Glycopeptide antibiotic and application thereof
By discovering and cloning the simplest glycopeptide antibiotic biosynthesis gene cluster and expressing heterologously in Streptomyces, the novel glycopeptide antibiotics, Varsomycin A, B and C were successfully produced, solving the drug resistance of existing glycopeptide antibiotics to drug-resistant pathogens and achieving a significant inhibitory effect on drug-resistant strains.
Patent Information
- Application Number
- CN202510211876.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-25
- Publication Date
- 2025-06-27
AI Technical Summary
Existing glycopeptide antibiotics face challenges with drug-resistant pathogens, especially vancomycin-resistant Enterococcus and Staphylococcus, which lead to increased treatment difficulty.
By clustering analysis of actinomycetes carrying glycopeptide antibiotic biosynthesis gene clusters in the NCBI database, a simplest glycopeptide antibiotic biosynthesis gene cluster was found and cloned, and novel glycopeptide antibiotics, Varsomycin A, B and C were produced in Streptomyces through heterologous expression.
The novel glycopeptide antibiotics Varsomycin A, B and C have significant inhibitory activities on clinically resistant strains, providing new biosynthetic pathways and natural backbone molecules, and providing important fermentation strains and precursor compounds for the development of new glycopeptide antibiotics.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly relates to a glycopeptide antibiotic and its application. Background Art
[0002] Glycopeptide antibiotics (GPA) are first-line drugs clinically used to treat infections caused by Gram-positive drug-resistant pathogens. For example, vancomycin and teicoplanin are clinically used to treat methicillin-resistant Staphylococcus aureus infections. No drug-resistant pathogens were found in the early stage of the application of glycopeptide antibiotics, so they were once hailed as the "last line of defense" for treating Gram-positive pathogens clinically. However, 30 years after clinical application, vancomycin-resistant pathogens were detected clinically. According to a report by the US Centers for Disease Control and Prevention, the detection rate of vancomycin-resistant Enterococcus in the United States is currently as high as an astonishing 30%. With the emergence of clinical drug-resistant pathogens, the treatment of vancomycin-resistant pathogens has become increasingly difficult. To cope with the emergence of drug-resistant pathogens, chemical semi-synthesis derivatives were made on the structural skeletons of vancomycin, A40926, and chloriromycin, and the second-generation semi-synthetic glycopeptide antibiotics Telavancin, Dalbavancin, and Oritavancin were developed and approved by the US FDA for marketing (Blaskovich MAT, Hansford KA, Butler MS, Jia Z, Mark AE, Cooper MA. Developments in Glycopeptide Antibiotics. ACS Infect Dis. 2018 May 11;4(5):715-735.).
[0003] Glycopeptide antibiotics have excellent bactericidal effects and a low frequency of drug-resistant mutations. Therefore, GPA has achieved great success in clinical applications and the research and development of new antibiotics (Butler MS, Hansford KA, Blaskovich MA, Halai R, Cooper MA. Glycopeptide antibiotics: back to the future. J Antibiot (Tokyo). 2014 Sep;67(9):631-44.). In recent years, the research and development of new antibiotics to inhibit drug-resistant pathogenic bacteria has been a hot topic in the study of microbial natural products. The discovery of new glycopeptide antibiotics is of great significance for alleviating the antibiotic resistance crisis, especially the infections caused by vancomycin-resistant enterococci and staphylococci. The mechanism of action of traditional GPA, such as vancomycin, is mainly to inhibit the transglycosylation reaction in the synthesis of bacterial cell wall peptidoglycan by binding to the d-alanyl-d-alanine (d-Ala-d-Ala) at the end of the lipid II precursor of peptidoglycan synthesis in the bacterial cell wall, thereby inhibiting the synthesis of the bacterial cell wall and achieving a bactericidal effect (Wang F, Zhou H, Olademehin OP, Kim SJ, Tao P. Insights into Key Interactions between Vancomycin and Bacterial Cell Wall Structures. ACS Omega. 2018 Jan 31;3(1):37-45.).Recently, the team led by Professor Wright at McMaster University in Canada found that the V-type glycopeptide antibiotics Complestatin and Corbomycin do not inhibit bacterial cell wall synthesis. Instead, they bind to the peptidoglycan of the bacterial cell wall, blocking the hydrolytic action of bacterial autolysins, thereby inhibiting the degradation of the bacterial cell wall (Koteva, K., Xu, M., Wang, W., et al. ''Synthetic biology facilitates semisynthetic development of type V glycopeptide antibiotics targeting vancomycin-resistant Enterococcus,'' Journal of Medicinal Chemistry, 2023, 66, 9006-9022.; Culp EJ, Waglechner N, Wang W, Fiebig-Comyn AA, Hsu YP, Koteva K, Sychantha D, Coombes BK, Van Nieuwenhze MS, Brun YV, Wright GD. Evolution-guided discovery of antibiotics that inhibit peptidoglycan remodelling. Nature. 2020, Feb; 578 (7796): 582-587.). The specific binding sites of V-type glycopeptide antibiotics on the peptidoglycan of the bacterial cell wall remain to be further analyzed. The unique antibacterial mechanism of V-type glycopeptide antibiotics makes them have significant inhibitory activity against multi-drug resistant pathogens such as methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus, and Staphylococcus, and has important development value in the research and development of new drugs against drug-resistant pathogens.
[0004] With the spread of microbial drug resistance globally, the efficacy of commonly used clinical antibiotic drugs faces severe challenges, making the treatment of diseases caused by pathogen infections increasingly difficult. Particularly seriously, the rapid spread of multi-drug resistant pathogens and pan-drug resistant pathogens globally has led to the inability to treat some infections with existing antibiotic drugs.
