MUC1 binding molecule and chimeric antigen receptor comprising same

Abstract

Provided is an MUC1 binding molecule, comprising an MUC1 single domain antibody, which specifically binds to an MUC1 extracellular region. The present invention also relates to an anti-MUC1 single domain antibody-based chimeric antigen receptor and the use thereof. Specifically, provided is a chimeric antigen receptor having an antigen binding domain, wherein the antigen binding domain comprises an MUC1 binding molecule comprising the anti-MUC1 single domain antibody. An immune cell comprising the chimeric antigen receptor has a relatively high cell killing effect.

Description

MUC1 binding molecules and chimeric antigen receptors containing the same

[0001] This application claims priority to Chinese Patent Application No. CN202310958766.X filed on August 1, 2024, and Chinese Patent Application No. CN202310959241.8 filed on August 1, 2024, the contents of which are incorporated herein by reference in their entirety. Technical Field

[0002] The present invention relates to the field of biomedicine or biopharmaceutical technology, and more particularly to a MUC1 binding molecule and a chimeric antigen receptor comprising the same. Background Art

[0003] Over the past decade, engineering personalized immune responses to cancer has moved from theory to reality. Chimeric antigen receptor (CAR) T cell therapy, engineered from a patient's own immune cells, has already provided a breakthrough for certain types of aggressive leukemia and other blood cancers. This therapy uses genetic engineering techniques to splice the variable region gene sequences of an antibody that recognizes tumor antigens with the intracellular domain of a T lymphocyte immune receptor. These fusion gene sequences are then introduced into the T lymphocyte genome using a lentiviral vector system or a transposon transposase system. This allows the T cells to express the CAR, recognize and attack specific antigens, and enhance their ability to kill tumor cells. In some cases, CAR-T cells can even cure patients whose cancer has relapsed after multiple other treatments. However, CAR-T cells are not yet effective in achieving long-term survival in the majority of patients. Furthermore, while CAR-T therapy has achieved some success in treating blood cancers, it still has a long way to go in treating solid tumors such as pancreatic, lung, and colorectal cancers.

[0004] MUC1 is a mucin expressed in a variety of epithelial cells and highly expressed in various solid tumors and hematologic malignancies. It is one of the most promising targets for cancer therapy. Due to differences in MUC1's oxygen-glycosylation modifications and its fragmentation, the structure of MUC1 on the surface of tumor cells and normal cells differs significantly. These differences make MUC1 a specific target for solid tumors. Tumor-associated MUC1 differs from MUC1 expressed in normal cells. Due to the loss of Core 2 transferase and the abnormal activation of sialyltransferase, tumor-expressed MUC1 is mostly hypoglycosylated or has truncated sugar chains, exposing new antibody-binding epitopes. CAR-T cells designed to target these tumor-specific epitopes are often considered to have fewer off-target effects.

[0005] Nanobodies have natural advantages such as easy expression, high stability, and high affinity. Based on the advantages of nanoantibodies themselves and the biological mechanism of MUC1, the development of MUC1 nanoantibodies has very broad application prospects.

[0006] Summary of the Invention

[0007] An object of the present disclosure is to provide MUCl binding molecules and chimeric antigen receptors comprising the same.

[0008] In a first aspect, the present disclosure provides a MUC1 binding molecule comprising an anti-MUC1 single-domain antibody, wherein the complementarity determining regions (CDRs) of the single-domain antibody comprise CDR1, CDR2, and CDR3, wherein CDR1 comprises the sequence shown in any one of SEQ ID NOs: 1-10, CDR2 comprises the sequence shown in any one of SEQ ID NOs: 11-21, and CDR3 comprises the sequence shown in any one of SEQ ID NOs: 22-32.

[0009] In some embodiments, the single-domain antibody comprises CDR1, CDR2, and CDR3 represented by the SEQ ID NOs of any one of Group a1 to Group a11 in Table 1 below:

[0010] Table 1

[0011] In some embodiments, the single-domain antibody VHH is as shown in any one of SEQ ID NOs: 33-43.

