Embodiment 47 or Embodiment 48, which includes administering the ligomer compound to a human. Oligomer compounds.

[0071] Embodiment 51: The treatment involves administering 15 mg to 25 mg, optionally 20 mg, during the medication period. Embodiment 47 or Embodiment 48, which includes administering the ligomer compound to a human. Oligomer compounds.

[0072] Embodiment 52: The treatment involves administering 5 mg to 15 mg, optionally 10 mg of an oil during the medication period. The method described in Embodiment 47 or Embodiment 48, which includes administering a gomer compound to a human. Ligomer compounds.

[0073] Embodiment 53: (i) The treatment involves administering an oligomeric compound of 250 mg or less during the medication period. Embodiment 1 to include administering to a human, and (ii) the duration of the medication is 4 weeks. 34. Oligomer compounds for use as described in any of the above.

[0074] Embodiment 54: The treatment involves administering 40 mg of the oligomer compound six times during the medication period. An oligomer compound for use according to Embodiment 53, which includes the following:

[0075] Embodiment 55: (i) The treatment involves administering 40 mg of the oligomer compound six times during the medication period. Embodiment 53 or implementation comprising (ii) administering and (ii) thereafter once a week An oligomeric compound for use as described in Form 54.

[0076] Embodiment 56: The treatment involves administering 30 mg of the oligomer compound six times during the medication period. An oligomer compound for use according to Embodiment 53, which includes the following:

[0077] Embodiment 57: (i) The treatment involves administering 30 mg of the oligomer compound six times during the medication period. Embodiment 53 or implementation comprising (ii) administering and (ii) thereafter once a week An oligomeric compound for use as described in Form 56.

[0078] Embodiment 58: The treatment involves administering 20 mg of the oligomer compound six times during the medication period. An oligomer compound for use according to Embodiment 53, which includes the following:

[0079] Embodiment 59: (i) The treatment involves administering 20 mg of the oligomer compound six times during the medication period. Embodiment 53 or implementation comprising (ii) administering and (ii) thereafter once a week An oligomeric compound for use as described in Form 58.

[0080] Embodiment 60: The human being experiences a cardiovascular event caused by an increase in plasma Lp(a) levels. An oligomeric compound for use according to any of embodiments 1 to 59, having a high saturation.

[0081] Embodiment 61: The disease or condition is calcified aortic valve stenosis associated with elevated Lp(a), Increased cardiovascular risk associated with elevated Lp(a), and cardiovascular events associated with elevated Lp(a) Oligomer compounds for use as described in any of embodiments 1 to 59, selected from the recurrence thing.

[0082] Embodiment 62: A prior embodiment in which the oligomer compound is administered to a human by injection. An oligomeric compound for use as described in any of the following.

[0083] Embodiment 63: An embodiment in which the oligomer compound is administered to a human by subcutaneous injection. Oligomer compounds for use as described in 62.

[0084] Embodiment 64: The oligomer compound is formulated in a sterile solution, and optionally, the oligomer compound is prepared in a sterile solution. Embodiment 62 or Embodiment 6, in which each unit dose of the gomer compound does not exceed 1 mL of sterile solution. The oligomeric compound for use as described in 3.

[0085] Embodiment 65: Each unit dose of the oligomer compound does not exceed 0.8 mL of sterile solution. The oligomeric compound for use as described in Embodiment 64.

[0086] Embodiment 66: Each unit dose of the oligomer compound does not exceed 0.5 mL of sterile solution. The oligomeric compound for use as described in Embodiment 64.

[0087] Embodiment 67: Each unit dose of the oligomer compound does not exceed 0.4 mL of sterile solution. The oligomeric compound for use as described in Embodiment 64.

[0088] Embodiment 68: Each unit dose of the oligomer compound does not exceed 0.25 mL of sterile solution. , the oligomeric compound for use as described in Embodiment 64.

[0089] Embodiment 69: Each unit dose of the oligomer compound does not exceed 0.2 mL of sterile solution. The oligomeric compound for use as described in Embodiment 64.

[0090] Embodiment 70: The use described in any of Embodiments 64 to 69, wherein the sterile solution is water. Oligomer compounds for this purpose.

[0091] Embodiment 71: Embodiment 64, wherein the sterile solution is water containing a sodium phosphate buffer. Oligomer compounds for use as described in any of the ~69.

[0092] Embodiment 72: The sterile solution is water containing a sodium phosphate buffer and sodium chloride. An oligomeric compound for use according to any one of embodiments 64 to 69.

[0093] Embodiment 73: The treatment involves the administration of human fasting plasma Lp(a) at the start and end of the medication period. When the concentration is measured, the fasting plasma Lp(a) concentration of the person is reduced by at least 50%. An oligomeric compound for use as described in any of the prior embodiments.

[0094] Embodiment 74: The treatment involves the administration of human fasting plasma Lp(a) at the start and end of the medication period. When the concentration is measured, the fasting plasma Lp(a) concentration of the person is reduced by at least 75%. An oligomeric compound for use as described in any of the prior embodiments.

[0095] Embodiment 75: The treatment involves the administration of human fasting plasma Lp(a) at the start and end of the medication period. When the concentration is measured, the fasting plasma Lp(a) concentration of the person is reduced by at least 80%. An oligomeric compound for use as described in any of the prior embodiments.

[0096] Embodiment 76: The treatment involves the administration of human fasting plasma Lp(a) at the start and end of the medication period. When the concentration is measured, the fasting plasma Lp(a) concentration of the person is reduced by at least 85%. An oligomeric compound for use as described in any of the prior embodiments.

[0097] Embodiment 77: Oligomer compound and one or more pharmaceutically acceptable carriers or diluents A pharmaceutical composition comprising the oligomer compound ISIS681257, The pharmaceutical composition contains 125 mg or less of an oligomer compound.

[0098] Embodiment 78: The pharmaceutical composition contains 100 mg or less of an oligomer compound, The pharmaceutical composition described in Form 77.

[0099] Embodiment 79: The pharmaceutical composition contains 75 mg or less of an oligomer compound, The pharmaceutical composition described in Form 77.

[0100] Embodiment 80: The pharmaceutical composition contains 50 mg or less of an oligomer compound, The pharmaceutical composition described in Form 77.

[0101] Embodiment 81: The pharmaceutical composition contains 25 mg or less of an oligomer compound, The pharmaceutical composition described in Form 77.

[0102] Embodiment 82: The pharmaceutical composition contains 15 mg or less of an oligomer compound, The pharmaceutical composition described in Form 77.

[0103] Embodiment 83: The pharmaceutical composition contains 10 mg or less of an oligomer compound, The pharmaceutical composition described in Form 77.

[0104] Embodiment 84: The pharmaceutical composition contains 1 mg or more of the oligomer compound. The pharmaceutical composition described in 77.

[0105] Embodiment 85: The pharmaceutical composition contains 2.5 mg or more of the oligomer compound, The pharmaceutical composition described in Form 77.

[0106] Embodiment 86: Embodiment containing 5 mg or more of the oligomer compound The pharmaceutical composition described in 77.

[0107] Embodiment 87: The pharmaceutical composition contains 10 mg or more of the oligomer compound, The pharmaceutical composition described in Form 77.

[0108] Embodiment 88: The composition contains 75 mg to 85 mg, optionally 80 mg of oligomer compounds A pharmaceutical composition according to Embodiment 77, comprising a substance.

[0109] Embodiment 89: The composition contains 55 mg to 65 mg, optionally 60 mg of oligomer compounds A pharmaceutical composition according to Embodiment 77, comprising a substance.

[0110] Embodiment 90: The composition contains 35 mg to 45 mg, optionally 40 mg, of oligomer compounds A pharmaceutical composition according to Embodiment 77, comprising a substance.

[0111] Embodiment 91: The composition contains 25 mg to 35 mg, optionally 30 mg of oligomer compounds A pharmaceutical composition according to Embodiment 77, comprising a substance.

[0112] Embodiment 92: The composition contains 15 mg to 25 mg, optionally 20 mg of oligomer compounds A pharmaceutical composition according to Embodiment 77, comprising a substance.

[0113] Embodiment 93: The composition contains 5 mg to 15 mg, optionally 10 mg, of an oligomeric compound. A pharmaceutical composition according to Embodiment 77, comprising:

[0114] Embodiment 94: Embodiment 7, in which the composition is formulated for administration to humans by injection. A pharmaceutical composition as described in any of items 7 to 93.

[0115] Embodiment 95: The oligomer compound is formulated in a sterile solution, and optionally the composition The pharmaceutical composition according to Embodiment 94, wherein the amount does not exceed 1 mL of sterile solution.

[0116] Embodiment 96: The pharmaceutical composition is described in Embodiment 95, wherein the amount of the composition does not exceed 0.8 mL of sterile solution. A pharmaceutical composition.

[0117] Embodiment 97: The pharmaceutical composition is described in Embodiment 95, wherein the amount of the composition does not exceed 0.5 mL of sterile solution. A pharmaceutical composition.

[0118] Embodiment 98: The pharmaceutical composition is described in Embodiment 95, wherein the amount of the composition does not exceed 0.4 mL of sterile solution. A pharmaceutical composition.

[0119] Embodiment 99: The pharmaceutical composition is described in Embodiment 95, wherein the amount of the pharmaceutical composition does not exceed 0.25 mL of sterile solution. A listed pharmaceutical composition.

[0120] Embodiment 100: The pharmaceutical composition is described in Embodiment 95, wherein the amount of the pharmaceutical composition does not exceed 0.2 mL of sterile solution. A listed pharmaceutical composition.

[0121] Embodiment 101: The medical device according to any one of Embodiments 95 to 100, wherein the sterile solution is water. A pharmaceutical composition.

[0122] Embodiment 102: Embodiment 9, in which the sterile solution is water containing a sodium phosphate buffer. A pharmaceutical composition as described in any of numbers 5 to 100.

[0123] Embodiment 103: The sterile solution is water containing sodium phosphate buffer and sodium chloride. A pharmaceutical composition according to any one of embodiments 95 to 100.

[0124] Embodiment 104: The administration of the composition to humans at the start and end of the drug administration period When fasting plasma Lp(a) concentration is measured, the fasting plasma Lp(a) concentration of the person in question is reduced. A pharmaceutical composition according to any one of embodiments 77 to 103, which reduces by at least 50%.

[0125] Embodiment 105: The administration of the composition to humans at the start and end of the drug administration period When fasting plasma Lp(a) concentration is measured, the fasting plasma Lp(a) concentration of the person in question is reduced. A pharmaceutical composition according to any one of embodiments 77 to 103, which reduces by at least 75%.

[0126] Embodiment 106: The administration of the composition to humans at the start and end of the drug administration period When fasting plasma Lp(a) concentration is measured, the fasting plasma Lp(a) concentration of the person in question is reduced. A pharmaceutical composition according to any one of embodiments 77 to 103, which reduces by at least 80%.

[0127] Embodiment 107: The administration of the composition to humans at the start and end of the drug administration period When fasting plasma Lp(a) concentration is measured, the fasting plasma Lp(a) concentration of the person in question is reduced. A pharmaceutical composition according to any one of embodiments 77 to 103, which reduces by at least 85%.

[0128] Embodiment 108: For manufacturing the pharmaceutical composition described in any of Embodiments 77 to 107 A method comprising adding an oligomeric compound of 125 mg or less to one or more pharmaceutically acceptable compounds A method comprising combining a diluent, excipient, or carrier.

[0129] Embodiment 109: (a) Each of the pharmaceutical compositions described in any of Embodiments 77 to 107 (b) units for treatment according to any of embodiments 1 to 76 Packaged pharmaceutical products, including printed instructions describing the dosage form. .

[0130] Embodiment 110: Contains the pharmaceutical composition described in any of Embodiments 77 to 107, without Bacteria sealed container.

[0131] Embodiment 111: The sterile container according to Embodiment 110, wherein the container is a vial.

[0132] Embodiment 112: The sterile container according to Embodiment 110, wherein the container is a syringe.

[0133] Embodiment 113: (a) A sealed sterile container according to any of Embodiments 110 to 112 Each contains multiple unit dosage forms, and (b) the therapeutic method described in any of Embodiments 1 to 76 Packaged with printed instructions describing the administration of the unit dosage form. Pharmaceutical products.

[0134] Embodiment 114: A method for treating a disease or condition in a human, wherein during the drug administration period This includes administering an oligomer compound of 500 mg or less to a human, and said oligomer compound The item is ISIS681257, method.

[0135] Embodiment 115: The method includes the treatment described in any of Embodiments 1 to 76. The method described in morphology 114.

[0136] Embodiment 116: Pharmaceutical composition according to any of Embodiments 77 to 107, Embodiment 10 Packaged pharmaceutical compositions as described in 9 or 113, or embodiments 110-11 Use of ISIS681257 in the manufacture of sterile sealed containers as described in either of the two.

[0137] Embodiment 117: Administer a unit dose of ISIS681257 to a subject requiring it. A method that includes doing so.

[0138] Embodiment 118: The method according to Embodiment 117, wherein the unit dose is 120 mg.

[0139] Embodiment 119: The method according to Embodiment 117, wherein the unit dose is 100 mg.

[0140] Embodiment 120: The method according to Embodiment 117, wherein the unit dose is 80 mg.

[0141] Embodiment 121: The method according to Embodiment 117, wherein the unit dose is 60 mg.

[0142] Embodiment 122: The method according to Embodiment 117, wherein the unit dose is 40 mg.

[0143] Embodiment 123: The method according to Embodiment 117, wherein the unit dose is 30 mg.

[0144] Embodiment 124: The method according to Embodiment 117, wherein the unit dose is 20 mg.

[0145] Embodiment 125: The method according to Embodiment 117, wherein the unit dose is 15 mg.

[0146] Embodiment 126: The method according to Embodiment 117, wherein the unit dose is 10 mg.

[0147] Embodiment 127: The unit dose is administered once a week, according to Embodiments 117 to 126. A method using one of the following methods.

[0148] Embodiment 128: The unit dose is administered once every two weeks, as in Embodiments 117-126. Either method.

[0149] Embodiment 129: The unit dose is administered once every three weeks, as in Embodiments 117-126. Either method.

[0150] Embodiment 130: The unit dose is administered once every four weeks, as in Embodiments 117-126. Either method.

[0151] Embodiment 131: The unit dose is administered once a month, according to Embodiments 117 to 126 A method using one of the following methods.

[0152] Embodiment 132: The unit dose is administered once every two months, as in Embodiments 117-126. One of the methods described above.

[0153] Embodiment 133: The unit dose is administered once every three months, as in Embodiments 117-126. One of the methods described above.

[0154] Embodiment 134: The unit dose is administered on days 1, 3, 5, 8, 15, and 22, and thereafter The method according to any one of embodiments 117 to 126, administered once a week.

[0155] Embodiment 135: The subject has one or more symptoms of cardiovascular disease or disorder. The method described in any of the application methods 117 to 134.

[0156] Embodiment 136: An embodiment in which one or more symptoms of the cardiovascular disease or disorder are improved. The method described in morphology 135.

[0157] In certain embodiments, the Disclosure provides an oligomeric compound, and the oligomeric compound The substance is used in the treatment or prevention of diseases or conditions associated with elevated Lp(a) levels in humans. ISIS681257 is for use in this treatment, and the treatment is (a) loading or induction phase and (b) Including administering one or more doses of the oligomer compound to humans during the maintenance phase. In terms of administration methods, a certain dose of the oligomer compound is administered once a week, once every two weeks, or monthly during the maintenance period. Once, once every two months, or once every three months, as long as it is necessary, effective and / or tolerable. It is administered to humans.

[0158] In some embodiments, the treatment involves administering 450 mg or less, or 400 mg or less, during the course of medication. Lower, 350mg or less, 300mg or less, 250mg or less, 200mg or less, 150mg or less Lower, 100mg or less, 75mg or less, 50mg or less, 40mg or less, 30mg or less, 25 Administering oligomeric compounds to humans in amounts of 15 mg or less, 20 mg or less, or 15 mg or less. Includes.