[0005] As the first glycopeptide antibiotic to enter clinical use, vancomycin was once hailed as the "last line of defense" for clinical antibiotics against Gram-positive pathogenic bacteria due to its excellent antibacterial effect and the long-term absence of drug-resistant pathogens detected. However, 30 years after its clinical use, vancomycin-resistant Enterococcus was also detected clinically, indicating that the defense line of glycopeptide antibiotics has also been breached by drug-resistant pathogens.
[0006] The emergence of glycopeptide antibiotic-resistant pathogenic bacteria has sounded the alarm for the effectiveness of GPAs in clinical practice and promoted the research and development boom of new and highly effective GPAs. Although the second-generation chemically semi-synthetic GPAs have been marketed and successfully applied to the treatment of Gram-positive drug-resistant pathogenic bacteria such as vancomycin-resistant pathogenic bacteria infections, the corresponding drug-resistant pathogenic bacteria will surely emerge in the foreseeable future. Therefore, we need to continuously conduct research and development of GPAs with new structures and new mechanisms of action to address the clinical challenges of GPA resistance. Summary of the Invention
[0007] In this invention, actinomycetes carrying glycopeptide antibiotic biosynthetic gene clusters in the NCBI database were subjected to cluster analysis, and a phylogenetic analysis of the whole gene clusters of 69 biosynthetic gene clusters encoding the synthesis of heptapeptide backbone type V glycopeptide antibiotics was carried out. A minimal glycopeptide antibiotic biosynthetic gene cluster containing only non-ribosomal peptide structure genes, P450 genes, mbtH genes and ABC transporter genes was discovered. First, the biosynthetic gene cluster was directly cloned from the chromosome of the wild-type strain Streptomyces varsoviensis CGMCC 4.1431 by yeast transformation-mediated recombination cloning technology (Transformation associated recombination, TAR). Then, the cloned glycopeptide antibiotic biosynthetic gene cluster was transferred into S.coelicolor M1154 chassis cells for heterologous expression by indirect conjugation transfer between Escherichia coli and Streptomyces, but the corresponding target compound was not synthesized. Furthermore, on this basis, in vitro feeding of the essential aromatic amino acid precursors 4-hydroxyphenylglycine (Hpg) and 3,5-dihydroxyphenylglycine (Dpg) for glycopeptide antibiotic biosynthesis and the complementation of the transcriptional activator staQ derived from glycopeptide antibiotic A47934 with the Hpg and Dpg precursor synthesis genes were carried out. Through fermentation verification, the synthesis of a series of glycopeptide antibiotic compounds was detected, confirming that S. varsoviensis the minimal glycopeptide antibiotic biosynthetic gene cluster in CGMCC 4.1431 can synthesize glycopeptide antibiotics. After fermentation, separation and purification, the chemical structures of Varsomycin A, B, and C were identified by combining LC-MS and NMR, and the MIC was determined against clinical drug-resistant pathogenic strains.
[0008] The present invention adopts the following technical solutions: A glycopeptide antibiotic, characterized in that it is glycopeptide antibiotic Varsomycin A, B or C, and its chemical structural formula is as follows: 。
[0009] Furthermore, the present invention provides the use of the glycopeptide antibiotic in the preparation of antibacterial products.
[0010] Specifically, the antibacterial activity refers to antifungal and antibacterial activities, specifically against the following bacteria: Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Enterococcus faecalis, Enterococcus faecium, Mycobacterium smegmatis, Candida albicans, methicillin-resistant Staphylococcus aureus or vancomycin-resistant Enterococcus.
[0011] The present invention also provides a minimal glycopeptide antibiotic biosynthetic gene cluster, which is characterized in that it comprises the following genes in sequence from the 5'-end to the 3'-end: varE gene, varT gene, varA gene, varB gene, varC gene, varD gene, varF gene and varG gene; Specifically, the nucleotide sequence of the varE gene is shown as positions 1 to 225 of Sequence 1 or its degenerate sequence, the nucleotide sequence of the varT gene is shown as positions 374 to 2342 of Sequence 1 or its degenerate sequence, the nucleotide sequence of the varA gene is shown as positions 2999 to 9937 of Sequence 1 or its degenerate sequence; the nucleotide sequence of the varB gene is shown as positions 9934 to 14604 of Sequence 1 or its degenerate sequence; the nucleotide sequence of the varC gene is shown as positions 14679 to 30248 of Sequence 1 or its degenerate sequence; the nucleotide sequence of the varD gene is shown as positions 30356 to 35761 of Sequence 1 or its degenerate sequence; the nucleotide sequence of the varF gene is shown as positions 35908 to 37101 of Sequence 1 or its degenerate sequence; the nucleotide sequence of the varG gene is shown as positions 37120 to 38340 of Sequence 1 or its degenerate sequence; More specifically, its nucleotide sequence is shown as Sequence 1 or its degenerate sequence.
[0012] The present invention also provides a recombinant vector containing the minimal glycopeptide antibiotic biosynthetic gene cluster.
[0013] Specifically, by extracting the genomic DNA of Streptomyces S. varsoviensis CGMCC 4.1431, a DNA fragment obtained after digestion with enzymes; then designing homologous arms for capturing the gene cluster to construct a plasmid, and after Mss digestion with I enzyme, using the yeast transformation recombinant cloning system to perform directional cloning of the target gene cluster into the vector pCGW to obtain it.
[0014] The present invention further provides a recombinant strain containing the simplest glycopeptide antibiotic biosynthetic gene cluster or the recombinant vector described above; specifically, the recombinant vector is electrotransformed into E.coli strain ET12567, and the recombinant vector is transferred into S. coelicolor M1154 by triparental conjugation to obtain a recombinant strain; Optionally, it further includes the synthetic genes for expressing the precursor aromatic amino acids Hpg and / or Dpg in the recombinant bacterium.
