Spatiotemporal control of genomics and epigenomics by ultrasound

WO2024249770A3PCT designated stage expired Publication Date: 2025-05-30UNIV OF SOUTHERN CALIFORNIA
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
PCT/US2024/031876
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-06-01
Filing Date
2024-05-31
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Current CRISPR technologies face challenges in achieving spatial control and deep tissue penetration for genomic and epigenomic reprogramming, particularly in clinical applications, due to limitations in controllability, immunogenicity, and off-target effects, especially when used in combination with chimeric antigen receptor therapies for cancer treatment.

Method used

Development of heat-inducible gene editing systems that include a nucleotide sequence encoding a heat-sensitive promoter, a CRISPR-associated nuclease or its mutant form, and a guide RNA, which can be activated using ultrasound or heat stimulation, without the need for inorganic nanoparticles or polycationic polymers, allowing for precise and controlled gene editing and epigenetic modulation.

Benefits of technology

The system enables efficient and reversible modulation of gene expression, with up to 11-fold activation or 40-day repression of target genes, and has shown enhanced efficacy in treating tumors by priming them for CAR-T cell killing, demonstrating improved spatial and temporal control over existing methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024031876_30052025_PF_FP_ABST
    Figure US2024031876_30052025_PF_FP_ABST
Patent Text Reader

Abstract

We have engineered a set of CRISPR activation / interference (a / i) tools containing heat-sensitive genetic modules controllable by focused ultrasound (FUS) for the regulation of genome and epigenome in live cells and animals. We demonstrated the capabilities of FUS-inducible CRISPRa, CRISPRi, and CRISPR (FUS-CRISPR(a / i)) to upregulate, repress, and knockout exogenous and / or endogenous genes, respectively, in different cell types. We further targeted FUS-CRISPR to telomeres in tumor cells to induce telomere disruption, inhibiting tumor growth and enhancing tumor susceptibility to killing by chimeric antigen receptor (CAR)-T cells. FUS-CRISPR-mediated telomere disruption for tumor priming combined with CAR-T therapy demonstrated improved therapeutic effects in xenograft mouse models. The FUS-CRISPR(a / i) toolbox allows the remote, noninvasive, and spatiotemporal control of genomic and epigenomic reprogramming in vivo, with extended applications in cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

SPATIOTEMPORAL CONTROL OF GENOMICS AND EPIGENOMICS BYULTRASOUNDCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application includes a claim of priority under 35 U.S.C. §119(e) to U.S. provisional patent application No. 63 / 470,274, filed June 1, 2023, the entirety of which is hereby incorporated by reference.REFERENCE TO SEQUENCE LISTING

[0002] This application contains a Sequence Listing submitted as a computer readable form named “065715_000157WOPT_SequenceListing.xml”, having a size in bytes of 51,250 bytes, and created on May 29, 2024. The information contained in this computer readable form is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0003] This invention was made with government support under grant no. CA262815, EB029122, GM140929, HD107206, and HL121365 awarded by the (NIH) National Institutes of Health. The government has certain rights in the invention.FIELD OF INVENTION

[0004] This invention relates to acoustically / thermo-responsive CRISPR systems for gene activation, repression, and / or silencing for treatment of disease and / or improving efficacy of other therapies.BACKGROUND

[0005] The emergence of CRISPR technology has revolutionized numerous aspects of life science and medicine. With a single guide RNA (sgRNA), the Cas9 nuclease can be targeted to, in principle, any accessible genomic locus next to a protospacer adjacent motif (PAM) to cause site-specific double-strand break (DSB), providing a powerful way of editing endogenous genome and ultimately the phenotypes of organisms. The subsequent development of CRISPR / Cas9-mediated transcriptional activation (CRISPRa) and CRISPRi with nuclease-dead Cas9 (dCas9) further allowed for transcriptional and epigenetic modifications of endogenous loci, demonstrating the power of CRISPR in regulating the genome at different levels. As the CRISPR-based technologies advanced to translational applications and clinical trials, safety / controllability has become one of the major concerns, mainly due to the immunogenicity of Cas9-related proteins and their off-target effects accumulated during long-time expression in the cells.

[0006] To address this, controllable CRISPR systems utilizing small molecules, light, or heat as external cues for induction have been developed. Small-molecule-based systems can tightly control the time of action for CRISPR, but the diffusive characteristic of small molecules compromises the spatial precision. Light-based systems provide an elegant solution to control both the timing and location of CRISPR; however, it requires lightsensitive proteins which can be bulky and difficult to deliver, or possibly immunogenic due to their non-human origins. Also, the penetration depth of light with a maximum of millimeters limits its therapeutic applications particularly in tissues tens of centimeters deep. Heat-inducible CRISPR-dCas9 systems using near-infrared (NIR) and gold nanorods can only penetrate a maximum of a few centimeters due to NIR, and the clinical usage of gold nanorods is restricted.

[0007] Therefore it is an object of the present invention to provide systems and components for controllable CRISPR technologies with improved tissue penetration and spatial control in genomic and epigenomic reprogramming of cells for disease treatment.

[0008] It is another object of the present invention to provide treatment methods based on controllable CRISPR technologies that have improved tissue penetration, especially in combination with chimeric antigen receptor therapies in the treatment of cancer.

[0009] All publications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed invention, or that any publication specifically or implicitly referenced is prior art.SUMMARY OF THE INVENTION

[0010] The following embodiments and aspects thereof are described and illustrated in conjunction with compositions and methods which are meant to be exemplary and illustrative, not limiting in scope.

[0011] Various embodiments provide gene editing systems, preferably heat-inducible gene editing systems, which include:(i) a nucleotide sequence encoding a heat-sensitive promoter,(ii) a nucleotide sequence encoding a clustered regularly interspaced palindromic repeats (CRISPR)-associated (Cas) nuclease or a mutant form of the Cas nuclease lacking nuclease cleavage activity, and(iii) a nucleotide sequence encoding at least one guide RNA (gRNA) that hybridizes with a target sequence, wherein the nucleotide sequence encoding the heat-sensitive promoter is operably linked to the nucleotide sequence encoding the Cas endonuclease or the mutant form of the Cas endonuclease, or is operably linked to the nucleotide sequence encoding the at least one gRNA.

[0012] In various embodiments, the heat-inducible gene editing system does not include an inorganic nanoparticle, optionally the inorganic nanoparticle comprising gold nanorod, and is not complexed with a polycationic polymer or a semiconducting polymer.

[0013] In some embodiments, a gene editing system further includes an ultrasonography system. In some embodiments, an ultrasonography system includes one or more of an ultrasound transducer, an acoustic gel, a thermocouple, a thermometer, and a controller.

[0014] In some embodiments, a gene editing system further includes: a polynucleotide sequence encoding a first ligand, wherein the first ligand is not a naturally-occurring ligand for Notch receptor; and a polynucleotide sequence encoding a synthetic Notch receptor, wherein the synthetic Notch receptor specifically binds the first ligand and effectuates release of a regulatory protein comprising Gal4, and a polynucleotide sequence encoding a chimeric antigen receptor whose expression is driven by a promoter with an upstream activation sequence (UAS) specifically activatable by binding of the Gal4, wherein the synthetic Notch receptor comprises a) an extracellular domain that specifically binds the first ligand, b) a Notch regulatory region comprising a ligand-inducible proteolytic cleavage site, and c) an intracellular domain comprising the Gal4, or a T cell or NK cell engineered with the synthetic Notch receptor and the chimeric antigen receptor.

[0015] In some embodiments, the nucleotide sequence of (ii) encodes the Cas endonuclease comprising Cas9, Cas 12a, or Casl3.

[0016] In some embodiments, the nucleotide sequence of (ii) encodes the mutant form of the Cas endonuclease comprising endonuclease deficient Cas9 (dCas9), endonuclease deficient Casl2a (dCasl2a), or endonuclease deficient Casl3 (dCasl3).

[0017] In some embodiments, a gene editing system includes (i), (ii), (iii) and:(iv) a nucleotide sequence encoding a transcriptional activator or (v) a nucleotide sequence encoding an epigenetic regulator or a transcriptional repressor; and optionally(vi) a nucleotide sequence encoding a multimerized epitope and (vii) a nucleotide sequence encoding an affinity domain that specifically binds the epitope.

[0018] In some embodiments, the nucleotide sequence encoding the multimerized epitope, when present, is operably linked to the nucleotide sequence encoding the mutant form of the Cas endonuclease, thereby the multimerized epitope and the mutant form of the Cas endonuclease being expressible as a first fusion protein. In some embodiments, the nucleotide sequence encoding the affinity domain, when present, is operably linked to the nucleotide sequence encoding the epigenetic regulator or transcriptional repressor or the nucleotide sequence encoding the transcriptional activator, thereby the affinity domain and the epigenetic regulator, the transcriptional repressor, or the transcriptional activator being expressible as a second fusion protein.

[0019] In some embodiments, the nucleotide sequence of (i) is operably linked to the nucleotide sequence of (iii), such that the gRNA is driven by the heat-sensitive promoter; and wherein the nucleotide sequence of (iii) encodes the gRNA flanked by a hammerhead (HH) ribozyme and a hepatitis delta virus (HDV) ribozymes.

[0020] In some embodiments, the nucleotide sequence of (i) is operably linked to the nucleotide sequence of (ii), such that the Cas endonuclease is driven by the heat-sensitive promoter.

[0021] In some embodiments, the nucleotide sequence of (i) is operably linked to the nucleotide sequence of (ii), wherein the nucleotide sequence of (ii) encodes the mutant form of the Cas endonuclease, such that the mutant form of the Cas endonuclease is driven by the heat-sensitive promoter.

[0022] In some embodiments, the at least one gRNA targets telomere and optionally has a nucleic acid sequence of SEQ ID NO:21 or at least 95% or 90% identity to SEQ ID NO:21, or the target sequence comprises repetitive telomere sequence.

[0023] In some embodiments, the heat-sensitive promoter is a mammalian or human promoter operably linked to a heat-shock element (HSE). In some embodiments, an HSE has two or more (optionally 2-7) repeats of 5’-nGAAnnTTCnnGAAn-3’. In some embodiments, the mammalian or human promoter being HSPA1A, HSPH1, HSPB1, or a synthetic promoter YB-TATA.

[0024] In some embodiments, the heat-sensitive promoter comprises human heatshock protein 70 (HSP70) promoter or a 7H-YB promoter, wherein the 7H-YB promoter comprises 7 repeats of a heat-shock element (HSE) operably linked to and upstream of YB- TATA promoter.

[0025] In some embodiments, the transcriptional factor comprises a polypeptide comprising multiple repeats of Herpes simplex virus protein 16 (VP 16) transactivation domain.

[0026] In some embodiments, the epigenetic regulator comprises DNMT3A3L, DNMT3 A, or a mutant thereof.

[0027] Various embodiments provide methods for remotely-modulating and / or non- invasively modulating gene expression in a cell, which include: introducing a gene editing system disclosed herein to the cell for expression therein, and stimulating the cell with ultrasound or heat, thereby activating the heat-sensitive promoter for expression of its operably linked nucleotide sequence.

[0028] In some embodiments, the stimulation is with ultrasound. In some embodiments, the method further includes inserting a thermocouple to or near the cell to monitor temperature at or near the cell, and optionally temperature reading being fed to a controller to control intensity of the ultrasound.

[0029] In various implementations, the method utilizing a gene editing system comprising transcription activator(s) fused or linked to deactivated Cas nuclease results in or is effective for increasing a gene expression by at least 5, 6, 7, 8, 9, 10, or 11-fold compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation.

[0030] In various implementations, the method utilizing a gene editing system comprising a repressor fused or linked to deactivated Cas nuclease and / or comprising catalytic Cas nuclease results in or is effective for repressing a gene expression for at least 1, 5, 10, 20, 30, or 40 days. In preferable embodiment, the repression is reversible.

[0031] In some embodiments, the stimulation comprises increasing temperature by 3°C-7°C or to about 39°C-44°C.

[0032] Various embodiments provide methods for treating a subject having a tumor, and the methods include: introducing to a tumor cell of the subject a gene editing system comprising gRNA that targets telomere for expression therein, and stimulating the tumor cell with ultrasound or heat, thereby activating the heat-sensitive promoter for expression of its operably linked nucleotide sequence. In some embodiments, the subject has received a chimeric antigen receptor (CAR)-engineered immune cell (optionally T cell) therapy against the tumor. In some embodiment, the treatment method further comprises administering to the subject the CAR-engineered immune cell.

[0033] In some embodiments of treatment methods, the gene editing system further includes a polynucleotide sequence encoding a first cell-surface ligand that is not a naturally- occurring ligand for Notch receptor; wherein the CAR-engineered immune cell further expresses a synthetic Notch receptor, wherein the synthetic Notch receptor is configured for specifically binding the first ligand and releasing intracellularly a regulator protein comprising Gal4; wherein nucleotide sequence encoding the CAR contains an upstream activation sequence (UAS) which is activated upon binding of the regulatory protein comprising the Gal4; and wherein the method further comprises expressing the first ligand on the tumor cell surface, thereby inducing expression of the CAR in the immune cell, so as to inhibit or reduce the tumor in the subject.

[0034] In some embodiments, the introduction of the gene editing system to the tumor cell comprises delivery of the gene editing system via an adeno-associated virus.

[0035] Genetically engineered cells are also provided, which has been transduced or introduced with any gene editing system disclosed herein.

[0036] Expression vehicles, recombinantly engineered viruses, or vectors are also provided, which contain one or multiple transcripts from a gene editing system disclosed herein.

[0037] Other features and advantages of the invention will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, which illustrate, by way of example, various features of embodiments of the invention.BRIEF DESCRIPTION OF THE FIGURES

[0038] Exemplary embodiments are illustrated in referenced figures. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than restrictive.

[0039] Figures 1A-1H. FUS-CRISPRa allows for inducible upregulation of exogenous and endogenous genes. FIG. 1A, Schematic illustration of the FUS-CRISPRa system. FIG. IB, Normalized Flue luminescence in cells engineered with Pl-targeting FUS- CRISPRa and Pl -driven Flue quantified 24 h after different durations of heat shock (HS). Readings were normalized to the non-heated control (CT) group. FIG. 1C, Left, schematic illustration of FUS stimulation of cells in vitro; Right, normalized Flue luminescence in cells engineered with Pl -targeting FUS-CRISPRa and Pl -driven Flue quantified 24 h after FUS. Readings were normalized to the FUS- group. FIG. ID, Cells engineered with Pl- and P2- targeting FUS-CRISPRa, Pl-EYFP, and P2-ECFP were imaged 24 h after HS. Scale bar = 30 pm. FIG. IE, Relative IL1B mRNA expression in HEK 293T cells engineered with hILIB-targeting FUS-CRISPRa, normalized to IL1B mRNA level in wild type (WT) HEK 293T cells. FIG. IF, Pro-ILIB protein expression in wild type (WT) cells or engineered cells in figure IE. FIG. 1G-1H, Relative IL1B (1G) or IFNP (1H) mRNA expression in RAW 264.7 cells engineered with FUS-CRISPRa targeting mouse IL1B (1G) or IFNP (1H) gene, normalized to the corresponding mRNA levels in WT RAW 264.7 cells. In figure IB, CT, control, without HS; data are technical triplicates representative of three independent experiments. In figure 1C, FUS+, with 20 min FUS stimulation at 43 °C; FUS-, without FUS stimulation; n = 3 biological replicates. In figures 1D-1H, HS, with 30 min HS; CT, without HS. In IE, 1G and 1H, bar heights represent means; error bars represent s.e.m.; n = 3 technical replicates representative of two individual experiments. Unpaired t test was used in 1C, two-way ANOVA followed by Sidak’s multiple comparisons test was used in IB, IE, 1G and 1H.