[0159] This disclosure includes administering ISIS681257 to patients who require it. The law is provided. In certain embodiments, patients who require it have an appointment level of (a) For example, individuals with elevated levels, such as ≥30 mg / dL, ≥35 mg / dL, ≥40 mg / dL, ≥5 0mg / dL, ≧60mg / dL, ≧70mg / dL, ≧80mg / dL, ≧90mg / dL, ≧100mg / dL, ≧110mg / dL, ≧120mg / dL, ≧130mg / dL, ≧140mg / dL, ≧150mg / dL, ≧160mg / dL, ≧170mg / dL, ≧175mg / dL, ≧180mg / dL, ≧190mg / dL, ≧200mg / A person has a dL apo(a) level. Lp(a) is also nanomoles / liter It can be expressed in units. For example, ≥75 nanomoles / liter (nmol / L) or ≥ In human subjects, 30 mg / dL was used for one or more symptoms of cardiovascular disease or disorder. There is a risk involved. [Brief explanation of the drawing]

[0160] [Figure 1A] Figures 1A–C show the predicted Lp(a) levels resulting from various once-weekly medication regimens. Doses of 20 mg (Figure 1A), 30 mg (Figure 1B), or 40 mg (Figure 1C) indicate a steady-state reduction of Lp(a) of ≥80%. [Figure 1B] Figures 1A–C show the predicted Lp(a) levels resulting from various once-weekly medication regimens. Doses of 20 mg (Figure 1A), 30 mg (Figure 1B), or 40 mg (Figure 1C) indicate a steady-state reduction of Lp(a) of ≥80%. [Figure 1C] Figures 1A–C show the predicted Lp(a) levels resulting from various once-weekly medication regimens. Doses of 20 mg (Figure 1A), 30 mg (Figure 1B), or 40 mg (Figure 1C) indicate a steady-state reduction of Lp(a) of ≥80%. [Figure 2A] Figures 2A and 2B show the predicted Lp(a) levels resulting from various monthly medication regimens. Doses of 60 mg (Figure 2A) and 80 mg (Figure 2B) of Lp(a) show approximately an 80% steady-state reduction in Lp(a). [Figure 2B] Figures 2A and 2B show the predicted Lp(a) levels resulting from various monthly medication regimens. Doses of 60 mg (Figure 2A) and 80 mg (Figure 2B) of Lp(a) show approximately an 80% steady-state reduction in Lp(a). [Figure 3] This shows the expected Lp(a) level as a result of a 2-month medication regimen (e.g., once every 2 months). An 80 mg dose every 2 months shows approximately an 80% steady-state reduction in Lp(a). [Figure 4] This shows the expected Lp(a) level as a result of a 3-month medication regimen. A dose of 80 mg every 3 months shows a steady-state reduction of 80% in Lp(a) and a maximum reduction of over 90% in Lp(a). [Figure 5A]Figures 5A–D show the predicted Lp(a) levels resulting from various monthly medication regimens. These figures model the effects on Lp(a) from monthly administration of ISIS681257 at doses of 20 mg (Figure 5A), 40 mg (Figure 5B), 60 mg (Figure 5C), and 80 mg (Figure 5D). The dark central line represents the predicted dose, and the upper and lower lines represent the 90% confidence interval. [Figure 5B] Figures 5A–D show the predicted Lp(a) levels resulting from various monthly medication regimens. These figures model the effects on Lp(a) from monthly administration of ISIS681257 at doses of 20 mg (Figure 5A), 40 mg (Figure 5B), 60 mg (Figure 5C), and 80 mg (Figure 5D). The dark central line represents the predicted dose, and the upper and lower lines represent the 90% confidence interval. [Figure 5C] Figures 5A–D show the predicted Lp(a) levels resulting from various monthly medication regimens. These figures model the effects on Lp(a) from monthly administration of ISIS681257 at doses of 20 mg (Figure 5A), 40 mg (Figure 5B), 60 mg (Figure 5C), and 80 mg (Figure 5D). The dark central line represents the predicted dose, and the upper and lower lines represent the 90% confidence interval. [Figure 5D] Figures 5A–D show the predicted Lp(a) levels resulting from various monthly medication regimens. These figures model the effects on Lp(a) from monthly administration of ISIS681257 at doses of 20 mg (Figure 5A), 40 mg (Figure 5B), 60 mg (Figure 5C), and 80 mg (Figure 5D). The dark central line represents the predicted dose, and the upper and lower lines represent the 90% confidence interval. [Figure 6A] Figures 6A–D show the predicted Lp(a) levels resulting from various once-weekly drug regimens. Figures 6A–D model the effect on Lp(a) from once-weekly administration of ISIS681257 at doses of 5 mg (Figure 6A), 10 mg (Figure 6B), 20 mg (Figure 6C), and 30 mg (Figure 6D). The dark line in the center represents the predicted dose, and the upper and lower lines represent the 90% confidence interval. [Figure 6B]Figures 6A - D show the predicted Lp(a) levels as a result of various once - weekly dosing regimens. Figures 6A - D show the modeling of the effect on Lp(a) by administering ISIS681257 once weekly at doses of 5 mg (Figure 6A), 10 mg (Figure 6B), 20 mg (Figure 6C), and 30 mg (Figure 6D). The thick central line represents the predicted amount, and the upper and lower lines represent the 90% confidence intervals. [Figure 6C] Figures 6A - D show the predicted Lp(a) levels as a result of various once - weekly dosing regimens. Figures 6A - D show the modeling of the effect on Lp(a) by administering ISIS681257 once weekly at doses of 5 mg (Figure 6A), 10 mg (Figure 6B), 20 mg (Figure 6C), and 30 mg (Figure 6D). The thick central line represents the predicted amount, and the upper and lower lines represent the 90% confidence intervals. [Figure 6D] Figures 6A - D show the predicted Lp(a) levels as a result of various once - weekly dosing regimens. Figures 6A - D show the modeling of the effect on Lp(a) by administering ISIS681257 once weekly at doses of 5 mg (Figure 6A), 10 mg (Figure 6B), 20 mg (Figure 6C), and 30 mg (Figure 6D). The thick central line represents the predicted amount, and the upper and lower lines represent the 90% confidence intervals.

Mode for Carrying Out the Invention

[0161] It should be understood that both the above general description and the following detailed description are merely exemplary and explanatory and do not limit the present disclosure. In this specification, the use of the singular form includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise stated. Further, the terms "including" and other forms such as "includes" and "included" are not limiting. Also, "element" or should be understood that both the above general description and the following detailed description are merely exemplary and explanatory and do not limit the present disclosure. In this specification, the use of the singular form includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise stated. Further, the terms "including" and other forms such as "includes" and "included" are not limiting. Also, "element" or should be understood that both the above general description and the following detailed description are merely exemplary and explanatory and do not limit the present disclosure. In this specification, the use of the singular form includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise stated. Further, the terms "including" and other forms such as "includes" and "included" are not limiting. Also, "element" or should be understood that both the above general description and the following detailed description are merely exemplary and explanatory and do not limit the present disclosure. In this specification, the use of the singular form includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise stated. Further, the terms "including" and other forms such as "includes" and "included" are not limiting. Also, "element" or should be understood that both the above general description and the following detailed description are merely exemplary and explanatory and do not limit the present disclosure. In this specification, the use of the singular form includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise stated. Further, the terms "including" and other forms such as "includes" and "included" are not limiting. Also, "element" or should be understood that both the above general description and the following detailed description are merely exemplary and explanatory and do not limit the present disclosure. In this specification, the use of the singular form includes the plural unless otherwise specified. As used herein, the use of "or" means "and / or" unless otherwise stated. Further, the terms "including" and other forms such as "includes" and "included" are not limiting. Also, "element" or Unless otherwise specified, terms such as "component" include both elements and components that contain one unit and elements and components that contain sub-units in excess of one.

[0162] The paragraph headings used in this specification are for organizational purposes only and are not intended to limit the subject matter described. Without limitation, all documents or portions of documents cited in this application, including patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference herein for all purposes.

[0163] A. Definitions Unless otherwise provided, the terms used herein with respect to analytical chemistry, organic synthetic chemistry, and medicinal pharmaceutical chemistry, as well as these procedures and techniques, are well known and commonly used in the art. Standard techniques can be used for chemical synthesis and chemical analysis. Such specific techniques and procedures are described, for example, in "Carbohydrate Modifications in Antisense Research" Edited by Sangvi and Cook, American Chemical Society, Washington D.C., 1994; "Remington’s Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., 21st edition, 2005; and "Antisense Drug Technology, Principles, Strategies, and Applications" Edited by Stanley T. Crooke, CRC Press, Boca Raton, Fla., 2001. st edition ​aton, Florida; and Sambrook et al., “Molecula r Cloning,A laboratory Manual,” 2 nd Edit ion,Cold Spring Harbor Laboratory Press, These can be found in 1989, and for all purposes, they are referred to herein by reference. All patents, applications, and published applications referenced throughout this disclosure are incorporated herein by reference. If permitted, all patents, applications, and published applications referenced throughout this disclosure are incorporated herein by reference. Furthermore, other publications and other data are incorporated herein by reference in their entirety.

[0164] Unless otherwise specified, the following terms have the following meanings:

[0165] As used herein, “drug administration period” means the period from when a human subject receives the first dose until the end of the course of treatment. This refers to the period until the subject receives their last dose. Patient medication continues from the initial medication period. And, one or more further treatment periods continue in which the same or different medication regimens are used. It is assumed that the medication may be continued after the end of the treatment period. For example, in human subjects, the first During the treatment period, patients can receive six doses, with the first and last doses administered four weeks apart. They are separated. Subsequently, the human subjects then started two drug administration periods, and the human subjects were Receive the medication at regular intervals (for example, 1 unit per week, 1 unit per month) (Or 1 unit per 3 months).

[0166] As used herein, the term “unit dose” means the amount administered to a human at a particular point in time. A specific amount of the oligomer compound (for example, an oligomer compound administered to a human by a single subcutaneous injection) This refers to a specific quantity of a substance. Each unit dose is as described herein for repeated dosing regimens. It forms part of something.

[0167] As used herein, the term “unit dosage form” refers to each unit dose prepared for administration. It refers to a rational form.

[0168] As used herein, the term “sterile solution” means a liquid suitable for administration to human subjects. This means that, in certain embodiments, the sterile solution contains substantially no viable microorganisms or bacteria. Includes liquids not included in the above. In certain embodiments, the sterile solution is USP-grade water or US Contains grade P physiological saline.

[0169] As used herein, "nucleoside" means a compound comprising a nucleic acid base portion and a sugar portion. It means a compound. It is not limited to nucleosides, but naturally occurring nucleosides This includes nucleosides (found in DNA and RNA) and modified nucleosides. The phosphate group can be bonded to the phosphate group.

[0170] As used herein, "chemical modification" means a modification compared to a naturally occurring equivalent. This refers to chemical differences in compounds. Chemical modifications of oligonucleotides include nucleos This includes modifications (including modifications to the sugar portion and modifications to nucleic acid bases) and modifications to internucleoside bonds. Regarding oligonucleotides, differences in nucleic acid base sequences alone are not considered chemical modifications.

[0171] As used herein, "furanosyl" means a compound with four carbon atoms and one oxygen atom. This refers to a structure containing a five-membered ring.

[0172] As used herein, “naturally occurring sugar moiety” refers to a naturally occurring sugar moiety found in RNA. means a ribofuranosyl or a naturally-occurring deoxyribofuranosyl similar to DNA is carried out.

[0173] As used herein, "sugar moiety" means a naturally-occurring sugar moiety or a modified sugar moiety of a nucleoside or a sugar substitute.

[0174] As used herein, "modified sugar moiety (modified sugar moiety)" means a substituted sugar moiety or a sugar substitute.

[0175] As used herein, "substituted sugar moiety (substituted sugar moiety)" means a furanosyl that is not a naturally-occurring sugar moiety. Substituted sugar moieties include, but are not limited to, furanosyls containing substituents at the 2' position, 3' position, 5' position and / or 4' position. Certain substituted sugar moieties are bicyclic sugar moieties. position, 3' position, 5' position and / or 4' position. Specific substituted sugar moieties are bicyclic sugar moieties. position, 3' position, 5' position and / or 4' position. Specific substituted sugar moieties are bicyclic sugar moieties.

[0176] As used herein, "2'-substituted sugar moiety" means a furanosyl containing a substituent other than H or OH at the 2' position. Unless otherwise specified, a 2'-substituted sugar moiety is not a bicyclic sugar moiety (i.e., the 2'-substituent of the 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring). position, 3' position, 5' position and / or 4' position. Specific substituted sugar moieties are bicyclic sugar moieties. position, 3' position, 5' position and / or 4' position. Specific substituted sugar moieties are bicyclic sugar moieties. position, 3' position, 5' position and / or 4' position. Specific substituted sugar moieties are bicyclic sugar moieties.

[0177] As used herein, "MOE" means -OCH2CH2OCH3.

[0178] As used herein, "nucleic acid" refers to a molecule composed of nucleotide monomers. Nucleic acids include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid (ssDNA ), double-stranded nucleic acid (dsDNA), small interfering ribonucleic acid (siRNA) and microRNA A (miRNA). Nucleic acids can also contain any combination of these elements in a single molecule It may include [something].

[0179] As used herein, "nucleotide" means a nucleo containing a phosphate group. It means side. When used herein, "bound nucleoside" means phosphate bonded They may or may not be joined by the union, and therefore, "joined nuclei This includes, but is not limited to, "reotide." When used herein, "combined nutide" A "creoside" is a nucleoside linked in a continuous sequence (i.e., linked (There are no additional nucleosides between the nucleosides.)

[0180] As used herein, "nucleic acid base" means an oligonucleotide that binds to a sugar portion. A group of atoms that can form nucleosides that can be incorporated into a do, and another oligonucleotide This refers to a group of atoms capable of binding to the complementary native nucleic acid bases of a nucleic acid. The base may be naturally occurring or modified. When referring to a "nucleic acid base sequence," it means a sequence of nucleic acid bases that is linked together, regardless of any sugars, bonds, or modifications of nucleic acid bases. This refers to the sequence of consecutive nucleic acid bases.

[0181] As used herein, "unmodified nucleic acid bases" or "naturally occurring nucleic acid bases" The term refers to the heterocyclic nucleic acid bases of naturally occurring RNA or DNA, i.e., purine bases. adenine (A) and guanine (G), and the pyrimidine bases thymine (T) and cytosine (C) This means (containing 5-methyl C) and uracil (U).

[0182] As used herein, "modified nucleic acid base" means a modified nucleic acid base that does not occur naturally. It means the nucleic acid base.

[0183] As used herein, “modified nucleoside” refers to naturally occurring RNA or D12. This refers to nucleosides that contain at least one chemical modification compared to NA nucleosides. Modified nucleosides contain a modified sugar moiety and / or a modified nucleic acid base.

[0184] As used herein, "2'-substituted nucleoside" means a nucleoside with H or OH at the 2' position. This refers to nucleosides containing substituents other than those specified. Unless otherwise specified, 2'-substituted nucleosides. Sid is not a bicyclic nucleoside.

[0185] As used herein, “deoxynucleoside” means a naturally occurring deoxyri Nucleosides containing a 2'-H furanosyl sugar moiety, found in bonucleosides (DNA) This means that, in a particular embodiment, the 2'-deoxynucleoside modifies the nucleic acid base. It may contain, or may contain, RNA nucleic acid bases (e.g., uracil).

[0186] As used herein, “oligonucleotide” means a group of linked nucleos This refers to compounds containing a side. In certain embodiments, the oligonucleotide is one or more The above unmodified ribonucleoside (RNA) and / or unmodified deoxyribonucleoside (DNA) and / or one or more modified nucleosides.

[0187] As used herein, the term "oligonucleoside" refers to a group of nucleosides that do not have internucleoside bonds. This also means oligonucleotides that do not contain phosphorus atoms. When used herein, Oligonucleotides contain oligonucleosides.

[0188] As used herein, “modified oligonucleotide” means at least one modification Oligonucleotides containing a nucleoside and / or at least one modified internucleoside bond It means Ochido.

[0189] As used herein, “bond” or “bonding group” means two or more other atomic groups. It refers to the group of atoms that are bonded together.

[0190] As used herein, “nucleoside bond” means an oligonucleotide bond. This refers to a covalent bond between adjacent nucleosides.

[0191] As used herein, “naturally occurring nucleoside bond” means 3'-5' nucleotide bond. This refers to a sulfodiester bond.

[0192] When used herein, the term "modified nucleoside bond" refers to a modified nucleoside bond. "Nucleoside bond" refers to any nucleoside bond other than naturally occurring nucleoside bonds. ru.

[0193] As used herein, “terminal nucleoside bond” means an oligonucleotide bond This refers to the bond between the last two nucleosides in that domain.

[0194] As used herein, "phosphorus bond group" means a bond group that contains a phosphorus atom. The phosphorus-bonding group includes, but is not limited to, groups having the following formula: [ka] During the ceremony: R a and R d These are, independently, O, S, CH2, NH, or NJ1 (where J1 is (It is a C1-C6 alkyl group or a substituted C1-C6 alkyl group.) R b is either O or S, R c These are OH, SH, C1-C6 alkyl, substituted C1-C6 alkyl, and C1-C6 alcohol. It is xy, substituted C1-C6 alkoxy, amino, or substituted amino. J1 is R b It is either O or S.

[0195] The phosphorus-binding group is not limited to phosphodiesters, phosphorothioates, Phosphorodithioate, phosphonate, phosphoramidate, phosphorothioamidate, Thionoalkylphosphonates, phosphotriesters, thionoalkylphosphotriesters And boranophosphate is included.

[0196] As used herein, “internucleoside phosphate bond” means two nucleosides This refers to a phosphorus-binding group that directly bonds to a phosphorus molecule.

[0197] As used herein, “non-nucleoside interphosphorus bond” means two nucleosides This refers to a phosphorus-bonding group that is not directly bonded to a nucleosyl group. In certain embodiments, a non-nucleosyl group is used. The interphosphorus bond group attaches a nucleoside to a group other than a nucleoside. In certain embodiments In this case, the non-nucleoside phosphate bond group connects two groups that are neither nucleosides. do.

[0198] As used herein, "neutral bond group" means an uncharged bond group. The binding group is not limited to phosphotriesters, methylphosphonates, and MM. I(-CH2-N(CH3)-O-), amide-3(-CH2-C(=O)-N(H)- ), amide-4(-CH2-N(H)-C(=O)-), formacetal(-O-CH It contains 2-O- and thioform acetal (-S-CH2-O-). Further neutralization The compounding groups include siloxanes (dialkylsiloxanes), carboxylic acid esters, and carboxamides. , including nonionic bonds containing sulfides, sulfonic acid esters and amides (for example) , Carbohydrate Modifications in Antisense Research;YS Sanghvi and PDCook Eds.A CS Symposium Series 580;Chapters 3 and 4 (See pp. 40-65). Further neutral bonding groups include a mixed composition of N, O, S, and CH2. It contains nonionic bonds, including partial ones.

[0199] As used herein, “internucleoside neutral bond” means two nucleosides This refers to a neutral bond group that directly binds to the bond.

[0200] As used herein, "oligomer compound" means a compound containing two or more substructures. This refers to the molecular structure. In certain embodiments, the oligomer compound is an oligonucleotide. It contains. In certain embodiments, the oligomer compound contains one or more conjugate groups and / or terminal groups. In certain embodiments, the oligomeric compound is oligonucleotide It consists of rheotides. The oligomeric compounds also contain naturally occurring nucleic acids. Specific embodiments In this context, the oligomer compound comprises a main chain of one or more bonded monomer subunits. Each of the bonded monomer subunits is directly or indirectly connected to the heterocyclic base moiety. They are tactically bonded. In certain embodiments, the oligomeric compound is also a heterocyclic base. It may contain monomer subunits that are not bonded to a portion, thereby providing a debase site. In certain embodiments, monomer subunits, sugar moieties or sugar substitutes and heterocycles. The bond linking the base portion of the formula can be modified independently. In certain embodiments, the bond - The sugar unit may or may not contain a heterocyclic base, and may also contain monomers of peptide nucleic acids, etc. It can be replaced with an imitation.