[0012] The present disclosure also performs mutations on the basis of the MUC1 single-domain antibody (referred to as the wild-type single-domain antibody) in the first aspect to obtain MUC1 single-domain antibodies with different affinities. The second aspect of the present disclosure also provides a MUC1 binding molecule comprising a MUC1 single-domain antibody, wherein the complementarity determining region (CDR) of the MUC1 single-domain antibody comprises CDR1, CDR2, and CDR3, and the MUC1 single-domain antibody has one or more of the following characteristics (1)-(3):

[0013] (1) The CDR1 contains one or more of the following mutations compared to SEQ ID NO: 2: T3Q, R5D, R5H, R5K, R5E, R5Y, R6E, R6H, R6K, R6D, R6Y, preferably one or more mutations selected from the following group: T3Q, R5D, R6E, R5H\R6H, R5K\R6K, R5D\R6D, R5E\R6E, R5Y\R6Y,

[0014] (2) The CDR2 contains one or more of the following mutations compared to SEQ ID NO: 12: I1G, T3Q, T3W, F4D, D6A, D6G, D7S, T8Q, preferably one or more mutations selected from the following group: I1G, T3W, D6G, F4D\D6A, T3Q\T8Q, D6G\D7S,

[0015] (3) The CDR3 contains one or more of the following mutations compared to SEQ ID NO: 23: T1Q, I3G, Y6H, Q8E, Q8Y, L9G, L9Y, L9S, S10N, D12Q, preferably one or more mutations selected from the following group: T1Q, Q8E, Q8Y, L9G, I3G\L9G, L9Y, L9S, 6H\S10N\D12Q.

[0016] In some embodiments, the MUCl single-domain antibody comprises CDR1, CDR2, and CDR3, wherein the CDR1, CDR2, and CDR3 contain mutations shown in any one of Groups A1 to A17 in Table 2 below:

[0017] Table 2

[0018] In some embodiments, the MUCl single domain antibody has one or more of the following characteristics:

[0019] (1) the CDR1 is as shown in any one of SEQ ID NOs: 2, 49-56,

[0020] (2) the CDR2 is as shown in any one of SEQ ID NOs: 12, 57-62,

[0021] (3) The CDR3 is shown in any one of SEQ ID NOs: 23, 63-70.

[0022] In some embodiments, the MUCl single-domain antibody comprises CDR1, CDR2, and CDR3 shown in any one of the following SEQ ID NOs in Group B1 to Group B18 in Table 3:

[0023] Table 3

[0024] In some embodiments, the amino acid sequence of the MUC1 single-domain antibody is shown in any one of SEQ ID NOs: 71-87, preferably SEQ ID NOs: 71, 72, 78, or 83.

[0025] In some embodiments, the MUCl binding molecule may comprise one, two, or more anti-MUCl single domain antibodies described herein. The MUCl binding molecule may be a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, or an antigen-binding fragment thereof.

[0026] In some embodiments, the multivalent binding molecule or multispecific binding molecule connects multiple anti-MUC1 single domain antibodies or antigen-binding fragments thereof via a linker, wherein the linker consists of 1-15 amino acids selected from G and S.

[0027] In some embodiments, the single domain antibody is a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0028] In some embodiments, the single domain antibody further comprises a heavy chain constant region.

[0029] In some embodiments, the heavy chain constant region is a constant region of a human or camelid heavy chain antibody, comprising CH2 and CH3. In some embodiments, the CH2 and CH3 are CH2 and CH3 of a human IgG Fc, such as CH2 and CH3 of IgG4. Preferably, the heavy chain constant region is set forth in SEQ ID NO: 44. In some embodiments, the heavy chain constant region is a constant region of a cartilaginous fish heavy chain antibody, comprising CH1, CH2, CH3, CH4, and CH5.

[0030] In some embodiments, the MUCl binding molecule of any embodiment of the present disclosure is a chimeric antibody or a fully human antibody; preferably, a fully human antibody.

[0031] In some embodiments, the binding molecule is an antibody comprising the anti-MUCl single domain antibody as a heavy chain variable domain.

[0032] In some embodiments, the binding molecule further comprises a light chain variable domain, a heavy chain constant domain, and a light chain constant domain.

[0033] In some embodiments, the antigen-binding fragment of an antibody is selected from the group consisting of Fab, F(ab')2, Fv, and scFv.