[0040] Figures 2A-2H FUS-CRISPRi -mediated inducible suppression of endogenous genes. FIG. 2A, Schematic illustration of the FUS-CRISPRi system. FIG. 2B- 2C Representative flow cytometry data of CD81 (2B) or CXCR4 (2C) expression in FUS- CRISPRi-engineered lurkat cells with gRNA targeting CD81 (2B) or CXCR4 (2C), or with non-targeting (NT) gRNA. The cells were stained with anti-CD81 (2B) or anti-CXCR4 (2C) antibody four days after HS. FIG. 2D, Relative CD81 mRNA expression 3 or 9 days after HS in cells in 2B. FIG. 2E, Relative CXCR4 mRNA expression in cells in 2C. FIG. 2F, Percentage of CXCR4+ cells in Nalm6 cells engineered with CXCR4-targeting or NT FUS- CRISPRi with DNMT mutant with different treatments. FIG. 2G, Kinetics of CXCR4 expression in cells engineered with CXCR4-targeting FUS-CRISPRi. FIG. 2H, The migration ability (%) of the engineered FUS-CRISPRi Nalm6 cells in a transwell assay. In figures 2B-2H, HS, with 20 min HS; CT, without HS. In 2F, FUS+; with 20 min FUS stimulation at 43 °C on cells in vitro. In 2D-2E, bar heights represent means of technical triplicates representative of two individual experiments. In 2H, bar heights represent means of biological triplicates. Error bars represent s.e.m. Two-way ANOVA followed by Sidak’s multiple comparisons test was used for statistical analysis.

[0041] Figures 3A-3H. FUS-CRISPR-mediated knockout of target genes. FIG. 3A, Schematic illustration of the FUS-CRISPR system. FIG. 3B, Heat-inducible Cas9 expression represented by eGFP signal under flow cytometry in engineered lurkat cells. FIG. 3C, Knockout efficiencies in lurkat cells engineered with FUS-CRISPR targeting CD3D or Zap70 quantified four days after HS. N = 4 and 6 biological replicates for CD3D and Zap70, respectively. FIG. 3D, CD69 staining of WT or FUS-CRISPR-engineered lurkat cells afterTCR stimulation. FIG. 3E, The all-in-one FUS-CRISPR plasmid. FIG. 3F, Percentage of CD81+ cells (left) and the representative flow cytometry profile (right) in U-87 MG cells engineered with CD81 -targeting FUS-CRISPR quantified 8 days after HS. FIG. 3G, Knockout efficiencies in Nalm6 cells engineered with FUS-CRISPR with different gRNAs targeting PLK1 gene, quantified four days after HS. FIG. 3H, Normalized cell number of the cells in figure 3G on Day 4 after HS. Cell number was normalized to Day 0. In figures 3C, 3D and 3F, HS, with 20 min HS; CT, without HS. In 3G and 3H, HS, with 15 min HS; CT, without HS. Bar heights represent means; error bars represent s.e.m. In 3F and 3G, n = 3 biological replicates. In 3H, n = 3 technical replicates representative of two independent experiments. Unpaired t test was used in 3F, two-way ANOVA followed by Sidak’s multiple comparisons test was used in 3C, 3G and 3H.

[0042] Figures 4A-4H. FUS-CRISPR-mediated telomere disruption can inhibit tumour cell growth and its resistance to CAR-T cell killing. FIG. 4A, Nuclear distribution of tagBFP-TRF2 and HaloTag-53BPl in FUS-CRISPR-engineered HEK 293T cells with telomere-targeting gRNA or non-targeting (NT) gRNA. HS, with 30 min HS; CT, without HS. Right, enlarged image merging TRF2 and 53BP1 signals. Scale bar = 10 pm. FIG. 4B, Normalized cell number of FUS-CRISPR-engineered Nalm6 cells with telomere-targeting gRNA or NT gRNA two (D2) or four (D4) days after HS. Cell number was normalized to Day 0. N = 4 biological replicates. FIG. 4C, Heat-map of differential gene expression in Nalm6 cells engineered with telomere-targeting or NT FUS-CRISPR at 24, 48, or 96 h after HS. FIG. 4D, The top three enriched GO terms in the HS group compared to the CT group in the telomere-targeting FUS-CRISPR cells in figure 4C. FIG. 4E, Volcano plot showing the downregulated (blue) and upregulated (red) genes between HS and CT groups in the telomere-targeting FUS-CRISPR cells in 4C. FIG. 4F, Schematic illustration of CAR-T cell attack on tumour cells. FIG. 4G, Survival (%) of FUS-CRISPR-engineered Nalm6 tumour cells 72 h after culture with (w / T) or without (w / o T) aCD19CAR-T cells in the luciferasebased cytotoxicity assay. The survival (%) was normalized to CT, w / o T group. FIG. 4H, Cytotoxicity (%) of CAR-T cells in the co-culture groups (w / T) in 4G. The cytotoxicity (%) was quantified as 100% - Tumour survival (%). In 4G and 4H, n = 3 technical replicates. Data are representative of two independent experiments. In 4B, 4C, 4G and 4H, HS: with 10 min HS; CT, without HS. Bar heights represent means; error bars represent s.e.m. Two-way ANOVA followed by Sidak’s multiple comparisons test.

[0043] Figures 5A-5H FUS-CRISPR-mediated telomere disruption enhances the efficacy of CAR-T therapy in vivo. FIG. 5A, Timeline of FUS-CRISPR-mediated telomeredisruption experiment in NSG mice. FIG. 5B-5D, Tumour aggressiveness in the mice in a quantified by total flux of the tumour from BLI measurement (5B) and the tumour volume based on caliper measurement (5C). FIG. 5D, Survival curves of the tumour-bearing mice in 5 A. FIG. 5E, Experimental timeline of FUS-CRISPR combined with CAR-T therapy in NSG mice. FIG. 5F-5G, Tumour aggressiveness in the mice in 5E quantified by total flux of the tumour (5F), and the caliper-measured tumour volume (5G). FIG. 5H, Survival curves of the tumour-bearing mice in 4E. Data points represent means; error bands represent s.e.m.; n = 5 mice per group. Two-way ANOVA followed by Sidak’s multiple comparisons test was used in 5B, 5C, 5F, and 5G. Log-rank (Mantel-Cox) test was used in 5D and 5H.

[0044] Figures 6A-6G In vivo delivery and activation of FUS-CRISPR allows for synNotch CAR-T cell therapy. FIG. 6A, Schematic illustration of FUS-CRISPR-mediated synNotch CAR-T activation. Priming of synNotch CAR-T cells by FUS-CRISPR-induced tCD19 permits killing of PSMA+ PC3 cells. FIG. 6B, Principle of FUS-CRISPR-mediated tCD19 expression. The tCD19 gene is split by tandem repeated sequences flanking a Cas9 cutting site, which can be recombined into functional tCD19 after Cas9 cutting and singlestrand annealing (SSA). FIG. 6C, FUS-CRISPR-mediated tCD19 expression in PC3 cells quantified by anti-CD19 antibody staining. FIG. 6D, Cell death (%) of PC3 cells in 6C without (w / o T) or with (w / T) co-culture with aCD19-synNotch PSMACAR-T cells. FIG. 6E, Timeline of in vivo experiment in NSG mice. FIG. 6F, Tumour aggressiveness in the mice in 6E quantified by total flux of the tumour from BLI measurement. FIG. 6G, Survival curves of the tumour-bearing mice in 6E. In 6C-6D, CT: without HS; HS: with 15 min HS; n = 3 biological repeats. In 6E and 6F, FUS-: no FUS treatment. FUS+: 10 min FUS stimulation; n = 5 mice. Error bars and error bands represent s.e.m. Unpaired t test was used in 6C. Two-way ANOVA followed by Sidak’s multiple comparisons test was used in 6D and 6F. Log-rank (Mantel-Cox) test was used in 6G.

[0045] Figures 7A-7H. Design and validation of the FUS system. FIG. 7A, Schematics of the in- house built FUS system with closed-loop feedback for generation of localized hyperthermia at the target temperature. FIG. 7B-7C, Close-up (7B) and full shot (7C) of the experimental setup for FUS stimulation in vitro on cells. FIG. 7D-7E, Close-up (7D) and full shot (7E) of the experimental setup for FUS stimulation in vivo. FIG. 7F, FUS- induced hyperthermia at 43 °C for 10 min in vivo. FIG. 7G-7H, Quantified induction fold (7G) and representative images (7H) of FUS-induced Flue expression in mice bearing tumors engineered with Hsp-Fluc 6 h after 10 min FUS stimulation at 43 °C. Bar heights represent means; error bars represent s.e.m.; n = 3 mice; paired t test.

[0046] Figures 8A-8G. Additional figures associated with the FUS-CRISPRa system with the inducible gRNAs. FIG. 8A, DNA constructs used in Fig. IB and 1C. FIG. 8B, In vivo activation of CRISPRa by FUS. Left, schematic illustration of FUS stimulation in vivo. Right, HEK 293T cells transfected with the plasmids in 8A were subcutaneously injected into both sides of NSG mice, followed by FUS stimulation (43 °C, 15 min) 6 h after at one side (FUS+). The other side received no FUS (FUS-). Flue luminescence of both sides was quantified immediately before and 24 h after FUS stimulation and normalized to the readings before FUS. N = 4 mice. Paired t test. FIG. 8C, DNA constructs used in Fig. ID. FIG. 8D, The piggyBac (PB) transposon plasmid used in Fig. 1E-1H. Each target gene used a different sgRNA. FIG. 8E, Relative hILIB mRNA levels in non-engineered (wild type, WT) HEK 293T cells without HS (CT), or at different time points after 30 min HS. N = 3 technical repeats. FIG. 8F-8G, Relative mlLIB (8F) and mIFNP (8G) mRNA levels in WT RAW 264.7 cells without HS (CT), or at different time points after 30 min HS. N = 2 technical repeats. Data are representative of two independent experiments.

[0047] Figures 9A-9C. Gene repression with CRISPRoff. FIG. 9A, The “CRISPRoff’ plasmid used in this figure constructed based on the original CRISPRoff-v2.1 (Addgene plasmid #167981). FIG. 9B, Relative mRNA expression of target genes in different cell types engineered with Hsp-RGR and CRISPRoff. FIG. 9C, Relative mRNA expression of target genes in different cell types engineered with constitutive gRNA and CRISPRoff three days after transfection. In 9B-9C, bar heights represent means; error bars represent s.e.m.; n = 3 technical repeats. Data are representative of two independent experiments. Two- way ANOVA followed by Sidak’s multiple comparisons test was used for statistical analysis.

[0048] Figures 10A-10E. Inducible gene expression controlled by heat-sensitive promoters Hsp and 7H-YB. FIG. 10A, The general gating strategy for flow cytometry. FIG. 10B, Schematics of the Hsp- or 7H-YB-driven eGFP with constitutive mCherry constructs used in this figure. FIG. 10C, Representative flow cytometry data showing gene infection profile of Jurkat cells engineered with Hsp- or 7H-YB- driven constructs in 10B. The same mCherry+cell gate was used in both groups for eGFP expression analysis. FIG. 10D-10E, The percentage of eGFP+cells (10D) and the mean eGFP fluorescence intensity (10E) of the above-described engineered Jurkat cells. Cells were treated with no HS (CT), or HS of 10 min (HS10), 15 min (HS15), and 20 min (HS20) and analyzed by flow cytometry 24 h after HS. Bar heights represent means; error bars represent s.e.m.; n = 3 technical replicates representative of two independent experiments. Two-way ANOVA followed by Sidak’s multiple comparisons test was used for statistical analysis.

[0049] Figures 11A-11D. Gene repression in Nalm6 cells engineered with FUS- CRISPRi targeting CD81 or CXCR4. FIG. 11A, The FUS-CRISPRi constructs. FIG. 11B-11C, Representative staining results of CD81 (11B) or CXCR4 (11C) in the engineered Nalm6 cells four days after HS. FIG. 11D, Relative CD81 and CXCR4 mRNA expression in cells in 1 IB and 11C quantified three days after HS. HS, with 15 min of HS; CT, without HS. In 1 ID, bar heights represent means; error bars represent s.e.m.; n = 3 technical replicates. Data are representative of two individual experiments. Two-way ANOVA followed by Sidak’s multiple comparisons test was used for statistical analysis.

[0050] Figures 12A-12C. Reversible gene repression via FUS-CRISPRi. FIG. 12A, Schematics of FUS-CRISPRi using the R887E mutant DNMT. FIG. 12B, Flow cytometry profile of CXCR4 staining in cells engineered with FUS-CRISPRi targeting CXCR4 at different time points after HS. FIG. 12C, Bisulfite-sequencing analysis of CpG methylation in CXCR4-targeting FUS-CRISPRi Nalm6 cells performed using QUMA (Methods). HS, with 20 min HS; CT, without HS.

[0051] Figures 13A-13E. The SunTag-based FUS-CRISPRa system. FIG. 13A-13B Schematic illustration (13A) and DNA constructs (13B) of the SunTag-based FUS-CRISPRa system with the inducible dCas9. FIG. 13C, DNA construct containing a constitutive Pltargeting gRNAl and the Pl -driven Flue. FIG. 13D, Normalized Flue luminescence in multiple cells lines engineered with the lentiviruses encoding the plasmids in 13B and 13C. Readings were quantified 48 h after HS or FUS stimulation and normalized to the corresponding engineered cell lines without HS (CT). HS, with 20 min HS; FUS+, 20 min FUS stimulation in vitro on cells. N = 3 biological repeats. FIG. 13E, U-87 MG cell line engineered with the Pl-targeting FUS-CRISPRa system in 13B and 13C were subcutaneously injected into both sides of NSG mice, followed by FUS stimulation (43 °C, 20 min) 5 days later at one side (FUS+). The other side received no FUS (FUS-). Flue luminescence of both sides was quantified immediately before and 48 h after FUS stimulation and normalized to the readings before FUS. N = 4 mice. Unpaired t test was used in 13D, paired t test was used in 13E.

[0052] Figures 14A-14E. Constructs used in the FUS-CRISPR system. FIG. 14A-14B, “Two-plasmid” design of the FUS-CRISPR system with Hsp (14A) or 7H-YB (14B) and different arrangement of marker fluorescent proteins. FIG. 14C, T7E1 verification of PLK1 KO in Nalm6 cells engineered with PLK1 -targeting FUS-CRISPR. FIG. 14D, The “all-in- one” construct used for FUS-CRISPR targeting PLK1 gene. FIG. 14E, DNA constructs for FUS-CRISPR with telomere-targeting gRNA or NT gRNA.

[0053] Figure 15. Venn diagram summarizing the differentially expressed genes in the illustrated three groups of comparisons from the RNA-seq data.

[0054] Figures 16A-16C. Anti-CD19 CAR-T cells. FIG. 16A, The anti-CD19 (aCD19) CAR plasmid. FIG. 16B, Primary human T cells expressing the construct in 16A with membrane localization of eGFP. Scale bar = 10 pm. FIG. 16C, Representative eGFP expression profiles of WT primary human T cells and the aCD19CAR-T cells in 16B.

[0055] Figures 17A-17H. Control experiments related to Figure 5 using FUS-CRISPR with a non-targeting gRNA. FIG. 17A, Timeline of experiment in NSG mice. FIG. 17B-17C, Tumor aggressiveness in the mice in 17A quantified by total flux of the tumor from BLI measurement (17B) and the tumor volume based on caliper measurement (17C). FIG. 17D, Survival curves of the tumor-bearing mice in 17A. FIG. 17E, Experimental timeline of FUS- CRISPR with NT gRNA combined with CAR-T therapy in NSG mice. FIG. 17F-17G, Tumor aggressiveness in the mice in 17E quantified by total flux of the tumor (17F) and the caliper-measured tumor volume (17G). FIG. 17H, Survival curves of the tumor- bearing mice in 17E. Data points represent means; error bands represent s.e.m.; n = 5 mice per group. Two- way ANOVA followed by Sidak’s multiple comparisons test was used in 17B, 17C, 17F, and 17G. Log-rank (Mantel-Cox) test was used in 17D and 17H.