[0201] As used herein, “terminal group” means the 3' end of an oligonucleotide or This refers to one or more atoms bonded to either or both of the 5' ends. (Specific implementation) In its form, the terminal group is a conjugate group. In a particular embodiment, the terminal group is , containing one or more terminal nucleoside groups.

[0202] As used herein, "conjugate" or "conjugate group" means This refers to atoms or groups of atoms bonded to ligonucleotides or oligomeric compounds. In this context, a conjugate group may define one or more properties of the compound to which it is bonded, but is not limited to those properties. Pharmacodynamics, pharmacokinetics, binding, absorption, cell distribution, cell uptake, charge and / or clearance Changes characteristics such as S.

[0203] When used herein, "conjugate phosphate" in relation to the conjugate group A "car" or "linker" is defined as a group of any atom or group of atoms and (1) oligonucleotides (2) Covalently bond the rheotide to another part of the conjugate group This refers to a part of a conjugate group that is covalently bonded to two or more parts.

[0204] In this specification, the conjugate group is an original group such as an antisense oligonucleotide. It is shown as a group that provides a bond for forming a covalent bond to a gomer compound. In the application form, the binding site of the oligomer compound is the 3' terminal nucleocytosis of the oligomer compound. It is the 3'-oxygen atom of the 3'-hydroxyl group. In certain embodiments, oligomer - The bonding site of the compound is the 5'-hydroxyl group of the 5'-terminal nucleoside of the oligomer compound. It is the 5'-oxygen atom. In certain embodiments, it forms a bond to the oligomer compound. The bond for which this is performed is a severable bond. In such a particular embodiment, such a severable bond A severable joint constitutes all or part of the severable portion.

[0205] In certain embodiments, the conjugate group is a cleavable portion (e.g., a cleavable conjugate group). (Nucleosides that can be combined or cleaved) and carbohydrate clusters such as GalNAc clusters The star portion is included. The carbohydrate cluster portion is the target portion and optionally the conjugate portion. Includes gate linker. In certain embodiments, the carbohydrate cluster portion is a linker. It is determined by the number and properties of the do. For example, in certain embodiments, the carbohydrate class The tar portion contains three GalNAc groups and is denoted as "GalNAc3". Hydrated cluster portion (having specific tethers, branching groups and conjugate linker groups) The term is used herein and is denoted by a Roman numeral followed by a subscript "a". "GalNac3-1 a " is three GalNac groups and a specifically identified tether - Refers to a specific carbohydrate cluster portion of a conjugate group having branched and binding groups. Such carbohydrate cluster fragments have cleavable bonds or cleavable nucleos. It is bonded to the oligomer compound via cleavable parts such as dols.

[0206] As used herein, “cleavable portion” means a portion that can be divided under physiological conditions. This refers to possible bonds or groups. In certain embodiments, the cleavable portion extends to the inside of the cell. Alternatively, it is cleaved within intracellular compartments such as lysosomes. In certain embodiments, cleavage is possible. The portion is broken down by endogenous enzymes such as nucleases. In certain embodiments, The cleavable portion includes an atomic group having one, two, three, four, or more cleavable bonds. .

[0207] As used herein, “cleavable bond” means any chemical bond that is capable of being cleaved. This means that, in certain embodiments, the cleavable bond is an amide, polyamide, or ester. ethers, esters of one or both phosphodiesters, phosphate esters, carba Selected from mates, disulfides, or peptides.

[0208] As used herein, "carbohydrate cluster" means a scaffold group or bond. This refers to a compound having one or more carbohydrate residues bonded to a compounding group. (For example, carbohydrates) For an example of a conjugate cluster, see Maier et al., “Synthe sis of Antisense Oligonucleotides Conjug ated to a Multivalent Carbohydrate Cluster er for Cellular Targeting,” Bioconjugate Chemistry, 2003, (14):18-29 (refer to the entire text for this specification) (Used in reference to the book) or Rensen et al., “Design and Synth hesis of Novel N-Acetylgalactosamine-Ter Minated Glycolipids for Targeting of Lip oproteins to the Hepatic Asiaglycoprotei n Receptor,” J.Med.Chem.2004,(47):5798-5 (See 808).

[0209] As used herein, "single-stranded" means that it does not hybridize with its complement, and This refers to oligomeric compounds that lack sufficient self-complementarity to form stable self-double chains. .

[0210] As used herein, “double-stranded” means a pair of oligonucleotides that have hybridized with each other. This refers to a single self-complementary oligomer compound that forms a mer compound or hairpin structure. In certain embodiments, the double-chain oligomer compound is a combination of the first and second oligomer compounds. Includes objects.

[0211] As used herein, “antisense compound” includes oligonucleotides. This refers to a compound consisting of a compound or oligonucleotide, at least a portion of which is a target It is complementary to nucleic acids and can hybridize to their target nucleic acids, and as a result, At least one antisense activity is generated.

[0212] As used herein, “antisense activity” refers to the label of an antisense compound. Any detectable and / or measurable mutation attributable to hybridization to nucleic acids This means transformation. In certain embodiments, antisense activity is applied to the target nucleic acid transcript (e.g., This includes regulating the amount or activity of (mRNA). In certain embodiments, antisense activity This includes the regulation of pre-mRNA splicing.

[0213] As used herein, “RNase H-based antisense compound” means A At least a portion of the antisense activity of an antisense compound is related to the antisense compound Hybridization to target nucleic acids, followed by RNase H-mediated cleavage of target nucleic acids. This refers to antisense compounds caused by disconnection.

[0214] As used herein, “detecting” or “measuring” means detecting or This means that a test or assay for measurement will be performed. Such detection and / Alternatively, the measurement may result in a value of zero. Therefore, the test for detection or measurement is Even if the result is no activity (zero activity), the activity can still be detected or measured. Steps for this purpose are being taken.

[0215] As used herein, “detectable and / or measurable activity” means not zero. This does not mean statistically significant activity.

[0216] As used herein, "essentially invariant" means that changes in a particular parameter do not particularly affect the overall behavior of the parameter. This means that, compared to another parameter with a larger change, it is little to no change. Tastes good. In certain embodiments, if the change in a certain parameter is less than 5%, The parameters are essentially immutable. In a particular embodiment, the change of a certain parameter If the change is less than 2 times, and the change in another parameter is at least 10 times, The parameters are essentially immutable. For example, in a particular embodiment, antisense Activity is a change in the amount of target nucleic acid. In such a particular embodiment, non-target nucleic acid The quantity remains essentially unchanged if its change is much smaller than the change in the target nucleic acid, The change does not need to be zero.

[0217] As used herein, “expression” means the process by which a gene ultimately produces a protein. It means process. Expression involves transcription and post-transcriptional modification (e.g., splicing, polyadenix). This includes, but is not limited to, phasing (adding 5'-caps) and translation.

[0218] As used herein, “target nucleic acid” means an antisense compound that hybridizes This refers to nucleic acid molecules intended to produce the desired antisense activity. Nucleon oligonucleotides undergo hybridization with their target nucleic acids under physiological conditions. It possesses sufficient complementarity to enable the process.

[0219] As used herein, "nucleic acid base complementarity" or "complementarity" refers to the relationship between nucleic acid bases. In this case, it refers to a nucleic acid base that can base-pair with another nucleic acid base. For example, DNA In RNA, adenine (A) is complementary to thymine (T). For example, in RNA, Adenine (A) is complementary to uracil (U). In certain embodiments, complementary Nucleic acid bases are antisense compounds that can base-pair with the nucleic acid bases of their target nucleic acid. It refers to the nucleic acid bases of an object. For example, the nucleic acid bases at a specific position in an antisense compound are If a target nucleic acid can form a hydrogen bond with a nucleic acid base at a specific position, then that oligonucleotide and The positions of hydrogen bonds with the target nucleic acid are considered complementary in the nucleic acid base pair. Nucleic acid bases containing specific modifications can maintain their ability to pair with the opposing nucleic acid base. Therefore, it can still possess nucleic acid base complementarity.

[0220] As used herein, "non-complementary" with respect to nucleic acid bases means that they do not form hydrogen bonds with each other. It refers to pairs of nucleic acid bases that do not form a complete pair.

[0221] When used herein, oligomeric compounds (e.g., bonded nucleosides, o The term "complementary" with respect to ligonucleotides or nucleic acids means that such oligomeric compounds or That region hybridizes with another oligomer compound or that region through nucleic acid base complementation. This means the ability to perform complementary oligomeric compounds, which exhibit nucleic acid base complementarity at each nucleoside. It is not necessary to have it. Rather, some mismatches are acceptable. In certain embodiments Therefore, complementary oligomeric compounds or regions have complementary nucleic acid bases for 70% of their components. (70% complementary). In certain embodiments, the complementary oligomeric compound or region is 8 They are 0% complementary. In certain embodiments, the complementary oligomeric compound or region is They are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are , 95% complementary. In certain embodiments, complementary oligomeric compounds or regions They are 100% complementary.

[0222] As used herein, “mismatch” refers to a mismatch between the first oligomer compound and the second oligomer compound. When the oligomer compounds are aligned, the nucleic acid bases of the first oligomer compound are aligned with the second oligomer. - This means that the compound cannot pair with the nucleic acid base at the corresponding position. (First and second originals) One or both of the gomer compounds may be oligonucleotides.

[0223] As used herein, "hybridization" means complementary oligomerization. This refers to the pairing of compounds (e.g., an antisense compound and its target nucleic acid). It is not limited to a specific mechanism. While not definitively established, the most common mechanisms of pairing include the Watson-Crick type and the Hoog A hydrogen bond between complementary nucleic acid bases, which may be a Steen-type or inverse Hougsteen-type hydrogen bond. Hydrogen bonding is involved.

[0224] As used herein, "specifically hybridizes" means that the oligomeric compound For one nucleic acid site, hybridization with a greater affinity than hybridization with another nucleic acid site occurs. It means the ability to bred.

[0225] When used herein, the term "completely complementary" refers to oligonucleotides or portions thereof. "Equivalent" means that each nucleic acid base of the oligonucleotide or its portion is complementary to a nucleic acid or This means that it can pair with the nucleic acid bases in that continuous portion. Therefore, it is perfectly complementary. The region contains nucleic acid bases that do not mismatch or hybridize in any of the strands. do not have.

[0226] As used herein, "complementary percentage" refers to the nucleic acid bases of an oligomeric compound. This refers to the percentage of nucleic acid bases that are complementary to the isolength portion of the target nucleic acid. -Scent is an oligomeric compound nucleic acid base complementary to the nucleic acid base at the corresponding position of the target nucleic acid. The number is calculated by dividing it by the total length of the oligomeric compound.

[0227] As used herein, “identity percentage” means the total number of nucleic acid bases of the first nucleic acid. The nucleic acid bases at the corresponding positions of the second nucleic acid obtained by dividing by are the same (regardless of chemical modification) It refers to the number of nucleic acid bases in a given first nucleic acid.

[0228] As used herein, “modification” means reducing the amount of a molecule, function, or activity before modification. This refers to a change in the quantity or quality of the molecule, function, or activity compared to its quality. Regulation involves either an increase (stimulation or induction) or decrease (inhibition or reduction) in gene expression. This includes any of the following changes. As a further example, the regulation of expression involves the pre-mRNA process. This may include changes in the selection of the splice site, which may result in a quantity compared to the amount without adjustment. A change occurs in the absolute or relative quantity of a particular splice variant.

[0229] As used herein, “chemical motif” means oligonucleotide or its domain. This refers to the pattern of chemical modification in a region. The motif is a specific nucleotide of an oligonucleotide. It can be defined by modifications at the creoside and / or specific binding groups.

[0230] As used herein, “nucleoside motif” means oligonucleotide or This refers to the pattern of nucleoside modification in that region. The combination may be modified or unmodified. Unless otherwise specified, this specification The motifs that only describe nucleosides are intended to be nucleoside motifs. Therefore, in such cases, the combination is not limited.

[0231] As used herein, “sugar motif” means oligonucleotide or its region. This refers to the pattern of sugar modification in [the substance].

[0232] As used herein, “binding motif” means oligonucleotide or its domain. This refers to the pattern of binding modification in the region. The nucleoside of such oligonucleotides is They may be modified or not. Unless otherwise specified, the combinations used herein are The motifs that describe this are intended to be combined motifs. Therefore, this In such cases, the nucleoside is not limited.

[0233] As used herein, “nucleic acid base modification motif” means an oligonucleotide along with This refers to the pattern of modification of nucleic acid bases. Unless otherwise specified, nucleic acid base modification motif The function of "fu" is independent of the nucleic acid base sequence.

[0234] As used herein, “sequence motif” means an oligonucleotide or a portion thereof. This refers to the pattern of nucleic acid bases arranged along a given time. Unless otherwise specified, the sequence motif F is independent of chemical modification, and therefore any combination of chemical modifications, including no chemical modification. It may have.

[0235] When used herein, the “type of modification” or “nucleoside” The term "type" here refers to the chemical modification of nucleosides, including modified nucleosides and unmodified nucleosides. Contains osides. Therefore, unless otherwise specified, "nucleos having the first type of modification" "Sid" can be an unmodified nucleoside.

[0236] As used herein, “different modifications” means chemical modifications or chemical arrangements that are different from each other. This signifies substitution and includes the absence of modification. Therefore, for example, MOE nucleosides and unmodified D NA nucleosides are a "different modification" even if the DNA nucleoside is unmodified. Similarly, DNA and RNA, even if they are both naturally occurring unmodified nucleosides, These are "different modifications." Nucleosides that are the same except for containing different nucleic acid bases are different This is not a modification. For example, 2'-OMe modified sugars and nucleotides containing unmodified adenine nucleic acid bases Rheosides and nucleosides containing 2'-OMe modified sugars and unmodified thymine nucleic acid bases are different. It is not a modifier.

[0237] As used herein, “the same kind of modification” means modifications that are identical to one another. This includes the absence of ornamentation. Therefore, for example, two unmodified DNA nucleosides are DNA nucleos Even if the leoside is unmodified, it has "the same type of modification." Nucleosides containing this can contain different nucleic acid bases.

[0238] As used herein, “separate regions” means any adjacent region with chemical modification or The chemical modification motif makes it possible to distinguish its separate regions from one another, at least This refers to the oligonucleotide portion that contains one difference.

[0239] As used herein, “pharmaceutically acceptable carrier or diluent” means a carrier or diluent for animals. This refers to any substance suitable for administration. In certain embodiments, it refers to any substance that is pharmaceutically permitted. The carrier or diluent is sterile physiological saline. In certain embodiments, Sterile physiological saline is a physiological saline of pharmaceutical grade.

[0240] As used herein, the term “metabolic disorder” primarily refers to metabolic disorders (the breakdown of food). A disease characterized by dysregulation of a series of complex chemical reactions involved in energy generation. It means a disease or illness.

[0241] As used herein, the term “cardiovascular disorder” primarily refers to the function of the heart or blood vessels. It refers to a disease or condition characterized by insufficiency.

[0242] As used herein, “prodrug” means a substance that, when administered to a subject, is metabolized. The inactive form of a compound that forms an active compound or a more active compound (e.g., a drug). It refers to a state or a form with low activity.

[0243] As used herein, unless otherwise specified or modified, “double-stranded” The term refers to two distinct oligomeric compounds that hybridize with each other. The double-chain compounds maintain hybridization under physiologically equivalent conditions. Assuming sufficient complementarity, one end or both ends of one or both chains One or more nucleosides or non-hybridizing nucleosides (overhangs) It may have and / or one or more non-hybridizing internal nucleosides (mismatches). ) may have.

[0244] As used herein, “5' target site” refers to the 5' most prominent part of a particular antisense compound. This refers to the nucleotide of the target nucleic acid that is complementary to the nucleotide on the side.

[0245] When used in this specification, "approximately" means within ±10% of the value. For example, "Mar If it says "cars can increase by approximately 50%", it means that the marker is 45% to 55%. It means that it can increase.

[0246] As used herein, “administered simultaneously” means both of the two agents in the patient. This refers to the co-administration of two drugs in any manner in which their pharmacological effects manifest simultaneously. The preparation requires that the preparation be administered as a single pharmaceutical composition, in the same dosage form, or via the same route of administration. No. The effects of both drugs do not need to manifest simultaneously. The effects overlap over a period of time. They only need to be duplicated; they don't need to have the same time span.

[0247] As used herein, “administer” or “dosage” means to provide a drug to an individual. This means administering, including but not limited to administration by a medical professional and self-administration. The administration of drugs to individuals may be continuous, long-term, short-term, or intermittent. Administration is non It may be administered orally or by means other than parenteral administration.

[0248] As used herein, “agent” means an agent that, when administered to an animal, provides a therapeutic benefit. This refers to an active substance that can do this. "First agent" means the therapeutic compound of the present invention. For example, the first agent is an antisense oligonucleotide that targets apo(a). It is possible. The "second agent" refers to the second therapeutic compound of the present invention (for example, targeting apo(a) A second antisense oligonucleotide and / or a non-apo(a) therapeutic compound It means.

[0249] When used herein, “improvement,” “to improve,” or “to make an improvement” means This refers to the reduction of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of the indicator shall be determined by subjective or objective measures known to those skilled in the art. It is possible.

[0250] As used herein, “apo(a)” means any nucleic acid that codes for apo(a). Or it means a protein sequence. For example, in a particular embodiment, apo(a) is , the DNA sequence encoding apo(a), and the R transcribed from the DNA encoding apo(a) NA sequences (including genomic DNA containing introns and exons), encoding apo(a) It contains an mRNA sequence or a peptide sequence that codes for apo(a).

[0251] As used herein, “apo(a) nucleic acid” means any nucleic acid that encodes apo(a). It means nucleic acid. For example, in a particular embodiment, apo(a) nucleic acid is apo(a) The DNA sequence that codes, the RNA sequence transcribed from the DNA that codes for apo(a) (in This includes genomic DNA (including trons and exons) and mRNA encoding apo(a). It contains an array.