[0015] The present invention also provides a method for preparing glycopeptide antibiotics Varsomycin A, B or C, which comprises the following steps: fermenting and culturing the recombinant strain to produce the compound glycopeptide antibiotics Varsomycin A, B or C; when the synthetic genes for expressing the precursor aromatic amino acids Hpg and / or Dpg are not constructed, adding the precursor aromatic amino acids Hpg and Dpg to ensure the production of the compound, and preferably adding the precursor aromatic amino acids Hpg and Dpg at a concentration of 1 mM to ensure the production of the compound.
[0016] Optionally, it further includes the step of separating and purifying the glycopeptide antibiotics Varsomycin A, B or C.
[0017] Specifically, the separation and purification method is carried out by extraction, molecular sieve chromatography, reverse-phase medium-pressure preparative chromatography and reverse-phase high-performance preparative chromatography system.
[0018] The present invention provides a biosynthetic gene cluster capable of producing novel glycopeptide antibiotics. By heterologous expression, three novel glycopeptide antibiotics Varsomycin A, B and C are produced in Streptomyces chassis cells, and the minimum inhibitory concentration (MIC) is measured against clinically drug-resistant strains. All of them have significant inhibitory activities against clinical methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus. The present invention provides a new biosynthetic pathway and new natural skeleton molecules for the research and development of new glycopeptide antibiotics. Therefore, compared with the prior art, the beneficial effects of the present invention are as follows: The present invention discovers a biosynthetic gene cluster for synthesizing a completely new glycopeptide antibiotic skeleton, and through heterologous expression, obtains completely new glycopeptide antibiotics Varsomycin A, B and C with novel chemical structures; it has a significant bacteriostatic effect against clinically drug-resistant strains. This provides important fermentation strains and precursor compound molecules for the research and development of new glycopeptide antibiotics, and has important application prospects and economic value. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.
[0020] Figure 1 For the Streptomyces in Example 1 S. varsoviensis Schematic diagram of the glycopeptide antibiotic biosynthetic gene cluster in Streptomyces CGMCC 4.1431; Figure 2 For the Streptomyces cloned by TAR cloning technology in Example 1 S. varsoviensis Plasmid map of pGP41431 containing the glycopeptide antibiotic biosynthetic gene cluster in Streptomyces CGMCC 4.1431; Figure 3 Plasmid maps of the modified pIJ10257-staQ-HpgSyn and pIJ10257-staQ-HpgDpgSyn recombinant plasmids in Example 3; Figure 4 HPLC analysis chart after fermentation treatment with exogenous addition of substrates Hpg and Dpg in Example 5; Figure 5 HPLC analysis chart after fermentation treatment of the recombinant vectors obtained by introducing the pIJ10257-staQ-HpgSyn and pIJ10257-staQ-HpgDpgSyn recombinant plasmids in Example 5; Figure 6 High-resolution mass spectra of Varsomycin A, B, and C; Figure 7 One-dimensional proton nuclear magnetic resonance and carbon nuclear magnetic resonance spectra of Varsomycin A; Figure 8 One-dimensional proton nuclear magnetic resonance and carbon nuclear magnetic resonance spectra of Varsomycin B; Figure 9 One-dimensional proton nuclear magnetic resonance and carbon nuclear magnetic resonance spectra of Varsomycin C. Detailed implementation manners
[0021] The present invention will be further described in detail below in combination with the specific implementation manners. The provided examples are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.
[0022] Example 1. Cloning of the Varsomycin gene cluster Through retrieval in the NCBI database, the present invention found a minimal GPA biosynthetic gene cluster in Streptomyces S.varsoviensis CGMCC 4.1431 (which can be purchased), and directly cloned the biosynthetic gene cluster through the in vivo homologous recombination system of yeast. The specific implementation plan is as follows: 1. Streptomyces genomic DNA extraction and enzymatic digestion recovery 1) Add 50 mL of TSBY medium (1L: 30 g tryptic soy broth, 5 g yeast extract, 0.5% glycine) into a 250 mL Erlenmeyer flask, inoculate 2 mL of seed culture, and incubate at 30 °C with shaking at 250 rpm for 48 h; 2) Collect the bacterial solution into a 50 mL centrifuge tube and centrifuge at 5,000 rpm for 10 min at room temperature to collect the bacterial cells; 3) Weigh 0.3 - 0.5 g of fresh bacterial cells into a 2 mL centrifuge tube and wash twice with 1 mL of ddH2O; 4) Centrifuge to discard the supernatant, transfer the bacterial cells to a 50 mL centrifuge tube, and resuspend the cells with 5 mL of SET solution (75 mM NaCl, 25 mM EDTA, 20 mM Tris-Cl, pH 7.5); 5) Add lysozyme with a final concentration of 1 mg / mL and incubate at 37 °C for 8 min; 6) Add 1 / 10 volume of 10% SDS solution, gently invert to mix evenly, then add proteinase K with a final concentration of 0.5 mg / mL, gently invert to mix evenly and place in a 55 °C water bath for 2 h, gently invert 4 - 6 times