[0056] Figures 18A-18B. FUS-CRISPR-mediated synNotch CAR-T ceH activation. 18A, Lentiviral constructs used to generate anti-CD19 synNotch PSMACAR-T cells. 18B, FUS-CRISPR AAV constructs used to infect PC3 tumour cells for FUS- mediated telomere di srupti on and tCD 19 induction. SSA: single-strand annealing.DESCRIPTION OF THE INVENTION

[0057] All references cited herein are incorporated by reference in their entirety as though fully set forth. Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Singleton et al., Dictionary of Microbiology and Molecular Biology 3rded., Revised, J. Wiley & Sons (New York, NY 2006); and Sambrook and Russel, Molecular Cloning: A Laboratory Manual 4thed., Cold Spring Harbor Laboratory Press (Cold Spring Harbor, NY 2012), provide one skilled in the art with a general guide to many of the terms used in the present application. For references on how to prepare antibodies, see D. Lane, Antibodies: A Laboratory Manual 2nded. (Cold Spring Harbor Press, Cold Spring Harbor NY, 2013); Kohler and Milstein, (1976) Eur. J. Immunol. 6: 511; Queen et al. U. S. Patent No. 5,585,089; and Riechmann et al., Nature 332: 323 (1988); U.S. Pat. No. 4,946,778; Bird, Science 242:423-42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA85:5879-5883 (1988); Ward et al., Nature 334:544-54 (1989); Tomlinson I. and Holliger P. (2000) Methods Enzymol, 326, 461-479; Holliger P. (2005) Nat. Biotechnol. Sep;23(9): 1126- 36).

[0058] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Indeed, the present invention is in no way limited to the methods and materials described. For purposes of the present invention, the following terms are defined below.

[0059] A thermocouple, also known as a “thermoelectrical thermometer”, is an electrical device for measuring temperature, consisting of two dissimilar electrical conductors forming an electrical junction.

[0060] A controller, especially proportional-integral-derivative (PID) controller for use in an ultrasonography system, is an instrument for regulating temperature, flow, pressure, speed, or other process variables in a control system. PID controllers use a control loop feedback mechanism to control process variables; or to force feedback to match a setpoint.

[0061] In various embodiments, the CRISPR-associated (Cas) nuclease is an RNA- targeting effector protein. Exemplary CRISPR-Cas nucleases (or endonucleases) include Cas9, Cas 13 (including Cas 13 a, Cas 13b, Cas 13c), Cas 12 (including subtypes Cas 12a, Casl2b, Casl2c, Casl2g, Casl2h, Casl2i). In some embodiments, the Cas nuclease is or comprises Cas9. In other embodiments, the system and methods disclosed herein may use site-directed zinc finger nucleases (ZFNs) or TAL effector nucleases (TALENs) in replace of Cas nucleases.

[0062] In some embodiments, a mutant form of the Cas endonuclease has at least one nutation, such that it has no more than 5% of the nuclease activity of the wildtype Cas endonuclease. In some embodiments, a mutant form of the Cas endonuclease has a diminished nuclease activity by at least 97%, or 100% as compared with the Cas endonuclease not having the at least one mutation. In some embodiments, the Cas endonuclease (also called CRISPR enzyme) comprises two or more mutations wherein two or more of D10, E762, H840, N854, N863, or D986 according to SpCas9 protein or any corresponding or N580 according to SaCas9 protein ortholog are mutated, or the Cas endonuclease comprises at least one mutation wherein at least H840 is mutated. In further embodiments, the Cas endonuclease comprises two or more mutations comprising D10A, E762A, H840A, N854A, N863A or D986A according to SpCas9 protein or any corresponding ortholog, or N580A according to SaCas9 protein, or at least one mutation comprising H840A. In some embodiments, the Cas endonuclease comprises N580Aaccording to SaCas9 protein or any corresponding ortholog; or D10A according to SpCas9 protein, or any corresponding ortholog, and N580A according to SaCas9 protein.

[0063] In various embodiments, a mutant form of the Cas nuclease is catalytically inactive or nuclease-null. In some embodiments, a mutant form of the Cas nuclease ha a catalytic activity of no more than 5% compared to the Cas nuclease without the mutation.

[0064] In some embodiments, “dead Cas9” or “deactivated Cas9” (dCas9) is made by introducing a D10A point mutation into the RuvC nuclease domain and an H840A point mutation into the HNH nuclease domain of the wild-type Cas9 enzyme. The dCas9 has the ability to bind target DNA sequences similar to those of the wild-type Cas9; however, it cannot cleave DNA owing to the loss of its endonuclease cleavage activity. Thereby, dCas9 is an RNA-guided DNA binding protein where two catalytic domains of Cas9 nuclease have been inactivated. The dCas9 can be linked to various regulatory domains, such as an activator or repressor; and the linked-dCas9 is guided by the gRNA to identify the target sequence adjacent to the protospacer adjacent motif (PAM) by avoiding non-specific binding. For example, a dCas9 fused or linked to a transcription activation domain can target the promoter region of endogenous genes, thereby upregulating the endogenous loci.

[0065] In other embodiments, a mutant form of the Cas nuclease is catalytically inactive Casl2 (dCasl2) In one example embodiment, the dCasl2 is a dCasl2b or a dCasl2a, optionally Bacillus hisahii Casl2b.

[0066] The phrase “guide RNA” is also called guide CRISPR RNA (crRNA). In various embodiments, the guide RNA is designed to detect protospacer adjacent motif (PAM) or the equivalent for a target RNA or DNA. The protospacer adjacent motif (PAM) or PAM-like motif directs binding of the CRISPR-associated nuclease / crRNA complex as disclosed herein to the target locus of interest. The term “PAM” may be used interchangeably with the term “PFS” or “protospacer flanking site” or “protospacer flanking sequence”. In other embodiments, the one or more guide RNAs are designed to detect a single nucleotide polymorphism, splice variant of a transcript, or a frameshift mutation in a target RNA or DNA. In further embodiments, the one or more guide RNAs are designed to bind to one or more target molecules that are diagnostic for a disease state.

[0067] In various embodiments, the phrase “target sequence” refers to a polynucleotide sequence to which a guide sequence is designed to have complementarity, where hybridization between a target sequence and a guide sequence promotes the formation of a CRISPR complex. A target sequence may comprise RNA polynucleotides. The term “target RNA” refers to an RNA polynucleotide being or comprising the target sequence. In otherwords, the target RNA may be a RNA polynucleotide or a part of a RNA polynucleotide to which a part of the gRNA, i.e. the guide sequence, is designed to have complementarity and to which the CRISPR-associated nuclease function is to be directed. In some embodiments, target sequence comprises a protospacer adjacent motif site, or a single nucleotide polymorphism, a splice variant or a frameshift mutation, of the predefined nucleic acid sequence.

[0068] “Regulatory domain / protein,” “effector domain / protein,” or “functional domain / protein” may be used interchangeably unless otherwise specified. In various embodiments, one or more functional domains have one or more activities comprising methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, DNA integration activity RNA cleavage activity, DNA cleavage activity or nucleic acid binding activity.

[0069] “Transcriptional activator,” “transcription activator,” “transcription-related factor,” “transcription factor,” or “transcription activation domain” may be used interchangeably unless otherwise noted, and refers to a protein that binds to specific parts of DNA using DNA binding domains and is part of the system that controls the transcription of genetic information from DNA to RNA. In some embodiments, a transcriptional activator comprises VP64, which is composed of four tandem copies of VP16 (Herpes Simplex Viral Protein 16, amino acids 437-447*: DALDDFDLDML (SEQ ID NO:50)) connected with glycine-serine (GS) linkers. Examples of human transcription factors are presented in Table 1 of U.S. Patent Application No. 2014 / 0308746, which is incorporated by reference in its entirety.

[0070] “Polynucleotide,” “polynucleotide sequence,” or “nucleic acid” may be used interchangeably unless otherwise specified, which includes but is not limited to DNA, RNA, cDNA (complementary DNA), mRNA (messenger RNA), rRNA (ribosomal RNA), shRNA (small hairpin RNA), snRNA (small nuclear RNA), snoRNA (short nucleolar RNA), miRNA (microRNA), genomic DNA, synthetic DNA, synthetic RNA, and / or tRNA.

[0071] “Single chain variable fragment”, “single-chain antibody variable fragments” or “scFv” antibodies refer to forms of antibodies comprising the variable regions of only the heavy and light chains, connected by a linker peptide.

[0072] “Vector”, “cloning vector” and “expression vector” as used herein refer to the vehicle by which a polynucleotide sequence (e.g. a foreign gene) can be introduced into ahost cell, so as to transform the host and promote expression (e.g. transcription and translation) of the introduced sequence. Vectors include plasmids, phages, viruses, etc.

[0073] Chimeric antigen receptor” or “CAR” or “CARs” as used herein refers to engineered receptors, which graft an antigen specificity onto cells (for example T cells such as naive T cells, central memory T cells, effector memory T cells or combination thereof). CARs are also known as artificial T-cell receptors, chimeric T-cell receptors or chimeric immunoreceptors. In various embodiments, a CAR comprises a ligand-binding (or antigenspecific targeting) region, an extracellular domain, a transmembrane domain, one or more costimulatory domains, and an intracellular signaling domain. Further description of CAR structures is provided in US Patent No. 9447, 194 and US Patent Application Publication No. US20230310601, which are incorporated by reference herein. “Ligand-binding region / domain” or “antigen-specific targeting region” refers to the region of a CAR which targets specific ligands or antigens; and it typically includes an antibody or a functional equivalent thereof or a fragment thereof or a derivative thereof. “Co-stimulatory domain” (CSD) refers to the portion of the CAR which enhances the proliferation, survival and / or development of memory cells; and exemplary CSD comprises the costimulatory domain of any one or more of, for example, members of the TNFR superfamily, CD28, CD137 (4-1BB), CD 134 (0X40), Dap 10, CD27, CD2, CD5, ICAM-1, LFA-1(CD1 la / CD18), Lek, TNFR-I, TNFR-II, Fas, CD30, CD40 or combinations thereof. “Extracellular spacer domain” (ESD) may be included in a CAR; and ESD refers to the hydrophilic region which is between the ligand-binding (or antigen-specific targeting) region and the transmembrane domain; and exemplary ESD comprises any one or more of (i) a hinge, CH2 and CH3 regions of IgG4, (ii) a hinge region of IgG4, (iii) a hinge and CH2 of IgG4, (iv) a hinge region of CD8a, (v) a hinge, CH2 and CH3 regions of IgGl, (vi) a hinge region of IgGl or (vi) a hinge and CH2 region of IgGl. “Intracellular signaling domain” (ISD) or “cytoplasmic domain” of a CAR transduces the effector function signal and directs the cell to perform its specialized function; and exemplary ISD include but are not limited to the chain of the T-cell receptor complex or any of its homologs (e.g., r| chain, FceRly and P chains, MB1 (Iga) chain, B29 (IgP) chain, etc.), human CD3 zeta chain, CD3 polypeptides (A, 8 and £), syk family tyrosine kinases (Syk, ZAP 70, etc.), sre family tyrosine kinases (Lek, Fyn, Lyn, etc.) and other molecules involved in T-cell transduction, such as CD2, CD5 and CD28. “Transmembrane domain” (TMD) of a CAR is the transmembrane region of a transmembrane protein (forexample Type I transmembrane proteins), an artificial hydrophobic sequence or a combination thereof.

[0074] The term “specifically binding,” or “selectively binding,” refers to the interaction between binding pairs. In some embodiments, the interaction has an affinity constant of at most 10'6moles / liter, at most 10'7moles / liter, or at most 10'8moles / liter. In other embodiments, the phrase “specifically binds” or “selectively binding” refers to the specific binding of one protein to another protein or ligand, wherein the level of binding is statistically significantly higher than the background control for the assay.

[0075] “Linker” (L) or “linker domain” or “linker region” as used herein refer to an oligo- or polypeptide region from about 1 to 100 amino acids in length, which links together any of the domains / regions of the CAR of the invention. Linkers may be composed of flexible residues like glycine and serine so that the adjacent protein domains are free to move relative to one another.

[0076] The terms, “patient”, “individual” and “subject” are used interchangeably herein. A “subject” means a human or animal. Usually the animal is a vertebrate such as a primate, rodent, domestic animal or game animal. In various embodiment, the subject is a human in the methods.

[0077] The phrase “disease, condition, or a (pathogenic) infection” refers to an infection, an organ disease, a blood disease, an immune system disease, a cancer, a brain and nervous system disease, an endocrine disease, a pregnancy or childbirth-related disease, an inherited disease, or an environmentally-acquired disease. In various embodiments, the disease state is cancer.

[0078] Cancer” and “cancerous” refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include, but are not limited to B-cell lymphomas (Hodgkin’s lymphomas and / or nonHodgkins lymphomas), brain tumor, breast cancer, colon cancer, lung cancer, hepatocellular cancer, gastric cancer, pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, cancer of the urinary tract, thyroid cancer, renal cancer, carcinoma, melanoma, head and neck cancer, brain cancer, and prostate cancer, including but not limited to androgen-dependent prostate cancer and androgen-independent prostate cancer.

[0079] “Immune cell” as used herein refers to the cells of the mammalian immune system including but not limited to antigen presenting cells, B-cells, basophils, cytotoxic T- cells, dendritic cells, eosinophils, granulocytes, helper T-cells, leukocytes, lymphocytes,macrophages, mast cells, memory cells, monocytes, natural killer cells, neutrophils, phagocytes, plasma cells and T-cells.

[0080] Focused ultrasound (FUS) can penetrate deep and directly induce localized hyperthermia without intermediate co-factors in biological tissues. In fact, it has been used for tissue ablation in patients at relatively high temperatures (>60 °C), and for controlling heat-sensitive transgene expression in vivo at mildly elevated temperatures (42 - 43 °C). We have previously developed FUS-inducible CAR (FUS-CAR)-T cells that can be sonogenetically activated by FUS for cancer therapy with reduced off-tumour toxi cities.

[0081] Herein we have conceived and demonstrated that FUS, with its penetration power and spatiotemporal precision, would allow the direct control of CRISPR without cofactors for genome editing and regulations at specific tissues and organs. Here, we have developed a set of acoustogenetics- and CRISPR-based tools that include FUS-inducible CRISPRa (FUS-CRISPRa), FUS-inducible CRISPRi (FUS-CRISPRi), and FUS-inducible CRISPR (FUS-CRISPR). We have shown that this FUS-CRISPR(a / i) toolbox can allow FUS-inducible genomic and epigenomic reprogramming in multiple cell types and in vivo for synergistic cancer immunotherapy.

[0082] In various embodiments, high-intensity focused ultrasound (HIFU) and / or focused ultrasound (FUS) is applied. FUS can generate localized and mild hyperthermia in biological tissues. The heat stress can be sensed by cells through the endogenous transcriptional activator heat shock factor (HSF). Upon heat stimulation, HSFs undergo trimerization and nuclear localization to bind to the heat shock elements (HSEs) located in the promoter region of the heat shock protein (HSP) gene, leading to the expression of HSP. We therefore utilized the HSP promoter (Hsp) in our genetic circuits to design inducible CRISPR systems.

[0083] In some embodiments, a gene editing system is provided, which includes CRISPR / dCas activator system made by fusing or linking dCas (e.g., dCas9 or dCasl2) to a transcription activator domain(s), such as VP64 or the like, allowing activation of guide RNA (gRNA)-targeted endogenous genes. In some embodiments, CRISPR / dCas9 activator system is made by fusing dCas9 “directly” to a transcription activator domain(s), such as VP64, i.e., polynucleic acid encoding dCas9 is operably linked (optionally via polynucleic acid encoding a nuclear localization signal) to polynucleic acid encoding the transcription activator domain(s), such that dCas9 and the transcription activator domain are in one fusion protein in transcription and expression, see e.g., FIG. 8A. In some embodiments, the CRISPR / dCas9 activator system is made by linking dCas9 “indirectly” to a transcription activator domain(s),i.e., via members of a binding pair - for example in FIG. 13A and 13B, polynucleic acid encoding dCas9 is operably linked to polynucleic acid encoding peptide of an amplification system such as SunTag, whereas polynucleic acid encoding the transcription activator domain(s) such as VP64 is operably linked to polynucleic acid encoding an antibody (fragment) against the SunTag, such as when expressed, dCas9 in a fusion protein with SunTag would bind to an anti-SunTag scFv that is in a fusion protein with VP64, thereby linking dCas9 with VP64 “indirectly”.