[0252] As used herein, "apo(a)mRNA" refers to a protein called apo(a)mRNA. This refers to mRNA that performs the process.

[0253] As used herein, “apo(a) protein” means the protein encoding apo(a). This refers to any protein sequence.

[0254] As used herein, “apo(a)-specific inhibitor” means apo(a) nucleic acid and / or This refers to any agent that can specifically inhibit the expression of the apo(a) protein. Apo(a)-specific inhibitors include apo(a) nucleic acids and / or apo(a) proteins. Nucleic acids (including antisense compounds), peptides, antibodies, and small molecules that can inhibit expression. This includes molecules and other agents. In certain embodiments, the apo(a)-specific inhibitor is apo (a) By specifically regulating nucleic acid expression and / or apo(a) protein expression This can affect other components of the lipid transport system, including downstream components. Similarly, certain practical applications In terms of application, apo(a)-specific inhibitors affect other molecular processes in animals. It is possible to obtain it.

[0255] As used herein, "atherosclerosis" refers to a condition affecting the aorta and medium arteries. This refers to hardening of the arteries and is characterized by the presence of fat deposits. Fat deposits are also called "atheromas." These are called "plaques" and are mainly composed of cholesterol, other fats, calcium, and scar tissue. This can damage the arterial intima.

[0256] As used herein, “coronary heart disease (CHD)” refers to a condition in which blood and oxygen cannot be supplied to the heart. This means that the small blood vessels supplying blood become narrowed, which is a consequence of atherosclerosis. There are many such cases.

[0257] As used herein, “diabetes mellitus” or “diabetes” means “diabetes mellitus” with insufficient insulin. Metabolic disorders and abnormally high blood sugar (hyperglycemia) resulting from decreased levels or insulin sensitivity. This is a characteristic syndrome. A characteristic symptom is excessive urine production due to high blood glucose levels. Polyuria, increased thirst and fluid intake to compensate for increased urination (hyperthymus), optics of the eye The symptoms include blurred vision due to hyperglycemia, unexplained weight loss, and lethargy.

[0258] When used herein, the term "diabetic dyslipidemia" or "type 2 diabetes with dyslipidemia" is used. "Urinary disease" refers to type 2 diabetes, decreased HDL-C, elevated triglycerides (TG), and small, high blood pressure. This refers to a pathological condition characterized by an increase in the density of LDL particles.

[0259] As used herein, “diluent” means a substance that is pharmacologically necessary but has no pharmacological activity. Or, it means a component in the desired composition. For example, the diluent in the injectable composition is a liquid, for example. It could be physiological saline solution.

[0260] As used herein, “dyslipidemia” refers to an excess of lipids and / or lipoproteins. This refers to metabolic disorders of lipids and / or lipoproteins, including overproduction or deficiency. The disease involves lipids such as chylomicrons, cholesterol, and triglycerides, as well as low-density lipids. An increase in lipoproteins such as LDL cholesterol may appear as a symptom. ru.

[0261] As used herein, “dosage” means a single dose or a dose delivered within a specified period. This refers to the specified amount of the drug to be administered. In certain embodiments, a certain dose may be once, twice, or It can be administered in boluses, tablets, or injections. For example, subcutaneous administration is preferred. In a particular embodiment, the desired dose is a volume that cannot be easily addressed by a single injection. This requires two or more injections, and therefore the desired dose can be achieved using two or more injections. In certain embodiments, the drug is administered by long-term infusion or continuous infusion. The dosage can be expressed as the amount of medication per hour, day, week, or month. It can also be expressed in mg / kg or g / kg.

[0262] As used herein, “effective amount” or “therapeutically effective amount” means the active agent This refers to a sufficient amount of the active drug to produce the desired physiological outcome in the individual requiring it. The effective amount depends on the health and physical condition of the individual being treated, the taxonomic group of the individual being treated, and the group. Depending on the formulation of the product, the assessment of the individual's medical condition, and other relevant factors, it varies among individuals. obtain.

[0263] As used herein, “fully complementary” or “100% complementary” means the first Each nucleic acid base in the nucleic acid base sequence of the nucleic acid is complementary to the nucleic acid in the second nucleic acid base sequence of the second nucleic acid. This means having a base. In certain embodiments, the first nucleic acid is an antisense compound. It is a substance, and the second nucleic acid is the target nucleic acid.

[0264] As used herein, "glucose" is used as an energy source and an inflammatory intermediate. It is a monosaccharide used by cells. "Plasma glucose" is the glucose present in plasma. It refers to S.

[0265] As used herein, “high-density lipoprotein-C” or “HDL-C” means This refers to cholesterol associated with high-density lipoprotein particles in serum (or plasma). The concentration of HDL-C is typically quantified in mg / dL or nmol / L units. "Clean HDL-C" and "Plasma HDL-C" refer to HDL-C in serum and plasma, respectively. It means.

[0266] As used herein, "HMG-CoA reductase inhibitor" refers to the enzyme HMG Agents that act by inhibiting G-CoA reductase, such as atorvastatin and rosuvastatin. This refers to drugs such as fluvastatin, lovastatin, pravastatin, and simvastatin. .

[0267] When used herein, it relates to the detection and treatment evaluation of high cholesterol in adults. Guidelines from the National Cholesterol Education Program (NCEP) Expert Panel Report (A According to rch.Int.Med.(1988)148,36-39, "High Chores "Terollemia" refers to cholesterol, specifically circulating (plasma) cholesterol, or LDL. - This refers to a condition characterized by elevated cholesterol and VLDL-cholesterol levels.

[0268] As used herein, "hyperlipidemia" or "lipidemia" refers to serum lipids or This condition is characterized by elevated circulating (plasma) lipids. This condition shows abnormally high concentrations of fat. The lipid fraction in circulating blood consists of cholesterol, low-density lipoprotein, and very low-density lipoprotein. These are protein, chylomicrons, and triglycerides. The Fredrickson classification of hyperlipidemia is TG and cholesterol-rich lipoproteins measured by electrophoresis or ultracentrifugation It is based on the pattern of cosmic particles and is the main cause of hyperlipidemia such as hypertriglyceridemia. It is commonly used as a marking (Fredrickson and Lee, Circulation,1965,31:321-327;Fredrickson et al., New Eng J Med, 1967, 276(1):34-42).

[0269] As used herein, “hypertriglyceridemia” means a high level of triglycerides. It refers to a pathological condition characterized by an increase in [amount]. Its etiology includes temporary factors (i.e., genetic causes) and and secondary factors (diabetes, metabolic syndrome / insulin resistance, obesity, lack of exercise) (Other contributing factors such as smoking, excessive alcohol and a diet very high in carbohydrates) or most Many, but this includes combinations of both (Yuan et al. CMAJ, 2007, 1 76:1113-1120).

[0270] When used herein, "identifying animals with metabolic or cardiovascular diseases" "Choosing" or "choosing" refers to metabolic diseases, cardiovascular diseases, or metabolic syndrome. Those prone to developing a disease, or those with metabolic disorders, cardiovascular diseases, or metabolic syndrome. Identifying or selecting individuals diagnosed with a syndrome, or metabolic diseases, heart Any symptoms of visceral vascular disease or metabolic syndrome, but not limited to these. Hypercholesterolemia, hyperglycemia, hyperlipidemia, hypertriglyceridemia, hypertension, insulin Increased insulin resistance, decreased insulin sensitivity, and / or exceeding normal body weight and / or normal values. Identify or select individuals who have symptoms including excessive body fat or any combination thereof. This means selecting. Such a specification is not limiting, but serum or circulating ( Measurement of plasma cholesterol, measurement of serum or circulating plasma blood glucose, measurement of serum or circulating blood Standard clinical measurements such as plasma triglyceride measurement, blood pressure measurement, body fat mass measurement, and weight measurement. This can be achieved by any method, including bed examination or clinical evaluation.

[0271] As used herein, “improvement of cardiovascular outcomes” means the reduction of adverse cardiovascular events. Or it means a reduction in the risk of such events. Examples of adverse cardiovascular events are not limited to... However, possible complications include death, reinfarction, stroke, cardiac shock, pulmonary edema, cardiac arrest, and atrial arrhythmia. It can be done.

[0272] As used herein, “increase in HDL” or “uplift in HDL” means any Compared to HDL levels in animals that were not administered any compound, at least one of the present inventions This refers to an increase in HDL levels in animals after administration of one compound.

[0273] As used herein, “individual” or “subject” means selected for treatment or therapy. It means the person who is selected.

[0274] When used herein, “the individual in need” means selected for treatment or therapy. This refers to a person or non-human animal that requires such treatment or care.

[0275] When used herein, the terms "induce," "inhibit," "enhance," and "increase" are used to mean "induce," "inhibit," "enhance," and "increase." "To increase," "to decrease," and "to reduce" are all quantitative expressions used to describe the difference between two states. It represents a specific difference. For example, "an amount effective in inhibiting the activity or expression of apo(a)" means The activity or expression level of apo(a) in the treated sample is different from that of the untreated sample. This means that the activity or expression level of apo(a) in the sample is different. This applies, for example, to expression levels and activity levels.

[0276] As used herein, “inflammatory condition” refers to a disease, disease state, or symptom that causes inflammation. This refers to a group or other pathological condition. For example, rheumatoid arthritis and hepatic fibrosis are inflammatory conditions. Other examples of symptomatic conditions include sepsis, myocardial ischemia / reperfusion injury, adult respiratory distress syndrome, nephritis, and translocation. Graft rejection, inflammatory bowel disease, multiple sclerosis, arteriosclerosis, atherosclerosis and Vasculitis is one example.

[0277] When used herein, "inhibit expression or activity" means inhibiting the expression or activity of RNA or protein. This refers to a decrease or blockage of the expression or activity of a quality, and does not necessarily indicate the complete elimination of its expression or activity. It is not something that should be done.

[0278] As used herein, "insulin resistance" refers to a condition where a normal amount of insulin is present, It is defined as a condition in which a normal insulin response cannot be obtained from fat, muscle, and liver cells. It is understood that insulin resistance in adipocytes is due to the hydrolysis of stored triglycerides. This causes an increase in free fatty acids in the plasma. Insulin resistance in muscles is In contrast to reducing glucose uptake, insulin resistance in the liver impairs glucose storage. It decreases, and both of these effects cause blood glucose to rise. Insulin resistance is a contributing factor to insulin High plasma levels of glycemic acid and glucose are often associated with metabolic syndrome and type II glucose. It causes urinary tract infections.

[0279] As used herein, "insulin sensitivity" refers to how efficiently an individual can process glucose. This is a measure of how well the body processes glucose. Individuals with high insulin sensitivity process glucose more efficiently. While glucose is processed normally, individuals with low insulin sensitivity do not process glucose efficiently.

[0280] As used herein, "lipid reduction" means one or more lipids in the subject (for example) This means a decrease in lipids (LDL, VLDL). "Increased lipid levels" refers to a decrease in lipids (for example) in the subject. This means an increase in lipids (HDL). Lipid decrease or increase is due to one or more doses over time. It can occur.

[0281] As used herein, "lipid-lowering therapy" or "lipid-lowering agent" refers to the subject matter. This refers to a treatment regimen provided to a subject to reduce one or more types of lipids. In the embodiment, lipid-lowering therapy is performed on the subject with respect to apo(a), CETP, apoB, and total Cholesterol, LDL-C, VLDL-C, IDL-C, non-HDL-C, triglycerides Provided to reduce one or more of the following: small, high-density LDL particles and Lp(a) Examples of lipid-lowering therapies include apoB inhibitors, statins, fibrates, and MTP inhibitors. These are some examples, but are not limited to them.

[0282] When used herein, "lipoproteins" such as VLDL, LDL, and HDL are defined as This refers to a group of proteins found in serum, plasma, and lymph, which are important for lipid transport. The chemical composition of each lipoprotein is, for example, the ratio of protein to lipids in HDL. In contrast to VLDL, the ratio of protein to lipids is higher, while in VLDL, the ratio of protein to lipids is lower. different.

[0283] As used herein, "Lp(a)" refers to LD containing apo(a) and apoB. It contains L-like particles. Apo(a) is bonded to apoB by a disulfide bond.

[0284] When used herein, "low-density lipoprotein-cholesterol (LDL-C)" "This refers to cholesterol transported by low-density lipoprotein particles. Serum (also The concentration of LDL-C in plasma is typically quantified in mg / dL or nmol / L units. "Serum LDL-C" and "plasma LDL-C" refer to LDL- Each C represents a different character.

[0285] As used herein, “major risk factors” refers to a high risk factor for a particular disease or condition. This refers to contributing factors. In a particular embodiment, the major risk factors for coronary heart disease include: While not limited to these, smoking, high blood pressure, high LDL cholesterol, low HDL-C, and coronary heart disease are contributing factors. This includes family history, age, and other factors disclosed herein.

[0286] As used herein, “metabolic disorder” or “metabolic disease” refers to a change in metabolic function. Or it refers to a pathological condition characterized by a disorder. "Metabolic" and "metabolism" are used in the relevant technical field. It is a well-known term and generally encompasses the entire range of biochemical processes that occur within living organisms. Metabolic disorders include hyperglycemia, prediabetes, diabetes (type 1 and type 2), obesity, and insulin. This includes diabetes resistance, metabolic syndrome, and dyslipidemia due to type 2 diabetes, but These are not the only options.

[0287] As used herein, “metabolic syndrome” refers to lipids originating from metabolism. This refers to a pathological condition characterized by the accumulation of cardiovascular risk factors other than lipids and lipids. Specific Embodiments In this context, metabolic syndrome is characterized by the following factors: 102 cm in men or 102 cm in women. In cases where a waist circumference exceeds 88 cm; serum triglycerides are 150 mg / dL or higher; in men, 4 HDL-C less than 0 mg / dL or less than 50 mg / dL for women; 130 / 85 mm Blood pressure of 1g or higher; and any three of the following: fasting glucose of 110 mg / dL or higher. They are identified by their presence. These determinants can be easily measured during clinical practice. JAMA, 2001, 285:2486-2497).

[0288] "Pareral administration" refers to administration by injection or infusion. Parenteral administration includes subcutaneous administration. Administration by intravenous, intramuscular, intra-arterial, intraperitoneal, or intracranial administration, for example, within the spinal cavity. This includes intravascular or intraventricular administration. Administration may be continuous, long-term, short-term, or intermittent. obtain.

[0289] As used herein, “drug” means a drug that, when administered to an individual, provides a therapeutic benefit. It means a substance that is dripped. For example, in a particular embodiment, it is targeted to apo(a) The antisense oligonucleotides used are drugs.

[0290] As used herein, “pharmaceutical composition” or “composition” means a composition that is suitable for administration to an individual. It means a mixture of suitable substances. For example, a pharmaceutical composition is one or more active agents and a pharmaceutical carrier. For example, it may include a sterile aqueous solution.

[0291] When used herein, “pharmaceutically acceptable derivative” means the compound described herein. Derivatives of substances, such as solvates, hydrates, esters, prodrugs, polymorphs, isomers, and so on. Topologically labeled variants, pharmaceutically acceptable salts, and other inducers well known in the art. It includes conductors, etc.

[0292] As used herein, “pharmaceutically acceptable salt” means the raw salt of an antisense compound. A phytochemically and pharmaceutically acceptable salt, i.e., one that retains the desired biological activity of the parent compound, It means a salt that does not impart undesirable toxic effects. "Pharmacologically acceptable salt" or The term "salt" refers to pharmaceutically acceptable, non-toxic substances, including inorganic or organic acids and bases. Includes salts prepared from acids or bases. The compounds described herein are "pharmaceutically acceptable". "Salt" can be prepared by methods well known in the art. For an overview of scientifically acceptable salts, see Stahl and Wermuth, Hand book of Pharmaceutical Salts:Properties, Selection and Use(Wiley-VCH, Weinheim, Ger See many, 2002). For therapeutic administration to humans, antisense oligonucleotides are used. The sodium salt of creotide is useful and shows good tolerance. Therefore, in one embodiment In this specification, the compounds described herein are in the form of sodium salts.

[0293] As used herein, “portion” means a predetermined number of nucleic acids. It means a series of (i.e., joined) nucleic acid bases. In a particular embodiment, part , a predetermined number of consecutive nucleic acid bases of the target nucleic acid. In a particular embodiment, the portion is An antisense compound is a predetermined number of consecutive nucleic acid bases.

[0294] When used herein, “prevent” or “prevent” means disease, disorder or This delays or prevents the onset or manifestation of a disease for a period ranging from several minutes to indefinitely. This refers to preventing a disease, disability, or condition. It also means.

[0295] As used herein, “to increase” means an increase in volume. For example, plasma. Increasing HDL levels means increasing the amount of HDL in the plasma.

[0296] As used herein, “reduce” means to a smaller degree, size, amount or It means to reduce the number. For example, lowering plasma triglyceride levels means This means that the amount of triglycerides in the plasma decreases.

[0297] As used herein, “region” or “target region” means at least one identifiable region. It is defined as a portion of a target nucleic acid that has a functional structure, function, or characteristic. For example, a target region. These are 3'UTR, 5'UTR, exons, introns, exon / intron boundaries, and cos It may include the nucleotide region, translation initiation region, translation termination region, or other defined nucleic acid regions. (a) The regions that are structurally determined can be accessed from sequence databases such as NCBI. This information can be obtained by reference number, and such information is incorporated herein by reference. In a particular embodiment, the target region is 5 of a target segment within the target region. 'Includes the sequence from the target site to the target site of another target segment within the same target region' obtain.

[0298] As used herein, “second agent” or “second therapeutic agent” means “first agent.” This refers to a drug that can be used in combination with the other drug. The second therapeutic agent is labeled with Apo(a) or ApoB. This may include, but is not limited to, antisense oligonucleotides that target the target. These drugs include anti-apo(a) antibodies, apo(a) peptide inhibitors, cholesterol-lowering agents, and lipids. This may also include glucose-lowering agents, blood glucose-reducing agents, and anti-inflammatory agents.