every 20 minutes during this period; 7) After incubation, add 1 / 3 volume of 5 M NaCl and 1 volume of CHCl3, gently mix at room temperature until the solution becomes uniformly milky white; 8) Centrifuge at 7,000 rpm for 15 min at 4 °C, transfer the upper layer to a new 50 mL centrifuge tube with a cut pipette tip, try to avoid sucking the middle protein layer; 9) Add 1 volume of CHCl3, gently mix at room temperature until the solution becomes uniformly milky white; 10) Centrifuge at 7,000 rpm for 15 min at 4 °C, transfer the upper layer to a new 50 mL centrifuge tube, try to avoid sucking the middle protein layer; 11) Add 0.7 - 1 volume of pre-cooled isopropanol, gently mix until flocculates form, which is the genomic DNA; 12) Slowly pour out the isopropanol along the wall, add 5 mL of 70% ethanol and wash twice; 13) Pour out the 70% ethanol completely, place in a laminar flow hood to dry for 2 - 3 minutes, then add 500 μL of TE to dissolve the genomic DNA; 14) After fully dissolving the DNA, add 1% RNase A and incubate at 37 °C for 1 h to remove RNA; 15) Add proteinase K at a final concentration of 0.5 mg / mL and incubate at 55 °C for 1 h to remove proteins; 16) Add 1 volume of CHCl3 for extraction. After gently inverting and mixing, centrifuge at 13,300 rpm at 4 °C for 10 min; 17) Transfer the upper layer to a new 2 mL centrifuge tube, add 1 / 10 volume of 3 M NaOAc (pH 5.2) to a final concentration of 0.3 M. After inverting and mixing, add 0.7 - 1 volume of pre-cooled isopropanol and slowly mix until flocculates are produced, which is genomic DNA; 18) Slowly pour out the isopropanol along the wall and wash twice with 1 mL of 70% ethanol; 19) Discard the 70% ethanol and dry it in a laminar flow hood; 20) Add 200 μL of TE to dissolve the genomic DNA and store it at 4 °C for later use; 21) Pipette 60 μL of genomic DNA, add 10 μL of restriction enzyme buffer, 3 μL of Avr II enzyme, 3 μL of Nsi I enzyme, and make up the rest with ddH2O to a 100 μL system. Incubate at 37 °C overnight for digestion; 22) Add 500 μL of ddH2O to the overnight digestion product, add 1 volume of CHCl3 for extraction. After gently inverting and mixing, centrifuge at 13,300 rpm at 4 °C for 10 min; 23) Transfer the upper layer to a new 2 mL centrifuge tube, add 1 / 10 volume of 3 M NaOAc (pH 5.2) to a final concentration of 0.3 M. After inverting and mixing, add 0.7 - 1 volume of pre-cooled isopropanol and slowly mix until flocculates are produced; 24) Slowly pour out the isopropanol along the wall and wash twice with 1 mL of 70% ethanol; 25) Discard the 70% ethanol and dry it in a laminar flow hood; 26) Add 50 μL of TE to dissolve the digested genomic DNA and store it at 4 °C for later use.
[0023] 2. Cloning of the varsomycin biosynthetic gene cluster The obtained digested genomic DNA and the one treated with MssMix the I-digested linearized vector plasmid pCGW-GP41431-gbk and use the yeast transformation-associated recombination (TAR) system (Zhang JJ, Yamanaka K, Tang X, Moore BS. Direct cloning and heterologous expression of natural product biosynthetic gene clusters by transformation-associated recombination. Methods Enzymol. 2019;621:87-110.) for cloning. The specific implementation method is as follows: 1) Inoculate a single colony of VL6-48N yeast strain into 3 mL of YPD liquid medium (supplemented with Adenine to a final concentration of 100 μg / mL), and culture it overnight with shaking at 30 °C; Saccharomyces cerevisiae 2) Transfer 2 mL of the overnight culture to a new 100 mL of YPD liquid medium (supplemented with Adenine to a final concentration of 100 μg / mL, in a 500 mL conical flask), and culture it with shaking at 30 °C until the OD reaches 0.7 - 1.0; 600 = 0.7 - 1.0; 3) Place the conical flask on ice for 10 min, then transfer it to a 50 mL centrifuge tube and centrifuge at 1800×g for 3 min at 4 °C; 4) Discard the supernatant, resuspend the cells by gently vortexing at low speed in 50 mL of pre-cooled sterile water (4 °C), and centrifuge at 1800×g for 3 min at 4 °C; 5) Discard the supernatant, resuspend the cells by gently vortexing at low speed in 50 mL of pre-cooled 1 M sorbitol (4 °C), and place the 50 mL centrifuge tube on ice overnight to stabilize the osmotic pressure of the yeast cells; 6) Gently invert and mix the 50 mL yeast cell suspension that has been ice-bathed overnight at 4 °C, and then centrifuge at 1800×g for 3 min at 4 °C; 7) Discard the supernatant, add 20 mL of SPE solution (0.01 M HEPES, pH 7.5; 25 mM EDTA; 1 M sorbitol), gently vortex at low speed, add 40 μL of β-mercaptoethanol, gently invert and mix slowly, add 80 μL of zymolyase-20T, gently invert and mix slowly, and then incubate at 30 °C for 40 min; 8) By measuring the OD of the cell suspension 600To check the protoplast level: Take two 200 μL cell samples. Add one sample to 800 μL of 2% SDS and the other to 800 μL of 1 M sorbitol, and gently pipette to mix well. Measure the optical density of the two suspensions at OD 600 and compare their optical density values. When their difference is 10 - 20 times (about 90 - 95% of the cells are converted into protoplasts), the protoplast effect is the best, and more than 75% can be used for subsequent experiments; 9) Add pre-cooled 1 M sorbitol (4 °C) along the tube wall to 50 mL, gently