[0084] In some embodiments, a gene editing system is provided, which includes a CRISPR / dCas activator system comprising dCas (e.g., dCas9 or dCasl2) fused “directly” to a transcription activator domain(s), such as VP64 or the like, is driven under a constitutive promoter, whereas gRNA is driven by a heat sensitive promoter (preferably induced by ultrasound or focused ultrasound), e.g., see FIG. 1A and 8 A. In alternative further embodiments, a CRISPR / dCas9 activator system comprises dCas9 that is driven by a heat sensitive promoter (preferably induced by ultrasound or focused ultrasound), wherein gRNA is driven under a constitutive promoter. In yet further embodiments, a CRISPR / dCas9 activator system comprising dCas9 bound to a transcription activator domain (“indirectly”), wherein the dCas9 fused with an amplification system such as SunTag sequence is driven by a heat sensitive promoter, wherein the transcription activator domain fused with an antibody (such as scFv) recognizing the amplification system is driven under a constitutive promoter, and wherein the gRNA is also driven a constitutive promoter, e.g., see FIG. 13B and 13C.

[0085] In some embodiments, VP64 or the like refers to VP 16-based transcription activator, which include multiple (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 or more) repeats of the PADALDDFDLDML (SEQ ID NO:49) of the Herpes simplex virus protein 16 (VP16) transactivation domain. In some embodiments, the VP 16 repeats are linked by a short peptide linker, such as GlySer linker.

[0086] In some embodiments, a gene editing system is provided, which includes a CRISPR / dCas repressor system made by fusing, linking, or associating dCas (e.g., dCas9 or dCasl2) to a transcriptional repressor domain. Exemplary transcriptional repressor domains include but are not limited to a Kriippel-associated box (KRAB) domain, a NuE domain, a NcoR domain, a SID domain, or a SID4X domain. Further description of transcriptional repressor domains is provided in US Patent Application Publication No. US20150291966, which is hereby incorporated by reference in its entirety.

[0087] In some embodiments, a gene editing system is provided, which includes a CRISPR / dCas repressor system made by fusing or linking dCas to an epigenetic regulator,such as DNMT3A3L, DNMT3A and related partners, and mutant DNMT like DNMT3A(R887E)-3L. In preferable embodiments, a CRISPR / dCas9 repressor system comprising dCas9 bound to an epigenetic regulator domain (“indirectly”), wherein the dCas9 is fused to an amplification system such as SunTag sequence and is driven by a heat sensitive promoter, wherein the epigenetic regulator domain is fused with an antibody (such as scFv) recognizing the amplification system and is driven under a constitutive promoter, and wherein the gRNA is also driven a constitutive promoter, e.g., see FIG. 2A, 11 A and 12A.

[0088] In various embodiments, a CRISPR / endonuclease system such as CRISPR / Cas9 system comprises an endonuclease (such as Cas9) driven by a heat sensitive promoter, whereas gRNA is drive under a constitutive promoter, e.g., see FIG. 3A, 14A, or 14B and 14C.

[0089] CRISPR / dCas9-based activators can activate transcriptionally silenced genes after being guided by gene-specific gRNA(s). Exemplary dCas9-based activators include but are not limited to dCas9-VP64, VP64-dCas9-VP64, dCas9-VP64-Rta, and dCas9-VP192. In additional embodiments, protein tagging systems such as SunTag (dCas9-SunTag-VP64) and MS2-MCP (dCas9-VP64 + MCP-VP64) are also included to increase the number of VP64s at the same locus and enhance activation efficiency.

[0090] Additional transcriptional activators such as p65, Rta, and HSF1 can be fused to dCas9, dCasl2a, or dCasl3. In some embodiments, CRISPRa-VPR, synergistic activation mediator (SAM), SPH, and TREE systems have been developed by combining multiple transcriptional activators. For example in a CRISPRa-SAM system (including dCas9, MS2 helper, and gRNA), dCas9 is fused to the transcriptional activator VP64, complexes with the CRISPR guide RNA (gRNA); the stem- and tetra-loop sequences in the gRNA scaffold have been modified into minimal hairpin RNA aptamers, which selectively bind dimerized MS2 bacteriophage coat proteins; MS2 coat protein is fused to the p65 subunit of NF-kappaB and the activation domain of human heat-shock factor 1 (HSF1); and the guide RNA contains two aptamers, each capable of binding two MS2 coactivator proteins, effectively recruiting four coactivators for every CRISPR targeting activator complex. In some embodiments, a CRISPRa-SAM system is in one single transcript.

[0091] Transcriptional inducers can alternatively be fused to dCas9. For example, Cas9 can be fused to epigenetic modifiers such as p300, histone acetylase and Tetl, a CpG DNA demethylase.

[0092] In some embodiments, production of gRNA is driven by a heat shock promoter (RNA polymerase (RNAP) Il-dependent promoter). In some embodiments,production of the Cas nuclease or deactivated Cas nuclease is driven by a heat shock promoter.

[0093] Typically, RNAP II dependent promoters lead to extensive processing of transcripts, precluding their use for gRNA expression. However, incorporation of some ribozymes into RNA allows the generation of transcripts with precisely defined ends. Ribozymes are RNA molecules with catalytic activity, and catalysis occurs utilizing sequence specific interactions within the RNA molecule. For example, Hammerhead (HH) and hepatitis delta virus (HDV) ribozymes are small and mediate sequence-specific intramolecular RNA cleavage (cleavage of the RNA at the 3’ and 5’ end respectively). Therefore, in some embodiments, gRNA is in a sequence with artificial gene named RGR, which when transcribed under a heat sensitive promoter, generates an RNA molecule having ribozyme sequences at both ends of the designed gRNA, wherein primary transcripts of RGR undergo self-catalyzed cleavage to generate the desired gRNA. In some embodiments, gRNA is flanked by a hammerhead (HH) ribozyme at the 5’ end of the gRNA, and by a hepatitis delta virus (HDV) ribozyme at the 3’ end of the gRNA. In other embodiments, gRNA is flanked by nucleotide sequences encoding ribonuclease recognition sites. In further embodiments, the ribonuclease recognition sites are Cys4 ribonuclease recognition sites (e.g., from Pseudomonas aeruginosa). Examples of cis-acting ribozymes for use in accordance with the present disclosure include, without limitation, hammerhead (HH) ribozyme (see, e.g., Pley et al., 1994, incorporated by reference herein) and Hepatitis delta virus (HDV) ribozyme (see, e.g., Ferre-D'Amare et al., 1998, incorporated by reference herein). Examples of trans-acting ribozymes for use in accordance with the present disclosure include, without limitation, natural and artificial versions of the hairpin ribozymes found in the satellite RNA of tobacco ringspot virus (sTRSV), chicory yellow mottle virus (sCYMV) and arabis mosaic virus (sARMV). Further description of ribozyme flanking nucleic acids is provided in US Patent Application Publication no. US20170022499, which is incorporated herein by reference.

[0094] In some embodiments, a gene editing system comprises gRNA that has addition of protein-interacting RNA aptamer(s), e.g., wherein RNA sequence(s) that bind to adaptor protein(s) are inserted into selected region(s) of the gRNA. In some embodiments, addition of RNA aptamers facilitates recruitment of effector domains to the Cas (or dCas) complex. In some embodiments, each adaptor protein is linked or fused (optionally via a linker such as a GlySer linker) to one or more regulatory domain (e.g., transcription activation domains, or transcriptional repressor domain). In some embodiments, RNAaptamers are inserted at one or more of tetraloop stem-loop 2 loop(s) of the gRNA. Studies have shown that substitutions and deletions in the tetraloop and stem-loop 2 regions of the sgRNA sequence do not affect Cas9 catalytic function. In some embodiments, an RNA aptamer comprises a minimal hairpin aptamer, which selectively binds dimerized MS2 bacteriophage coat proteins in mammalian cells; and MS2-mediated recruitment of VP64 or the like to the tetraloop and / or the stem-loop 2 may increase the efficiency of transcriptional up-regulation compared to dCas-VP64 or the like. Further description of the tetraloop and the stem-loop 2 regions, as well as other stem-loop regions, of gRNA is provided in US Patent No. 11,001,829 and in Konermann et al. Nature 2015 January 29; 517(7536):583-588, which are herein incorporated by reference in its entirety. GlySer (or “GS”) linker based on glycine and serine residues and other peptide linkers are known in the literature, such as Chen et al. Adv Drug Deliv Rev. 2013 Oct 15, 65(10): 1357-1369.

[0095] In some embodiments, the adaptor protein comprises MS2. In some embodiments, the adaptor protein comprises PP7, Qp, F2, GA, fr, JP501, M12, R17, BZ13, JP34, JP500, KU1, Mil, MX1, TW18, VK, SP, FI, ID2, NL95, TW19, AP205, cpC)5, | Cb8r, Cbl2r, Cb23r, 7s, or PRR1.

[0096] In some embodiments, a gene editing system comprises two or more transcription activators to improve activation efficiency. For example, VP64 or the like is combined with NF-KB trans-activating subunit p65. p65 shares some common co-factors with VP64 and recruits a distinct subset of transcription factors and chromatin remodeling complexes, such as AP-1, ATF / CREB, and SP1, whereas VP64 recruits PC4, CBP / p300, and the SWI / SNF complex. In some embodiments, the two or more effector domains (e.g., transcription activators) are each linked or fused to dCas and MS2, e.g., forming heteroeffector pairing of dCas9 and MS2 fusion proteins, such as dCas9-VP64 paired with MS2- p65 or dCas9-p65 with MS2-VP64. In some embodiments, the hetero-effector pairing increases the transcription activation compared to homo-effector pairing such as dCas9-VP64 paired with MS2-VP64 or dCas9-p65 with MS2-p65. In further embodiments, a third activation domain (e.g., activation domain from human heat-shock factor 1 (HSF1)) is included in the dCas9 or MS2 fusion protein.

[0097] In some embodiments, a gene editing system comprises a combination of sgRNA having RNA aptamers appended thereto, dCas (e.g., dCas9) fused with nuclear localization signal (NLS) and VP64 or the like, and MS2-p65 fused with HSF1, which is designated as synergistic activation mediator (SAM).

[0098] In some embodiments, the mutant form of a Cas endonuclease (e.g., dCas9) is fused or linked to a multimerized epitope, e.g., a SunTag amplification epitope. In some embodiments, a gene editing system comprises a FUS-CRISPRi system composed of a heat inducible promoter (e.g., the 7H-YB promoter, or the Hsp; preferably the 7H-YB promoter) driving the dCas9 fused to eight repeats of GCN4; a constitutive promoter (e.g., EFS promoter) driving aGCN4-scFv-fused epigenetic regulator DNMT3A-3L; and a constitutive promoter (e.g., U6) driving the gRNA. The de novo DNA methyltransferase DNMT3A is responsible for the establishment of de novo genomic DNA methylation patterns. aGCN4- scFv encodes a cell surface anti-GCN4 single-chain variable fragment, and can in some aspects be substituted by aGCN4-Fab. scFv(GCN4) is a single-chain variable fragment antibody that robustly and specifically binds ‘SunTag’ epitopes (such as epitope derived from the yeast amino acid starvation-responsive transcription factor GCN4); these epitopes are originally derived (PMID: 10644744) from the Saccharomyces cerevisiae GCN4 gene (SGDID:S000000735) and may have been further optimized for binding to scFv(GCN4) (PMID:25307933). If a protein of interest is tagged with a repeating array (for example up to 24 repeats) of a SunTag epitope, multiple copies of scFv(GCN4) can be recruited to the SunTag epitope array. This results in a property of ‘signal amplification via protein multimerization’. For example, if the scFv(GCN4) antibody sequence is fused to an epigenetic regulator (e.g., DNMT3A, or DNMT3A-3L), expression of a protein of interest (e.g., dCas9) tagged with a SunTag epitope array can recruit a high number of copies of the epigenetic regulator. The GCN4 peptide contains many hydrophobic residues and is largely unstructured in solution, possibly leading to its poor expression. Hence, one or more residues may be modified or inserted to increase a-helical propensity and reduce hydrophobicity. In some embodiments, a GCN4 peptide (each repeating unit of a multimerized epitope) has an amino acid sequence of LLPKNYHLENEVARLKKLVGER (SEQ ID NO: 54). In some embodiments, a GCN4 peptide (each repeating unit of a multimerized epitope) has an amino acid sequence of EELLSKNYHLENEVARLKK (SEQ ID NO:55). In further embodiments, multiple copies (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or more copies) of a GCN4 peptide are tandem linked to form an amplification tag. In further embodiments, a linker (e.g., GlySer linker) may be inserted in between GCN4 epitopes. Further description of a multimerized protein tagging system is provided in US Patent Applicant Publication No. US20170219596, which is incorporated herein by reference in its entirety.

[0099] In various embodiments, a heat-sensitive promoter is a mammalian or human promoter activated by increased temperature, e.g., temperature increased to between about 40 °C and 48 °C, or to between about 42 °C and 45 °C, or to about 43 °C. In some embodiments, a heat- sensitive promoter is a mammalian or human promoter (also called ‘core promoter’) operably linked to a heat-shock element (HSE). Exemplary HSEs and heat-sensitive promoters are further described in Miller et al., Nat Biomed Eng. 2021 November; 5(11): 1348-1359. The cellular response to hyperthermia is mediated by trimerization of the temperature-sensitive transcription factor heat shock factor 1 (HSF1) and its subsequent binding to HSEs. HSEs comprise multiple inverted repeats of the consensus sequence 5'- nGAAn-3' and are arrayed upstream of the transcription start site of heat-shock proteins (HSPs) to allow their upregulation following thermal stress. Exemplary core promoters, suitable for operably linking with HSEs, include HSPB1 core promoter, HSPA1A core promoter, HSPH1 core promoter, HSPA6 core promoter, and synthetic core promoter (e.g., YB). In some embodiments, HSE for operably linking with a core promoter is seven tandem repeats of 5’-nGAAnnTTCnnGAAn-3’. In some embodiments, HSE for operably linking with a core promoter is two tandem repeats of 5’-nGAAnnTTCnnGAAn-3’. In some embodiments, HSE for operably linking with a core promoter is three tandem repeats of 5’- nGAAnnTTCnnGAAn-3’. In some embodiments, HSE for operably linking with a core promoter is four, five, or six, or more tandem repeats of 5’-nGAAnnTTCnnGAAn-3’.

[0100] In some embodiment, a heat sensitive promoter comprises Hsp. In some embodiments, a heat sensitive promoter comprises 7H-YB. 7H-YB promoter comprises 7 repeats of a heat-shock element (HSE) operably linked to and upstream of YB-TATA promoter. In some embodiments, a YB-TATA promoter has a sequence of: GCGATTAATCCATATGCTCTAGAGGGTATATAATGGGGGCCACTAGTCTACTACC AGAAAGCTTGGTACCGAGCTCGGATCCAGCCACC (SEQ ID NO:57). In some embodiments, a YB-TATA promoter is used in its shorter version TCTAGAGGGTATATAATGGGGGCCA (SEQ ID NO: 58). Accordingly, wherever YB- TATA is referred to as a component of an inducible promoter herein, an equivalent sequence with sYB-TATA substituted in place of YB-TATA is also considered to be an alternative embodiment of the invention. Further description of YB-TATA promoter or similar mini promoters are provided in US Patent Application Publication No. US20230167458, which is hereby incorporated by reference.

[0101] In some embodiments, a heat-sensitive promoter is or comprises a human heat shock protein 70B (Hsp) promoter, and optionally the human heat shock protein 70B (Hsp) promoter has a sequence as set forth in SEQ ID NO:53: GTCGAGGCGCGTCCTCAGAGCCAGCCGGGAGGAGCTAGAACCTTCCCCGCGTTT CTTTCAGCAGCCCTGAGTCAGAGGCGGGCTGGCCTGGCATAGCCGCCCAGCCTCT CGGCTCACGGCCCGATCCGCCCGAACCTTCTCCCGGGGTCAGCGCCGCGCTGCGC CGCCCGGCTGACTCAGCCCGGGCGGGCGGGCGGGAGGCTCTCGACTGGGCGGGA AGGTGCGGGAAGGTTCGCGGCGGCGGGGTCGGGGAGGTGCAAAAGGATGAAAA GCCCGTGGAAGCGGAGCTGAGCAGATCCGAGCCGGGCTGGCGGCAGAGAAACC GCAGGGAGAGCCTCACTGCTGAGCGCCCCTCGACGGCGGAGCGGCAGCAGCCTC CGTGGCCTCCAGCATCCGACAAGAAGCTCTCTAGTCGACGGTATCGAT (SEQ ID NO:53).

