Construction method and use of rhodosporidium toruloides engineered strain with high yield of ergothioneine

Abstract

A construction method and a use of a Rhodosporidium toruloides engineered strain with a high yield of ergothioneine. The method comprises the following steps: heterologously expressing, in Rhodosporidium toruloides, Neurospora crassa-derived ergothioneine synthetase encoding genes Ncegt1 and Ncegt2, and a Saccharomyces cerevisiae-derived ATP sulfatase encoding gene MET14, and weakening a fatty acid synthesis pathway key gene ACC1. Experiments prove that: the constructed Rhodosporidium toruloides engineered strain with a high yield of ergothioneine uses glucose as a unique carbon source, and is cultured for 72 h in a 5 L fermentation tank, and the yield of ergothioneine can reach 6.2 g / L.

Description

A method for constructing an engineered strain of Rhodosporidium toruloides with high ergothioneine production and its application Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a method for constructing a Rhodosporidium toruloides engineered strain for efficiently producing ergothioneine and an application thereof, and particularly to a Rhodosporidium toruloides engineered strain heterologously expressing ergothioneine synthase genes Ncegt1 and Ncegt2 from Neurospora crassa and an ATP sulfurylase gene MET14 from Saccharomyces cerevisiae, and weakening a key gene ACC1 in a fatty acid synthesis pathway, and an application thereof in fermentative production of ergothioneine. Background Art

[0002] Ergothioneine (EGT) is a sulfur-containing amino acid found in ergot fungi. In liquid form, EGT exists as thioketones and thiols, with the thioketone being the predominant form in neutral or alkaline environments. It is a valuable and effective antioxidant with great potential for improving neurodegenerative and cardiovascular diseases. Ergothioneine can also be synthesized in a small number of other organisms, such as Neurospora crassa, mycobacteria, and filamentous fungi, but the highest yield is only 2 mg / L.

[0003] Ergothioneine production methods include chemical synthesis, extraction, and microbial synthesis. Due to the high cost and complex processes of chemical synthesis and extraction, microbial fermentation is preferred by researchers. In nature, EGT is produced via two distinct pathways: bacterial and fungal. Both pathways utilize S-adenosylmethionine (SAM) to methylate histidine three times using either the ergothioneine biosynthesis methyltransferase (encoded by egtD) or the ergothioneine biosynthesis protein 1 (encoded by Egt1) to form histidine betaine. In the fungal pathway, histidine is methylated three times by Egt1 to form hycine. The same enzyme then ligates cysteine ​​to form hycine cysteine ​​sulfoxide. Ammonium pyruvate is then separated from the intermediate by the β-lyase Egt2, and sulfur reduction subsequently produces EGT. Compared to the bacterial pathway, this fungal pathway involves only two enzymes and does not require γ-glutamyl-cysteine, thus eliminating competition between EGT and glutathione biosynthesis, making it more efficient than the bacterial pathway.

[0004] SUMMARY OF THE INVENTION

[0005] The technical problem to be solved by the present invention is how to construct a toruloides rhodosporium yeast engineering bacterium with high yield of thioneine.The technical problem to be solved is not limited to the described technical themes, and those skilled in the art can clearly understand other technical themes not mentioned herein by the following description.

[0006] In order to solve the above technical problems, the present invention first provides a method for constructing an ergothioneine-producing recombinant bacterium.

[0007] The method for constructing an ergothioneine-producing recombinant bacterium provided by the present invention comprises the following steps: increasing the content and / or activity of ergothioneine synthases Ncegt1 and Ncegt2 derived from Neurospora crassa in rhodosporidium toruloides; increasing the content and / or activity of ATP sulfurylase MET14 derived from Saccharomyces cerevisiae in the rhodosporidium toruloides, and reducing the content and / or activity of ACC1, a key protein in the fatty acid synthesis pathway in the rhodosporidium toruloides.

[0008] In the above method, the ergothioneine synthase Ncegt1 is a protein of A1) or A2):

[0009] A1) a protein having an amino acid sequence of SEQ ID No. 2;

[0010] A2) A protein derived from A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID No. 2, having more than 80% identity with A1) and having ergothioneine synthase Ncegt1 activity.

[0011] The ergothioneine synthase Ncegt2 is a protein of B1) or B2):

[0012] B1) a protein having an amino acid sequence of SEQ ID No. 4;

[0013] B2) A protein derived from B1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID No. 4, which has more than 80% identity with B1) and has ergothioneine synthase Ncegt2 activity.

[0014] The ATP sulfurylase MET14 is a protein of C1) or C2):

[0015] C1) a protein having an amino acid sequence of SEQ ID No. 9;

[0016] C2) A protein derived from C1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID No. 9, which has more than 80% identity with C1) and has ATP sulfurylase MET14 activity.

[0017] The key protein ACC1 of the fatty acid synthesis pathway is a protein of D1) or D2):

[0018] D1) a protein having an amino acid sequence of SEQ ID No. 15;

[0019] D2) A protein derived from D1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID No. 15, which has more than 80% identity with D1) and has the activity of ACC1, a key protein in the fatty acid synthesis pathway.

[0020] The identity described in A1), B1), C1), and D1) above refers to amino acid sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, a search can be performed using blastp as the program, setting the Expect value to 10, all filters to OFF, BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity (%) can be calculated. The identity includes amino acid sequences that are 85% or greater, 90% or greater, or 95% or greater identical to the amino acid sequences set forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 9, or SEQ ID No. 15 of the present invention.

[0021] Further, the coding gene of the ergothioneine synthase Ncegt1 is a DNA molecule of a1) or a2):

[0022] a1) a DNA molecule whose nucleotide sequence is SEQ ID No. 1;

[0023] a2) A DNA molecule that has more than 90% identity with the DNA molecule described in a1) and encodes the ergothioneine synthase Ncegt1.

[0024] The coding gene of the ergothioneine synthase Ncegt2 is a DNA molecule of b1) or b2):

[0025] b1) a DNA molecule whose nucleotide sequence is SEQ ID No. 3;

[0026] b2) A DNA molecule that has more than 90% identity with the DNA molecule described in b1) and encodes the ergothioneine synthase Ncegt2.