[0299] As used herein, "segment" refers to a smaller sub-part of a region within a nucleic acid. It is defined as follows. For example, a "target segment" is one or more antinucleotides of the target nucleic acid. This refers to the nucleotide sequence targeted by the sense compound. "5' target site" means the target This refers to the nucleotide furthest 5' end of the segment. The "3' target site" refers to the target segment. It refers to the 3' endmost nucleotide. Alternatively, the "start site" is the most 3' end of the target segment. The term "termination site" can refer to the nucleotide at the 5' end, while the term "termination site" refers to the nucleotide at the 3' end of the target segment. This refers to the Otid. The target segment also starts from the "start site" of one sequence and continues from another sequence. It can end at a "terminal point".

[0300] As used herein, "statin" means a substance that inhibits the activity of HMG-CoA reductase. It means an agent that does something.

[0301] As used herein, "subcutaneous administration" means administration just beneath the skin.

[0302] As used herein, “subject” means a person selected for treatment or therapy. It means.

[0303] As used herein, “symptoms of cardiovascular disease or cardiovascular disorder” means heart blood Caused by or associated with cardiovascular disease or cardiovascular disorder, It refers to the phenomena that serve as indicators of this condition. For example, angina; chest pain; shortness of breath; palpitations; weakness; dizziness; Nausea; sweating; tachycardia; bradycardia; arrhythmia; atrial fibrillation; leg swelling; cyanosis; fatigue; syncope; facial Face paralysis; paralysis of the limbs; muscle limping or spasms; abdominal distension; or fever associated with cardiovascular disease. These are symptoms of cardiovascular disease.

[0304] As used herein, “target” or “targeted” means targeting a nucleic acid. Design and selection of antisense compounds that specifically hybridize and induce desired effects. It means process.

[0305] As used herein, “therapeutically effective amount” means a dose that provides a therapeutic benefit to an individual. This refers to the amount of medication.

[0306] As used herein, “lifestyle changes for treatment” refers to adipose tissue. This refers to changes in diet and lifestyle aimed at lowering the amount and / or cholesterol levels. Such changes can reduce the risk of developing heart disease, and the total daily calorie intake... Total fat, saturated fat, polyunsaturated fat, monounsaturated fat, carbohydrates, protein, cholesterol Rolls, advice on dietary intake of insoluble fiber, and advice on physical activity. It may include.

[0307] When used herein, “to treat” or “to treat” means a disease, disorder or This refers to administering the compounds described herein to achieve a change or improvement in the disease state. vinegar.

[0308] When used herein, “prevent” or “prevent” means as described herein. This refers to inhibiting or delaying one or more symptoms of a disease, disorder, or condition. For example, in certain embodiments, administration of ISIS681257 to subjects may result in cardiovascular disorders. It prevents one or more of the following symptoms. For example, administration of ISIS681257 to the target population is cardiovascular To inhibit or delay one or more symptoms associated with the disorder.

[0309] As used herein, “triglyceride” or “TG” refers to three fatty acid components. This refers to lipids or triglycerides consisting of glycerol molecules bound together.

[0310] When used herein, "Type 2 diabetes" ("Type 2 diabetes mellitus," "Type 2 diabetes mellitus") "Non-insulin-dependent diabetes mellitus", "NIDDM", "Obesity-related diabetes mellitus", or "Adult Diabetes mellitus (also known as "onset diabetes") is characterized by insulin resistance, relative insulin deficiency, and high blood sugar levels. It is a metabolic disorder primarily characterized by blood glucose levels.

[0311] Specific Embodiments This disclosure relates to the treatment and improvement of one or more diseases associated with Apo(a) and / or Lp(a). , providing the use of ISIS681257 in the manufacture of drugs for delaying or preventing ISIS681257 has the following structure and contains its salts. [ka]

[0312] This disclosure is intended to treat, prevent or improve the diseases, disorders or conditions described herein. We provide a kit which includes (i) ISIS681257; and optionally (ii) the original This includes the second agent or therapy described in the details.

[0313] The kit of the present invention, through the combination therapy described herein, treats the diseases and disorders described herein. Alternatively, it may further include instructions for using a kit to treat, prevent, or improve a medical condition.

[0314] B. Apolipoprotein (a) (apo(a)) One apo(a) protein can form a single apolipoprotein via a disulfide bond. It binds to B (apoB) protein to form lipoprotein (a) (Lp(a)) particles. The apo(a) protein is a plasminogen, particularly a kringle IV2 type repeat domain. It has a high degree of homology with the internal structure. The kringle repeat domain in apo(a) promotes thrombus formation. It may be a progressive and antifibrinolytic factor, potentially increasing the progression of atherosclerosis. It is thought that apo(a) is transcriptionally regulated by IL-6, and IL-6 inhibitors ( In a study of rheumatoid arthritis patients treated with tocilizumab, plasma levels increased over 3 months. It decreased by 30% after treatment. Apo(a) preferentially binds to oxidized phospholipids and aids in vasculitis. It has been shown that it extends. Furthermore, studies have shown that Lp(a) particles stimulate endothelial permeability and It induces the expression of rasminogen activator inhibitor type 1, and macrophage interleukin 8 It has also been suggested that it may activate the secretion of . Importantly, recent gene-related studies have shown that Furthermore, Lp(a) is an independent risk factor for myocardial infarction, stroke, peripheral vascular disease, and abdominal aortic aneurysm. It became clear that this was the case. Furthermore, in the study of early-onset coronary artery disease (PROCARDIS) Clarke et al. found a strong independent association between coronary heart disease and plasma Lp(a) concentration. Sexuality was described. In addition, Solfrizzi et al. found that an increase in serum Lp(a) is associated with Alzheimer's disease. This suggests a possible link to an increased risk of Heimer's disease (AD). Targeting apo(a) Antisense compounds are subject to WO2005 / 000201 and US2010-0331390 This information has been previously disclosed and is incorporated herein by reference in its entirety. Targeting APO(a) The antisense oligonucleotide base ISIS-APOA to be used Rx was evaluated in a Phase I clinical trial to examine its safety profile .

[0315] Therapeutic indications for apo(a) This disclosure provides a method for modulating the expression of apo(a) in a subject using ISIS681257, a conjugate antisense compound targeted against apo(a) nucleic acids . ISIS681257 reduces the expression of apo(a) when administered to humans .

[0316] In certain embodiments, the invention provides a method of using ISIS68 1257 in a pharmaceutical composition for treating a subject. In certain embodiments, the individual has an apo(a)-related disease. In certain embodiments, the individual has an Lp(a)-related disease. In certain embodiments, the individual has an inflammatory, cardiovascular and / or metabolic disease, disorder or condition . In certain embodiments, the subject has an inflammatory, cardiovascular and / or metabolic disease, disorder or condition.

[0317] In certain embodiments, cardiovascular diseases, disorders or conditions (CVD) include an increased risk of Lp(a )-related CVD, recurrence of cardiovascular events associated with elevated Lp(a), aortic valve stenosis (e.g., calcific aortic valve stenosis associated with high Lp(a)), aneurysm (e.g., abdominal aortic aneurysm), angina, arrhythmia, atherosclerosis, cerebrovascular disease, coronary artery disease, coronary artery heart disease, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypertension, hypertriglyceridemia , myocardial infarction, peripheral vascular disease (e.g., peripheral arterial disease), stroke, etc., but are not limited thereto. ​

[0318] In certain embodiments, ISIS681257 is used for cardiovascular diseases, disorders, or pathological conditions. To modulate the physiological markers or phenotype of ISIS681257. For example, by administering ISIS681257 to humans. As a result, Lp(a), LDL, and cholesterol levels are lower compared to untreated subjects. It may be possible. In certain embodiments, the regulation of physiological markers or phenotypes may be performed in ISIS. This may be related to the inhibition of apo(a) by 681257.

[0319] In certain embodiments, physiological markers of cardiovascular disease, disorder, or pathology are defined It is quantifiable. For example, Lp(a), LDL, or cholesterol levels can be quantifiable, for example, These markers can be measured and quantified by standard lipid tests. In certain embodiments, the markers are approximately 5, 10, 15, 20, 25, 30, and 3. 5, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or It decreases by 99%, or by a percentage within the range defined by any two of these values. obtain.

[0320] Furthermore, symptoms associated with cardiovascular diseases, disorders, or conditions may be addressed in the target population. Methods for prevention, treatment, or improvement are provided herein in certain embodiments. Methods are provided to reduce the rate of onset of symptoms associated with cardiovascular disease, disorder, or pathology. In certain embodiments, the severity of symptoms associated with cardiovascular disease, disorder, or pathology. A method for reducing is provided. In such an embodiment, the method is therapeutically effective This involves administering a certain amount of ISIS681257 to individuals who require it.

[0321] Cardiovascular diseases, disorders, or conditions may be characterized by a number of physical symptoms. Any symptoms that are known to those skilled in the art to be related to a disorder or condition are described herein. The compounds and methods used can prevent, treat, improve, or otherwise regulate the condition. In certain embodiments, symptoms may include, but are not limited to, angina; chest pain; and shortness of breath. Palpitations; weakness; dizziness; nausea; sweating; tachycardia; bradycardia; arrhythmia; atrial fibrillation; leg swelling; cyanosis -ze; fatigue; fainting; facial paralysis; paralysis of the limbs; muscle limp or spasms; abdominal distension; or It could be a fever.

[0322] In certain embodiments, metabolic diseases, disorders, or conditions include hyperglycemia, prediabetes, Diabetes mellitus (Type 1 and Type 2), obesity, insulin resistance, metabolic syndrome, and glucose This includes, but is not limited to, urinary dyslipidemia.

[0323] In certain embodiments, ISIS681257 is used for metabolic diseases, disorders, or pathological conditions. To modulate physiological markers or phenotypes. For example, administering ISIS681257 to humans. As a result, glucose and insulin resistance levels in the treated group decreased compared to the untreated group. It is possible. In certain embodiments, the regulation of physiological markers or phenotypes is possible. This may be related to the inhibition of apo(a) by 81257.

[0324] In certain embodiments, physiological markers of metabolic diseases, disorders, or pathologies are quantified. It is possible to modify it. For example, glucose levels or insulin resistance can be modified in the relevant technology. It can be measured and quantified by standard tests that are known to be effective. Regarding the car, the marker is approximately 5, 10, 15, 20, 2 in certain embodiments. 5, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 A range defined by 95% or 99%, or any two of these values. It may decrease by that amount. In another example, insulin sensitivity is known in the art. Such markers can be measured and quantified by standard tests. In certain embodiments, the marker is approximately 5, 10, 15, 20, 25, 30, 35 , 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or It can increase by 99%, or by a percentage within the range defined by any two of these values. ru.

[0325] Furthermore, symptoms associated with metabolic diseases, disorders, or conditions may be treated in the necessary context. Methods for prevention, treatment, or improvement are provided herein. In certain embodiments, A method is provided for reducing the rate of onset of symptoms associated with metabolic diseases, disorders, or conditions. In certain embodiments, it reduces the severity of symptoms associated with metabolic diseases, disorders, or conditions. A method is provided for this purpose. In such embodiments, the method provides a therapeutically effective amount This includes administering ISIS681257 to individuals that require it.

[0326] Metabolic diseases, disorders, or conditions may be characterized by a number of physical symptoms. Any symptoms known to those skilled in the art as being related to harm or pathology are described herein. Compounds and methods can be used to prevent, treat, improve, or otherwise regulate the condition. In certain embodiments, symptoms include, but are not limited to, excessive urine production (polyuria), One of the following: excessive thirst and increased fluid intake (hyperthiasis), blurred vision, unexplained weight loss, and lethargy. It is possible.

[0327] In certain embodiments, inflammatory diseases, disorders, or conditions include Lp(a)-related CVD. Increased risk, recurrence of cardiovascular events associated with elevated Lp(a), aortic stenosis (e.g., high Calcified aortic stenosis associated with Lp(a), coronary artery disease (CAD), Alzheimer's disease This includes, but is not limited to, diseases and thromboembolic disorders, conditions, or pathologies. Thromboembolic diseases, disorders, or conditions include stroke, thrombosis, myocardial infarction, and peripheral vascular disease. This includes, but is not limited to, the following:

[0328] In certain embodiments, ISIS681257 is used for inflammatory diseases, disorders, or pathological conditions. To modulate physiological markers or phenotypes. For example, administering ISIS681257 to humans. Then, compared to untreated subjects, levels of inflammatory cytokines or other inflammatory markers were higher. This may decrease. In certain embodiments, regulation of physiological markers or phenotypes is IS This may be related to the interference of Apo(a) by IS681257.

[0329] In certain embodiments, physiological markers of inflammatory diseases, disorders, or pathologies are quantified. It is possible to measure cytokine levels according to standards known in the relevant field. Such markers can be measured and quantified by specific tests. In certain embodiments, the manufacturer contains at least about 5%, 10%, 15%, 20%, and 25% of the product. %, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75 %, 80%, 85%, 90%, 95%, or 99%, or any of these values. It can decrease by the amount defined by the two factors.

[0330] Furthermore, symptoms associated with inflammatory diseases, disorders, or conditions may be treated in the necessary individuals. Methods for prevention, treatment, or improvement are provided herein. In certain embodiments, Methods are provided for reducing the rate of onset of symptoms associated with inflammatory diseases, disorders, or conditions. In certain embodiments, it reduces the severity of symptoms associated with inflammatory diseases, disorders, or conditions. A method is provided for this purpose. In such embodiments, the method provides a therapeutically effective amount This includes administering ISIS681257 to individuals that require it.

[0331] In a particular embodiment, one or more pharmaceutical compositions described herein in a therapeutically effective amount Treatment of an individual with a disease, disorder, or condition related to apo(a), including administration of a substance A method of treatment is provided. In a particular embodiment, the individual has an elevated apo(a) level. In certain embodiments, a therapeutically effective amount of one or more medicines described herein Individuals with diseases, disorders, or conditions related to Lp(a), including administration of a drug composition. A method for treating the body is provided. In a particular embodiment, the individual has an Lp(a) level It is increasing. In certain embodiments, the individual is inflammatory, cardiovascular and / or metabolic The patient has a disease, disorder, or condition. In certain embodiments, a therapeutically effective amount of ISIS Administration of 681257 is accompanied by monitoring at the apo(a) or Lp(a) level. In this embodiment, administration of a therapeutically effective amount of ISIS681257 is equivalent to ISIS681 To determine the individual's response to 257, inflammatory, cardiovascular and / or metabolic Monitoring markers of other disease processes associated with the onset of disease or apo(a) The physician uses the individual's response to the administration of ISIS681257 to determine if ISIS Determine the amount and duration of treatment intervention based on 681257.

[0332] In certain embodiments, administration of ISIS681257 resulted in reduced apo(a) expression. At least approximately 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, Or it decreases by a range defined by any two of these values. In the application morphology, apo(a) expression was at least ≤100 mg / dL and ≤90 mg / dL. , ≦80mg / dL, ≦70mg / dL, ≦60mg / dL, ≦50mg / dL, ≦40 The levels decrease to mg / dL, ≤30 mg / dL, ≤20 mg / dL, or ≤10 mg / dL.

[0333] In certain embodiments, administration of ISIS681257 reduced Lp(a) expression. At least approximately 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%, Or it decreases by a range defined by any two of these values. In the application morphology, Lp(a) expression was at least ≤200 mg / dL and ≤190 mg / dL. L, ≦180mg / dL, ≦175mg / dL, ≦170mg / dL, ≦160mg / d L, ≦150mg / dL, ≦140mg / dL, ≦130mg / dL, ≦120mg / d L, ≦110mg / dL, ≦100mg / dL, ≦90mg / dL, ≦80mg / dL, ≦70mg / dL, ≦60mg / dL, ≦55mg / dL, ≦50mg / dL, ≦45m g / dL, ≦40mg / dL, ≦35mg / dL, ≦30mg / dL, ≦25mg / dL The levels decrease to ≤20 mg / dL, ≤15 mg / dL, or ≤10 mg / dL.

[0334] In certain embodiments, the present invention uses ISIS681257 in the preparation of pharmaceuticals. A method is provided for doing so. In a particular embodiment, a pharmaceutical including ISIS681257 The composition is intended for patients suffering from inflammatory, cardiovascular, and / or metabolic diseases, disorders, or conditions. They are used to prepare drugs for treating patients who are susceptible to them, or for treating patients who are prone to them.

[0335] Apo(a) Treatment Group Certain individuals with high Lp(a) levels are at significant risk for various diseases (Li ppi et al.,Clinica Chimica Acta,2011,412 :797-801; Solfrizz et al.). For example, the Lp(a) level of the subject. If the concentration exceeds ≥75 nanomoles / liter (nmol / L) or ≥30 mg / dL, They are considered to be at high risk for various diseases. Many of those with high Lp(a) levels... Currently, current treatments cannot reduce Lp(a) levels to a safe level. Since apo(a) plays an important role in the formation of Lp(a), apo(a) By reducing it, Lp(a) levels can be reduced, which can help prevent and treat Lp(a)-related diseases. It can be improved.

[0336] In certain embodiments, treatment by the compounds and methods disclosed herein is apo( a) Suitable for humans with elevated levels and / or Lp(a) levels. Specific Embodiments In humans, the levels are ≥10 mg / dL, ≥20 mg / dL, ≥30 mg / dL, and ≥40 mg / dL. g / dL, ≧50mg / dL, ≧60mg / dL, ≧70mg / dL, ≧80mg / dL , having an apo(a) level of ≥90 mg / dL or ≥100 mg / dL. Specific implementation Morphologically, humans have ≥10 mg / dL, ≥15 mg / dL, ≥20 mg / dL, and ≥2 5mg / dL, ≧30mg / dL, ≧35mg / dL, ≧40mg / dL, ≧50mg / dL, ≧60mg / dL, ≧70mg / dL, ≧80mg / dL, ≧90mg / dL, ≧ 100mg / dL, ≧110mg / dL, ≧120mg / dL, ≧130mg / dL, ≧ 140mg / dL, ≧150mg / dL, ≧160mg / dL, ≧170mg / dL, ≧ 175mg / dL, ≧180mg / dL, ≧190mg / dL, ≧200mg / dL L It has a p(a) level.