[0102] In some embodiments, the gRNA of a gene editing system targets telomere repeats. In various embodiments, a gene editing system comprising a gRNA targeting telomere sequence further includes, or is used in combination with, one or more polynucleotide sequences encoding a chimeric antigen receptor and immune cells, or with CAR-engineered T cells or immune cells. A telomere is a distinct structure at each end of chromosomes that is composed of tandem six nucleotide repeats of TTAGGG and a complex of shelterin proteins. In some embodiments, gRNA that targets telomere sequence has a sequence of SEQ ID NO:21. In some embodiments, gRNA that targets telomere sequence has a sequence having at least 95%, 90%, 85%, 80%, 75%, or 70% sequence identity to SEQ ID NO:21.

[0103] In some embodiments, the gRNA of a gene editing system provided herewith comprises gRNA that targets telomere sequence, and the gene editing system further includes a polynucleotide sequence encoding a chimeric antigen receptor (CAR). In some embodiments, the gRNA of a gene editing system provided herewith comprises gRNA that targets telomere sequence, and the gene editing system further includes a polynucleotide sequence encoding a CAR and an immune cell (e.g., T cell). In some embodiments, the gRNA of a gene editing system provided herewith comprises gRNA that targets telomere sequence, and the gene editing system further includes an immune cell engineered to express a CAR. In some embodiments, the gene editing system containing gRNA that targets telomere sequence and immune cell(s) expressing CAR are in use for killing or reducing activity and / or viability of tumor cells.

[0104] In various embodiments, a gene editing system provided herewith further includes a polynucleotide sequence encoding a synthetic Notch receptor (synNotch receptor) and a polynucleotide sequence encoding a chimeric antigen receptor (CAR). In various embodiments, a gene editing system provided herewith further includes an immune cell engineered to co-express a synNotch receptor and a CAR. In various embodiments, a gene editing system provided herewith is used in combination with a cell therapy system comprising a polynucleotide sequence encoding a synthetic Notch receptor (synNotch receptor), a polynucleotide sequence encoding a chimeric antigen receptor (CAR), and one or more immune cells (T cells or NK cells). In various embodiments, a gene editing system provided herewith is used in combination with immune cells that are genetically engineered to express a synNotch receptor and a CAR. In some embodiments, an immune cell engineered to co-express a synNotch receptor and a CAR utilizes the Gal4 / upstream activation sequence (UAS) two-component activation system. In some embodiments, a GAL4-VP16 (or GAL4-VP64) / UAS two-component activation system is utilized. For example, transcription activator protein Gal4 (or a chimeric transcription factor thereof such as GAL4-VP16 or GAL4-VP64) can bind short upstream activation sequences (UAS) (also called enhancer sequence) to target and enhance expression of a gene of interest. In some embodiments, the CAR is driven by a promoter downstream of the UAS. Further description of synNotch receptors is provided in US Patent Nos. 9,670,281 and 10,590,182, which are incorporated by reference in their entirety.

[0105] In various embodiments, a synthetic Notch receptor does not bind its naturally-occurring ligand Delta and it comprises, in covalent linkage: a) an extracellular domain comprising a ligand-binding domain; b) a Notch regulatory region comprising a ligand-inducible proteolytic cleavage site; and c) an intracellular domain, heterologous to the Notch regulatory region, comprising a transcriptional activator, wherein the transcriptional activator replaces a naturally-occurring intracellular notch domain, and wherein binding of the ligand-binding domain to corresponding ligand induces cleavage at the Notch regulatory region, thereby releasing the intracellular domain and effectuating the transcriptional activator.

[0106] In some embodiments, a gene editing system further comprises a polynucleotide sequence encoding a first ligand, preferably cell-surface ligand, and either further comprises or is used in combination with a polynucleotide encoding a synNotch thatspecifically binds the first ligand and induces release of Gal4-based transcription activator, and a polynucleotide encoding a CAR whose expression is driven by a promoter having an UAS.

[0107] In further embodiments, a gene editing system further comprises or is used in combination with an ultrasonography system. In some embodiments, an ultrasonography system comprises one or more of an ultrasound transducer, an acoustic gel, and a thermocouple and a controller.

[0108] In various embodiments, expression vehicle, vector, recombinant virus, or equivalents used to practice methods as provided herein are or comprise: an adeno-associated virus (AAV), a lentiviral vector or an adenovirus vector; an AAV serotype AAV5, AAV6, AAV8 or AAV9; a rhesus-derived AAV, or the rhesus-derived AAV AAVrh. l0hCLN2; an organ-tropic AAV; and / or an AAV capsid mutant or AAV hybrid serotype. In alternative embodiments, the AAV is engineered to increase efficiency in targeting a specific cell type that is non-permissive to a wild type (wt) AAV and / or to improve efficacy in infecting only a cell type of interest. In alternative embodiments, the hybrid AAV is retargeted or engineered as a hybrid serotype by one or more modifications comprising 1) a transcapsidation, 2) adsorption of a bi-specific antibody to a capsid surface, 3) engineering a mosaic capsid, and / or 4) engineering a chimeric capsid. It is well known in the art how to engineer an adeno- associated virus (AAV) capsid in order to increase efficiency in targeting specific cell types that are non-permissive to wild type (wt) viruses and to improve efficacy in infecting only the cell type of interest; see e.g., Wu et al., Mol. Ther. 2006 September; 14(3):316-27. Epub 2006 Jul. 7; Choi, et al., Curr. Gene Ther, 2005 June; 5(3):299-310.

[0109] Various embodiments provide methods for remotely-modulating and / or non- invasively modulating gene expression in a cell, which include: introducing and expressing a gene editing system disclosed herein to the cell, and stimulating the cell with ultrasound or heat, thereby activating the heat-sensitive promoter for expression of its operably linked nucleotide sequence, wherein the gRNA binds one or more target genes to modulate target gene expression, and / or the transcription activator, transcription repressor, and / or epigenetic regulator, if present in the gene editing system, modulate gene expression.

[0110] In some embodiments, the stimulation is with ultrasound. In some embodiments, the method further includes inserting a thermocouple to or near the cell to monitor temperature at or near the cell, and optionally temperature reading being fed to a controller to control intensity of the ultrasound.

[0111] In some embodiments, the method results in or is effective for altering a gene expression by at least 2-fold increase, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by 3-fold increase, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by 4-fold increase, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by 4-fold increase, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by 6- fold increase, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by 7-fold, 8-fold, 9-fold, or more of increase, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 10% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 20% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 30% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 40% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 50% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 60% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 70% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 80% decrease,compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation. In some embodiments, the method results in or is effective for altering a gene expression by at least 90% decrease, compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation.

[0112] In some embodiments, the method results in or is effective for altering a gene expression for at least 1-5 days. In some embodiments, the method results in or is effective for altering a gene expression for at least 5-10 days. In some embodiments, the method results in or is effective for altering a gene expression for at least 20-30 days. In some embodiments, the method results in or is effective for altering a gene expression for at least 30-40 days. In various implementations, the repression is reversible.

[0113] In some embodiments, the stimulation comprises increasing temperature by 3°C-7°C. In some embodiments, the stimulation comprises increasing temperature to about 39°C-44°C.

[0114] Various embodiments provide methods for treating a subject having a tumor, which include: introducing and expressing to a tumor cell of the subject a gene editing system disclosed herein, and stimulating the tumor cell or nearby tumor tissue with ultrasound or heat, thereby activating the heat-sensitive promoter for expression of its operably linked nucleotide sequence.

[0115] In some embodiments, the subject has received a chimeric antigen receptor (CAR)-engineered immune cell (optionally T cell) therapy against the tumor. In other embodiments, the method further comprises administering to the subject the CAR-engineered immune cell.

[0116] In some embodiments, a polynucleotide sequence encoding a first ligand, preferably cell-surface ligand, is introduced to a first tumor cell, and the gene editing system disclosed herein is also introduced to the first tumor cell (or to nearby second tumor cell); and a T cell or NK cell engineered to co-express a synNotch receptor and a CAR is provided to the tumor, wherein the synNotch specifically binds to the first ligand expressed by the first or second tumor cell and intracellularly releases Gal4 or Gal4-based transcription activator, and wherein the CAR is driven by a promoter with an UAS. Preferably the CAR comprises one or more tumor antigen specific-targeting domains as the extracellular domain.

[0117] In some embodiments, the gene editing system further comprises a polynucleotide sequence encoding a first cell-surface ligand that is not a naturally-occurring ligand for Notch receptor; wherein the CAR-engineered immune cell further expresses a synthetic Notch receptor, wherein the synthetic Notch receptor is configured for specificallybinding the first ligand and releasing intracellularly a regulator protein comprising Gal4; wherein nucleotide sequence encoding the CAR contains an upstream activation sequence (UAS) which is activated upon binding of the regulatory protein comprising the Gal4; and wherein the method further comprises expressing the first ligand on the tumor cell surface, thereby inducing expression of the CAR in the immune cell, so as to inhibit or reduce the tumor in the subject.

[0118] In some embodiments, the introduction of the gene editing system to the tumor cell comprises delivery of the gene editing system via an adeno-associated virus.EXAMPLES

[0119] The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.

[0120] CRISPR (clustered regularly interspaced short palindromic repeats) is a revolutionary technology for genome editing, and its derived technologies such as CRISPR activation (CRISPRa) and CRISPR interference (CRISPRi) further allow transcriptional and epigenetic modulations. However, the need for precise, safe, and reversible CRISPR-based genome and epigenome editing methods remains important for clinical translation. Here, we engineered a set of inducible CRISPR(a / i) tools for the regulation of genome and epigenome in cells and animals controllable by focused ultrasound (FUS), which can penetrate deep in vivo and induce hyperthermia locally to activate desired genes. We demonstrated the capabilities of FUS-inducible CRISPR, CRISPRa, and CRISPRi (FUS-CRISPR(a / i)) in modulating genome or epigenome to knockout, activate, and repress exogenous and / or endogenous genes. We further showed that FUS-CRISPR-mediated telomere disruption could prime solid tumours and enhance the susceptibility to chimeric antigen receptor (CAR)-T cell killing in vivo. To demonstrate its translational potential, we used clinically validated adeno- associated viruses (AAVs) to deliver FUS-CRISPR genes directly into xenograft tumours, followed by FUS-induced telomere disruption and the expression of a clinically validated antigen in a subpopulation of cancer cells at the tumour site. These induced cancer cells functioned as "training centers" to train and activate synNotch CAR-T cells to produce CARs against a universal tumour antigen, leading to the extermination of the entire population of neighboring cancer cells. The FUS-CRISPR(a / i) toolbox developed here hence allows theremote, noninvasive, and spatiotemporal control of genomic and epigenomic reprogramming in vivo, with applications in cancer treatment.

[0121] Inducible upregulation of exogenous and endogenous genes via FUS- CRISPRa

[0122] To engineer a FUS-CRISPRa system with the heat-sensitive heat shock protein promoter (Hsp), we adopted the Ribozyme-gRNA-Ribozyme (RGR) strategy utilizing self-cleaving HH and HDV ribozymes that allows for gRNA production from RNA polymerase II promoters like Hsp. Upon FUS-induced heat stimulation (Fig. 7A-7H), Hsp initiates production of the HHRibo-sgRNA-HDVRibo transcript, which undergoes selfcleavage to generate the sgRNA (Fig. 1 A). The sgRNA then integrates with the constitutively expressed dCas9 and transcriptional factors (e.g., VP64, SAM45) to activate target gene expression (Fig. 1 A).

[0123] We first tested the capability of FUS-CRISPRa in activating exogenous genes. In cells transfected with FUS-CRISPRa for the inducible expression of gRNAl targeting a synthetic promoter Pl (Fig. 8 A), different durations of heat stimulation induced tunable expression of Pl -driven firefly luciferase (Flue, Fig. IB). The synthetic Pl promoter is described by Nissim et al. in Molecular Cell 54, 698-710 (2014). FUS stimulation (43 °C, 20 min) also induced a comparable level of Flue activation in the engineered cells in vitro (Fig.IC). We further applied FUS in vivo in mice and observed significant Flue activation via FUS-CRISPRa as well (Fig. 8B). In addition, we engineered cells with multiplexed FUS- CRISPRa containing Hsp-DsRed2-RGlR-RG2R, allowing simultaneous inducible production of multiplexed gRNAl and gRNA2 targeting synthetic promoters Pl and P2 respectively (Fig. 8C). Along with the Hsp-driven DsRed2 expression, the activations of Pl- driven EYFP and P2-driven ECFP via FUS-CRISPRa were also observed in the cells with heat shock (HS), with minimal background signals in control (CT) cells without HS (Fig.ID). Together, the above validated the design of FUS-CRISPRa with inducible gRNAs for multiplexed genome regulation.

[0124] We then applied FUS-CRISPRa to regulate endogenous gene expressions. We constructed an all-in-one piggyBac plasmid containing Hsp-RGR targeting the human IL1B (hILIB) gene, which is a target of CRISPRa, together with the constitutive dCas9-SAM (Fig. 8D) to generate cell lines accordingly. Quantification of hILIB mRNA level and pro-ILIB protein expression in the engineered HEK 293T cells at different time points after HS revealed a trend of heat-inducible upregulation of hILIB through FUS-CRISPRa (Fig. IE, IF). No heat-inducibility of hILIB was observed in wild type (WT) cells (Fig. 8E). Todemonstrate the general applicability of FUS-CRISPRa, we also validated our design in mouse RAW 264.7 cells targeting mouse IL1B (mlLIB) and IFNP (mIFNP) genes (Fig. 1G, 1H). Heat itself did not significantly alter mlLIB and mIFNP expression in WT RAW 264.7 cells (Fig. 8F, 8G). As such, FUS-CRISPRa allows inducible activation of various exogenous and endogenous genes in different cell types.

[0125] FUS-CRISPRi-mediated epigenetic regulation for gene repression

[0126] We next sought to engineer FUS-CRISPRi for controllable gene repression for lasting periods through epigenetic reprogramming. CIRSPRoff is an epigenetic memory writer composed of dCas9, DNA methyltransferase DNMT3A-3L domains, and KRAB domains which durably silences gene expression (Fig. 9A). We co-transfected HEK 293T cells with CRISPRoff and Hsp-RGR containing gRNA targeting ARPC2, a target of CRISPRi, to test heat-inducible gene repression. However, we did not observe significant ARPC2 downregulation after HS (Fig. 9B). We also tested Hsp-RGR containing Zap70- targeting gRNA in Jurkat cells by electroporation, yet still did not observe Zap70 downregulation (Fig. 9B). On the contrary, robust gene repression was observed when constitutive ARPC2 or Zap70 gRNA was co-transfected with CRISPRoff (Fig. 9C). We hypothesized that the copy number of gRNA generated from Hsp-RGR after HS may not be sufficient to induce gene repression with CRISPRoff.

[0127] Therefore, we employed a different strategy to engineer FUS-CRISPRi by changing the inducible component from gRNA to dCas9 while incorporating the SunTag amplification system. Since heat-inducible expression may result in a lower protein copy number than constitutive expression, we reasoned that having a heat-inducible dCas9- nxGCN4 and a constitutive scFv-regulator would allow a favorable stoichiometry to promote the recruitment of multiple copies of the regulators to a given dCas9 complex. We also replaced the Hsp with synthetic heat-sensitive promoter 7H-YB with higher heat inducibility (Fig. 10B). As such, this FUS-CRISPRi system is composed of the 7H-YB promoter driving the dCas9 fused to eight repeats of GCN4, a constitutive EFS promoter driving a aGCN4- scFv-fused epigenetic regulator DNMT3A-3L, and the constitutive U6 promoter driving the gRNA (Fig. 2A, Fig. 11 A). FUS stimulation induces dCas9-8xGCN4 expression, allowing the recruitment of multiple copies of the epigenetic regulators through the scFv. As such, the complex is brought to the target locus by the gRNA to repress gene expression via DNA methylation (Fig. 2A).