[0027] The coding gene of the ATP sulfurylase MET14 is a DNA molecule of c1) or c2):

[0028] c1) a DNA molecule whose nucleotide sequence is SEQ ID No. 8;

[0029] c2) A DNA molecule that has more than 90% identity with the DNA molecule described in c1) and encodes the ATP sulfurylase MET14.

[0030] The coding gene of the fatty acid synthesis pathway protein ACC1 is a DNA molecule of d1) or d2):

[0031] d1) a DNA molecule having a nucleotide sequence of SEQ ID No. 14;

[0032] d2) A DNA molecule that has more than 90% identity with the DNA molecule described in d1) and encodes the key protein ACC1 in the fatty acid synthesis pathway.

[0033] The identity described in a2), b2), c2) or d2) above refers to sequence similarity with a natural nucleic acid sequence, including nucleotide sequences that have 91% or higher, or 92% or higher, or 93% or higher, or 94% or higher, or 95% or higher, or 96% or higher, or 97% or higher, or 98% or higher, or 99% or higher identity with the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 9, or SEQ ID No. 15. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0034] In the above method, the method for increasing the content and / or activity of ergothioneine synthases Ncegt1 and Ncegt2 derived from Neurospora crassa in Rhodosporidium toruloides can be overexpressing ergothioneine synthases Ncegt1 and Ncegt2 derived from Neurospora crassa in Rhodosporidium toruloides.

[0035] Furthermore, the overexpression method can be to introduce the coding genes of ergothioneine synthase genes Ncegt1 and Ncegt2 into Rhodosporidium toruloides.

[0036] Furthermore, the coding genes of the ergothioneine synthase genes Ncegt1 and Ncegt2 can be introduced into Rhodosporidium toruloides via a recombinant plasmid.

[0037] In a preferred embodiment, the recombinant plasmid contains two Ncegt1-P2A-Ncegt2 fragments, and the transcription of these two fragments is controlled by promoter Pgpd1 and promoter Ppgk2 respectively.

[0038] In a preferred embodiment, the recombinant plasmid is a 2*Ncegt1-P2A-Ncegt2 plasmid; the 2*Ncegt1-P2A-Ncegt2 plasmid is obtained by replacing the fragment between the Xba I and Spe I restriction sites in the Ncegt1-P2A-Ncegt2 plasmid with the Ppgk2-Ncegt1-P2A-Ncegt2-Tnos2 fragment. The Ncegt1-P2A-Ncegt2 plasmid is obtained by replacing the fragment between the Nco I and EcoRⅤ restriction sites in the pkocar2 vector with the Ncegt1-P2A-Ncegt2 fragment. The transcription of both the Ncegt1 and Ncegt2 genes is controlled by the Pgpd1 promoter.

[0039] The nucleotide sequence of the Ncegt1-P2A-Ncegt2 fragment is shown in SEQ ID No.6.

[0040] The nucleotide sequence of the Ppgk2-Ncegt1-P2A-Ncegt2-Tnos2 fragment is shown in SEQ ID No.7.

[0041] In the above method, the method for increasing the content and / or activity of Saccharomyces cerevisiae-derived ATP sulfurylase MET14 in Rhodosporidium toruloides can be overexpressing ATP sulfurylase MET14 in Rhodosporidium toruloides.

[0042] Furthermore, the overexpression method may be to introduce the gene encoding ATP sulfurylase MET14 into Rhodosporidium toruloides.

[0043] Furthermore, the gene encoding the ATP sulfurylase MET14 is introduced into Rhodosporidium toruloides via a recombinant plasmid.

[0044] In a preferred embodiment, the transcription of the MET14 gene in the recombinant plasmid is controlled by the promoter Pgpd1.

[0045] In a preferred embodiment, the recombinant plasmid is a pkocar2-MET14 plasmid; the pkocar2-MET14 plasmid is a vector obtained by replacing the fragment between the Nco I and EcoRⅤ restriction sites in the pkocar2 vector with a MET14 gene sequence fragment.

[0046] In the above method, the method for reducing the content and / or activity of the key protein ACC1 in the fatty acid synthesis pathway in Rhodosporidium toruloides can be to introduce a substance that reduces the activity of the key protein ACC1 in the fatty acid synthesis pathway or a substance that reduces the content of the key protein ACC1 in the fatty acid synthesis pathway into Rhodosporidium toruloides.

[0047] Furthermore, the substance that reduces the activity of the key protein ACC1 in the fatty acid synthesis pathway may be a protein, polypeptide or small molecule compound that inhibits the function of the key protein ACC1 in the fatty acid synthesis pathway.

[0048] The substance that reduces the content of the key protein ACC1 in the fatty acid synthesis pathway can be a substance that inhibits the synthesis of the key protein ACC1 in the fatty acid synthesis pathway or promotes the degradation of the key protein ACC1 in the fatty acid synthesis pathway or knocks down or knocks out the gene encoding the key protein ACC1 in the fatty acid synthesis pathway.

[0049] Furthermore, the substance that knocks down the gene encoding the key protein ACC1 in the fatty acid synthesis pathway can be any substance that can prevent the expression of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway, such as miRNA, siRNA, dsRNA, shRNA, etc. that interfere with the expression of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway.

[0050] The material for knocking out the gene encoding the key protein ACC1 of the fatty acid synthesis pathway can be a material that achieves in any way that the host cell does not produce the functional protein product of the gene, specifically by removing all or part of the encoding gene sequence, introducing a mutation so that no functional protein is produced, removing or changing regulatory components (such as promoter editing) so that the encoding gene sequence is not transcribed, preventing translation by binding to mRNA, etc. Typically, the knockout is carried out at the genomic DNA level so that the offspring of the cell also permanently carry the knockout.

[0051] Furthermore, the substance for knocking out the gene encoding the key protein ACC1 in the fatty acid synthesis pathway is a substance for knocking out the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway. The nucleotide sequence of the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway is shown in SEQ ID No.10.

[0052] In a preferred embodiment, the substance for knocking out the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway can be a CRISPR / Cas9 gene editing system targeting the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway. The CRISPR / Cas9 gene editing system targeting the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway comprises an sgRNA targeting the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway and a Cas9 nuclease.

[0053] In a preferred embodiment, the target sequence of the sgRNA targeting the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway is shown as SEQ ID No.11.

[0054] In a preferred embodiment, the sgRNA targeting the promoter of the gene encoding the key protein ACC1 in the fatty acid synthesis pathway is shown as SEQ ID No.12.