invert to mix well, centrifuge at 600×g for 10 min at 4 °C, then slowly pour out the supernatant, and use the tip of the pipette to suck out the remaining liquid; 10) Add 5 mL of pre-cooled 1 M sorbitol (4 °C) along the wall to resuspend the cells, and slowly pipette to mix well with a pipette tip with a cut-off tip, avoiding generating bubbles; 11) Slowly add pre-cooled 1 M sorbitol (4 °C) along the wall to make up to 50 mL, and gently invert to mix well; 12) Centrifuge at 600×g for 10 min at 4 °C to collect the bacteria. Slowly pour out the supernatant, and use the tip of the pipette to suck out the remaining liquid; 13) Add 2 mL of STC solution (0.01 M Tris-HCl, pH 7.5; 10 mM CaCl2; 1 M sorbitol), and slowly pipette to mix well with a pipette tip with a cut-off tip, and let it stand at room temperature for 10 min; 14) Meanwhile, prepare the DNA solution in a 2 mL centrifuge tube, containing 0.5 - 1 μg of linearized vector and 2 - 4 μg of digested genomic DNA; 15) Slowly add 200 μL of yeast protoplast cells along the wall to the DNA solution with a cut-off pipette tip, gently pipette to mix well 6 - 8 times, and let it stand at room temperature for 10 min; 16) Add 800 μL of 20% PEG8000 solution, slowly invert the centrifuge tube 8 - 10 times to mix well, and let it stand at room temperature for 20 min; 17) Centrifuge at 700×g for 10 min at 4 °C to collect the protoplast cells; 18) Pipette the supernatant clean with a pipette, add 800 μL of SOS solution (6.6 mM CaCl2; 0.25 g of yeast extract; 1 g of peptone; 18.2 g of sorbitol, 100 mL), and slowly pipette to resuspend with a pipette tip with a cut-off tip, avoiding generating bubbles; 19) Place the resuspended cells in an incubator at 30 °C and let it stand for 30 - 40 min; 20) Add the cell suspension into 8 mL of melted SD-Trp top agarose screening medium (1 M sorbitol; 2% glucose; 2% agarose powder; after autoclaving and cooling, add 50 mL of 10× Yeast Nitrogen Base and 5 mL of 100× adenine) (maintained at 60 °C in a water bath), and gently pipette and mix with a cut pipette tip; 21) Immediately pour the cell suspension onto a plate of SD-Trp bottom agarose screening medium (1 M sorbitol; 2% glucose; 1.5% agarose powder, after autoclaving and cooling, add 50 mL of 10× Yeast Nitrogen Base, 5 mL of 100× adenine, and 0.1% 5-fluorouracil (prepared with DMSO)); 22) After the SD-Trp agarose plate solidifies, wrap the culture plate with aluminum foil and place it in a 30 °C incubator for dark incubation for 3 - 5 days; 23) Screen the yeast positive clones by PCR and extract plasmids from the growing monoclonal colonies.
[0024] S.varsoviensis The structure of the GPA biosynthetic gene cluster of CGMCC 4.1431 is as shown in the appendix Figure 1 as follows, the order and annotation of its functional genes are shown in Table 1, and its nucleotide sequence is as shown in SEQ ID No: 1.
[0025]
[0026] Table 1 S.varsoviensis Functional gene annotation of the GPA biosynthetic gene cluster of CGMCC 4.1431: .
[0027] The GPA biosynthetic gene cluster was cloned into the plasmid vector pCGW to obtain the plasmid pGP41431, whose structure is shown in the appendix Figure 2 as follows.
[0028] The primer information used in this experiment is as follows: var-dF: AAGGCGGACTGGAAGAG var-dR: TGACTGCGGAGCGATT var-gbk: GCCTCCCATGGTATAAATAGTGGCCAGGGACTTCCAGGTCGTCGCGGTCGATCCGCGCGGTGTCGGGCTGTCCGACAAGTTTAAACGTCAAGGGCGCGCCCAAGGCACTGGTGTGGTCTCCGTTCGTGACTCCAAGGATGTCGAAAGCTACATATAA.
[0029] Example 2. Heterologous expression of the Varsomycin biosynthetic gene cluster The plasmid pGP41431 in Example 1 was transformed into competent EPI300 by electroporation. After correct verification by enzyme mapping, the plasmid pGP41431 was transformed into competent ET12567. E.coli Using ET12567 / pR9406 as the helper strain, the plasmid pGP41431 was transferred into M1154 by triparental mating. The M1154 / pGP41431 recombinant strain was obtained by culturing at 30°C. E. coli E. coli S. coelicolor S. coelicolor
[0030] Example 3. Modification of the Varsomycin recombinant strain 1. Obtaining the M1154 / pGP41431 / pIJ10257-SP44-SR39-staQ recombinant strain 1) The present invention uses primers pIJ10257-staQ-sF and pIJ10257-staQ-sR to clone the regulatory factor from plasmid pA47934 (YimG, Wang W, Thaker MN, Tan S, Wright GD. How To Make a Glycopeptide: A Synthetic Biology Approach To Expand Antibiotic Chemical Diversity. ACS Infect Dis. 2016 Sep 9;2(9):642-650.) staQ for cloning; 2) The vector pIJ10257-SP44-SR39 is digested with Nde I and Hin dIII enzymes; 3) The digested pIJ10257-SP44-SR39 vector is subjected to Gibson assembly with the cloned staQ fragment and transferred into E. coli DH5α by electroporation; 4) Single colonies are picked for colony PCR verification. After correct verification, sequencing is performed. After correct sequencing, the E. coli DH5α / pIJ10257-SP44-SR39-staQ recombinant strain is obtained; 5) The recombinant plasmid pIJ10257-SP44-SR39-staQ is transferred into E. coli ET12567 competent cells. Using E. coli ET12567 / pR9406 as the helper strain, the plasmid pIJ10257-SP44-SR39-staQ is transferred to S. coelicolor M1154 / pGP41431 by triparental conjugation transfer and cultured at 30 °C to obtain S. coelicolor M1154 / pGP41431 / pIJ10257-SP44-SR39-StaQ recombinant strain.