[0337] In certain embodiments, a person has an apo(a) level that exceeds the upper limit of normal, for example For humans, the recommended daily intake is ≥30 mg / dL, ≥35 mg / dL, ≥40 mg / dL, ≥50 mg / dL. L, ≧60mg / dL, ≧70mg / dL, ≧80mg / dL, ≧90mg / dL, ≧1 00mg / dL, ≧110mg / dL, ≧120mg / dL, ≧130mg / dL, ≧1 40mg / dL, ≧150mg / dL, ≧160mg / dL, ≧170mg / dL, ≧1 Apotherapy for 75 mg / dL, ≥180 mg / dL, ≥190 mg / dL, ≥200 mg / dL (a) Has a level.

[0338] Specific Apo(a) medication regimens In certain embodiments, ISIS681257 is administered to subjects who require it. In certain embodiments, 5 mg of ISIS681257 is administered to human subjects. In a specific embodiment, 10 mg of ISIS681257 is administered to a human subject. In a specific embodiment, 15 mg of ISIS681257 is administered to a human subject. In this embodiment, 20 mg of ISIS681257 is administered to a human subject. In one embodiment, 25 mg of ISIS681257 is administered to a human subject. In the administration method, 30 mg of ISIS681257 is administered to human subjects.

[0339] In certain embodiments, ISIS681257 is administered to subjects who require it. In certain embodiments, 40 mg of ISIS681257 is administered to human subjects. In certain embodiments, 50 mg of ISIS681257 is administered to human subjects. In a specific embodiment, 60 mg of ISIS681257 is administered to a human subject. In a specific embodiment, 70 mg of ISIS681257 is administered to a human subject. In this embodiment, 80 mg of ISIS681257 is administered to a human subject. In this embodiment, 90 mg of ISIS681257 is administered to a human subject.

[0340] In certain embodiments, ISIS681257 is administered to subjects who require it. In certain embodiments, during the course of treatment, 5 mg of ISIS681257 is administered to human subjects. It is administered. In certain embodiments, during the course of treatment, 10 mg of ISIS681257 is administered. It is administered to human subjects. In certain embodiments, 15 mg of ISIS68 is administered during the treatment period. 1257 is administered to human subjects. In certain embodiments, 20 mg of I is administered during the treatment period. SIS681257 is administered to human subjects. In certain embodiments, during the drug administration period, 2 5 mg of ISIS681257 is administered to human subjects. In certain embodiments, the drug is administered. During the period, 30 mg of ISIS681257 will be administered to human subjects. In certain embodiments... The medication period is one week. In certain embodiments, administration is only once during the medication period. It will continue.

[0341] In a specific embodiment, 5 mg of ISIS681257 is administered weekly to human subjects. In a specific embodiment, 10 mg of ISIS681257 is administered weekly to a human subject. In certain embodiments, 15 mg of ISIS681257 is administered weekly to human subjects. It is administered. In certain embodiments, 20 mg of ISIS681257 is administered weekly to humans. It is administered to elephants. In certain embodiments, 25 mg of ISIS681257 is administered weekly to the elephants. It is administered to the target. In a specific embodiment, 30 mg of ISIS681257 is administered weekly. It is administered to human subjects. In certain embodiments, 40 mg of ISIS6812 is administered weekly. 57 is administered to human subjects. In certain embodiments, 50 mg of ISIS68 is administered weekly. 1257 is administered to human subjects. In certain embodiments, 60 mg of ISIS is administered weekly. 681257 is administered to human subjects. In certain embodiments, 70 mg of IS is administered weekly. IS681257 is administered to human subjects. In certain embodiments, 80 mg is administered weekly. ISIS681257 is administered to humans.

[0342] In certain embodiments, ISIS681257 is administered to subjects who require it. In certain embodiments, during the drug administration period, 20 mg of ISIS681257 is administered to human subjects. It is administered to the patient. In certain embodiments, during the course of treatment, 30 mg of ISIS681257 It is administered to human subjects. In certain embodiments, 40 mg of ISIS6 is administered during the treatment period. 81257 is administered to human subjects. In certain embodiments, 50 mg is administered during the course of treatment. ISIS681257 is administered to human subjects. In certain embodiments, during the course of treatment, 60 mg of ISIS681257 is administered to human subjects. In certain embodiments, During the drug period, 70 mg of ISIS681257 is administered to human subjects. In certain embodiments During the treatment period, 80 mg of ISIS681257 is administered to human subjects. In one embodiment, the medication period is one month. In a specific embodiment, the medication period is four weeks. In certain embodiments, the drug is administered only once during the treatment period.

[0343] In a specific embodiment, 20 mg of ISIS681257 was administered to human subjects once every four weeks. It is administered. In certain embodiments, 30 mg of ISIS681257 is administered once every four weeks. It is administered to human subjects. In a specific embodiment, 40 mg of ISIS68 is administered once every four weeks. 1257 is administered to human subjects. In certain embodiments, 50 mg of 1257 is administered once every four weeks. SIS681257 is administered to human subjects. In certain embodiments, it is administered once every four weeks, 6 0 mg of ISIS681257 is administered to human subjects. In certain embodiments, for 4 weeks In a specific embodiment, 70 mg of ISIS681257 is administered once to a human subject. In addition, 80 mg of ISIS681257 is administered to human subjects once every four weeks.

[0344] In a specific embodiment, 20 mg of ISIS681257 is administered to a human subject once a month. In certain embodiments, 30 mg of ISIS681257 is administered to humans once a month. It is administered to the target. In certain embodiments, 40 mg of ISIS68125 is administered once a month. 7 is administered to human subjects. In certain embodiments, 50 mg of ISIS6 is administered once a month. 81257 is administered to human subjects. In certain embodiments, 60 mg of I is administered once a month. SIS681257 is administered to human subjects. In certain embodiments, once a month, 70 mg of ISIS681257 is administered to human subjects. In certain embodiments, 1 per month In one instance, 80 mg of ISIS681257 is administered to human subjects.

[0345] C. Specific pharmaceutical compositions In certain embodiments, the Disclosure relates to a pharmaceutical composition comprising one or more antisense compounds. To provide. In certain embodiments, such pharmaceutical compositions are suitable and pharmaceutically acceptable. It contains a diluent or carrier. In certain embodiments, the pharmaceutical composition includes sterile physiological saline and It contains one or more antisense compounds. In certain embodiments, such a pharmaceutical composition is It consists of sterile physiological saline solution and one or more antisense compounds. In a particular embodiment, Sterile physiological saline is a physiological saline of pharmaceutical grade. In certain embodiments, the pharmaceutical composition The substance comprises one or more antisense compounds and sterile water. In certain embodiments, the pharmaceutical The composition consists of one or more antisense compounds and sterile water. In a particular embodiment, Sterile physiological saline is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition is Contains one or more antisense compounds and phosphate-buffered saline (PBS). Specific implementation In form, the pharmaceutical composition comprises one or more antisense compounds and sterile phosphate-buffered food. It consists of saline solution (PBS). In certain embodiments, sterile physiological saline is of pharmaceutical grade P It is BS.

[0346] In certain embodiments, the antisense compound is used for the preparation of a pharmaceutical composition or formulation. It can be mixed with pharmaceutically acceptable active and / or inactive substances. The compositions and methods for preparing them are not limited to those used, but the route of administration, the severity of the disease or It depends on many criteria, including the dosage administered.

[0347] In certain embodiments, the pharmaceutical compositions provided herein include one or more modified oligonucleotides. The nucleotide comprises a nucleotide and one or more excipients. In such a particular embodiment, the excipient It is water, saline solution, alcohol, polyethylene glycol, gelatin, lactose, amyl -ze, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethyl Selected from cellulose and polyvinylpyrrolidone.

[0348] In certain embodiments, the pharmaceutical composition provided herein includes a delivery system. Examples include, but are not limited to, liposomes and emulsions. The delivery system is useful for preparing certain pharmaceutical compositions, such as pharmaceutical compositions containing hydrophobic compounds. Yes. In certain embodiments, specific organic solvents such as dimethyl sulfoxide are used. ru.

[0349] In certain embodiments, the pharmaceutical composition is administered by injection (e.g., intravenously, subcutaneously, intramuscularly, etc.) Prepared for administration by means of a carrier. In such a particular embodiment, the pharmaceutical composition is a carrier It contains aqueous solutions such as water, or physiological solutions such as Hanks' solution, Ringer's solution, or saline buffer. It is formulated with a phytocompatible buffer. In certain embodiments, other components are included. (For example, an ingredient that helps dissolve or an ingredient that acts as a preservative). In a particular embodiment Then, an injectable suspension is prepared using an appropriate liquid carrier, suspending agent, etc. The specified injectable pharmaceutical composition is provided in a unit dosage form, for example, in an ampoule or in a multi-dose container. Provided are specific injectable pharmaceutical compositions, suspensions in oily or aqueous vehicles, solutions or This is an emulsion and may contain compounding agents such as suspending agents, stabilizers, and / or dispersants. Specific solvents suitable for use in injectable pharmaceutical compositions include lipophilic solvents and fats such as sesame oil. Oils, synthetic fatty acid esters such as ethyl oleate or triglycerides, and liposomes This includes, but is not limited to, aqueous suspensions for injection that increase the viscosity of the suspension. Substances such as sodium carboxymethylcellulose, sorbitol, or dextra It may contain, etc. If necessary, such suspension may contain a suitable stabilizer or a high-concentration solution. It may also contain agents that increase the solubility of drugs to enable the preparation of the mixture.

[0350] In certain embodiments, the Disclosure relates to a pharmaceutical composition comprising an oligonucleotide of the Disclosure. The present invention provides a method for administering the drug to the target. Preferred routes of administration include parenteral administration (e.g., intravenous, intramuscular). This includes intramedullary and subcutaneous tissue.

[0351] Non-exclusive disclosure and reference The specific compounds, compositions, and methods described herein may be described in accordance with specific embodiments. As explained in detail above, the following examples illustrate the compounds described herein. This application provides only and does not limit itself to the compound. References referred to in this application Each of the references and GenBank accession numbers, etc., are referred to herein by reference in their entirety. It is used in conjunction with [the text].

[0352] The sequence listing attached to this application may, if necessary, list each sequence as either "RNA" or "DNA". Although they are identified as misaligned, in reality, these sequences can be modified by any combination of chemical modifications. It can be decorated. Those skilled in the art will know that "RNA" is used to describe modified oligonucleotides. It will be easy to recognize that the name "DNA" is, in some cases, arbitrary. For example, oligonucleotides containing a nucleoside that includes a 2'-OH sugar moiety and a thymine base. This refers to DNA or modified bases that have modified sugars (2'-OH relative to the natural 2'-H in DNA). This is described as RNA that has thymine (methylated uracil) in contrast to the natural uracil of RNA. It is possible.

[0353] Therefore, the nucleic acid sequences described herein are not limited to, but include those in the sequence listing. Nuclear nuclei containing any combination of natural or modified RNA and / or DNA, including those containing the same material. Acids, for example, include nucleic acids having modified nucleic acid bases, although this is not limited to them. Intended. As a further example, though not limited to, the nucleic acid sequence "ATCGATC Oligonucleotides having "G" are modified or unmodified, and the nucleic acid base sequence This includes, but is not limited to, any oligonucleotides that have RNA bases. Compounds containing the sequence "AUCGAUCG" and "AUCGATCG" Any one that has some DNA bases and some RNA bases, as well as "AT me CG AUCG" (in the sequence, me Other Cs include cytosine bases with a methyl group at the 5th position. Contains oligonucleotides with modified bases. [Examples]

[0354] The following embodiments illustrate, and are not limited to, specific embodiments of the present disclosure. Furthermore, if specific embodiments are provided, the inventors of those specific embodiments It is intended for general applications. For example, the development of oligonucleotides having a specific motif. The indication is for further oligonucleotides having the same or similar motif. It provides rational support. Also, for example, when a particular high-affinity modification appears at a specific position, Other high-affinity modifications at the same position are also considered preferable unless otherwise specified.

[0355] Example 1: Clinical trial of ISIS681257 As described herein, in healthy volunteers with high Lp(a) A controlled dose-escalation Phase 1 trial was conducted to evaluate the effects of single and repeated administrations of ISIS681257. Safety, tolerability, pharmacokinetics (PK), and pharmacodynamics (PD) were evaluated. ISIS68125 7 was previously disclosed in WO2014 / 179625 and is also mentioned above. SIS681257 has the efficacy to inhibit Lp(a) when administered to non-human subjects. It has been shown to be tolerable. Subsequent studies have shown that when administered to human subjects... It was discovered that the characteristics of ISIS681257 had unexpectedly improved.

[0356] screening Participants were screened for eligibility to participate in this study 28 days prior to treatment. The inclusion criteria for this study include the following: 1. At the time of informed consent, the person weighs 50 kg or more and is between 18 and 65 years old. Healthy men and women. 2. BMI < 35.0 kg / m2 3. At the time of screening, subjects had a blood count of ≥75 nanomoles / liter (nmol / L) (≥3 It must have Lp(a) of 0 mg / dL. Lp(a) press cleaning If the Lp(a) value obtained by the protocol is measured within 6 months of medication, this standard applies. It can also be used to satisfy.

[0357] Test reagent A solution of the test drug ISIS681257 (100 mg / m³) placed in a glass vial with a stopper. (L, 0.8 mL) was used. The vial was disposable. Multiple dose IS The IS681257 solution and placebo (0.9% sterile saline) were administered to an open-label pharmacist ( Prepared by a qualified agent. On each administration day, a trained specialist administered ISIS68 1257 or placebo can be administered as a subcutaneous injection (sc) to the abdomen, thigh, or upper arm. It was administered blindly to the lateral region.

[0358] Treatment and post-treatment evaluation Subjects enrolled in the trial were divided into two treatment groups: single dose escalation (SAD) or repeated dose escalation. I separated them into (MAD) categories.

[0359] Example 1A: Single dose escalation (SAD) Approximately 28 subjects were enrolled in the SAD group of this study and received either ISIS681257 or a placebo (3: Participants were randomized in step 1 and divided into cohorts of 4 or 8 individuals. The participants are listed in Table 1. Participants received either a placebo or ISIS681257 at the listed dose. [Table 1]

[0360] After treatment with a single dose of ISIS681257 or placebo, subjects were treated for up to 90 days. The subjects were followed up to monitor drug safety, tolerability, PK, and PD. During the follow-up period, the subjects were treated. Post-treatment days 2, 3, 8, 15, and 30 (for cohorts C, D, and E, further on day 50 after treatment) On the 70th and 90th day of the trial, safety and clinical laboratory evaluation (blood sampling), monitoring, Return to the laboratory for a visit to collect records of concomitant medication use and adverse events (AEs). Urine and stool samples were collected on designated days. All visits by subjects for post-treatment evaluation were limited to a maximum of ±1 The visit lasted for several days.

[0361] Analysis of serum samples was performed after a single dose of ISIS681257, and on days 2, 4, 8, and 1 post-treatment. When measured on days 5 and 30, Lp(a) levels showed a dose-dependent decrease (cohort). C, D, and E were also evaluated at approximately 50, 70, and 90 days post-treatment. Table 2 shows the results expressed as the average rate of change (%) of Lp(a). [Table 2]

[0362] Furthermore, the isoform of apo(a), lipoprotein-related phospholipase A2 (Lp- PLA2), secreted phospholipase A2 (sPLA2), apolipoprotein B-related oxidation Phospholipids (OxPL-apoB) and apolipoprotein (a)-related oxidized phospholipids (Ox An analysis of PL-apo(a)) was conducted.

[0363] The safety and tolerability of ISIS681257 in subjects were assessed during scheduled visits to the testing facility. Clinical evaluation was performed on the following: Clinical staff assessed the following: adverse events (AEs) and quality of life. Price, information on concomitant medications / treatments, vital signs, physical examination results (e.g., injection site reaction (IS)). R) or cold-like symptoms (FLS)), waist circumference, subcutaneous fat thickness measurement, DEXA scan, electrocardiogram (ECG), liver MRI, and echocardiography must be obtained and / or measured. The safety and tolerability were evaluated based on these factors.

[0364] Serum chemistry (e.g., ALT, AST, bilirubin, creatinine, BUN), urine analysis, Coagulation (e.g., aPTT (sec), PT (sec), INR, plasminogen), supplementation Body (e.g., C5a, Bb), blood (e.g., hematocrit, white blood cells, platelets), immune Function, thyroid function, inflammation (hsCRP), lipid panel (e.g., total cholesterol, HDL) L, LDL, TG, ApoB, VLDL), ISIS681257 plasma trough concentration and / or Alternatively, clinical tests such as immunogenicity tests are performed on the subject samples to assess the health of each subject and Safety and drug progression were evaluated.

[0365] Clinical laboratory measurements of subject samples were also used for drug PK profiling. For example, I Measurement of the quantity and stability of SIS681257 and / or its metabolites, drug-binding proteins The quality of the plasma and / or other interactions between ISIS681257 and plasma components will be evaluated. Each sample was used for this purpose.

[0366] Both single-dose and repeated-dose therapy with ISIS681257 are clinically important. No safety or tolerability issues arose at any of the test doses. No SR was observed, and no adverse reactions were detected in any clinical tests. Liver enzymes ALT and AS were also detected. T did not rise.

[0367] The unconjugated compound (ISIS494372) and GalNAc are conjugated In previous experiments on both of the jugated compounds (ISIS681257), Gal The NAc-conjugated compound was observed after the first dose in humans as reported herein. Compared to the above, the efficacy in humans is significantly lower and / or the duration of action is significantly shorter. The above results are surprising, as it had been suggested that they would be short (for example, WO20 Examples 89, 100 and 108 of 14 / 179625 and Tsimikas et al. (See al., Lancet, 2015 Oct 10;386:1472-83). In light of their surprising results, GalNAc conjugated compounds (IS IS681257 and its salts) indicate that when used to treat humans, GalNAc is conjugated. Lower doses and / or lower doses than expected based on previous in vivo studies of the compound. It can be administered infrequently. This is because it is used in the treatment of one or more very serious conditions in humans. Key improvements include reducing treatment costs, improving patient compliance, and decreasing medication dosages. and / or the potential reduction in the risk of potential adverse events with lower dose regimens. It is something that can be brought about.