[0055] In the above method, the Rhodosporidium toruloides can be any Rhodosporidium toruloides known in the art, specifically Rhodosporidium toruloides Rt.Δku70 strain, Rhodosporidium toruloides NP11 strain, Rhodosporidium toruloides BUCT010 strain or Rhodosporidium toruloides BUCT011 strain.

[0056] In a specific embodiment of the present invention, the recombinant bacteria may be Rhodosporidium toruloides HYRT1001 CGMCC No.27505.

[0057] In order to solve the above technical problems, the present invention further provides a recombinant bacterium constructed according to the above construction method.

[0058] In a preferred embodiment, the recombinant bacterium is Rhodosporidium toruloides HYRT1001, whose deposit number is CGMCC No.27505.

[0059] The Rhodosporidium toruloides HYRT1001 was deposited on May 31, 2023 at the General Microbiology Center of the China Culture Collection Administration (CGMCC; address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; Postal Code: 100101).

[0060] In order to solve the above technical problems, the present invention also provides a method for constructing the above-mentioned ergothioneine-producing recombinant bacteria or a new use of the above-mentioned recombinant bacteria.

[0061] The present invention provides a construction method of the above-mentioned thioneine-producing recombinant bacteria, or an application of the above-mentioned recombinant bacteria in producing thioneine, in improving thioneine yield, in preparing a product for producing thioneine, or in preparing a product for improving thioneine yield.

[0062] To achieve the above object, the present invention finally provides a method for producing thioneine.

[0063] The method for producing ergothioneine provided by the present invention comprises the following steps: fermenting and culturing the recombinant bacteria or Rhodosporidium toruloides HYRT1001 to obtain a fermentation product, wherein the fermentation product contains ergothioneine.

[0064] Furthermore, the method comprises the following steps:

[0065] 1) inoculating the above-mentioned recombinant bacteria or Rhodosporidium toruloides HYRT1001 into YPD liquid medium to obtain a seed solution;

[0066] The solvent of the YPD liquid culture medium is water, and the solutes and their concentrations are as follows: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L;

[0067] 2) inoculating the seed liquid into a fermentation medium and culturing the culture medium to obtain a fermentation product;

[0068] The solvent of the fermentation medium is water, and the solutes and their concentrations are: glucose 25g / L, yeast powder 10g / L, peptone 15g / L, KH2PO4 2g / L, MgSO4 0.5g / L, (NH4)2SO4 4.5g / L, FeSO4·7H2O 0.1g / L, MnSO4·H2O 0.1g / L, and biotin 0.5mg / L.

[0069] Furthermore, in 1), the culture condition may be cultured at 30° C. and 250 rpm for 24 hours.

[0070] In the above 2), the culture conditions may be 28° C., a rotation speed of 500-800 rpm, coupled with dissolved oxygen, dissolved oxygen controlled at 40%, aeration volume of 4 L / min, and pH maintained at 6.5 for 72 hours.

[0071] Furthermore, the 2) further comprises the following steps: feeding the feed medium at 10 mL / h during the fermentation for 12-24 hours, sampling and measuring the glucose content every 4 hours, and adjusting the feed flow rate to keep the glucose content below 1 g / L.

[0072] The solvent of the fed-batch culture medium is water, and the solutes and their concentrations are: glucose 500 g / L, yeast powder 60 g / L, and MgSO4·7H2O 0.6 g / L.

[0073] The present invention first constructs a recombinant Rhodosporidium toruloides engineered strain Rt-1 that obtains improved thioneine production by heterologously expressing the ergothioneine synthase encoding genes Ncegt1 and Ncegt2 derived from Neurospora crassa in Rhodosporidium toruloides. Further, by overexpressing the ATP sulfurylase encoding gene MET14 derived from Saccharomyces cerevisiae in the recombinant bacteria Rt-1, while weakening the fatty acid synthesis pathway key gene ACC1, the recombinant Rhodosporidium toruloides engineered strain HYRT1001 that obtains efficient production of thioneine is finally constructed. Experimental results show that the HYRT1001 strain uses glucose as the sole carbon source and is cultivated in a 5L fermentation tank for 72h, and the output of thioneine can reach 6.2g / L. For the industrial production of thioneine, the Rhodosporidium toruloides engineered strain of the efficient production of thioneine constructed by the present invention will produce huge economic benefits and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] FIG1 is a plasmid map of the present invention for constructing two promoters to express Ncegt1 and Ncegt2 genes respectively.

[0075] Figure 2 is a double enzyme digestion verification diagram (SpeI / NcoI, 11263bp / 5490bp / 783bp) of the two promoters expressing Ncegt1 and Ncegt2 gene plasmids in the present invention, wherein M is a DNA marker and 1 is a SpeI / NcoI double enzyme digestion verification plasmid.

[0076] FIG3 is a map of the Ncegt1-P2A-Ncegt2 gene expression plasmid constructed in the present invention.

[0077] Figure 4 is a double enzyme digestion verification diagram of the Ncegt1-P2A-Ncegt2 expression plasmid in the present invention (EcoRV / NcoI, 12065bp / 3017bp / 783bp), wherein M is a DNA marker, and 1 and 2 are EcoRV / NcoI double enzyme digestion verification plasmids.

[0078] FIG5 is a map of the 2*Ncegt1-P2A-Ncegt2 gene expression plasmid constructed in the present invention.

[0079] Figure 6 is a double enzyme digestion verification diagram of the 2*Ncegt1-P2A-Ncegt2 expression plasmid in the present invention (EcoRV / XbaI, 15006bp / 6649bp), wherein M is a DNA marker and No. 5 is a plasmid verified to be correct by double enzyme digestion with EcoRV / XbaI.

[0080] FIG7 is a map of the MET14 gene expression plasmid constructed in the present invention.

[0081] FIG8 is a diagram showing the double enzyme digestion verification of the MET14 gene expression plasmid (Xba I / Pme I, 10649 bp / 1709 bp) in the present invention, wherein M is a DNA Marker, and 1 and 2 are Xba I / Pme I double enzyme digestion verification plasmids.

[0082] Figure 9 is a map of the promoter gRNA plasmid of the ACC1 gene constructed using CRISPR-Cas9 technology in the present invention.