[0031] 2. Obtaining of M1154 / pGP41431 / pIJ10257-staQ-HpgSyn Recombinant Strain 1) The present invention uses primers pIJ10257-staQ-HpgSyn-sF and pIJ10257-staQ-HpgSyn-sR to clone the regulatory factor StaQ and the Hpg synthesis gene from pA47934; 2) The vector pIJ10257-SP44-SR39 is digested with NdeI and Hin digest with dIII enzyme; 3) Gibson assemble the digested pIJ10257 - SP44 - SR39 vector with the cloned staQ - HpgSyn fragment and transform it into E. coli DH5α by electroporation; 4) Pick monoclonal colonies for colony PCR verification. After correct verification, perform sequencing. After correct sequencing, the E. coli DH5α / pIJ10257 - SP44 - SR39 - staQ - HpgSyn recombinant strain is obtained; 5) Transfer the recombinant plasmid pIJ10257 - SP44 - SR39 - staQ - HpgSyn into E. coli competent ET12567 cells. Using E. coli ET12567 / pR9406 as the helper strain, transfer the plasmid pIJ10257 - SP44 - SR39 - staQ - HpgSyn into S. coelicolor M1154 / pGP41431 by triparental mating. Incubate at 30 °C to obtain S. coelicolor M1154 / pGP41431 / pIJ10257 - staQ - HpgSyn recombinant strain.
[0032] 3. Obtaining of M1154 / pGP41431 / pIJ10257 - staQ - HpgDpgSyn Recombinant Strain 1) In this invention, primers pIJ10257 - staQ - HpgDpgSyn - sF and pIJ10257 - staQ - HpgDpgSyn - sR are used to clone the regulatory factor StaQ, Hpg synthesis gene and Dpg synthesis gene from the A47934 genome; 2) Digest the vector pIJ10257 - SP44 - SR39 with Nde I and Hin dIII enzyme; 3) Gibson assemble the digested pIJ10257 - SP44 - SR39 vector with the cloned staQ - HpgDpgSyn fragment and transform it into E. coli DH5α by electroporation; 4) Pick monoclonal colonies for colony PCR verification. After correct verification, perform sequencing. After correct sequencing, the E. coli DH5α / pIJ10257 - SP44 - SR39 - staQ - HpgDpgSyn recombinant strain is obtained; 5) Transfer the recombinant plasmid pIJ10257-SP44-SR39-staQ-HpgDpgSyn into E. coli competent ET12567 cells, using E. coli ET12567 / pR9406 as the helper strain, and transfer the plasmid pIJ10257-SP44-SR39-staQ-HpgDpgSyn into S. coelicolor M1154 / pGP41431 by triparental mating. Incubate at 30 °C to obtain S. coelicolor the recombinant strain M1154 / pGP41431 / pIJ10257-staQ-HpgDpgSyn.
[0033] The structures of the plasmids pIJ10257-staQ-HpgSyn and pIJ10257-staQ-HpgDpgSyn are shown in the appendix Figure 3 as follows.
[0034] The primer information used in this experiment is as follows: .
[0035] Example 4. Fermentation with exogenous addition of the precursor substrates Hpg and Dpg Since the Varsomycin biosynthetic gene cluster lacks the essential precursor aromatic amino acids Hpg and Dpg for biosynthesis, the present invention adds exogenous precursor substrates during the fermentation stage. The concentration of the added substrates is 1 mM for both.
[0036] The specific operation steps are as follows: 1) Prepare a stock solution of l-Hpg and l-Dpg with a concentration of 1 M, filter it through a 0.22 μM filter membrane, and set aside for later use; 2) Inoculate the seed culture into the SAM medium (1 L: 15 g glucose; 15 g soy peptone; 5 g sodium chloride; 1 g yeast extract; 1 g calcium carbonate (added last after adjusting the pH); 2.5 mL glycerol; pH 6.8) at an inoculation amount of 1%; 3) Add l-Hpg and l-Dpg with a final concentration of 1 mM to the SAM medium and then perform shaking culture on a shaker.
[0037] The culture conditions are 30 °C, 250 rpm, and ferment for 7 days.
[0038] Example 5. Isolation, purification and identification of fermentation products The product of the M1154 / pGP41431 / pIJ10257-SP44-SR39-staQ recombinant strain after fermentation according to Example 4 will be separated and purified by washing, extraction, LH20 molecular sieve, reversed-phase medium-pressure preparative chromatography, and Elite preparative chromatography (Xu M, Wang W, Wright GD. Glycopeptide antibiotic discovery in the genomic era. Methods Enzymol. 2022;665:325-346.), and its chemical structure will be analyzed by Agilent high-resolution mass spectrometry and Bruker AVANCEIII 600 MHz nuclear magnetic resonance spectroscopy.
[0039] The M1154 / pGP41431 / pIJ10257-staQ-HpgSyn recombinant strain and the M1154 / pGP41431 / pIJ10257-staQ-HpgDpgSyn recombinant strain can produce Varsomycin A, Varsomycin B, and Varsomycin C without the exogenous addition of precursor synthesis substrates, and the fermentation products were detected by high-performance liquid chromatography as Figure 5 shown.