[0034] The third aspect of the present disclosure also provides a fusion protein comprising the anti-MUCl binding molecule according to any embodiment of the present disclosure and other polypeptides.

[0035] In some embodiments, the additional polypeptide is located at the N-terminus and / or C-terminus of the binding molecule.

[0036] In some embodiments, the additional polypeptide is selected from a polypeptide that localizes the binding molecule to a different organelle, a tag for purification or a tag for immune response, a transmembrane protein or its transmembrane region, or a chimeric antigen receptor component.

[0037] In some embodiments, the fusion protein is a chimeric antigen receptor, whose antigen binding domain comprises the MUC1 binding molecule; preferably, the chimeric antigen receptor comprises: an optional signal peptide sequence, a MUC1 binding molecule comprising a MUC1 single domain antibody, a hinge region, a transmembrane region, and an intracellular region.

[0038] The present disclosure also provides a nucleic acid molecule comprising a sequence selected from the group consisting of: (1) a coding sequence for a MUC1 binding molecule or fusion protein according to any embodiment of the present disclosure;

[0039] (2) The complementary sequence of (1).

[0040] In some embodiments, the coding sequence is DNA or RNA.

[0041] The present disclosure also provides a nucleic acid construct comprising the nucleic acid molecule described herein.

[0042] In one or more embodiments, the nucleic acid construct is a vector, such as a cloning vector, an expression vector, or an integration vector. In one or more embodiments, the expression vector is a constitutive expression vector. Preferably, the constitutive expression vector is a transposable vector.

[0043] In some embodiments, the nucleic acid construct is an mRNA. In some embodiments, the mRNA comprises, in the 5′-3′ direction, a 5′ cap structure, a 5′ UTR, an open reading frame (ORF), a 3′ UTR, and Poly(A), wherein the open reading frame contains the sequence of the nucleic acid molecule.

[0044] The present disclosure also provides a host cell selected from:

[0045] (1) expressing the MUC1 binding molecule or the fusion protein described in any embodiment of the present invention;

[0046] (2) comprising a nucleic acid molecule as described herein; and / or

[0047] (3) comprising a nucleic acid construct as described herein.

[0048] In some embodiments, the host cell is a T cell, a TIL cell, or a NK cell, and the fusion protein is a chimeric antigen receptor.

[0049] In some embodiments, the cell contains: a coding sequence for the chimeric antigen receptor described in any embodiment of the present disclosure.

[0050] In some embodiments, the cells contain mRNA encoding the chimeric antigen receptor.

[0051] In some embodiments, the cell contains DNA encoding the chimeric antigen receptor, preferably, the chimeric antigen receptor DNA is integrated into the genome of the cell.

[0052] In some embodiments, the cells express and / or contain coding sequences for a therapeutic agent that is an antibody (eg, a single chain antibody, a single domain antibody, a bispecific antibody) or a cytokine.

[0053] The present disclosure also provides a method for producing a MUCl binding molecule, comprising: culturing the host cells described herein under conditions suitable for producing a MUCl binding molecule (e.g., a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody, an antibody or an antigen-binding fragment thereof), and optionally purifying the MUCl binding molecule from the culture.

[0054] The present disclosure also provides a pharmaceutical composition comprising the MUC1 binding molecule, nucleic acid molecule, nucleic acid construct or host cell described in any embodiment herein, and a pharmaceutically acceptable excipient.

[0055] In some embodiments, the pharmaceutical composition is used to treat cancer.

[0056] In some embodiments, the cancer is a MUCl-associated cancer. Preferably, the cancer is selected from the group consisting of breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer, or glioblastoma.

[0057] The present disclosure also provides use of the MUCl binding molecule described in any embodiment herein in the preparation of a medicament for preventing or treating cancer.

[0058] In some embodiments, the cancer is a MUCl-associated cancer. Preferably, the cancer is selected from the group consisting of breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer, or glioblastoma.

[0059] The present disclosure also provides a method for treating or preventing cancer, comprising administering to a patient in need thereof a therapeutically effective amount of the MUCl binding molecule according to any embodiment of the present disclosure, or a pharmaceutical composition containing the MUCl binding molecule according to any embodiment of the present disclosure.