[0128] We transduced lurkat cells with the FUS-CRISPRi system containing gRNAs targeting surface markers CD81 or CXCR4, which can be quantified by staining. Cell surfacestaining of CD81 four days after HS showed a significant decrease in CD81 expression in the HS cells compared with non-heated control (CT) cells (53.8% vs. 91.7%, Fig. 2B). Similarly, CXCR4 expression was also repressed by HS (46.7% in HS vs. 90.8% in CT cells, Fig. 2C). HS itself did not affect CD81 or CXCR4 expression in the cells with non-targeting (NT) gRNA (Fig. 2B, 2C). The effect of FUS-CRISPRi -mediated gene repression was also confirmed by quantification of the corresponding mRNA levels (Fig. 2D, 2E). Similar gene repression effects were achieved in Nalm6 cells engineered with FUS-CRISPRi (Fig. 11B, 11C).

[0129] CXCR4 is a chemokine receptor known to promote tumour growth and metastasis. We therefore examined the effect of FUS-CRISPRi-mediated CXCR4 downregulation in Nalm6 tumour cells. We also replaced the WT DNMT in the original FUS-CRISPRi with a DNMT mutant (DNMT3A(R887E)-3L) of reduced off-target methylation (Fig. 12A). A dramatic reduction of CXCR4 expression was seen in CXCR4 FUS-CRISPRi cells four days after HS compared with those without HS, and FUS stimulation was able to induce a comparable repression effect in the engineered cells (Fig. 2F). Dynamic tracking revealed that the CXCR4 expression in the cells with HS recovered to a level similar to that in the cells without HS in approximately 40 days, indicating a sustained but reversible effect of FUS-CRISPRi (Fig. 2G, 12B). The FUS-CRISPRi-mediated gene repression was also confirmed by methylation analysis (Fig. 12C). Transwell assays further demonstrated that the migration ability was compromised in cells with HS-induced CXCR4 downregulation (Fig. 2H). Taken together, our results show that FUS-CRISPRi allows inducible and reversible gene repression on different genes through epigenetic modulation in different cell types, allowing the control of cellular functions by ultrasound.

[0130] The SunTag-based FUS-CRISPRi platform is versatile in that it can be readily converted into a FUS-CRISPRa system by replacing the epigenetic regulators with transcription activators like VP64 (Fig. 13A, 13B). We hence engineered such a system and tested its ability to activate Pl-driven Flue (Fig. 13C). We observed robust Flue activation with HS or FUS stimulation in multiple cell types and in vivo (Fig. 13D, 13E), validating the design of SunTag-based FUS-CRISPRa.

[0131] FUS-CRISPR-mediated knockout of endogenous genes

[0132] One of the advantages of the FUS-inducible system is its ability to transiently activate regulators (e.g., Cas9) that may be immunogenic or toxic if expressed constitutively. Following the development of FUS-CRISPRa and FUS-CRISPRi, we engineered FUS- CRISPR composed of inducible Cas9 and constitutive gRNAs (Fig. 3A, Fig. 14A, 14B) andverified heat-inducible Cas9 expression in the engineered cells (Fig. 3B). In Jurkat T cells engineered with FUS-CRISPR targeting key signaling molecules CD3D or Zap70, HS induced CD3D knockout (KO) in 44.3% cells and Zap70 KO in 39.2% cells as quantified by genotyping PCR and sequencing (Fig. 3C). Low levels of basal KO were observed in CT cells (13% for CD3D and 15.4% for Zap70), likely due to the leakage of the heat-sensitive promoters (Fig. 3C). To test whether HS-induced KO can affect cellular functions, we stimulated the Jurkat T cells with anti-T-cell receptor (TCR) antibody and quantified T-cell activation by CD69 staining. Since CD3D is a subunit of the TCR complex and Zap70 is an important mediator of the TCR signaling pathway, Jurkat cells with HS-induced KO of CD3D or Zap70 demonstrated significantly weakened TCR-dependent T-cell activation, reflected by CD69 expressions (Fig. 3D).

[0133] To examine the feasibility of broad applications, we further engineered an all- in-one plasmid for FUS-CRISPR and tested it in multiple tumour cell lines (Fig. 3E). Surface staining of U-87 MG glioma tumour cells engineered with CD81 -targeting FUS-CRISPR showed that HS induced significant CD81 KO (Fig. 3F). To explore the therapeutic applications of FUS-CRISPR, we generated Nalm6 tumour cells containing FUS-CRISPR targeting polo-like kinase 1 (PLK1, Fig. 14C), a key regulator of cell cycle and an active target of cancer therapy. HS induced PLK1 KO and significantly inhibited cell proliferation with different PLK1 -targeting gRNAs (Fig. 3G, 3H, Fig. 14D). In summary, FUS-CRISPR can be applied to control genome editing of endogenous genes and reprogramming of cellular functions.

[0134] Telomere disruption by FUS-CRISPR

[0135] In addition to genetic editing of single genes, we hypothesized that FUS- CRISPR can act with a higher editing efficiency on repetitive loci such as telomeres than on non-repetitive loci. It has been reported that telomere dysfunction can trigger catastrophic events leading to cell senescence and apoptosis. We hence co-transfected HEK 293T cells with FUS-CRISPR containing the gRNA targeting repetitive telomere sequences (Fig. 14D) and HaloTag-fused 53BP1, a marker for DNA double strand breakage (DSB) to report the genome editing sites. Fluorescence microscopy revealed that HS induced DSB at multiple loci in the cells with telomere-targeting FUS-CRISPR, as evidenced by the dotted 53BP1 pattern, which was not observed in non-activated CT cells or cells with non-targeting NT FUS-CRISPR (Fig. 4A). We also co-transfected the cells with tagBFP-fused telomeric repeat binding factor 2 (TRF2) to mark the telomere loci. Merged images of 53BP1 and TRF2showed multiple colocalization puncta, confirming the presence and precision of FUS- CRISPR-induced DSB at telomeres (Fig. 4A).

[0136] We then engineered Nalm6 tumour cells with telomere-targeting or NT FUS- CRISPR. We observed that a relatively short duration of HS (10 min) significantly inhibited the proliferation of the cells engineered with telomere FUS-CRISPR, but not that of the cells with NT FUS-CRISPR, indicating that telomere disruption rather than hyperthermia itself suppressed cell growth (Fig. 4B). Bulk RNA-seq further revealed that FUS-CRISPR- mediated telomere disruption led to the upregulation of multiple genes associated with the stress response p53 signaling pathway and apoptotic process (e.g., MDM2, FAS, BBC3) and the TNF family (e.g., CD70) in the engineered cells to trigger cell cycle arrest (Fig. 4C-4E, Fig. 15). This priming effect of FUS-CRISPR on tumour cells may hence not only cause the tumour cell cycle arrest and apoptosis, but also induce T cell immune responses via TNF family.

[0137] To test whether telomere disruption affects tumour killing by T cells, we employed anti-CD19 chimeric receptor antigen (CAR)-T cells specifically targeting CD 19+ Nalm6 tumour cells (Fig. 4F, Fig. 16). CAR-T cells were co-cultured with Flue-expressing FUS-CRISPR Nalm6 cells with or without HS at a low effector-to-target (E:T) ratio of 1 :20 for luciferase-based killing assay. The percentage of surviving tumour cells and the corresponding cytotoxicity of the CAR-T cells were quantified from Flue luminescence 72 h after co-culture (Fig. 4G, 4H). CAR-T cells demonstrated significantly stronger cytotoxicity against Nalm6 cells with HS-induced telomere disruption than that against CT Nalm6 cells (84.6% vs. 54.3%), while similar cytotoxicities were observed against NT FUS-CRISPR Nalm6 cells with or without HS (59.2% and 61.2%, respectively, Fig. 4H). These results indicated that tumour cells with induced priming and telomeric DSB became more susceptible to CAR-T cell killing.

[0138] Tumour priming via FUS-CRISPR for enhanced CAR-T therapy

[0139] Encouraged by the effect of FUS-CRISPR-mediated telomere disruption in vitro, we investigated its therapeutic potentials in vivo. We generated subcutaneous tumours in NSG mice using Fluc+ Nalm6 cells engineered with telomere FUS-CRISPR or NT FUS- CRISPR. The tumours were treated with (FUS+) or without (FUS-) 10 min FUS on Days 9 and 12 (Fig. 5A and Fig. 17A). No significant difference in growth was observed between NT FUS-CRISPR tumours with or without FUS, indicating that FUS alone did not affect tumour growth (Fig. 17B-17D). In the mice bearing telomere FUS-CRISPR tumours, FUS+ tumours exhibited mildly inhibited growth compared with the FUS- tumours from bioluminescenceimaging (BLI) yet no statistically significant difference from caliper measurement (Fig. 5B- 5C). Both the FUS+ and FUS- groups showed 0% survival at the end of observation (Fig. 5D). These results indicated that FUS-CRISPR-mediated telomere disruption alone was not sufficient for tumour treatment.

[0140] Therefore, we hypothesized that a treatment strategy combining FUS- CRISPR-mediated telomere disruption for tumour priming and CAR-T therapy could lead to a more prominent therapeutic outcome. We accordingly generated subcutaneous tumours in mice using telomere FUS-CRISPR Nalm6 cells followed with (FUS+) or without (FUS-) FUS stimulation (Fig. 5E). Ten days later, we injected a low dose of CAR-T cells intravenously in both FUS+ and FUS-groups (Fig. 5E). We observed significantly suppressed growth of the tumours in the FUS+ group compared to that of FUS- (Fig. 5F-5G). The two groups of mice also showed different survival profiles: while all the mice in the FUS+ group survived, only 40% (two out of five) mice in the FUS- group responded to CAR-T therapy, and the rest 60% mice had reached euthanasia criteria due to tumour progression by the end of observation (Fig. 5H). We further performed a control experiment using NT FUS-CRISPR tumours with CAR-T treatment in both FUS- and FUS+ groups (Fig. 17E). There was only a mild inhibition of tumour growth in the FUS+ group compared with the FUS- group, but there was no significant difference in the survival rate between the two groups (Fig. l7F- 17H). Taken together, telomere-targeting FUS-CRISPR can allow ultrasound-controllable genome editing and tumour priming for efficient CAR-T therapy to achieve synergistic therapeutic effects.

[0141] Clinically compatible FUS-CRISPR delivery for cancer cell reprogramming and immunotherapy

[0142] To further demonstrate the translational potential of our technology, we set off to use adeno-associated virus (AAV) to directly deliver FUS-CRISPR components into tumour cells in vivo. Meanwhile, in addition to tumour priming via FUS-CRISPR-mediated telomere disruption, we proposed to further prime the CAR-T cells by employing the synNotch design to overcome the less efficient gene delivery in vivo. In synNotch CAR-T cells, binding with a FUS-induced specific antigen A (“priming”) in the viral-infected subpopulation of cancer cells can induce the cleavage of the synNotch receptor and release of the fused transcription factor, activating the expression of a CAR against antigen B universally expressed on the whole population of cancer cells (“killing”). These dual-receptor AND-gate T cells are only armed and activated in the presence of dual antigen tumor cells;and once activated, can target tumor cells with the dual antigens A and B or tumor cells with just antigen B.

[0143] We hence engineered anti-CD19 synNotch CAR-T cells, where synNotch recognizes tCD19 (truncated CD 19) and activates anti-PSMA (prostate-specific membrane antigen) CAR expression (Fig. 18 A). Meanwhile, we engineered a FUS-CRISPR circuit that allowed the disruption of telomeres and induction of tCD19 expression in PSMA+ PC3 prostate cancer cells upon FUS stimulation (Fig. 18B). As such, the FUS-induced tCD19+ PC3 cells can serve as “training centers” to trigger PSMACAR expression in synNotch CAR T cells, which in turn leads to the killing of all the PSMA+ PC3 cells at the proximity of tumor site, both tCD19+ and tCD19-, via PSMACAR (Fig. 6A). This integration of FUS- CRISPR and synNotch CAR T can hence overcome two potential problems: (1) the lack of specific and clinically validated antigens for solid tumours; (2) the possibly less ideal efficiency of AAV gene delivery and FUS-induction in vivo.

[0144] We first tested this design in vitro by infecting the PC3 cancer cells with two AAVs. One AAV contained the inducible Cas9 driven by the heat-inducible 7H-YB promoter, and the other AAV contained U6-driven gRNAs targeting a truncated CD 19 (tCD19) reporter and the telomere, respectively, followed by the tCD19 reporter (Fig. 18B). The tCD19 reporter was composed of the tCD19 gene split at two points each with inserted tandem repeated sequence, thereby resulting in tandem repeated sequences flanking the gRNA targeting site, which could be recombined into functional tCD19 after FUS-CRISPR- mediated double-strand break (DSB) followed by single-strand annealing (SSA)-mediated repair (Fig. 18B). We observed that HS induced tCD19 expression in 12.2% of the engineered PC3 cells as compared to a basal expression of 1.2% (Fig. 6C). Co-culture of HS- treated PC3 cells with anti-CD19 synNotch PSMACAR-T cells led to the death of 71.8% of the PC3 cells, while minimal cell death was observed without the presence of synNotch CAR-T cells, or when the PC3 cells without HS stimulation were co-cultured with synNotch CAR-T cells (Fig. 6D).

[0145] To test this in vivo, we generated subcutaneous PC3 tumours (PSMA+, Fluc+) in NSG mice. When the tumours were approximately 50 mm3(Day 17), FUS-CRISPR AAVs were delivered into PC3 cells via intratumoural injection. The PC3 tumours were treated with or without FUS stimulation on Day 20 and Day 25. Anti-CD19 synNotch PSMACAR-T cells were injected intravenously on Day 23 (Fig. 6E). We observed a significant eradication of the PC3 tumours treated with FUS, compared to those without FUS treatment (Fig. 6F, Fig. 18C). A significantly higher survival rate was also observed in the FUS+ group, compared tothe FUS- group (100% vs. 0% by Day 38, Fig. 6G). Our results hence indicate that FUS- CRISPR-mediated in vivo reprogramming of cancer cells allows for synNotch CAR-T cells to achieve anti-tumour effects.

[0146] Discussion

[0147] We developed a FUS-CRISPR(a / i) toolbox including FUS-controllableCRISPRa, CRISPRi, and CRISPR systems that allowed inducible control of genetic and epigenetic reprogramming by FUS.

[0148] We demonstrated inducible upregulation, downregulation, and knockout of exogenous and / or endogenous genes in multiple cell types in vitro and in vivo using FUS. We induced multiple DSBs at telomere sites in tumour cells via telomere-targeting FUS-CRISPR, which primed tumours for efficient killing by cytotoxic CAR-T cells in vitro and in vivo. We further delivered FUS-CRISPR in vivo using AAV to reprogram tumour cells and prime the synNotch CAR-T cells for tumour killing. These synergistic strategies enhanced the efficacy of CAR-T therapy against relatively resistant tumours.

[0149] Ultrasound and its integration with genetic engineering and synthetic biology revolutionizes the control of genetics and cellular functions in live animals with unprecedented penetration depth at tens of centimeters. Despite its high temporal resolution (e.g., hundreds of frames per second), the spatial resolution of traditional ultrasound is however limited at submillimeter levels. With recent development in acoustic reporter genes (ARGs) and functional ultrasound localization microscopy, ultrasound imaging can achieve spatial resolutions in micrometers and at single cell levels. We believe that the ultrasound control of genetics and cellular functions can reach the level of single cells and subcellular compartments. The FUS-CRISPR(a / i) toolbox developed in this work can further allow the ultrasound-guided regulation in the dimensions of genome and epigenome at single-base precision. Moreover, FUS-CRISPR(a / i) can be integrated with different CRISPR regulators and gRNAs, and such a modular design should enable the targeting of, in principle, any accessible genomic locus for various reprogramming purposes. As such, the FUS- CRISPR(a / i) toolbox should provide a versatile platform to allow the remote and noninvasive control of genome and epigenome in specific tissues / organs of genetically engineered animals with high spatiotemporal resolution.