[0040] The specific operation steps are as follows: 1) Treat the fermentation broth in Example 4; 2) Centrifuge at 7,000 rpm for 20 min, discard the supernatant, and transfer the cells to a 500 mL beaker; 3) Add 150 mL of 20% methanol-water (0.05% acetic acid) solution, stir at room temperature for 30 min, and then centrifuge at 7,000 rpm for 10 min; 4) Discard the supernatant, add 150 mL of 20% methanol-water (0.05% acetic acid) solution, stir at room temperature for 30 min, and then centrifuge at 7,000 rpm for 10 min; 5) Add 150 mL of DMSO to extract the compound, stir at room temperature for 30 min, sonicate for 10 min, continue to stir at room temperature for 20 min, and centrifuge at 7,000 rpm for 20 min; retain the supernatant DMSO extract; 6) Add 120 mL of DMSO to extract the compound, repeat step 5, and retain the supernatant DMSO extract; 7) Add 100 mL of DMSO to extract the compound, repeat step 5, retain the supernatant DMSO extract; and perform freeze-drying; 8) Analyze the DMSO extracts in steps 5, 6, and 7 by Agilent high-performance liquid chromatography; the liquid phase analysis conditions are as follows: Chromatographic column: Symmetry Shield RP8 Column, 100Å, 3.5 µm, 4.6 mm×150 mm (Waters); Detector: PDA; Sample loading volume: 10 μL Mobile phase A: 0.1% TFA ddH2O; Mobile phase B: 0.1% TFA acetonitrile Gradient program: t = 0 min, 5% mobile phase B, t = 20 min, 95% mobile phase B, t = 25 min, 95% mobile phase B, t = 26 min, 5% mobile phase B, t = 30 min, 5% mobile phase B 9) Dissolve each freeze-dried sample in 20 mL of DMSO (ultrasonic the partially precipitated samples until the solution is clear), and centrifuge at 13,300 rpm for 20 min 10) Slowly drip methanol along the tube wall into the DMSO solution in step 9 to precipitate proteins. After the solution changes from clear to turbid, centrifuge at 13,300 rpm for 20 min, and repeat 2 - 3 times until no precipitate forms after adding methanol 11) Rotavaporize the supernatant obtained in step 10 to remove methanol, and then freeze-dry 12) Dissolve the freeze-dried sample in step 11 thoroughly with 5 - 10 mL of DMSO, and add an equal volume of 50% aqueous acetonitrile solution (0.5% ammonia water) 13) Centrifuge at 13,300 rpm for 10 min, take the supernatant and load it onto an LH20 molecular sieve column (40×610 mm) for separation; elute with 50% aqueous acetonitrile solution (0.5% ammonia water) as the mobile phase, and collect fractions at 10 mL / tube 14) Analyze the solution in the collection tube by high-performance liquid chromatography, with the method the same as in step 8 15) Combine the samples according to the liquid chromatography results and concentrate them using a rotavapor. After concentration, place them on a freeze-dryer for freeze-drying 16) Dissolve the freeze-dried sample with 1 mL of DMSO and further purify it using a medium-pressure preparative column Medium-pressure preparative conditions: Chromatographic column: Airs Science Flash C8, 20 - 35 µm, 100Å, 40g; Detector: PDA; Flow rate: 32 mL / min Mobile phase A: 0.1% Formic acid ddH2O; Mobile phase B: 0.1% Formic acid acetonitrile Gradient program: t = 0 min, 5% mobile phase B; t = 5 min, 18% mobile phase B; t = 25 min, 65% mobile phase B; t = 26 min, 95% mobile phase B; t = 30 min, 95% mobile phase B; 17) Transfer 100 μL of the eluate obtained in step 16 to a liquid phase vial for high performance liquid chromatography analysis; Combine and lyophilize the collected fractions according to the liquid phase results; 18) Further separate and purify the remaining sample by Elite liquid chromatography; Elite chromatographic preparation conditions: Chromatographic column: Agilent, Pursuit XRs 5 C18 250×10 mm; Detector: PDA; Flow rate: 3 mL / min Mobile phase A: 0.1% TFA in ddH2O; Mobile phase B: 0.1% TFA in acetonitrile; Gradient program: t = 0 min, 10% mobile phase B; t = 1 min, 30% mobile phase B; t = 15 min, 34% mobile phase B; t = 15.1 min, 95% mobile phase B; t = 17 min, 95% mobile phase B; t = 17.1 min, 10% mobile phase B; t = 20 min, 10% mobile phase B; 19) Combine the separated and purified samples and lyophilize them respectively to obtain pure Varsomycin A, B and C; The high resolution first order mass spectra of the purified Varsomycin A, B and C were collected using an Agilent LC-HR-TOF. The NMR samples were dissolved in DMSO- d6 and collected on a Bruker AVANCE III 600 MHz nuclear magnetic resonance spectrometer.
[0041] The high performance liquid chromatography diagrams of Varsomycin A, B and C are as shown in the appendix Figure 4 and the chemical structures of Varsomycin A, B and C were identified. The high resolution mass spectra are as shown in Figure 6 the appendix, and the high resolution first order mass spectra diagrams are as shown in the appendix Figure 7 and the nuclear magnetic resonance spectra diagrams are as shown in the appendix Figure 7 、 8 and Figure 9.