[0060] In some embodiments, the cancer is a MUCl-associated cancer. Preferably, the cancer is selected from the group consisting of breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer, or glioblastoma.

[0061] The present disclosure also provides a kit for detecting MUC1 for evaluating drug treatment effects or diagnosing cancer, wherein the kit comprises the MUC1 binding molecule, nucleic acid construct, phage, and host cell described in any embodiment of the present invention.

[0062] In some embodiments, the kit further comprises a reagent for detecting the binding of MUCl to the single domain antibody, antibody, or antigen-binding fragment thereof, for example, by enzyme-linked immunosorbent assay.

[0063] In some embodiments, the detection binding agent is a detectable label that can be linked to the MUC1 binding molecule, such as biotin. The detectable label is linked to the MUC1 binding molecule or is separately present in the kit.

[0064] The present disclosure also provides a non-diagnostic method for detecting the presence of MUC1 in a sample, the method comprising: incubating the sample with a MUC1-binding molecule described in any embodiment herein, and detecting binding of MUC1 to a single domain antibody, antibody, or antigen-binding fragment thereof, thereby determining the presence of MUC1 in the sample. The detection is performed by enzyme-linked immunosorbent assay (ELISA).

[0065] The present disclosure also provides use of the MUCl binding molecule described in any embodiment herein in preparing a kit for detecting MUCl in a sample, evaluating the effect of drug treatment, or diagnosing cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 shows the titer test results of alpaca antiserum against MUC1 protein.

[0067] FIG2 shows the ELISA test results of candidate antibodies and MUC1 protein.

[0068] FIG3 shows the affinity test results of candidate antibodies to MUC1 protein.

[0069] FIG4 shows the binding test results of the candidate antibodies to the MB468 tumor cell line.

[0070] Figures 5-6 show the ELISA test results of candidate mutant antibodies and MUC1 protein.

[0071] FIG7 shows the binding test results of the candidate mutant antibodies and the MB468 tumor cell line.

[0072] FIG8 shows the binding test results of candidate mutant antibodies and H226 tumor cell lines.

[0073] FIG9 shows the binding test results of the candidate mutant antibodies and the RPMI8226 tumor cell line.

[0074] FIG10 shows the binding test results of candidate mutant antibodies to SKOV3 tumor cell lines.

[0075] Figure 11 shows the proliferation fold of CAR-T cells.

[0076] FIG12 shows the cell viability during CAR-T cell proliferation.

[0077] Figure 13 shows the CAR positivity rate of CAR-T cells on day 9.

[0078] Figure 14 shows the ratio of CD4 and CD8 in CAR-T cells on day 9.

[0079] FIG15 shows the time required for each group of CAR-T to kill 50% of MUC1 highly expressing tumor cells MB468 under different effector-target ratios.

[0080] Figure 16 shows the 48h tumor lysis rate of each group of CAR-T on HCT116 tumor cells with extremely low MUC1 expression.

[0081] Figure 17 shows the CAR positivity rate of the two donors after each round of co-culture.

[0082] Figure 18 shows the theoretical proliferation multiples of the CAR-positive T cells of the two donors compared to the number of CAR-positive cells initially inoculated at the end of the fifth round.

[0083] Figure 19 shows the IFN-γ secretion levels of CAR-T in each group in the first three rounds of the co-culture experiment.

[0084] Figure 20 shows the cell killing results of MUC1 CAR-T from two donors prepared by the JL system.

[0085] Figure 21 shows the cell viability and positive rate of CAR-T cells prepared by LNP delivery of mRNA.

[0086] Figure 22 shows the 24h transfection positivity rate of CAR-T and MOCKT cells prepared by LNP delivery of mRNA and electroporation.

[0087] Figure 23 shows the killing results of MAD-MB468 by CAR-T cells prepared by LNP and electroporation with different effector targets.

[0088] Figure 24 shows the killing results of SKOV3 by CAR-T cells prepared by LNP and electroporation with different effector targets. DETAILED DESCRIPTION

[0089] After extensive and in-depth research and extensive screening, the inventors have discovered a class of MUC1 binding molecules comprising anti-MUC1 single-domain antibodies. The MUC1 binding molecules disclosed herein are capable of highly specific binding to MUC1, exhibit high affinity and biological activity, low immunogenicity, structural stability, and good drugability. The present disclosure also mutates the MUC1 single-domain antibodies to obtain intermediate-affinity MUC1 single-domain antibodies, thereby reducing nonspecific binding and lowering risk. The present disclosure also provides chimeric antigen receptors and cells comprising the MUC1 single-domain antibodies.