[0150] AAV has been demonstrated to allow gene delivery in humans. We envision that the FUS-CRISPR(a / i) cassettes can be directly delivered using AAV followed by FUS- induced localized hyperthermia in patients to achieve therapeutic effects. Transgenic FUS- CRISPR(a / i) mouse models similar to tet-controllable Cas9 mice may also be developed.Such advancements should fully unleash the power of FUS-controllable technologies for genomic manipulation in live animals and patients in a remote, noninvasive, and spatiotemporally precise fashion. The FUS-CRISPR(a / i) technology should benefit fundamental, translational, and clinical research, with its applications ranging from interrogation of gene functions in targeted tissues / locations and / or CRISPR screening under physiological context in transgenic mice, to disease treatment in specific tissues in patients.

[0151] CRISPR-Cas9 proteins have been a powerful tool for genome editing, but can evoke adaptive immune responses and tissue damages in vivo, and are therefore potentially pathogenic if used to correct inherited genetic defects to treat diseases. Protein engineering to remove immunogenic epitopes and humanize these synthetic proteins to circumvent this issue can be difficult owing to the high diversity of the human leukocyte antigen (HLA) loci. Using our sonogenetics approach, the transiently induced genomic and epigenomic regulators can be cleared in a timely manner to mitigate or evade the adaptive immune response, offering a new option for genome editing and gene therapy at specific tissues / organs.

[0152] With ultrasound-induced local activation of “training centers”, the SynNotch- guided activation of PSMACAR-T cells will be effective at the local tumour area to kill the entire population of cancer cells via a universal antigen, but will have gradually decaying CAR expression if they stray away from the tumour area, sparing normal tissues / organs expressing similar antigens. This is in contrast to the direct usage of constitutive PSMACAR- T cells that can cause significant off-tumour toxicity. Furthermore, the approach of FUS- CRISPR targeting telomeres and switchable tCD19 can have multiple beneficial effects: (1) the highly repetitive telomeric sequences allows FUS-CRISPR to trigger massive DSBs in the genome to cause cancer cell apoptosis; (2) the cytokine / chemokine release from these FUS- CRISPR-induced apoptotic cancer cells aids the recruitment of SynNotch CAR-T cells; (3) the FUS-CRISPR-induced “training center” activates SynNotch CAR-T cells to attack the entire population of cancer cells. These combined effects can lead to enhanced therapeutic outcome.

[0153] Techniques

[0154] General cloning

[0155] Plasmids were constructed by Gibson Assembly (NEB, E2611L), T4 ligation(NEB, M0202L), or Golden Gate Assembly. PCR was performed using synthesized primers (Integrated DNA Technologies) and Q5 DNA polymerase (NEB, M0491). The sequences of the constructed plasmids were verified by Sanger sequencing (Azenta). Plasmids used in thisstudy and their corresponding templates are listed in Table 1. The sequences of the gRNAs are listed in Table 2.

[0156] General cell culture and antibodies

[0157] HEK 293T and RAW 264.7 cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco, 10569010) supplemented with 10% fetal bovine serum (FBS) (Gibco, 10438026) and 1% penicillin-streptomycin (P / S) (Gibco, 15140122). Jurkat and Nalm6 cells were cultured in Roswell Park Memorial Institute Medium (RPMI 1640) (Gibco, 22400105) with 10% FBS and 1% P / S. Primary human T cells were cultured in complete RPMI 1640 supplemented with 100 U / ml recombinant human IL-2 (PeproTech, 200-02). All mammalian cells were cultured at 37 °C in a humidified 5% CO2 incubator.

[0158] Gene delivery methods

[0159] General plasmid transfection in HEK 293 T cells were performed using Lipofectamine 3000 transfection reagent (Invitrogen, L3000001) according to the manufacturer’s protocol.

[0160] Electroporation in Jurkat cells was performed. Briefly, ten million Jurkat cells were resuspended in 500 pl of OptiMEM containing 20 pg Hsp-RGR or U6-gRNA plasmid and 20 pg CRISPRoff plasmid (Fig. 9B-9C) in a 4-mm cuvette and electroporated at 270 V, 950 pF (exponential wave, infinite resistance) using the Bio-Rad Gene Pulser Xcell Electroporation System. Cells were transferred to prewarmed culture media immediately after electroporation.

[0161] For piggyBac-based cell line generation (Fig. 1E-1H), the piggyBac transposon vector (Fig. 9D) and the piggyBac transposase plasmid (SBI, PB210PA-1) were delivered into cells at a ratio of 2.5:1 by Lipofectamine transfection in HEK 293T cells or by electroporation in Raw 264.7 cells using the Lonza 4D-Nucleofector and the SF kit (Lonza, V4XC-2032). Puromycin selection (5 pg / ml) was applied for 10 days.

[0162] For lentiviral transduction, the lentivirus was produced by transfecting HEK 293T cells with the transfer plasmid, packaging plasmid, and envelope plasmid using calcium phosphate-mediated transfection method (Promega, El 200) and harvesting the supernatant 48 - 72 h after transfection. For transduction of cell lines, 100-500 pl of unconcentrated lenvirus was added to IxlO5cells. For transduction of primary human T cells, the lentivirus was concentrated using LENTI-X™ Concentrator (Takara, 631232) followed by transduction as detailed in the Isolation, culture, and lentiviral transduction of primary human T cells section. FACS was performed to enrich the engineered cell populations when transduction efficiency was lower than 90% for cell lines or lower than 60% for primary T human cells.

[0163] In vitro heat shock

[0164] Cells were resuspended in regular culture media in 8-strip PCR tubes with 50 pl per tube and received heat shock (HS) in a thermal cycler (Bio-Rad, 1851148) for various durations before returning to normal culture condition. Samples heated with the thermal cycler were labeled as “HS” in the figures (as opposed to heating via FUS, which was labeled as “FUS+”). All in vitro HS experiments were performed at 43 °C.

[0165] Activation of exogenous genes via FUS-CRISPRa

[0166] For Fig. IB, HEK 293T cells were co-transfected with three FUS-CRISPRa plasmids (Fig. 8A) at 1 : 1 : 1 ratio using Lipofectamine in a 12-well plate with 900 ng total DNA per well. Approximately 18 h after transfection, cells were resuspended in culture medium, equally aliquoted into PCR tubes, and subjected to different HS treatment. The content of each individual PCR tube was added to individual wells containing 150 pl prewarmed medium in a 96-well plate (Corning, 3904) and returned to normal cell culture condition. The luminescence of each well was measured 24 h later using the Bright-Glo substrate (Promega, E2610) and a Tecan Infinite M200 Pro plate reader.

[0167] For Fig. ID, HEK 293T cells were co-transfected with four FUS-CRISPRa plasmids (Fig. 8C) at 1: 1 :1: 1 ratio using Lipofectamine in a 12-well plate with 1 pg total DNA per well. HS was performed 18 - 24 h after transfection. Imaging was performed 24 h after HS as described in the Fluorescence microscopy section.

[0168] Quantitative PCR

[0169] Total RNA was extracted from cells using Quick-RNA Microprep Kit (Zymo Research, R1050) and reverse transcribed to obtain cDNA using SUPERSCRIPT™ IV Reverse Transcriptase (Invitrogen, 18090010). Quantitative PCR (qPCR) was performed using iTaq Universal SYBRRTM Green Supermix (Bio-Rad, 1725121) with primers listed in Table 3.

[0170] Western blot analysis

[0171] Cells / tumours were harvested and homogenized with RIP A buffer (Cell signaling Technology, 9806S) containing protease and phosphatase inhibitor cocktail (Merck, 04693116001 and 4906837001). The same amount of protein lysate was loaded into a precast polyacrylamide SDS-PAGE gel (Bio Rad, 3450123) and ran at 30 mA for 90 min. The separated proteins were transferred onto 0.45 pm PVDF membrane (Bio Rad, 1620184) at 230 mA for 100 min. After blocking with TBS-T (Tris-buffer saline containing 0.1% Tween 20) containing 5% powdered milk for 60 min, membrane was incubated with primary antibodies against IL IB (Abeam, Ab2105) and P-actin (Santa Cruz, sc-69879) overnight at 4°C subsequently and the corresponding HRP-conjugated secondary antibodies, followed by chemiluminescence detection using a Bio-Rad ChemiDoc XRS+ gel imager.

[0172] Fluorescence microscopy

[0173] Microscopic images were taken with a Nikon Eclipse Ti inverted microscope with a cooled charge-coupled device (CCD) camera. For Fig. ID and Fig. 16B, HEK 293T or primary human T cells were dropped onto uncoated glass-bottom dishes (Cell E&G, GBD00002-200) followed immediately by imaging. For Fig. 4A, HEK 293T cells were resuspended in staining media (regular media containing JANELIA FLUOR® HALOTAG® Ligands at 1 :2000 dilution) and seeded onto fibronectin (Sigma Aldrich, F1141)-coated glassbottom dishes. Three hours later, staining media were washed out three times and replaced with regular media. Images were taken 6 h after seeding.

[0174] Staining and flow cytometry

[0175] Staining was performed using fluorophore-conjugated antibodies according to manufacturers’ protocols. Flow cytometry analysis was performed using BD Accuri C6 or SONY SH800. Gating was based on non-engineered cells with the same staining (if any) with gating strategy illustrated in Fig. 10A. Flow cytometry data were analyzed using Flow Jo software (FlowJo).

[0176] Methylation detection

[0177] CXCR4-targeting FUS-CRISPRi Nalm6 cells without HS (CT) or 10 days after HS were used. Genomic DNA was extracted from cells using Quick-DNA Miniprep Plus Kit (Zymo Research, D4068). Bisulfite conversion was performed using EpiJET Bisulfite Conversion Kit (Thermo Scientific, K1461). PCR was performed using primer pairs5’-GAGGTGGGTAGTTGGAAGTTTTTAG-3’ (SEQ ID NO:1), 5’-ATAATTTAACCTCCCCTTTAAC ACC-3’ (SEQ ID NO:2) (for region 1), 5’-GGGATTTAAGGGGGAGATATATGTAG-3’ (SEQ ID NO:3), 5’- AAAACCTAAATACTCCAATAACCAC-3’ (SEQ ID NO:4) (for region 2), 5’-GTTTTTTGTTTATTGTGTTGGGAGA-3’ (SEQ ID NO: 5), 5’-TACATATATCTCCCCCTTAAATCC-3’ (SEQ ID NO:6) (for region 3) followed by Sanger sequencing (Fig. 12C). The results were analyzed using QUMA, a quantification tool for methylation analysis.

[0178] Transwell migration assay

[0179] 7 ,5xl04Fluc+ cells in 100 pl culture medium were seeded onto PolycarbonateMembrane Transwell inserts (Corning, 3422). 600 pl culture media containing 10 ng / ml CXCR4 ligand CXCL12 (Peprotech, 300-28 A) were added to the transwell lower chambersas the chemoattractant. The cells in the inserts and the lower chambers were collected separately 3 h later followed by quantification of luminescence as described above.Total luminescence of sample X = Luminescence of X insert + Luminescence of X lower chamber;Migration (%) of sample X = (Luminescence of X lower chamber / Total luminescence of X) x 100%.

[0180] TCR stimulation in Jurkat cells

[0181] Jurkat cells were cultured in cell culture medium containing 1.7 pg / ml anti- TCR antibody (Sigma- Aldrich, 05-919) overnight followed by anti-CD69 antibody staining (Biolegend, 310910).

[0182] Isolation, culture, and lentiviral transduction of primary human T cells

[0183] Human peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats (Excellos) using lymphocyte separation medium (Corning, 25-072-CV), sorted with Pan T Cell Isolation Kit (Miltenyi, 130-096-535) to obtain primary human T cells, and activated by adding Dynabeads (Gibco, 11141D) at 1 : 1 bead-to-cell ratio. Two to three days later, T cells were mixed with lentivirus at multiplicity of infection (MOI) equal to 5 in Retronectin (Takara, T100B)-coated culture plates and centrifuged at 1800 g for 1 h at 32 °C for lentiviral transduction before returning to normal culture condition. Approximately one week later, T cells (with Dynabeads removed) were used for downstream applications or cryopreserved for future usage.

[0184] Quantification of knockout (KO) efficiency

[0185] Genomic DNA was extracted from cells using Quick-DNA Miniprep Plus Kit (Zymo Research, D4068). An approximately 500bp fragment flanking the gRNA target site in the genome of engineered or WT cells was amplified by PCR with primers designed through NCBI Genome Data Viewer and Primer-BLAST (Table 4). Sanger sequencing of the PCR products was performed to obtain trace files, which were uploaded to TIDE (TIDE created by Bas van Steensel lab, shinyapps.datacurators.nl / tide / ) to quantify the KO efficiency.

[0186] T7E1 assay

[0187] T7E1 assay was performed to verify genome editing in Nalm6 cells engineered with PLK1 -targeting FUS-CRISPR with or without HS. T7E1 assay was performed using primers 5’-TGCGAATGGTTGTGGACAGTGTTAAG-3’ (SEQ ID NO: 7), 5’-AGTCTGTGAAGAATAGGGAGGAGTAGAG-3’ (SEQ ID NO: 8) and the ALT-R® Genome Editing Detection Kit following the manufacturer’s protocol (IDT, 1075931).

[0188] Quantification of cell proliferation in vitro

[0189] Cells were stained with a live / dead dye AOPI (Nexcelom, CS2-0106) and counted using an automated cell counter (Nexcelom, Cellometer K2) to determine the cell number before seeding (Day 0). The same number of cells were then seeded in a 24-well plate for different groups. Cell culture media were refreshed every two days. At the time points specified in the corresponding figure legends (Fig. 3H, Fig. 4B), cells were collected and counted again as described above to determine the number of live cells, which was then normalized to the seeding cell number on Day 0 to obtain the normalized cell number.

[0190] Bulk RNA-seq

[0191] Nalm6 cells engineered with telomere-targeting or NT FUS-CRISPR were subjected to 10 min HS or no treatment (CT). Total RNA was collected at 24, 48, and 96 h after HS using the RNA microprep kit (Zymo Research, R1050) and sent for bulk RNA-seq (Novogene). RNA-seq data analysis was performed. Briefly, raw RNA-seq reads were first preprocessed using Ktrim software (vl.4.1) to remove sequencing adaptors and low-quality cycles; PCR duplicates (i.e., reads with identical sequences) and ribosomal RNAs were then removed using in-house programs and the remaining reads were aligned to the human genome (build GRCh38 / hg38) using STAR software (v2.7.9a); expression quantification were performed using featureCounts software (v2.0.3) against RefSeq gene annotation; differential expression analysis were performed using DESeq2 software (vl.26.0); genes with an expression change larger than 1.5-fold and adjusted p-value smaller than 0.05 were considered as differentially expressed genes (DEGs). Functional annotation of the DEGs was performed using DAVID webserver. RNA-seq results from the three time points (24, 48, and 96 h) in the same treatment group were considered as three repeats for data analysis in Fig. 4D, 4E and Fig. 15.

[0192] Luciferase-based in vitro cytotoxicity assay

[0193] For Fig. 4G, 4H, 2 x 104Fluc+FUS-CRISPR-engineered Nalm6 cells with 10 min HS (HS) or without (CT) were cultured alone (w / o T), or aCD19CAR-T cells were mixed with 2 x 104Fluc+FUS-CRISPR-engineered Nalm6 cells at an E:T ratio of 1 :20 and co-cultured (w / T) in 96-well plates. Culture media were renewed at 48 h by replacing one- third volume of the supernatant with fresh media. Flue luminescence was measured 72 h after co-culture using the Bright-Glo Luciferase Assay System (Promega, E2610) and a Tecan Infinite M200 Pro plate reader. Flue luminescence represents the amount of surviving Nalm6 tumour cells.

[0194] For Fig. 6D, 2 x 104Fluc+PC3 cells engineered with FUS-CRISPR AAVs (Fig. 18 A) with 15 min HS (HS) or without (CT) were either cultured alone (w / o T), or cocultured with aCD19-synNotch PSMACAR-T cells 24 h after HS at E:T = 1 : 1 (w / T) in 96- well plates. Flue luminescence was measured 24 h after co-culture as described above.Tumour survival (%) of sample X = (Luminescence of X / mean Luminescence of “CT, w / o T” samples) x 100%;Cytotoxicity (%) of CAR-T cells in sample X = 100% - Tumour survival (%) of X.