[0083] FIG10 shows the yield of ergothioneine produced by shake flask fermentation of the engineered bacteria obtained by heterologously expressing the ergothioneine synthase encoding genes Ncegt1 and Ncegt2 in four Rhodosporidium toruloides yeasts Rt.Δku70, NP11, BUCT010, and BUCT011, respectively.

[0084] Figure 11 shows the yield of ergothioneine produced by shake flask fermentation of starting bacteria and recombinant bacteria in the present invention.

[0085] Figure 12 shows the output of thioneine produced by fermentation in fermentation tanks of starting bacteria and recombinant bacteria in the present invention.

[0086] Preservation Instructions

[0087] Chinese name: Rhodosporidium toruloides

[0088] Latin name: Rhodosporidium toruloides

[0089] Strain ID: HYRT1001

[0090] Depository: General Microbiology Center of China Culture Collection Administration

[0091] Abbreviation of depository institution: CGMCC

[0092] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing

[0093] Deposit date: May 31, 2023

[0094] CGMCC registration number: CGMCC No.27505 Modes for Carrying Out the Invention

[0095] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0096] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0097] The primer sequences used in the following examples are shown in Table 1.

[0098] Table 1

[0099] In the following examples, the LB liquid medium contained water as the solvent, and the solutes and their concentrations were as follows: 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl. The pH was adjusted to 7.0-7.2. The LB solid medium was supplemented with 1.5% (w / v) agar powder. The medium was sterilized at 121°C for 20 min. After cooling to approximately 50-60°C, spectinomycin was added to a final concentration of 150 μg / mL.

[0100] In the following examples, the YPD liquid medium contained water as the solvent, and the solutes and their concentrations were as follows: 20 g / L peptone, 10 g / L yeast extract, and 20 g / L glucose. YPD solid medium was supplemented with 1.5% (w / v) agar powder and sterilized at 115°C for 30 min.

[0101] The IMA medium described in the following examples was prepared as follows: 15 g of agar powder was added to 905.7 mL of water, sterilized at 121°C for 20 min, and microwaved until the agar was completely dissolved. Then, 10 mL of K salt, 20 mL of M salt, 2.5 mL of 20% NH₄NO₃, 1 mL of 1% CaCl₂, 5 mL of Z salt, 10 mL of 0.01% FeSO₄·7H₂O, 20 mL of 20% glucose, 40 mL of 1 M MES, and 10 mL of 50% glycerol were added. After the IMA was cooled to approximately 50°C, 4 mL of 0.1 M AS was added. Among them, K salt: 20.5% K2HPO4, 14.5% KH2PO4, sterilized at 121℃ for 20min; M salt: 3% MgSO4·7H2O, 1.5% NaCl, 2.5% (NH4)2SO4, sterilized at 121℃ for 20min; Z salt: 0.01% ZnSO4·7H2O, 0.01% CuSO4·5H2O, 0.01% H3BO3, 0.01% MnSO4·H2O, 0.01% Na2MoO4·2H2O, sterilized by filtration.

[0102] The pkocar2 vector in the following examples is described in the document “Koh CM, et al. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC Microbiol. 2014 Feb 27; 14:50.”

[0103] The NM810 (NM8-5S-tRNA-tRNA-SgH) vector in the following examples is described in the document “Schultz JC, et al.. Development of a CRISPR / Cas9 system for high efficiency multiplexed gene deletion in Rhodosporidium toruloides. Biotechnol Bioeng. 2019 Aug; 116(8): 2103-2109.”

[0104] The pZPK-PGK-hyg-Tnos plasmid in the following examples is described in the document “Wang Y, et al. Overexpression of Δ12-Fatty Acid Desaturase in the Oleaginous Yeast Rhodosporidium toruloides for Production of Linoleic Acid-Rich Lipids. Appl Biochem Biotechnol. 2016 Dec; 180(8): 1497-1507.”

[0105] The Rhodosporidium toruloides Δku70 strain (hereinafter referred to as Rt.Δku70) in the following examples is described in the literature “Koh CM, et al. Molecular characterization of KU70 and KU80 homologues and exploitation of a KU70-deficient mutant for improving gene deletion frequency in Rhodosporidium toruloides. BMC Microbiol. 2014 Feb 27; 14:50.”

[0106] The Rhodosporidium toruloides NP11 strain (hereinafter referred to as NP11) in the following examples is recorded in the document “Zhou R, Zhu Z, Zhang S, Zhao ZK. The complete mitochondrial genome of the lipid-producing yeast Rhodotorula toruloides. FEMS Yeast Res. 2020 Sep 1; 20(6): foaa048.”

[0107] The Rhodosporidium toruloides CGMCC 2.1609 strain (hereinafter referred to as BUCT010) in the following examples is described in the literature "Sambles C, Middelhaufe S, Soanes D, Kolak D, Lux T, Moore K, P, Parker D, Lee R, Love J, Aves SJ. Genome sequence of the oleaginous yeast Rhodotorula toruloides strain CGMCC 2.1609. Genom Data. 2017 May 15;13:1-2."

[0108] The Rhodosporidium toruloides CGMCC 2.1389 strain BUCT011 (hereinafter referred to as BUCT011) in the following examples is described in the document “Kamal R, Liu Y, Li Q, Huang Q, Wang Q, Yu X, Zhao ZK. Exogenous l-proline improved Rhodosporidium toruloides lipid production on crude glycerol. Biotechnol Biofuels. 2020 Sep 14; 13: 159.”

[0109] Example 1. Construction of recombinant plasmid

[0110] 1. Construction of plasmids for heterologous expression of ergothioneine synthase encoding genes Ncegt1 and Ncegt2 controlled by two promoters

[0111] 1. Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the thioneine synthase gene Ncegt1 (the nucleotide sequence of the thioneine synthase gene Ncegt1 is shown in SEQ ID No. 1, encoding the protein shown in SEQ ID No. 2) and the thioneine synthase gene Ncegt2 (the nucleotide sequence of the thioneine synthase gene Ncegt2 is shown in SEQ ID No. 3, encoding the protein shown in SEQ ID No. 4). Then, using the Ncegt1 gene sequence as a template and egt1-F / egt1-R as primers, PCR amplification was performed to obtain the Ncegt1 gene sequence fragment; using the Ncegt2 gene sequence as a template and egt2-F / egt2-R as primers, PCR amplification was performed to obtain the Ncegt2 gene sequence fragment.