[0090] Antibody

[0091] As used herein, a "MUCl binding molecule" is a protein that specifically binds to MUCl, including but not limited to antibodies, heavy chain antibodies, nanobodies, or antigen-binding fragments thereof.

[0092] As used herein, the term "antibody" includes monoclonal antibodies (including full-length antibodies having an immunoglobulin Fc region), antibody compositions with polyepitopic specificity, multispecific antibodies (e.g., bispecific antibodies), diabodies, and single-chain molecules, as well as antibody fragments, particularly antigen-binding fragments, e.g., Fab, F(ab')2, and Fv. As used herein, "antibody" and "immunoglobulin" are used interchangeably.

[0093] Traditional "antibodies" contain a basic 4-chain antibody unit, which is a heterotetrameric glycoprotein consisting of two identical light chains (L) and two identical heavy chains (H). Each heavy chain has a variable domain (VH) at the N-terminus, followed by three (for each α and γ chain, CH1, CH2 and CH3) and four (for μ and ε isotypes, CH1, CH2, CH3 and CH4) constant domains (CH) and a hinge region (Hinge) between the CH1 domain and the CH2 domain. Each light chain has a variable domain (VL) at the N-terminus, followed by a constant domain (CL) at the other end. Paired VH and VL together form an antigen binding site. For the structure and properties of different classes of antibodies, see, for example, Basic and Clinical Immunology, 8th edition, Daniel P. Sties, Abba I. Terr and Tristram G. Parsolw, eds., Appleton & Lange, Norwalk, CT, 1994, page 71 and chapter 6. Light chains from any vertebrate species can be assigned to one of two distinct types, called kappa and lambda, based on the amino acid sequence of their constant domains. The gamma and alpha classes are further divided into subclasses based on relatively minor differences in CH sequence and function. For example, humans express the following subclasses: IgG1, IgG2A, IgG2B, IgG3, IgG4, IgA1, and IgA2.

[0094] The "heavy chain antibodies" described herein are antibodies derived from camelids or cartilaginous fish. Compared to the above-mentioned four-chain antibodies, heavy chain antibodies lack light chains and heavy chain constant region 1 (CH1), and only contain two heavy chains composed of variable regions (VHH) and other constant regions. The variable regions are connected to the constant regions by a hinge-like structure. Each heavy chain of the camelid heavy chain antibody contains one variable region (VHH) and two constant regions (CH2 and CH3), and each heavy chain of the cartilaginous fish heavy chain antibody contains one variable region and five constant regions (CH1-CH5). By fusing with the constant region of human IgG Fc, the heavy chain antibody can have the CH2 and CH3 of human IgG Fc.

[0095] As used herein, the terms "single-domain antibody," "anti-MUC1 single-domain antibody," "heavy chain variable region domain of a heavy chain antibody," "VHH," and "nanobody" are used interchangeably to refer to single-domain antibodies that specifically recognize and bind to MUC1. A single-domain antibody is the variable region of a heavy chain antibody. Typically, a single-domain antibody contains three CDRs and four FRs. Preferably, the single-domain antibody of the present disclosure comprises a CDR1 as set forth in any one of SEQ ID NOs: 1-10, a CDR2 as set forth in any one of SEQ ID NOs: 11-21, and a CDR3 as set forth in any one of SEQ ID NOs: 22-32. Preferably, the single-domain antibody of the present disclosure comprises a FR1 as set forth in any one of the VHHs of SEQ ID NOs: 33-43, a FR2 as set forth in any one of the VHHs of SEQ ID NOs: 33-43, a FR3 as set forth in any one of the VHHs of SEQ ID NOs: 33-43, and a FR4 as set forth in any one of the VHHs of SEQ ID NOs: 33-43. VHHs obtained by recombinantly expressing the CDRs and FRs are also within the scope of the present disclosure. Single-domain antibodies (SDAs) are the smallest functional antigen-binding fragments. Typically, antibodies naturally lacking the light chain and heavy chain constant region 1 (CH1) are first obtained, and then the variable region of the antibody heavy chain is cloned to construct a SDA consisting solely of a single heavy chain variable region.