[0195] Animals

[0196] Animal studies were approved in Protocol SI 5285 by UCSD Institutional Animal Care and Use Committee (IACUC). All researchers complied with animal-use guidelines and ethical regulations during animal studies. Six-to-eight weeks old male NOD.Cg-Prkdcscid I12rgtmlWjl / SzJ (NSG) mice were purchased from Jackson Laboratory or UCSD Animal Care Program.

[0197] In vivo bioluminescence imaging

[0198] In vivo bioluminescence imaging (BLI) of firefly luciferase signals was performed using Lumina LT Series III (PerkinElmer). Firefly luciferase substrate D-luciferin (GoldBio, LUCK-1G) was administered intraperitoneally, followed by BLI approximately 10 min later until capture of the peak signal. Images were analyzed with Living Image software (PerkinElmer). The integrated luminescence reading within a fixed region of interest (ROI) over the tumour was used to represent the tumour size.

[0199] FUS system / Ultrasonography system

[0200] We developed a FUS system with real-time temperature control feedback loop for generating localized hyperthermia in vitro and in vivo (Fig. 7A). A focused 1.1-MHz single element transducer was fabricated in-house using a pre-focused modified PZT (diameter: 70mm, radius of curvature: 65mm, DL-47, Del Piezo Specialties) with a 20 mm hole in the center. A coupling cone (length: 65mm) with an opening (diameter: 4mm) at the tip was 3D-printed and glued to the transducer to hold degassed water through the acoustic path and to guide the ultrasound focus. The opening at the tip of the cone was sealed with acoustically transparent thin-film (Chemplex, 100). Deionized water was degassed with a vacuum pump (Vevor). A function generator (Sanford Research System, SG386) and a 50dB power amplifier (E&I, 325LA) were used to feed pulsed sine waves to the transducer.

[0201] For FUS stimulation on cells in vitro (Fig. 7B, 7C), cells were resuspended in 50pl medium in a PCR tube. The cell-containing PCR tube was fixed on the acoustic absorber (Precision Acoustics, F28-SMALL) below the transducer. A needle-typethermocouple (Physitemp Instruments, MT-29 / 2HT) was inserted into the tube to measure the temperature of the cell medium with a thermometer (Omega, HH806AU). Acoustic gel (Aquasonic, 26354) was applied between the transducer and the tube.

[0202] For in vivo FUS stimulation (Fig. 7D, 7E), the anesthetized mouse was placed on its side on the animal bed with an embedded acoustic absorber. The animal bed is placed on a heating plate (Auber Instruments, WSD-30B) set to 37°C to maintain the body temperature of the anesthetized mouse. The needle-type thermocouple was inserted into the tumour region subcutaneously to measure the temperature. Acoustic gel was generously applied. The FUS transducer was placed above the mouse to focus on the tumour. Stable heat generation and induction of heat-sensitive transgene expression in vitro and in vivo using this FUS system was validated (Supplementary Fig. 7F-7H).

[0203] The temperature readings were fed to a proportional-integral-derivative (PID) controller in real-time to adjust the output power of the function generator to maintain the focal temperature at the target value. All in vivo FUS stimulation was targeted at 43 °C for 10 min or less with 90-95% duty cycle and 500 ms PRT. The code repository for the PID controller and the device interfaces can be found at github.com / phuongho43 / ultrasound_pid. Ultrasound duty cycle is the percentage of time the ultrasound signal is “on”; and it is calculated by dividing the time the sound is delivered by the total time the sound head is applied. Pulse repetition period (PRT = 1 / PRF), and PRF stands for pulse repetition frequency.

[0204] In vivo tumour model

[0205] For the Nalm6 tumour model, 2 x 105Nalm6 cells were injected subcutaneously into NSG mice on Day 0. FUS stimulation (43 °C, 10 min) targeted at the tumour region was performed on Day 9 and Day 12 in the FUS+ groups. 2 x 106CD19CAR- T cells were administered intravenously on Day 10 in the indicated groups. Tumour aggressiveness was monitored by BLI and caliper measurement (volume = length x width2 / 2).

[0206] For the PC3 tumour model, 1 x 106PSMA+ Fluc+ PC3 cells were injected subcutaneously into NSG mice on Day 0. The two FUS-CRISPR AAVs of similar titers (Fig. 18 A) were mixed at 1 : 1 ratio (25 pl each) and injected intratumourally on Day 17 when the PC3 tumours were approximately 50 mm3. The AAVs were produced by the GT3 Core Facility of the Salk Institute with titers of 9.31E+11 genome copy (GC) / mL (AAV2-7HYB- Cas9) and 1.22E+12 GC / mL (AAV2-U6-gRNAl-U6-gRNA2-PGK-tCD19reporter). Tumours were treated with or without FUS stimulation (43 °C, 10 min) on Day 20 and Day25. On Day 23, 8 x 106aCD19-SynNotch PSMACAR-T cells were injected intravenously. Tumour aggressiveness was monitored by BLI.

[0207] Software and statistical analysis

[0208] Data were graphed and the corresponding statistical analysis was performed in GraphPad Prism 9.0.0. The detailed statistical test methods were indicated in the corresponding figure legends. Microscopy images were analyzed in Fiji ImageJ2 2.3.0. Schematic figures were created with BioRender.com.

[0209] Code availability

[0210] The code repository for the PID controller and the device interfaces for the inhouse built FUS system can be found at github.com / phuongho43 / ultrasound_pid.Table 1. List of plasmids used in this study.(* In various aspects, dCas9-NLS-VP64 protein consists of dCas9 fused to a SV40 nuclear localization signal (NLS) and the viral VP64 transcription activation domain, which efficiently recruits RNA Pol II to initiate transcription. For example, sequence Pro-Lys-Lys- Lys-Arg-Lys-Val (SEQ ID NO:52) can act as a nuclear location signal.).Table 2. Sequences of gRNAs used in this study.Table 4, Sequences of genotyping PCR primers used in this study.

[0211] Various embodiments of the invention are described above in the Detailed Description. While these descriptions directly describe the above embodiments, it is understood that those skilled in the art may conceive modifications and / or variations to the specific embodiments shown and described herein. Any such modifications or variations that fall within the purview of this description are intended to be included therein as well. Unless specifically noted, it is the intention of the inventors that the words and phrases in the specification and claims be given the ordinary and accustomed meanings to those of ordinary skill in the applicable art(s).

[0212] The foregoing description of various embodiments of the invention known to the applicant at this time of filing the application has been presented and is intended for the purposes of illustration and description. The present description is not intended to be exhaustive nor limit the invention to the precise form disclosed and many modifications and variations are possible in the light of the above teachings. The embodiments described serve to explain the principles of the invention and its practical application and to enable others skilled in the art to utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated. Therefore, it is intended that the invention not be limited to the particular embodiments disclosed for carrying out the invention.

[0213] While particular embodiments of the present invention have been shown and described, it will be obvious to those skilled in the art that, based upon the teachings herein, changes and modifications may be made without departing from this invention and its broader aspects and, therefore, the appended claims are to encompass within their scope all such changes and modifications as are within the true spirit and scope of this invention. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, and respective component(s) thereof, that are useful to an embodiment, yet open to the inclusion of unspecified elements, whether useful or not. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). Although the open-ended term “comprising,” as a synonym of termssuch as including, containing, or having, is used herein to describe and claim the invention, the present invention, or embodiments thereof, may alternatively be described using alternative terms such as “consisting of’ or “consisting essentially of.”

[0214] In some embodiments, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment of the invention (especially in the context of certain of the following claims) can be construed to cover both the singular and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein.

[0215] Unless specifically stated or obvious from context, as used herein, the term “about” is understood as within a range of normal tolerance in the art, for example within 2 standard deviations of the mean. About can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term “about.”

Claims

WHAT IS CLAIMED IS:

1. A heat-inducible gene editing system, comprising:(i) a nucleotide sequence encoding a heat-sensitive promoter,(ii) a nucleotide sequence encoding a clustered regularly interspaced palindromic repeats (CRISPR)-associated (Cas) endonuclease or a mutant form of the Cas endonuclease lacking endonuclease cleavage activity, and(iii) a nucleotide sequence encoding at least one guide RNA (gRNA) that hybridizes with a target sequence, wherein the nucleotide sequence encoding the heat-sensitive promoter is operably linked to the nucleotide sequence encoding the Cas endonuclease or the mutant form of the Cas endonuclease, or is operably linked to the nucleotide sequence encoding the at least one gRNA; and wherein the heat-inducible gene editing system does not include an inorganic nanoparticle, optionally the inorganic nanoparticle comprising gold nanorod, and is not complexed with a polycationic polymer or a semiconducting polymer.

2. The gene editing system of claim 1, further comprising an ultrasonography system comprising an ultrasound transducer, a thermometer, and an acoustic gel, and optionally a thermocouple and a controller.

3. The gene editing system of claim 1, further comprising: a polynucleotide sequence encoding a first ligand, wherein the first ligand is not a naturally-occurring ligand for Notch receptor; and a polynucleotide sequence encoding a synthetic Notch receptor, wherein the synthetic Notch receptor specifically binds the first ligand and effectuates release of a regulatory protein comprising Gal4, and a polynucleotide sequence encoding a chimeric antigen receptor whose expression is driven by a promoter with an upstream activation sequence (UAS) specifically activatable by binding of the Gal4, wherein the synthetic Notch receptor comprises a) an extracellular domain that specifically binds the first ligand, b) a Notch regulatory region comprising a ligand-inducible proteolytic cleavage site, and c) an intracellular domain comprising the Gal4; ora T cell or NK cell engineered with the synthetic Notch receptor and the chimeric antigen receptor.

4. The gene editing system of any one of claims 1-3, wherein the nucleotide sequence of (ii) encodes the Cas endonuclease comprising Cas9, Casl2a, or Casl3.

5. The gene editing system of any one of claims 1-3, wherein the nucleotide sequence of (ii) encodes the mutant form of the Cas endonuclease comprising endonuclease deficient Cas9 (dCas9), endonuclease deficient Cas 12a (dCasl2a), or endonuclease deficient Cas 13 (dCasl3).

6. The gene editing system of claim 5, further comprising:(iv) a nucleotide sequence encoding a transcriptional activator or (v) a nucleotide sequence encoding an epigenetic regulator or a transcriptional repressor; and optionally(vi) a nucleotide sequence encoding a multimerized epitope and (vii) a nucleotide sequence encoding an affinity domain that specifically binds the epitope; wherein the nucleotide sequence encoding the multimerized epitope, when present, is operably linked to the nucleotide sequence encoding the mutant form of the Cas endonuclease, thereby the multimerized epitope and the mutant form of the Cas endonuclease being expressible as a first fusion protein; and wherein the nucleotide sequence encoding the affinity domain, when present, is operably linked to the nucleotide sequence encoding the epigenetic regulator or transcriptional repressor or the nucleotide sequence encoding the transcriptional activator, thereby the affinity domain and the epigenetic regulator, the transcriptional repressor, or the transcriptional activator being expressible as a second fusion protein.

7. The gene editing system of claim 1, wherein the nucleotide sequence of (i) is operably linked to the nucleotide sequence of (iii), such that the gRNA is driven by the heatsensitive promoter; and wherein the nucleotide sequence of (iii) encodes the gRNA flanked by a hammerhead (HH) ribozyme and a hepatitis delta virus (HDV) ribozymes.

8. The gene editing system of claim 1, wherein the nucleotide sequence of (i) is operably linked to the nucleotide sequence of (ii), such that the Cas endonuclease is driven by the heat- sensitive promoter.

9. The gene editing system of claim 6, wherein the nucleotide sequence of (i) is operably linked to the nucleotide sequence of (ii), wherein the nucleotide sequence of (ii)encodes the mutant form of the Cas endonuclease, such that the mutant form of the Cas endonuclease is driven by the heat-sensitive promoter.

10. The gene editing system of any one of preceding claims, wherein the at least one gRNA targets telomere and optionally has a nucleic acid sequence of SEQ ID NO:21, or the target sequence comprises repetitive telomere sequence.

11. The gene editing system of any one of preceding claims, wherein the heat-sensitive promoter is a mammalian or human promoter operably linked to a heat-shock element (HSE), optionally the HSE being two or more (optionally 2-7) repeats of 5’- nGAAnnTTCnnGAAn-3’, and optionally the mammalian or human promoter being HSPA1A, HSPH1, HSPB1, or a synthetic promoter YB-TATA.

12. The gene editing system of claim 11, wherein the heat-sensitive promoter comprises human heat-shock protein 70 (HSP70) promoter or a 7H-YB promoter, wherein the 7H-YB promoter comprises 7 repeats of a heat-shock element (HSE) operably linked to and upstream of YB-TATA promoter.

13. The gene editing system of any one of preceding claims, wherein the transcriptional factor comprises a polypeptide comprising multiple repeats of Herpes simplex virus protein 16 (VP 16) transactivation domain.

14. The gene editing system of claim 6, wherein the epigenetic regulator comprises DNMT3 A3L, DNMT3 A, or a mutant thereof.

15. A method for remotely-modulating and / or non-invasively modulating gene expression in a cell, comprising: introducing a gene editing system of any one of claims 1-14 to the cell for expression therein, and stimulating the cell with ultrasound or heat, thereby activating the heatsensitive promoter for expression of its operably linked nucleotide sequence, wherein the gRNA binds the target sequence.

16. The method of claim 15, wherein the stimulation is with ultrasound, and the method further comprises inserting a thermocouple to or near the cell to monitor temperature at or near the cell, and optionally temperature reading being fed to a controller to control intensity of the ultrasound.

17. The method of claim 15, wherein the method results in or is effective for increasing a gene expression by at least 5, 6, 7, 8, 9, 10, or 11 -fold compared to that in the absence of the gene editing system or in the absence of the ultrasound or heat stimulation.

18. The method of claim 15, wherein the method results in or is effective for repressing a gene expression for at least 1, 5, 10, 20, 30, or 40 days, and the repression is reversible.

19. The method of claim 15, wherein the stimulation comprises increasing temperature by 3°C-7°C or to about 39°C-44°C.

20. A method for treating a subject having a tumor, comprising: introducing to a tumor cell of the subject a gene editing system according to claim 10 for expression therein, and stimulating the tumor cell with ultrasound or heat, thereby activating the heatsensitive promoter for expression of its operably linked nucleotide sequence, wherein the subject has received a chimeric antigen receptor (CAR)- engineered immune cell (optionally T cell) therapy against the tumor or wherein the method further comprises administering to the subject the CAR-engineered immune cell.

21. The method of claim 20, wherein the gene editing system further comprises a polynucleotide sequence encoding a first cell-surface ligand that is not a naturally- occurring ligand for Notch receptor; wherein the CAR-engineered immune cell further expresses a synthetic Notch receptor, wherein the synthetic Notch receptor is configured for specifically binding the first ligand and releasing intracellularly a regulator protein comprising Gal4; wherein nucleotide sequence encoding the CAR contains an upstream activation sequence (UAS) which is activated upon binding of the regulatory protein comprising the Gal4; and wherein the method further comprises expressing the first ligand on the tumor cell surface, thereby inducing expression of the CAR in the immune cell, so as to inhibit or reduce the tumor in the subject.

22. The method of claim 20, wherein the introduction of the gene editing system to the tumor cell comprises delivery of the gene editing system via an adeno-associated virus.

23. A genetically engineered cell engineered with a gene editing system of any one of claims 1-14.

24. An expression vehicle, a recombinantly engineered virus, or a vector, comprising one or multiple transcripts from the gene editing system of any one of claims 1-14.

Citation Information

Patent Citations

  • Thermal bioswitches and related genetic circuits, vectors, cells, compositions, methods and systems

    US20170298425A1

  • Compositions and methods for controlled expression of antigen-specific receptors

    WO2020018964A1

  • Engineered CAS endonuclease variants for improved genome editing

    WO2022082179A2

  • Systems, methods, and compositions comprising miniature crispr nucleases for gene editing and programmable gene activation and inhibition

    WO2022266298A1