[0112] 2. Using the pZPK-PGK-hyg-Tnos plasmid as a template and Tnos-F1 / Tnos-R1 as primers, PCR amplification was performed to obtain the Tnos1 gene sequence fragment. Using the pZPK-PGK-hyg-Tnos plasmid as a template and Ppgk-F1 / Ppgk-R1 as primers, PCR amplification was performed to obtain the Ppgk1 gene sequence fragment. The Ncegt1 gene sequence fragment and the Tnos1 gene sequence fragment were ligated by overlapping PCR to obtain the Ncegt1-Tnos1 fragment. The Ncegt2 gene sequence fragment and the Ppgk1 gene sequence fragment were ligated by overlapping PCR to obtain the Ppgk1-Ncegt2 fragment.

[0113] 3. Using the Novozymes C113-ClonExpress-MultiS One-Step Cloning Kit, the Ncegt1-Tnos1 and Ppgk1-Ncegt2 fragments were ligated with the pkocar2 vector, linearized by double digestion with Nco I and Eco RV, to generate a ligation product. The ligation product was then transformed into competent E. coli DH5α cells and evenly plated onto LB plates containing 150 μg / mL spectinomycin. The cells were cultured overnight at 37°C. A single colony was isolated and verified by double digestion with enzymes to obtain the correct plasmid. This plasmid was named Pgdp1-Ncegt1-Tnos1-Ppgk1-Ncegt2-T35s. The plasmid map is shown in Figure 1. Double digestion verification results are shown in Figure 2.

[0114] The Pgdp1-Ncegt1-Tnos1-Ppgk1-Ncegt2-T35s plasmid is obtained by replacing the fragment between the Nco I and Eco RV restriction sites in the pkocar2 vector with the Ncegt1-Tnos1-Ppgk1-Ncegt2 fragment (the nucleotide sequence of the Ncegt1-Tnos1-Ppgk1-Ncegt2 fragment is shown in SEQ ID No. 5). The Ncegt1 and Ncegt2 genes are transcribed by the promoters Pgpd1 and Ppgk1, respectively.

[0115] 2. Construction of a single-copy plasmid for heterologous expression of ergothioneine synthase encoding genes Ncegt1 and Ncegt2 linked by P2A peptide

[0116] 1. Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the ergothioneine synthase genes Ncegt1 and Ncegt2. PCR amplification was then performed using the Ncegt1 gene sequence as a template and egt1-F / egt1-P2A-R primers to obtain the Ncegt1-P2A gene sequence fragment. PCR amplification was performed using the Ncegt2 gene sequence as a template and egt2-P2A-F / egt2-R primers to obtain the P2A-Ncegt2 gene sequence fragment.

[0117] 2. Using the Novozymes C113-ClonExpress-MultiS One-Step Cloning Kit, the Ncegt1-P2A and P2A-Ncegt2 gene sequence fragments were ligated with the pkocar2 vector, linearized by double digestion with Nco I and Eco RV, to produce ligation products. The ligation products were then transformed into competent E. coli DH5α cells and evenly plated onto LB culture plates containing 150 μg / mL spectinomycin. The cells were cultured overnight at 37°C. A single colony was picked and verified by double digestion with enzymes to obtain the correct plasmid, which was named Ncegt1-P2A-Ncegt2. The plasmid map is shown in Figure 3. The double digestion verification results are shown in Figure 4.

[0118] The Ncegt1-P2A-Ncegt2 plasmid is obtained by replacing the fragment between the Nco I and Eco RV restriction sites in the pkocar2 vector with the Ncegt1-P2A-Ncegt2 fragment (the nucleotide sequence of the Ncegt1-P2A-Ncegt2 fragment is shown in SEQ ID No. 6). Both the Ncegt1 and Ncegt2 genes are transcribed under the Pgpd1 promoter.

[0119] 3. Construction of a double-copy plasmid for heterologous expression of the ergothioneine synthase encoding genes Ncegt1 and Ncegt2 linked by P2A peptide

[0120] 1. Using the pZPK-PGK-hyg-Tnos plasmid as a template and Ppgk-F2 / Ppgk-R2 as primers, PCR amplification was performed to obtain the Ppgk2 gene sequence fragment; using the pZPK-PGK-hyg-Tnos plasmid as a template and Tnos-F2 / Tnos-R2 as primers, PCR amplification was performed to obtain the Tnos2 gene sequence fragment; using the Ncegt1-P2A-Ncegt2 plasmid as a template and egt1-pgk-F / egt2-nos-R as primers, PCR amplification was performed to obtain the Ncegt1-P2A-Ncegt2 gene sequence fragment.

[0121] 2. Using the Novozymes C113-ClonExpress-MultiS One Step Cloning Kit, the Ppgk2 gene sequence fragment, the Ncegt1-P2A-Ncegt2 gene sequence fragment, and the Tnos2 gene sequence fragment were ligated with the Ncegt1-P2A-Ncegt2 vector, which had been linearized by double digestion with Xba I and Spe I, to obtain a ligation product. The ligation product was then transformed into Escherichia coli DH5α competent cells and evenly spread on an LB culture dish containing 150 μg / mL spectinomycin. The cells were cultured overnight at 37°C, and a single colony was picked. The correct plasmid was verified by double digestion and named 2*Ncegt1-P2A-Ncegt2. The plasmid map is shown in Figure 5. The double digestion verification results are shown in Figure 6.

[0122] The 2*Ncegt1-P2A-Ncegt2 plasmid is a vector obtained by replacing the fragment between the Xba I and Spe I restriction sites in the Ncegt1-P2A-Ncegt2 plasmid with the Ppgk2-Ncegt1-P2A-Ncegt2-Tnos2 fragment (the nucleotide sequence of the Ppgk2-Ncegt1-P2A-Ncegt2-Tnos2 fragment is shown in SEQ ID No. 7). This plasmid contains two Ncegt1-P2A-Ncegt2 fragments, whose transcription is controlled by the Pgpd1 and Ppgk2 promoters, respectively.

[0123] 4. Construction of gene MET14 plasmid

[0124] 1. Nanjing Qingke Biotechnology was commissioned to synthesize the MET14 gene sequence (the nucleotide sequence of the MET14 gene is shown in SEQ ID No. 8, encoding the protein shown in SEQ ID No. 9). The MET14 gene sequence was used as a template and met14-F / met14-R were used as primers to perform PCR amplification to obtain a MET14 gene sequence fragment.