[0368] Example 1B: Repeated dose escalation (MAD) Thirty subjects were enrolled in the MAD group of this study and given ISIS681257 and placebo in a 4:1 ratio. Participants were randomized and divided into a cohort of 10. Each participant received a placebo dose as described in Table 3. Each subject received either a dose of vo or placebo. A total of six doses of either the drug or placebo were administered to each subject. The drug was administered to the subjects. A loading dose was administered on days 1 (first dose), 3, 5, and 8 of the study during the first week. Then, a maintenance dose was administered once a week, on days 15 and 22 of the study. [Table 3]

[0369] During and for up to 13 weeks after treatment with ISIS681257 or placebo, the drug Safety, tolerability, PK, and PD were monitored in the subjects. During the treatment period and follow-up period, subjects On the 5th, 8th, 15th, 22nd, 29th, 36th, 50th, 64th, 85th and 113th day of the examination Safety and clinical laboratory evaluation (blood sampling), monitoring, record of concomitant drug use and AE events I returned to the testing facility for a visit related to data collection. Urine and stool samples were also collected on specific days. After treatment All visits by subjects for evaluation had a maximum duration of ±1 day.

[0370] Analysis of serum samples was performed after repeated administration of ISIS681257, at 5, 8, and 15 days after the start of treatment. When measured on the 22nd, 29th, and 36th day, a decrease in Lp(a) levels was observed. Table 4 shows the results expressed as the average percentage change (%) of Lp(a) from the line. In particular, Lp(a) levels continued to decrease after a single dose of ISIS681257, and AA In the hort, the lowest value is reached around day 50. This is because the effective half-life of ISIS681257 is This indicates that it is much longer than expected. Furthermore, cohorts BB and CC show that A sustained decrease in Lp(a) was observed for 36 days after administration of ISIS681257. [Table 4] [Table 5]

[0371] In human subjects, ISIS681257 showed dose-dependent, long-lasting statistical effects. A significant decrease in Lp(a) was observed, and the ED50 was 4.5 mg. (ISIS681257) Unexpectedly, ISIS494372 (a conjugate with the same nucleic acid base sequence and length) Untested antisense compounds; previously described in WO2013 / 177468) It was found to be more than 30 times more powerful than ISIS494372 and ISIS6812. Previous experiments on both of 57 (reported in WO2014 / 179625) showed that Ga The high in vivo potency of lNAc-conjugated compounds in mice is a valuable asset. Although it had shown to be beneficial, these previous experiments showed an unexpected 30 times increase in humans. The above improvements were not evident and were not anticipated. Furthermore, repeated administration of 10 mg cohort In the study, based on data points from day 36 onwards, the Lp(a) level of 6 out of 8 patients was determined. This indicates that the lowest value of the value was not reached until approximately day 50, which suggests that in humans, ISIS681257 is ISIS494372 (Tsimikas et al.,L Compared to ancet, 2015 Oct 10;386:1472-83), it was better than expected. It has been shown to exhibit a long half-life (T1 / 2), and similarly, this is ISIS49 Previous mouse experiments on both 4372 and ISIS681257 did not reveal this, It was something I never would have imagined.

[0372] Furthermore, the isoform of apo(a), lipoprotein-related phospholipase A2 (Lp- PLA2), secreted phospholipase A2 (sPLA2), apolipoprotein B-related oxidation Phospholipids (OxPL-apoB) and apolipoprotein (a)-related oxidized phospholipids (Ox An analysis of PL-apo(a)) was performed. The results showed LDL cholesterol and apolipotan Protein B (apoB) and oxidized phospholipids (OxPL) related to apoB and apo(a) It showed a significant decrease in Lp(a). Therefore, the decrease in Lp(a) indicates that LDL-C and apoB-1 This occurs not only in conjunction with a decrease in 00, but also in a significant decrease in pro-inflammatory OxPL, which is related to the heart. Beneficial effects on several causal pathways that mediate vascular disease and calcified aortic stenosis, and They match. Viney, et al. Lancet, 2016, Sep 2016; See 388:2239-53.

[0373] The safety and tolerability of ISIS681257 in subjects were assessed during scheduled visits to the testing facility. Clinical evaluation was performed on the following: Clinical staff assessed the following: adverse events (AEs) and quality of life. Price, information on concomitant medications / treatments, vital signs, physical examination results (e.g., injection site reaction (IS)). R) or cold-like symptoms (FLS)), waist circumference, subcutaneous fat thickness measurement, DEXA scan, electrocardiogram (ECG), liver MRI, and echocardiography must be obtained and / or measured. The safety and tolerability were evaluated based on these factors.

[0374] Serum chemistry (e.g., ALT, AST, bilirubin, creatinine, BUN), urine analysis, Coagulation (e.g., aPTT (sec), PT (sec), INR, plasminogen), supplementation Body (e.g., C5a, Bb), blood (e.g., hematocrit, white blood cells, platelets), immune Function, thyroid function, inflammation (hsCRP), lipid panel (e.g., total cholesterol, HDL) L, LDL, TG, ApoB, VLDL), ISIS681257 plasma trough concentration and / or Alternatively, clinical tests such as immunogenicity tests are performed on the subject samples to assess the health of each subject and Safety and drug progression were evaluated.

[0375] Clinical laboratory measurements of subject samples were also used for drug PK profiling. For example, I Measurement of the quantity and stability of SIS681257 and / or its metabolites, drug-binding proteins The quality of the plasma and / or other interactions between ISIS681257 and plasma components will be evaluated. Each sample was used for this purpose.

[0376] Repeated-dose therapy with ISIS681257 does not raise any safety or tolerability issues. It did not happen. Neither ISR nor FLS was observed. Liver enzymes ALT and AST were elevated. It wasn't there.

[0377] The more than 30-fold improvement in efficacy in humans was far greater than expected. The untreated compound (ISIS494372) and GalNAc are conjugated. In previous experiments with both compounds (ISIS681257), GalNAc was found to be effective against condyloma. The regulated compounds showed a greater effect than those observed after the first dose in humans as reported herein. However, this suggests that the efficacy in humans is significantly low and / or the duration of action is significantly short. Therefore, the above results are surprising (for example, WO2014 / 1796). Examples 89, 100, and 108 of 25, and Tsimikas et al., Lan (See cet, 2015 Oct 10;386:1472-83). These surprising results In light of the results, GalNAc conjugated compounds (ISIS68125) 7) and its salts) when used to treat humans, GalNAc is conjugated into the compound. Based on the previous in vivo studies, the dose and / or frequency were lower than expected. It can be administered. This can lead to one or more very significant improvements in the treatment of humans, for example. If so, treatment costs will be reduced, patient compliance will be improved, drug dosages will be reduced and / or This may lead to a reduction in the risk of potential adverse events with lower-dose medication regimens. It is possible.

[0378] Example 2: Medication regimen Modeling based on the results of the ongoing Phase 1 clinical trial was performed for ISIS681257 The optimal clinical medication regimen was evaluated.

[0379] Administered once a week Figures 1A-C. Expected weekly medication regimen. ISIS681257 20 mg (Figure 1A) By administering a dose of 30 mg (Figure 1B) or 40 mg (Figure 1C) once a week... A chart modeling the effect on Lp(a) is shown. Lp(a) represents the steady state at ≥80%. It shows a decrease in state.

[0380] Administered once a month Figures 2A-B. Expected monthly medication regimen. ISIS681257 60 mg (Figure The effect on Lp(a) when administered once a month at doses of 2A) and 80 mg (Figure 2B) The modeled chart is shown. Lp(a) represents the decrease in steady state at approximately 80%.

[0381] Administration once every two months Figure 3. Expected 2-month medication regimen. ISIS681257 at a dose of 80 mg for 2 months. The chart shows a model of the effect on Lp(a) when administered monthly. a) shows a steady-state decrease of approximately 80%.

[0382] Administration once every three months Figure 4. Expected 3-month medication regimen. ISIS681257 at a dose of 80 mg for 3 months. The chart shows a model of the effect on Lp(a) when administered monthly. a) shows a steady-state decrease of 80% and a maximum decrease exceeding 90%.

[0383] Example 3: Medication regimen After the completion of the Phase 1 trial described above, further modeling was performed to determine the most advanced ISIS681257. We evaluated appropriate clinical medication regimens.

[0384] Administered once a week Figures 6A-D. Expected weekly medication regimen. ISIS681257 5mg (Figure 6 A) Once a week in doses of 10 mg (Figure 6B), 20 mg (Figure 6C), and 30 mg (Figure 6D). This chart models the effect of administration on Lp(a). The dark line in the center represents The forecast quantity is shown, and the top and bottom lines represent the 90% confidence interval.

[0385] Administered once a month Figures 5A-D. Expected monthly medication regimen. ISIS681257 20 mg (Figure 5A-D). 5A), 40 mg (Figure 5B), 60 mg (Figure 5C), and 80 mg (Figure 5D) doses once a month This chart models the effect on Lp(a) from a single dose. The dark line in the center represents the effect on Lp(a). The line represents the predicted quantity, and the upper and lower lines represent the 90% confidence interval.

[0386] Example 4: Patients with hyperlipoprotein(a)emia and a confirmed diagnosis of cardiovascular disease (CVD) A randomized, double-blind, placebo-controlled dose-escalation study of ISIS681257 administered subcutaneously to patients. Phase 2 augmented trial The tests described herein evaluate the safety of ISIS681257, including its tolerability. Blood samples from patients with hyperlipoprotein(a)emia and diagnosed cardiovascular disease (CVD). Various doses and dosage regimens of ISIS681257 to lower plasma Lp(a) levels This evaluates the effectiveness of the men. CVD is defined as confirmed coronary artery disease, stroke, or terminal cerebrospinal fluid. It is defined as peripheral artery disease. Patients also have Lp(a) plasma levels ≥ 60 mg / dL It must be present. ISIS681257 is used for hyperlipoprotein(a)emia and diagnosis. This can provide therapeutic benefits to patients with a confirmed CVD.

[0387] Patient administration is once weekly by subcutaneous injection, 10 mg or 20 mg, for a maximum of 52 weeks. It may be any of the mg of ISIS681257. Further patient administration may be up to 13 doses. The medication is administered by subcutaneous injection once every four weeks in doses of 20 mg, 40 mg, or 60 mg. It could be a discrepancy. The primary endpoint is compared to placebo at the primary analysis time point. This is the percentage change in plasma Lp(a) from baseline in the ISIS681257 treatment group. The primary analysis point was week 25 for patients receiving the drug every four weeks, and week 1 for patients receiving the drug every week. For the patient, this was at week 27. The secondary endpoint was the placebo group at the time of the primary analysis. The effects of ISIS681257 may include those of any one of the following compared to: • Percentage change in LDL-C from baseline (%) • Percentage of patients who achieved plasma Lp(a) ≤ 50 mg / dL • Percentage of patients who achieved plasma Lp(a) ≤ 30 mg / dL • Percentage change from baseline (ApoB) • Percentage change from baseline (%) and / or • Percentage change (%) from baseline in OxPL-apoB