[0096] As used herein, "Nanobodies" refer to VHH-based immune molecules containing the CDRs or CDR combinations described herein. These can be heavy chain antibodies as described above, or multivalent or multispecific molecules containing multiple VHHs, or recombinant molecules obtained by recombining VHHs with antibody Fc (e.g., CH2 and CH3 or CH2, CH3, and CH4).

[0097] Binding molecules comprising two or more single-domain antibodies of the same specificity are multivalent single-domain antibodies; binding molecules comprising two or more single-domain antibodies of different specificities are multispecific single-domain antibodies. Multispecificity can be directed against MUC1 and another antigen, or against two different epitopes of MUC1. Multivalent or multispecific single-domain antibodies connect multiple single-domain antibodies via a linker. The linker typically consists of 1-15 amino acids selected from G and S.

[0098] In this article, the terms heavy chain antibody and antibody are used to distinguish different combinations of antibodies. Due to the structural similarities between the two, the following description of the structure of antibodies, except for the light chain, also applies to heavy chain antibodies.

[0099] The "variable region" or "variable domain" of an antibody refers to the amino-terminal domain of the heavy or light chain of an antibody. The variable domains of the heavy and light chains may be referred to as "VH" and "VL," respectively. These domains are generally the most variable parts of an antibody (relative to other antibodies of the same type) and contain the antigen-binding site.

[0100] The term "variable" refers to the situation where certain segments in the variable domain differ widely in the antibody sequence. The variable domain mediates antigen binding and defines the specificity of a particular antibody for its specific antigen. The more highly conserved parts of the variable domain are called framework regions (FR). Typically, the structure of the light chain variable region is FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4, and the structure of the heavy chain variable region is FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4. The constant domain is not directly involved in the binding of the antibody to the antigen, but exhibits a variety of effector functions, such as the participation of antibodies in antibody-dependent cell-mediated cytotoxicity. There are a variety of variable region annotation schemes for antibodies, including: Chothia, Kabat, IMGT and Contact. The IMGT annotation scheme is used as an example herein.

[0101] "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C-terminal region of an antibody heavy chain that mediates the binding of the immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells), or binding to the first component (C1q) of the classical complement system. In IgG, IgA, and IgD antibody isotypes, the Fc region is composed of two identical protein fragments, the CH2 domain and the CH3 domain, from the two heavy chains of the antibody; the Fc region of IgM and IgE contains three heavy chain constant domains (CH domains 2-4) in each polypeptide chain. Although the boundaries of the Fc region of an immunoglobulin heavy chain can vary, the human IgG heavy chain Fc region is generally defined as the sequence segment from the amino acid residue at heavy chain position C226 or P230 to the carboxyl terminus, where the numbering is according to the EU index, as in Kabat. As used herein, the Fc region can be a native sequence Fc or a variant Fc.

[0102] "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen-binding region and / or variable region of an intact antibody. Antibody fragments are preferably antigen-binding fragments of an antibody. Examples of antibody fragments include Fab, Fab', F(ab'), F(ab')2, Fd, and Fv fragments, disulfide-linked Fv; diabodies; linear antibodies; single-chain antibody molecules; scFv-Fc fragments; multispecific antibodies formed from antibody fragments; and any fragment that can increase half-life by chemical modification or by incorporation into liposomes. Antigen-binding fragments can be prepared by a variety of techniques, including but not limited to proteolytic digestion of intact antibodies and expression by host cells containing the antigen-binding fragment.

[0103] "Fv" is the smallest antibody fragment that contains a complete antigen recognition and binding site. This fragment consists of a dimer of one heavy-chain variable domain and one light-chain variable domain in tight, non-covalent association. From the folding of these two domains protrude six hypervariable loops (three loops each from the heavy and light chains), which contribute the amino acid residues for antigen binding and confer antigen-binding specificity to the antibody. However, even a single variable domain (or half an Fv containing only three HVRs specific for an antigen) has the ability to recognize and bind antigen, albeit with lower affinity than the complete binding site. "Single-chain Fv," also abbreviated as "sFv" or "scFv," is an antibody fragment comprising the VH and VL domains of an antibody, linked into a single polypeptide chain. Preferably, the sFv polypeptide further comprises a polypeptide linker between the VH and VL domains, allowing the sFv to form the desired antigen-binding structure.