[0125] 2. Using the Novozymes C113-ClonExpress-MultiS One-Step Cloning Kit, the MET14 gene sequence fragment was ligated with the pkocar2 vector, linearized by double digestion with Nco I and Eco RV, to produce a ligation product. The ligation product was then transformed into competent E. coli DH5α cells and evenly plated onto an LB dish containing 150 μg / mL spectinomycin. The cells were cultured overnight at 37°C. A single colony was isolated and verified by double digestion with enzymes to obtain the correct plasmid. This plasmid was named pkocar2-MET14, and its plasmid map is shown in Figure 7. The double digestion verification results are shown in Figure 8.

[0126] The pkocar2-MET14 plasmid is obtained by replacing the fragment between the Nco I and Eco RV restriction sites in the pkocar2 vector with a MET14 gene sequence fragment. Transcription of the MET14 gene is controlled by the promoter Pgpd1.

[0127] 5. Construction of promoter mutation plasmid of gene ACC1

[0128] 1. sgRNA was designed based on the ACC1 gene promoter sequence (the nucleotide sequence of the ACC1 gene promoter is shown in SEQ ID No. 10). The designed sgRNA target sequence is as follows: CAGCGGGAAGTTCGGTCGGG (SEQ ID No. 11). PCR amplification was performed using primers gRNA-F and gRNA-R as templates to obtain the sgRNA fragment (the nucleotide sequence of the sgRNA fragment is shown in SEQ ID No. 12).

[0129] 2. Use BsaI digestion and ligation to ligate the sgRNA fragment to the NM810 vector linearized with BsaI to obtain a ligation product. The ligation product was then transformed into E. coli DH5α competent cells and evenly spread on an LB culture dish containing 100 μg / mL Kana. Incubate overnight at 37°C, pick a single colony, extract the plasmid, and send it for sequencing. The correctly sequenced plasmid was named NM810-ACC1gRNA. Its plasmid map is shown in Figure 9.

[0130] The NM810-ACC1gRNA plasmid is a vector obtained by ligating the sgRNA fragment into the Bsa I restriction site of the NM810 vector.

[0131] Example 2. Preparation of recombinant bacteria

[0132] 1. Construction of four engineered strains of Rhodosporidium toruloides expressing the ergothioneine synthase genes Ncegt1 and Ncegt2

[0133] Agrobacterium containing the Pgdp1-Ncegt1-Tnos-Ppgk-Ncegt2-T35s plasmid from step 1 of Example 1 was co-cultured with host strains Rt.Δku70, NP11, BUCT010, and BUCT011 on IMA plates, respectively. The co-cultures were then transferred to YPD plates containing 300 μM cefotaxime and 150 μg / mL hygromycin B and cultured at 30°C until a single colony was formed. Single colonies were picked and transferred to YPD plates containing hygromycin B. Hygromycin B-resistant transformants were screened and the genome was extracted for verification. Correct transformants were collected and inoculated on plates containing 30 μg / mL doxycycline to induce the hph resistance selection marker to be excised from the genome, and the hygromycin-sensitive Ncegt1 and Ncegt2 gene-expressing strains Ncegt1 and Ncegt2 / OE were obtained, which were designated as Rt.Δku70-1, NP11-1, BUCT010-1 and BUCT011-1, respectively.

[0134] 2. Construction of four engineered strains of Rhodosporidium toruloides expressing the ergothioneine synthase genes Ncegt1 and Ncegt2

[0135] Agrobacterium containing the Ncegt1-P2A-Ncegt2 plasmid from step 2 of Example 1 was co-cultured with host strains Rt.Δku70, NP11, BUCT010, and BUCT011 on IMA plates. The co-cultures were then transferred to YPD plates containing 300 μM cefotaxime and 150 μg / mL hygromycin B and cultured at 30°C until single colonies were formed. Single colonies were picked and transferred to YPD plates containing hygromycin B. Hygromycin B-resistant transformants were screened for genome extraction and verification. Correct transformants were collected and inoculated on plates containing 30 μg / mL doxycycline to induce excision of the hph resistance selection marker from the genome, resulting in hygromycin-sensitive single-copy Ncegt1 and Ncegt2 gene-expressing strains Ncegt1-P2A-Ncegt2 / OE, designated Rt.Δku70-2, NP11-2, BUCT010-2, and BUCT011-2, respectively.

[0136] 3. Construction of a Rhodosporidium toruloides strain expressing two copies of the ergothioneine synthase genes Ncegt1 and Ncegt2

[0137] Agrobacterium containing the 2*Ncegt1-P2A-Ncegt2 plasmid from step 3 of Example 1 was co-cultured with the host strain Rt.Δku70 on an IMA plate. The co-culture was then transferred to a YPD plate containing 300 μM cefotaxime and 150 μg / mL hygromycin B and cultured at 30°C until a single colony was formed. A single colony was picked and transferred to a YPD plate containing hygromycin B. Hygromycin B-resistant transformants were screened for genome verification. Correct transformants were collected and inoculated on a plate containing 30 μg / mL doxycycline to induce excision of the hph resistance selection marker from the genome, obtaining a hygromycin-sensitive double-copy Ncegt1 and Ncegt2 gene-expressing strain 2*Ncegt1-P2A-Ncegt2 / OE, which was designated Rt-1.

[0138] 4. Construction of a MET14-expressing Rhodosporidium toruloides strain

[0139] Agrobacterium containing the pkocar2-MET14 plasmid in step 4 of Example 1 was co-cultured with the recombinant bacteria Rt-1 on an IMA plate, and the co-culture was then transferred to a YPD plate containing 300 μM cefotaxime and 150 μg / mL hygromycin B and cultured at 30°C until a single clone was formed. A single clone was picked and transferred to a YPD plate containing hygromycin B, and hygromycin B-resistant transformants were screened for genome verification. Correct transformants were collected and inoculated on a plate containing 30 μg / mL doxycycline, and the hph resistance selection marker was induced to be excised from the genome to obtain a hygromycin-sensitive MET14 gene expression strain (2*Ncegt1-P2A-Ncegt2, MET14) / OE.