[0388] This study may reveal that the properties of ISIS681257 are unexpectedly improved when administered to human subjects with hyperlipoprotein(a)emia and diagnosed cardiovascular disease (CVD). Treatment with ISIS681257 may result in a reduction of Lp(a) in patients with hyperlipoprotein(a)emia and diagnosed cardiovascular disease (CVD). Treatment with ISIS681257 may result in a reduction of baseline LDL-C, baseline apoB, baseline OxPL-apo(a), and / or baseline OxPL-apoB. In one embodiment, the present invention may be described as follows. [Aspect 1] An oligomer compound for use in the treatment or prevention of a disease or condition in humans, wherein the oligomer compound is ISIS681257, and the treatment comprises administering 500 mg or less of the oligomer compound to the human during the course of treatment. [Aspect 2] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 250 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 3] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 100 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 4] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 50 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 5] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 25 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 6] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 15 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 7] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 60 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 8] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 40 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 9] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 30 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 10] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 20 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 11] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 10 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 12] The oligomer compound for use according to aspect 1, wherein the treatment comprises administering 5 mg or less of the oligomer compound to the human during the drug administration period. [Aspect 13] The oligomer compound for use according to any one of aspects 1 to 12, wherein the drug administration period is 3 months. [Aspect 14] The oligomer compound for use according to any one of aspects 1 to 12, wherein the drug administration period is 2 months. [Aspect 15] The oligomer compound for use according to any one of aspects 1 to 12, wherein the drug administration period is one month. [Aspect 16] The oligomer compound for use according to any one of aspects 1 to 12, wherein the drug administration period is 4 weeks. [Aspect 17] The oligomer compound for use according to any one of aspects 1 to 12, wherein the drug administration period is 3 weeks. [Aspect 18] The oligomer compound for use according to any one of aspects 1 to 12, wherein the drug administration period is 2 weeks. [Aspect 19] The oligomer compound for use according to any one of aspects 1 to 12, wherein the drug administration period is one week. [Aspect 20] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 125 mg or less of the oligomer compound. [Aspect 21] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 100 mg or less of the oligomer compound. [Aspect 22] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 75 mg or less of the oligomer compound. [Aspect 23] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 50 mg or less of the oligomer compound. [Aspect 24] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 25 mg or less of the oligomer compound. [Aspect 25] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 15 mg or less of the oligomer compound. [Aspect 26] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 60 mg or less of the oligomer compound. [Aspect 27] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 40 mg or less of the oligomer compound. [Aspect 28] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 30 mg or less of the oligomer compound. [Aspect 29] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 20 mg or less of the oligomer compound. [Aspect 30] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 10 mg or less of the oligomer compound. [Aspect 31] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment comprises administering a unit dose containing 5 mg or less of the oligomer compound. [Aspect 32] The oligomer compound for use according to any one of aspects 14 to 19, wherein the treatment comprises administering a unit dose containing 1 mg or more of the oligomer compound. [Aspect 33] The oligomer compound for use according to aspect 32, wherein the treatment comprises administering a unit dose containing 2.5 mg or more of the oligomer compound. [Aspect 34] The oligomer compound for use according to aspect 32, wherein the treatment comprises administering a unit dose containing 5 mg or more of the oligomer compound. [Aspect 35] The oligomer compound for use according to any one of aspects 20 to 34, wherein the treatment comprises administering a unit dose of 75 mg to 85 mg, optionally 80 mg. [Aspect 36] The oligomer compound for use according to any one of aspects 20 to 34, wherein the treatment comprises administering a unit dose of 55 mg to 65 mg, optionally 60 mg. [Aspect 37] The oligomer compound for use according to any one of aspects 20 to 34, wherein the treatment comprises administering a unit dose of 35 mg to 45 mg, optionally 40 mg. [Aspect 38] The oligomer compound for use according to any one of aspects 20 to 34, wherein the treatment comprises administering a unit dose of 25 mg to 35 mg, optionally 30 mg. [Aspect 39] The oligomer compound for use according to any one of aspects 20 to 34, wherein the treatment comprises administering a unit dose of 15 mg to 25 mg, optionally 20 mg. [Aspect 40] The oligomer compound for use according to any one of aspects 20 to 34, wherein the treatment comprises administering a unit dose of 5 mg to 15 mg, optionally 10 mg. [Aspect 41] The oligomer compound for use according to any one of aspects 20 to 34, wherein the treatment comprises administering a unit dose of 1 mg to 10 mg, optionally 5 mg. [Aspect 42] The oligomer compound for use according to any one of aspects 20 to 41, wherein the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 43] The oligomer compound for use according to any one of aspects 20 to 41, wherein the treatment comprises administering to the person a unit dose not exceeding 2 during the drug administration period. [Aspect 44] The oligomer compound for use according to any one of aspects 20 to 41, wherein the treatment comprises administering to the person a unit dose not exceeding 3 during the drug administration period. [Aspect 45] The oligomer compound for use according to any one of aspects 20 to 41, wherein the treatment comprises administering to the person a unit dose not exceeding 4 during the drug administration period. [Aspect 46] The oligomer compound for use according to any one of aspects 20 to 41, wherein the treatment comprises administering to the person a unit dose not exceeding 5 during the drug administration period. [Aspect 47] The oligomer compound for use according to any one of aspects 20 to 41, wherein the treatment comprises administering to the person a unit dose not exceeding 6 during the drug administration period. [Aspect 48] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 100 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is 3 months. [Aspect 49] The oligomer compound for use according to aspect 48, wherein (i) the treatment comprises administering to the person an oligomer compound of 100 mg or less during the drug administration period, (ii) the drug administration period is 3 months, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 50] The oligomer compound according to aspect 48 or aspect 49, wherein the treatment comprises administering 75 mg to 85 mg, optionally 80 mg, of the oligomer compound to the human during the drug administration period. [Aspect 51] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 100 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is 2 months. [Aspect 52] The oligomer compound for use according to aspect 51, wherein (i) the treatment comprises administering to the person an oligomer compound of 100 mg or less during the drug administration period, (ii) the drug administration period is 2 months, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 53] The oligomer compound according to aspect 51 or aspect 52, wherein the treatment comprises administering 75 mg to 85 mg, optionally 80 mg, of the oligomer compound to the human during the drug administration period. [Aspect 54] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 100 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is one month. [Aspect 55] The oligomer compound for use according to aspect 54, wherein (i) the treatment comprises administering to the person an oligomer compound of 100 mg or less during the drug administration period, (ii) the drug administration period is one month, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 56] The oligomer compound according to aspect 54 or aspect 55, wherein the treatment comprises administering 75 mg to 85 mg, optionally 80 mg, of the oligomer compound to the human during the drug administration period. [Aspect 57] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 75 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is one month. [Aspect 58] The oligomer compound for use according to aspect 57, wherein (i) the treatment comprises administering to the person an oligomer compound of 75 mg or less during the drug administration period, (ii) the drug administration period is one month, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 59] The oligomer compound according to aspect 57 or aspect 58, wherein the treatment comprises administering 55 mg to 65 mg, optionally 60 mg, of the oligomer compound to the human during the drug administration period. [Aspect 60] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 60 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is one month. [Aspect 61] The oligomer compound for use according to aspect 60, wherein (i) the treatment comprises administering to the person an oligomer compound of 60 mg or less during the drug administration period, (ii) the drug administration period is one month, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 62] The oligomer compound according to aspect 60 or aspect 61, wherein the treatment comprises administering 55 mg to 65 mg, optionally 60 mg, of the oligomer compound to the human during the drug administration period. [Aspect 63] The oligomer compound according to aspect 61 or aspect 62, wherein the treatment comprises administering 60 mg of the oligomer compound to the human during the drug administration period. [Aspect 64] The oligomer compound according to aspect 61 or aspect 62, wherein the treatment comprises administering 40 mg of the oligomer compound to the human during the drug administration period. [Aspect 65] The oligomer compound according to aspect 61 or aspect 62, wherein the treatment comprises administering 20 mg of the oligomer compound to the human during the drug administration period. [Aspect 66] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 50 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is one week. [Aspect 67] The oligomer compound for use according to aspect 66, wherein (i) the treatment comprises administering to the person an oligomer compound of 50 mg or less during the drug administration period, (ii) the drug administration period is one week, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 68] The oligomer compound according to aspect 66 or aspect 67, wherein the treatment comprises administering 35 mg to 45 mg, optionally 40 mg, of the oligomer compound to the human during the drug administration period. [Aspect 69] The oligomer compound according to aspect 66 or aspect 67, wherein the treatment comprises administering 25 mg to 35 mg, optionally 30 mg, of the oligomer compound to the human during the drug administration period. [Aspect 70] The oligomer compound according to aspect 66 or aspect 67, wherein the treatment comprises administering 15 mg to 25 mg, optionally 20 mg, of the oligomer compound to the human during the drug administration period. [Aspect 71] The oligomer compound according to aspect 66 or aspect 67, wherein the treatment comprises administering 5 mg to 15 mg, optionally 10 mg, of the oligomer compound to the human during the drug administration period. [Aspect 72] The oligomer compound according to aspect 66 or aspect 67, wherein the treatment comprises administering 1 mg to 10 mg, optionally 5 mg, of the oligomer compound to the human during the drug administration period. [Aspect 73] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 80 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is 4 weeks. [Aspect 74] The oligomer compound for use according to aspect 73, wherein (i) the treatment comprises administering to the person an oligomer compound of 80 mg or less during the drug administration period, (ii) the drug administration period is 4 weeks, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 75] The oligomer compound for use according to aspect 73, wherein (i) the treatment comprises administering to the person an oligomer compound of 60 mg or less during the drug administration period, (ii) the drug administration period is 4 weeks, and (iii) the treatment comprises administering to the person a unit dose not exceeding 1 during the drug administration period. [Aspect 76] The compound according to any one of aspects 73 to 75, wherein the treatment comprises administering 35 mg to 45 mg, optionally 40 mg, of the oligomer compound to the human during the drug administration period. [Aspect 77] The compound according to any one of aspects 73 to 75, wherein the treatment comprises administering 25 mg to 35 mg, optionally 30 mg, of the oligomer compound to the human during the drug administration period. [Aspect 78] The compound according to any one of aspects 73 to 75, wherein the treatment comprises administering 15 mg to 25 mg, optionally 20 mg, of the oligomer compound to the human during the drug administration period. [Aspect 79] The oligomer compound for use according to any one of aspects 1 to 47, wherein (i) the treatment comprises administering 250 mg or less of the oligomer compound to the human during the drug administration period, and (ii) the drug administration period is 4 weeks. [Aspect 80] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 40 mg of the oligomer compound six times during the drug administration period. [Aspect 81] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 40 mg of the oligomer compound four times during the drug administration period. [Aspect 82] The oligomer compound for use according to aspect 79 or aspect 80, wherein (i) the treatment comprises administering 40 mg of the oligomer compound six times during the drug administration period, and (ii) once a week thereafter. [Aspect 83] The oligomer compound for use according to aspect 79 or aspect 80, wherein (i) the treatment comprises administering 40 mg of the oligomer compound four times during the drug administration period, and (ii) once a week thereafter. [Aspect 84] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 30 mg of the oligomer compound six times during the drug administration period. [Aspect 85] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 30 mg of the oligomer compound four times during the drug administration period. [Aspect 86] The oligomer compound for use according to aspect 79, wherein (i) the treatment comprises administering 30 mg of the oligomer compound six times during the drug administration period, and (ii) once a week thereafter. [Aspect 87] (i) The treatment comprises administering 30 mg of the oligomer compound four times during the drug administration period, and (ii) once a week thereafter, for use according to aspect 79 Oligomer compounds. [Aspect 88] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 20 mg of the oligomer compound six times during the drug administration period. [Aspect 89] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 20 mg of the oligomer compound four times during the drug administration period. [Aspect 90] The oligomer compound for use according to aspect 79, wherein (i) the treatment comprises administering 20 mg of the oligomer compound six times during the drug administration period, and (ii) once a week thereafter. [Aspect 91] The oligomer compound for use according to aspect 79 or aspect 89, wherein (i) the treatment comprises administering 20 mg of the oligomer compound four times during the drug administration period, and (ii) once a week thereafter. [Aspect 92] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 10 mg of the oligomer compound four times during the drug administration period. [Aspect 93] The oligomer compound for use according to aspect 79 or aspect 92, wherein (i) the treatment comprises administering 10 mg of the oligomer compound four times during the drug administration period, and (ii) once a week thereafter. [Aspect 94] The oligomer compound for use according to aspect 79, wherein the treatment comprises administering 5 mg of the oligomer compound four times during the drug administration period. [Aspect 95] The oligomer compound for use according to aspect 79 or aspect 94, wherein (i) the treatment comprises administering 5 mg of the oligomer compound four times during the drug administration period, and (ii) once a week thereafter. [Aspect 96] The oligomer compound for use according to any one of aspects 1 to 95, wherein the human is at high risk of cardiovascular events resulting from chronically elevated plasma Lp(a) levels. [Aspect 97] The oligomer compound for use according to any one of aspects 1 to 95, wherein the disease or condition is selected from one or more symptoms of calcified aortic valve stenosis associated with elevated Lp(a), elevated cardiovascular risk associated with elevated Lp(a), recurrence of cardiovascular events associated with elevated Lp(a), or cardiovascular disease or cardiovascular disorder associated with elevated Lp(a). [Aspect 98] The oligomer compound for use according to any one of the prior embodiments, wherein the oligomer compound is administered to a human by injection. [Aspect 99] The oligomer compound for use according to aspect 98, wherein the oligomer compound is administered to the human by subcutaneous injection. [Aspect 100] The oligomer compound for use according to aspect 98 or aspect 99, wherein the oligomer compound is formulated with a sterile solution, and optionally, each unit dose of the oligomer compound does not exceed 1 mL of the sterile solution. [Aspect 101] The oligomer compound for use according to aspect 100, wherein each unit dose of the oligomer compound does not exceed 0.8 mL of the sterile solution. [Aspect 102] The oligomer compound for use according to aspect 100, wherein each unit dose of the oligomer compound does not exceed 0.5 mL of the sterile solution. [Aspect 103] The oligomer compound for use according to aspect 100, wherein each unit dose of the oligomer compound does not exceed 0.4 mL of the sterile solution. [Aspect 104] The oligomer compound for use according to aspect 100, wherein each unit dose of the oligomer compound does not exceed 0.25 mL of the sterile solution. [Aspect 105] The oligomer compound for use according to aspect 100, wherein each unit dose of the oligomer compound does not exceed 0.2 mL of the sterile solution. [Aspect 106] The oligomer compound for use according to any one of aspects 100 to 105, wherein the sterile solution is water. [Aspect 107] The oligomer compound for use according to any one of aspects 100 to 105, wherein the sterile solution is water containing a sodium phosphate buffer. [Aspect 108] The oligomer compound for use according to any one of aspects 100 to 105, wherein the sterile solution is water containing a sodium phosphate buffer and sodium chloride. [Aspect 109] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment reduces the fasting plasma Lp(a) concentration of the person by at least 50% when the fasting plasma Lp(a) concentration of the person is measured at the start and end of the drug administration period. [Aspect 110] An oligomer compound for use according to any one of the prior embodiments, wherein the treatment reduces the fasting plasma Lp(a) concentration of the person by at least 75%, when the fasting plasma Lp(a) concentration of the person is measured at the start and end of the drug administration period. [Aspect 111] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment reduces the fasting plasma Lp(a) concentration of the person by at least 80% when the fasting plasma Lp(a) concentration of the person is measured at the start and end of the drug administration period. [Aspect 112] The oligomer compound for use according to any one of the prior embodiments, wherein the treatment reduces the fasting plasma Lp(a) concentration of the person by at least 85%, when the fasting plasma Lp(a) concentration of the person is measured at the start and end of the drug administration period. [Aspect 113] A pharmaceutical composition comprising an oligomer compound and one or more pharmaceutically acceptable carriers or diluents, wherein the oligomer compound is ISIS681257, and the pharmaceutical composition contains 125 mg or less of the oligomer compound. [Aspect 114] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 100 mg or less of the oligomer compound. [Aspect 115] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 75 mg or less of the oligomer compound. [Aspect 116] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 60 mg or less of the oligomer compound. [Aspect 117] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 50 mg or less of the oligomer compound. [Aspect 118] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 40 mg or less of the oligomer compound. [Aspect 119] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 30 mg or less of the oligomer compound. [Aspect 120] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 25 mg or less of the oligomer compound. [Aspect 121] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 20 mg or less of the oligomer compound. [Aspect 122] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 15 mg or less of the oligomer compound. [Aspect 123] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 10 mg or less of the oligomer compound. [Aspect 124] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 5 mg or less of the oligomer compound. [Aspect 125] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 1 mg or more of the oligomer compound. [Aspect 126] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 2.5 mg or more of the oligomer compound. [Aspect 127] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 5 mg or more of the oligomer compound. [Aspect 128] The pharmaceutical composition according to aspect 113, wherein the pharmaceutical composition contains 10 mg or more of the oligomer compound. [Aspect 129] The pharmaceutical composition according to aspect 113, wherein the composition comprises 75 mg to 85 mg, optionally 80 mg, of the oligomer compound. [Aspect 130] The pharmaceutical composition according to aspect 113, wherein the composition comprises 55 mg to 65 mg, optionally 60 mg, of the oligomer compound. [Aspect 131] The pharmaceutical composition according to aspect 113, wherein the composition comprises 35 mg to 45 mg, optionally 40 mg, of the oligomer compound. [Aspect 132] The pharmaceutical composition according to aspect 113, wherein the composition comprises 25 mg to 35 mg, optionally 30 mg, of the oligomer compound. [Aspect 133] The pharmaceutical composition according to aspect 113, wherein the composition comprises 15 mg to 25 mg, optionally 20 mg, of the oligomer compound. [Aspect 134] The pharmaceutical composition according to aspect 113, wherein the composition comprises 5 mg to 15 mg, optionally 10 mg, of the oligomer compound. [Aspect 135] The pharmaceutical composition according to any one of aspects 113 to 134, wherein the composition is formulated for administration to humans by injection. [Aspect 136] The pharmaceutical composition according to aspect 135, wherein the oligomer compound is formulated with a sterile solution, and the composition is optionally not greater than 1 mL of the sterile solution. [Aspect 137] The pharmaceutical composition according to aspect 135, wherein the amount of the pharmaceutical composition does not exceed 0.8 mL of the sterile solution. [Aspect 138] The pharmaceutical composition according to aspect 135, wherein the amount of the pharmaceutical composition does not exceed 0.5 mL of the sterile solution. [Aspect 139] The pharmaceutical composition according to aspect 135, wherein the amount of the pharmaceutical composition does not exceed 0.4 mL of the sterile solution. [Aspect 140] The pharmaceutical composition according to aspect 135, wherein the amount of the pharmaceutical composition does not exceed 0.25 mL of the sterile solution. [Aspect 141] The pharmaceutical composition according to aspect 135, wherein the amount of the pharmaceutical composition does not exceed 0.2 mL of the sterile solution. [Aspect 142] The pharmaceutical composition according to any one of aspects 135 to 141, wherein the sterile solution is water. [Aspect 143] The pharmaceutical composition according to any one of aspects 135 to 141, wherein the sterile solution is water containing a sodium phosphate buffer. [Aspect 144] The pharmaceutical composition according to any one of embodiments 135 to 141, wherein the sterile solution is water containing a sodium phosphate buffer and sodium chloride. [Aspect 145] The pharmaceutical composition according to any one of aspects 113 to 144, wherein administration of the composition to a human reduces the fasting plasma Lp(a) concentration of the human by at least 50% when the fasting blood Lp(a) concentration of the human is measured at the start and end of the drug administration period. [Aspect 146] The pharmaceutical composition according to any one of aspects 113 to 144, wherein administration of the composition to a human reduces the fasting plasma Lp(a) concentration of the human by at least 75% when the fasting plasma Lp(a) concentration of the human is measured at the start and end of the drug administration period. [Aspect 147] The pharmaceutical composition according to any one of aspects 113 to 144, wherein administration of the composition to a human reduces the fasting plasma Lp(a) concentration of the human by at least 80% when the fasting plasma Lp(a) concentration of the human is measured at the start and end of the drug administration period. [Aspect 148] The pharmaceutical composition according to any one of aspects 113 to 144, wherein administration of the composition to a human reduces the fasting plasma Lp(a) concentration of the human by at least 85% when the fasting plasma Lp(a) concentration of the human is measured at the start and end of the drug administration period. [Aspect 149] A method for producing a pharmaceutical composition according to any one of aspects 113 to 148, comprising combining 125 mg or less of the oligomer compound with one or more pharmaceutically acceptable diluents, excipients, or carriers. [Aspect 150] A packaged pharmaceutical product comprising (a) a plurality of unit dosage forms each containing a pharmaceutical composition according to any one of aspects 113 to 148, and (b) printed instructions describing the administration of the unit dosage forms for treatment according to any one of aspects 1 to 112. [Aspect 151] A sterile sealed container containing the pharmaceutical composition described in any one of aspects 113 to 148. [Aspect 152] The sterile container according to aspect 151, wherein the container is a vial. [Aspect 153] The sterile container according to aspect 151, wherein the container is a syringe. [Aspect 154] A packaged pharmaceutical product comprising (a) a plurality of unit dosage forms, each contained in a sealed sterile container as described in any one of aspects 151 to 153, and (b) printed instructions describing the administration of the unit dosage forms for treatment as described in any one of aspects 1 to 112. [Aspect 155] A method for treating a disease or condition in a human, comprising administering to a human being 500 mg or less of an oligomer compound during the drug administration period, wherein the oligomer compound is ISIS681257. [Aspect 156] The method according to aspect 114, comprising the treatment described in any one of aspects 1 to 112. [Aspect 157] Use of ISIS681257 in the manufacture of a pharmaceutical composition according to any one of aspects 113 to 148, a packaged pharmaceutical composition according to aspect 150 or 154, or a sterile sealed container according to any one of aspects 151 to 153.

Claims

1. A composition comprising an oligomeric compound or a pharmaceutically acceptable salt thereof for treating or preventing conditions associated with elevated levels of apolipoprotein (a) (apo(a)) and / or lipoprotein (a) (Lp(a)) in humans, (i) The oligomer compound has the following structure: 【Chemistry 1】 A composition comprising, (ii) the treatment or prophylaxis comprising administering to a human being a unit dose of 75 mg to 85 mg of the oligomer compound or a pharmaceutically acceptable salt thereof, wherein the unit dose is administered once a month or once every four weeks.

2. The composition according to claim 1, wherein the unit dose is 80 mg administered once a month or once every four weeks.

3. The composition according to claim 1 or 2, wherein the oligomer compound is administered as a sodium salt.

4. The composition according to any one of claims 1 to 3, wherein the human is at high risk of cardiovascular events resulting from chronically elevated plasma Lp(a) levels.

5. The composition according to any one of claims 1 to 4, wherein the aforementioned pathological condition is selected from one or more symptoms of cardiovascular disease or cardiovascular disorder associated with elevated Lp(a), elevated cardiovascular risk associated with elevated Lp(a), recurrence of cardiovascular events associated with elevated Lp(a), or elevated Lp(a).

6. The composition according to any one of claims 1 to 5, wherein the oligomer compound is administered to the human by injection.

7. The composition according to claim 6, wherein the oligomer compound is administered to the human by subcutaneous injection.

8. The composition according to claim 6, wherein the oligomer compound is formulated with a sterile solution, and optionally, each unit dose of the oligomer compound does not exceed 1 mL of the sterile solution.

9. The composition according to claim 8, wherein each unit dose of the oligomer compound does not exceed 0.8 mL of the sterile solution.

10. The composition according to claim 8, wherein each unit dose of the oligomer compound does not exceed 0.5 mL of the sterile solution.

11. The composition according to claim 8, wherein each unit dose of the oligomer compound does not exceed 0.4 mL of the sterile solution.

12. The composition according to claim 8, wherein each unit dose of the oligomer compound does not exceed 0.25 mL of the sterile solution.

13. The composition according to claim 8, wherein each unit dose of the oligomer compound does not exceed 0.2 mL of the sterile solution.

14. a) The sterile solution is water. b) The sterile solution is a physiologically compatible buffer solution. c) The sterile solution is water containing a sodium phosphate buffer, or d) The sterile solution is water containing a sodium phosphate buffer and sodium chloride. The composition according to claim 8.

15. The composition according to any one of claims 1 to 14, wherein the treatment or prevention reduces the fasting plasma Lp(a) concentration of a human by at least 50% when the fasting plasma Lp(a) concentration of the human is measured at the beginning and end of the drug administration period.

16. The oligomer compound has the following structure: 【Chemistry 2】 The composition according to claim 3, having the following characteristics.

Citation Information

Patent Citations

  • COMPOSITIONS AND METHODS FOR MODULATING APOLIPOPROTEIN (a) EXPRESSION

    WO2014179625A1