[0104] As used herein, the term "monoclonal antibody" refers to an antibody obtained from a group of substantially homogeneous antibodies, i.e., except for possible naturally occurring mutations and / or post-translational modifications (e.g., isomerization, amidation) that may be present in small amounts, the individual antibodies constituting the group are identical. Monoclonal antibodies are highly specific, directed against a single antigenic site. Compared to polyclonal antibody preparations (which typically include different antibodies directed against different determinants (epitopes)), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, the advantage of monoclonal antibodies is that they are synthesized by hybridoma culture and are not contaminated by other immunoglobulins. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody group and should not be interpreted as requiring the production of antibodies by any particular method. For example, the monoclonal antibodies used according to the present disclosure can be generated by a variety of techniques, including, for example, hybridoma methods, phage display methods, recombinant DNA methods, and techniques and single-cell sequencing methods for generating human or human-like antibodies from animals having part or all of the human immunoglobulin loci or genes encoding human immunoglobulin sequences.

[0105] Monoclonal antibodies herein also include "chimeric" antibodies in which a portion of the heavy and / or light chain is identical or homologous to the corresponding sequence in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain is identical or homologous to the corresponding sequence in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity.

[0106] The "humanized" form of a non-human (e.g., mouse) antibody refers to a chimeric antibody that minimally contains sequences derived from non-human immunoglobulins. Therefore, a "humanized antibody" generally refers to a non-human antibody in which the variable domain framework region is exchanged with sequences found in human antibodies. Typically, in a humanized antibody, the entire antibody (except for the CDRs) is encoded by a nucleic acid molecule of human origin or is identical to such an antibody (except for the CDRs). The CDRs (some or all of which are encoded by nucleic acids derived from non-human organisms) are transplanted into the β-pleated skeleton of the human antibody variable region to produce an antibody, the specificity of which is determined by the transplanted CDRs. Methods for producing such antibodies are well known in the art, for example, using mice with genetically engineered immune systems. In the present disclosure, antibodies, single domain antibodies, heavy chain antibodies, etc. all include humanized variants of each of the antibodies.

[0107] A "human antibody" refers to an antibody that has an amino acid sequence corresponding to the amino acid sequence of an antibody produced by a human and / or is produced using any of the techniques disclosed herein for producing human antibodies. This definition of a human antibody specifically excludes humanized antibodies that contain non-human antigen-binding residues. Human antibodies can be produced using a variety of techniques known in the art, including phage display libraries. In some embodiments, the present disclosure also provides single domain antibodies, heavy chain antibodies, antibodies, or antigen-binding fragments thereof that bind to the same epitope of MUC1 as any anti-MUC1 single domain antibody of the present disclosure, i.e., single domain antibodies, heavy chain antibodies, antibodies, or antigen-binding fragments thereof that can cross-compete with any single domain antibody of the present disclosure for binding to MUC1.

[0108] In the present disclosure, the CDR1 of the single-domain antibody comprises the sequence shown in any one of SEQ ID NOs: 1-10; the CDR2 of the single-domain antibody comprises the sequence shown in any one of SEQ ID NOs: 11-21; and the CDR3 of the single-domain antibody comprises the sequence shown in any one of SEQ ID NOs: 22-32.

[0109] In some embodiments, the single-domain antibody comprises CDR1, CDR2, and CDR3 shown in any one of the SEQ ID NOs in Group a1 to Group a11 in Table 1:

[0110] In some embodiments, the FR1 of the single-domain antibody VHH can be selected from the FR1 of any VHH of SEQ ID NOs: 33-43, the FR2 of the VHH can be selected from the FR2 of any VHH of SEQ ID NOs: 33-43, the FR3 of the VHH can be selected from the FR3 of any VHH of SEQ ID NOs: 33-43, and the FR4 of the VHH can be selected from the FR4 of any VHH of SEQ ID NOs: 33-43.