[0140] 5. Construction of a Rhodosporidium toruloides strain with attenuated ACC1 gene

[0141] Agrobacterium containing the NM810-ACC1gRNA plasmid constructed in step 5 of Example 1 was co-cultured with the recombinant bacteria (2*Ncegt1-P2A-Ncegt2, MET14) / OE on an IMA plate, and then the co-culture was transferred to a YPD plate containing 300 μM cefotaxime and 10 μg / mL bleomycin and cultured at 30°C until a single clone was formed. The single clone was picked and transferred to a YPD plate containing bleomycin, and the bleomycin-resistant transformant was screened for genome extraction and sent for sequencing verification. Finally, the recombinant bacteria (2*Ncegt1-P2A-Ncegt2, MET14, P) with the ACC1 promoter region knocked out were screened. ACC1 *), and record it as HYRT1001.

[0142] Sequencing results showed that the recombinant strain HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1*) is a bacterium obtained by replacing "CAGCGGGAAGTTCGGTCGGG (SEQ ID No. 11)" in the ACC1 gene promoter sequence (SEQ ID No. 10) on the recombinant bacterium (2*Ncegt1-P2A-Ncegt2, MET14) / OE with "CAGCGGGAAGTTCGGTCGGG (SEQ ID No. 13)".

[0143] Example 3, recombinant bacteria HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1 *) Fermentation and preservation

[0144] 1. Screening for shake flask fermentation of strains expressing ergothioneine synthase genes Ncegt1 and Ncegt2

[0145] Test strains: starting bacteria Rt.ΔKU70, NP11, BUCT010 and BUCT011, recombinant bacteria Rt.Δku70-1, NP11-1, BUCT010-1, BUCT011-1, Rt.Δku70-2, NP11-2, BUCT010-2 and BUCT011-2.

[0146] 1. Pick a single colony from the YPD plate and inoculate it into 5 mL of YPD liquid medium. Cultivate at 30°C and 250 rpm for 24 h to obtain the cultured bacterial liquid.

[0147] 2. After completing step 1, the cultured bacterial liquid was transferred to a shake flask containing fermentation medium at a 5% inoculum volume and cultured at 30°C and 250 rpm for 120 h to obtain a fermentation liquid.

[0148] The solvent of the fermentation medium in the above-mentioned shake flask is water, and the solutes and their concentrations are: glucose 25 g / L, yeast powder 10 g / L, peptone 15 g / L, KH2PO4 2 g / L, MgSO4 0.5 g / L, (NH4)2SO4 4.5 g / L, FeSO4·7H2O 0.1 g / L, MnSO4·H2O 0.1 g / L, and biotin 0.5 mg / L.

[0149] 3. After completing step 2, 1mL fermented liquid is taken, 0.5mm grinding beads are added, homogenizer is used to break up thalline, and then the thalline 12000rpm after breaking is centrifuged for 10min, and supernatant is drawn for the detection of thioneine.

[0150] 4. After completing step 3, high performance liquid chromatography (HPLC) is adopted to detect the ergothioneine in the supernatant. Specific parameters are as follows: high performance liquid chromatography instrument is Agilent 1260, chromatographic column Kromasil 100-5 C18 (150mm×4.6mm), mobile phase is methanol 1: ultrapure water 99, column temperature 30℃, wavelength 254nm, flow velocity 0.5mL / min, sample volume 2μL.

[0151] The results are shown in Figure 10. The results show that compared with other Rhodosporidium toruloides yeasts, after the starting strain Rt.ΔKU70 expressed the ergothioneine synthase genes Ncegt1 and Ncegt2, the ergothioneine production of Rt.Δku70-2 was higher, at 361.5 mg / L. Therefore, Rt.Δku70 was used as the base strain for further modification to increase the production of ergothioneine.

[0152] 2. Recombinant bacteria HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1 *) Shake flask fermentation

[0153] Test strains: starting strain Rt.ΔKU70, recombinant strain Rt-1 (2*Ncegt1-P2A-Ncegt2 / OE) and recombinant strain HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1 *).

[0154] The results are shown in Figure 11. The results show that the thioneine production of the starting bacteria Rt.ΔKU70 shake flask fermentation is 35.15 mg / L, the thioneine production of the recombinant bacteria Rt-1 is 560.25 mg / L, and the thioneine production of the recombinant bacteria HYRT1001 is 925.4 mg / L.

[0155] 3. Recombinant bacteria HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1 *) 5 L bioreactor fed-batch fermentation

[0156] Test strains: starting strain Rt.ΔKU70, recombinant strain Rt-1 (2*Ncegt1-P2A-Ncegt2 / OE) and recombinant strain HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1 *).

[0157] 1. Pick a single colony from the YPD plate and inoculate it into 20 mL of YPD liquid medium. Cultivate at 30°C and 250 rpm for 24 h to obtain the cultured bacterial liquid.

[0158] 2. After completing step 1, transfer the cultured bacterial solution to 100 mL of YPD liquid medium at a 5% inoculum volume and culture at 30°C and 250 rpm for 24 h to obtain seed solution.

[0159] 3. After completing step 2, the seed liquid was inoculated into a 5L fermentor containing 2L fermentation medium at a 10% inoculum size, the temperature was set to 28°C, the rotation speed was 500-800 rpm, the dissolved oxygen was coupled, the dissolved oxygen was controlled at 40%, the ventilation volume was set to 4L / min, and ammonia was added to control the pH to maintain 6.5. When the fermentation was continued for 12-24 hours, the feed medium was added at 10mL / h, and the glucose content was measured every 4 hours. The feed flow rate was adjusted to make the glucose less than 1g / L. The fermentation was continued for 72 hours to obtain the fermentation liquid.

[0160] The solvent of the fermentation medium in the above-mentioned fermenter is water, and the solutes and their concentrations are: glucose 45 g / L, yeast powder 20 g / L, peptone 15 g / L, KH2PO4 5 g / L, MgSO4·7H2O 5 g / L, FeSO4·7H2O 0.3 g / L, MnSO4·H2O 0.1 g / L, biotin 0.5 mg / L, and polyether defoamer 0.6 mL / L.

[0161] The solvent of the above-mentioned fed-batch culture medium is water, and the solutes and their concentrations are: glucose 500 g / L, yeast powder 60 g / L, and MgSO4·7H2O 0.6 g / L.