[0042] Example 6 Applications of Varsomycin A, Varsomycin B and Varsomycin C In this invention, the antibacterial activities of Varsomycin A, B and C were determined. The antibacterial activities against Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Enterococcus faecalis, Enterococcus faecium, Mycobacterium smegmatis, Candida albicans, methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus were mainly tested, and the results are shown in Table 2. The specific operation steps are as follows: 1) Prepare the stock solutions of compounds Varsomycin A, B and C with a concentration of 25.6 mg / mL using DMSO; 2) Pick monoclonal colonies of the above-mentioned strains to be tested into 3 mL of the corresponding culture medium and culture them overnight on a shaker at 37 °C; 3) Dilute the overnight cultured bacterial solution 100-fold with 0.9% normal saline and measure the OD 600 value; 4) Dilute the bacterial solution in step 3) with the corresponding culture medium to OD 600 = 0.0004 - 0.0005; 5) Add the diluted bacterial solution to a 96-well plate. Add 198 μL of the diluted bacterial solution to the wells in the first column, add 100 μL of the diluted bacterial solution to the second to eleventh columns, and add 100 μL of the corresponding culture medium to the twelfth column as a negative control group; 6) Add 2 μL of the compound with a concentration of 25.6 mg / mL to each well in the first column. Set up gradient dilution samples of the drug to be tested with an initial concentration of 256 μg / mL, pipette and mix well. Use a multichannel pipette to aspirate 100 μL of the sample from the first column and add it to the second column, gently pipette and mix well 6 - 8 times, then aspirate 100 μL from the second column and add it to the third column, and so on, until 100 μL is aspirated from the ninth column and added to the tenth column (gradient dilution), and finally aspirate 100 μL from the tenth column and discard it; 7) After culturing the 96-well plate in an incubator for 16 - 20 h, read the corresponding MIC values of the test compounds.
[0043] The measured MIC values are shown in Table 2.
[0044] Table 2. MIC values of three compounds against different bacteria .
Claims
1. A glycopeptide antibiotic, characterized in that: It is a glycopeptide antibiotic Varsomycin A, B or C, and its chemical structure is as follows: ; ; 。 2. Use of the glycopeptide antibiotic as claimed in claim 1 in the preparation of antibacterial products.
3. The use according to claim 2, characterized in that The antibacterial agent refers to antifungal and antibacterial agents, specifically antifungal agents against the following bacteria: Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Enterococcus faecalis, Enterococcus faecium, Mycobacterium smegmatis, Candida albicans, drug-resistant Staphylococcus aureus or vancomycin-resistant Enterococcus.
4. A simplest glycopeptide antibiotic biosynthetic gene cluster, characterized in that: It includes the following genes in order from the 5' end to the 3' end: varE gene, varT gene, varA gene, varB gene, varC gene, varD gene, varF gene and varG gene; Specifically, the nucleotide sequence of the varE gene is shown in positions 1 to 225 of SEQ ID NO. 1 or a degenerate sequence thereof, the nucleotide sequence of the varT gene is shown in positions 374 to 2342 of SEQ ID NO. 1 or a degenerate sequence thereof, the nucleotide sequence of the varA gene is shown in positions 2999 to 9937 of SEQ ID NO. 1 or a degenerate sequence thereof; the nucleotide sequence of the varB gene is shown in positions 9934 to 14604 of SEQ ID NO. 1 or a degenerate sequence thereof; the nucleotide sequence of the varC gene is shown in positions 14679 to 30248 of SEQ ID NO. 1 or a degenerate sequence thereof; the nucleotide sequence of the varD gene is shown in positions 30356 to 35761 of SEQ ID NO. 1 or a degenerate sequence thereof; the nucleotide sequence of the varF gene is shown in positions 35908 to 37101 of SEQ ID NO. 1 or a degenerate sequence thereof; the nucleotide sequence of the varG gene is shown in positions 37120 to 38340 of SEQ ID NO. 1 or a degenerate sequence thereof; More specifically, the nucleotide sequence is as shown in SEQ ID NO: 1 or its degenerate sequence.
5. A recombinant vector containing the simplest glycopeptide antibiotic biosynthetic gene cluster as claimed in claim 4.
6. The recombinant vector according to claim 5, characterized in that By extracting Streptomyces Streptomyces varsoviensis CGMCC 4.1431 genomic DNA, DNA fragments obtained after enzyme digestion; then the homologous arms of the gene cluster were designed to construct plasmids, Mss I restriction enzyme digestion, and the target gene cluster was cloned into the vector pCGW using the yeast transformation recombination cloning system.
7. A recombinant strain containing the simplest glycopeptide antibiotic biosynthetic gene cluster as claimed in claim 4 or the recombinant vector as claimed in claim 5; specifically, the recombinant vector as claimed in claim 5 or 6 is electroporated into Escherichia coli ET12567 strain, the recombinant vector was transferred to Streptomyces coelicolor Recombinant strains were obtained in M1154; Optionally, the method further comprises expressing a synthetic gene for the precursor aromatic amino acid Hpg and / or Dpg in the recombinant bacteria.
8. A method for preparing glycopeptide antibiotic Varsomycin A, B or C, characterized in that: The method comprises the following steps: fermenting and culturing the recombinant strain as described in claim 7 to produce the compound glycopeptide antibiotic Varsomycin A, B or C; adding the precursor aromatic amino acids Hpg and Dpg to ensure the production of the compound under specific fermentation conditions when no synthetic gene for expressing the precursor aromatic amino acids Hpg and / or Dpg is constructed, preferably adding the precursor aromatic amino acids Hpg and Dpg at a concentration of 1 mM to ensure the production of the compound.
9. The method according to claim 8, characterized in that The method also includes the steps of isolating and purifying glycopeptide antibiotic Varsomycin A, B or C.
10. The method according to claim 8, characterized in that The separation and purification method is to separate and purify through extraction, molecular sieve chromatography, reverse phase medium pressure preparative chromatography and reverse phase high performance preparative chromatography system.
Citation Information
Cited By
A glycopeptide antibiotic varsomycin c3 and preparation method and use thereof
CN122685689A
An Hpg 3 Glycopeptide compound varsomycin D4 in S configuration and use thereof
CN122685690A