[0162] 4. Process and detect the samples according to the sample processing and detection methods in Example 3.

[0163] The results are shown in Figure 12. The results show that the thioneine production of the starting bacteria Rt.ΔKU70 fermentor is 269 mg / L, the thioneine production of the recombinant bacteria Rt-1 is 4.09 g / L, and the thioneine production of the recombinant bacteria HYRT1001 is 6.2 g / L.

[0164] 4. Recombinant bacteria HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1 *)

[0165] Recombinant bacteria HYRT1001 (2*Ncegt1-P2A-Ncegt2, MET14, P ACC1 *) was deposited on May 31, 2023, at the China General Microbiology Center of Culture Collection (CGMCC; address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Postal Code: 100101), with the deposit number CGMCC No. 27505.

[0166] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. Industrial Applicability

[0167] The present invention constructs a recombinant Rhodosporidium toruloides engineered strain HYRT1001 for efficiently producing thioneine by heterologously expressing the ergothioneine synthase encoding genes Ncegt1 and Ncegt2 from Neurospora crassa and the ATP sulfurylase encoding gene MET14 from Saccharomyces cerevisiae in Rhodosporidium toruloides, while weakening the fatty acid synthesis pathway key gene ACC1. Experimental results show that the HYRT1001 strain, using glucose as the sole carbon source, is cultivated in a 5L fermentor for 72 hours, and the output of thioneine can reach 6.2g / L. For the industrial production of thioneine, the Rhodosporidium toruloides engineered strain for efficiently producing thioneine constructed by the present invention will produce huge economic benefits and has great application value.

Claims

1. A method for constructing a recombinant bacterium producing ergothioneine, characterized in that: The construction method comprises the following steps: increasing the content and / or activity of ergothioneine synthases Ncegt1 and Ncegt2 derived from Neurospora crassa in red winter spore yeast; increasing the content and / or activity of ATP sulfurylase MET14 derived from Saccharomyces cerevisiae in the red winter spore yeast, and reducing the content and / or activity of ACC1, a key protein in the fatty acid synthesis pathway in the red winter spore yeast.

2. The construction method according to claim 1, characterized in that: The ergothioneine synthase Ncegt1 is a protein of A1) or A2): A1) a protein whose amino acid sequence is SEQ ID No. 2; A2) A protein derived from A1) having ergothioneine synthase Ncegt1 activity and having more than 80% identity with A1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID No.

2.

3. The construction method according to claim 1 or 2, characterized in that: The coding gene of the ergothioneine synthase Ncegt1 is a DNA molecule of a1) or a2): a1) a DNA molecule whose nucleotide sequence is SEQ ID No. 1; a2) A DNA molecule which has more than 90% identity with the DNA molecule described in a1) and encodes the ergothioneine synthase Ncegt1.

4. The construction method according to any one of claims 1 to 3, characterized in that: The ergothioneine synthetase Ncegt2 is a protein of B1) or B2): B1) a protein whose amino acid sequence is SEQ ID No. 4; B2) A protein derived from B1) having ergothioneine synthase Ncegt2 activity and having more than 80% identity with B1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID No.

4.

5. The construction method according to any one of claims 1 to 4, characterized in that: The coding gene of the ergothioneine synthetase Ncegt2 is a DNA molecule of b1) or b2): b1) a DNA molecule whose nucleotide sequence is SEQ ID No. 3; b2) A DNA molecule that has more than 90% identity with the DNA molecule described in b1) and encodes the ergothioneine synthase Ncegt2.

6. The construction method according to any one of claims 1 to 5, characterized in that: The ATP sulfurylase MET14 is a protein of C1) or C2): C1) a protein whose amino acid sequence is SEQ ID No. 9; C2) A protein derived from C1) having ATP sulfurylase MET14 activity and having more than 80% identity with C1) obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence of SEQ ID No.

9.

7. The construction method according to any one of claims 1 to 6, characterized in that: The coding gene of the ATP sulfurylase MET14 is a DNA molecule of c1) or c2): c1) a DNA molecule whose nucleotide sequence is SEQ ID No. 8; c2) A DNA molecule that has more than 90% identity with the DNA molecule described in c1) and encodes the ATP sulfurylase MET14.

8. The construction method according to any one of claims 1 to 7, characterized in that: The key protein ACC1 of the fatty acid synthesis pathway is a protein of D1) or D2): D1) a protein having an amino acid sequence of SEQ ID No. 15; D2) A protein derived from D1) having more than 80% identity with D1) and having the activity of ACC1, a key protein in the fatty acid synthesis pathway, obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of SEQ ID No.

15.

9. The construction method according to any one of claims 1 to 8, characterized in that: The coding gene of the fatty acid synthesis pathway protein ACC1 is a DNA molecule of d1) or d2): d1) a DNA molecule whose nucleotide sequence is SEQ ID No. 14; d2) A DNA molecule that has more than 90% identity with the DNA molecule described in d1) and encodes the key protein ACC1 in the fatty acid synthesis pathway.

10. The construction method according to any one of claims 1 to 9, characterized in that: The Rhodosporidium toruloides is a Rhodosporidium toruloides Rt.Δku70 strain, a Rhodosporidium toruloides NP11 strain, a Rhodosporidium toruloides BUCT010 strain or a Rhodosporidium toruloides BUCT011 strain.

11. The construction method according to any one of claims 1 to 10, characterized in that: The recombinant bacteria is Rhodosporidium toruloides HYRT1001 CGMCC No.27505.

12. The recombinant bacterium constructed by the construction method according to any one of claims 1 to 11.

13. The recombinant bacterium according to claim 12, characterized in that: The recombinant bacterium is Rhodosporidium toruloides HYRT1001, and its deposit number is CGMCC No.27505.

14. the application of arbitrary described method in claim 1-11 in producing thioneine, the application in improving thioneine output, the application in preparing the product of producing thioneine or the application in preparing the product of improving thioneine output.

15. the application of the recombinant bacteria described in any one of claim 12 or 13 in producing thioneine, in improving thioneine yield, in preparing a product producing thioneine, or in preparing a product improving thioneine yield.

16. A method for producing thioneine, comprising the steps of: fermenting and culturing the recombinant bacteria according to claim 12 or 13 to obtain a fermentation product, wherein the fermentation product contains thioneine.

Images