[0111] In a preferred embodiment, the FR region of the single-domain antibody VHH of the present disclosure is the FR region of any VHH selected from SEQ ID NOs: 33 to 43. Further preferably, the CDR of such an antibody is selected from any one of Group a1 to Group a11 in Table 1. In some embodiments, the single-domain antibody VHH is as shown in any one of SEQ ID NOs: 33 to 43.

[0112] The present disclosure also mutates the above-mentioned MUC1 single domain antibody (referred to as a wild-type single domain antibody) to obtain a MUC1 single domain antibody with desired affinity. The present disclosure also provides a MUC1 binding molecule comprising a mutated anti-MUC1 single domain antibody.

[0113] Preferably, mutations are made in a wild-type single-domain antibody having CDR1 as set forth in SEQ ID NO: 2, CDR2 as set forth in SEQ ID NO: 12, and CDR3 as set forth in SEQ ID NO: 23. The mutations are located in the CDR regions of the wild-type single-domain antibody and may comprise one or more mutations. In the CDR1 region of SEQ ID NO: 2, one or more of the following mutations may be made: T3Q, R5D, R5H, R5K, R5E, R5Y, R6E, R6H, R6K, R6D, R6Y, preferably comprising one or more mutations selected from the following group: T3Q, R5D, R6E, R5H\R6H, R5K\R6K, R5D\R6D, R5E\R6E, R5Y\R6Y. In the CDR2 region of SEQ ID NO: 12, one or more of the following mutations may be made: I1G, T3Q, T3W, F4D, D6A, D6G, D7S, T8Q, preferably comprising one or more mutations selected from the following group: I1G, T3W, D6G, F4D\D6A, T3Q\T8Q, D6G\D7S. In the CDR3 region of SEQ ID NO: 23, one or more of the following mutations may be made: T1Q, I3G, Y6H, Q8E, Q8Y, L9G, L9Y, L9S, S10N, D12Q, preferably comprising one or more mutations selected from the following group: T1Q, Q8E, Q8Y, L9G, I3G\L9G, L9Y, L9S, 6H\S10N\D12Q.

[0114] The mutated MUC1 single domain antibody comprises a CDR1, a CDR2, and a CDR3, wherein the CDR1, CDR2, and CDR3 comprise mutations as set forth in any one of Groups A1 to A17 in Table 2 below. In some embodiments, the mutated anti-MUC1 single domain antibody has reduced affinity for MUC1 compared to a wild-type single domain antibody having a CDR1 as set forth in SEQ ID NO: 2, a CDR2 as set forth in SEQ ID NO: 12, and a CDR3 as set forth in SEQ ID NO: 23. The anti-MUC1 single domain antibody has a binding affinity for MUC1 of approximately 1×10 -8 ~5×10 -7 M's K D Bind to MUC1, preferably 1.5 × 10 -8 ~2×10 -7 M. K D The expression of CDR1, CDR2 and CDR3 is determined by surface plasmon resonance (SPR). In some embodiments, the MUCl single-domain antibody comprises CDR1, CDR2 and CDR3 as shown in any one of the SEQ ID NOs in Group B1 to Group B17 in Table 3 below.

[0115] The FR region of the MUC1 single-domain antibody can be the same as the FR region of the wild-type single-domain antibody, or can be humanized and optimized. In some embodiments, the amino acid sequence of the MUC1 single-domain antibody is shown in any one of SEQ ID NOs: 71-87, preferably SEQ ID NOs: 71, 72, 78, or 83.

[0116] The MUC1 binding molecules described herein may comprise one, two, or more anti-MUC1 single domain antibodies described herein, such as monovalent or multivalent single domain antibodies, multispecific single domain antibodies, heavy chain antibodies or antigen-binding fragments thereof, or antibodies or antigen-binding fragments thereof.

[0117] In some embodiments, the MUC1 binding molecules herein comprise an anti-MUC1 single domain antibody and an immunoglobulin Fc region. The Fc region useful in the present disclosure can be derived from immunoglobulins of different subtypes, such as IgG (e.g., IgG1, IgG2, IgG3, or IgG4 subtypes), IgA1, IgA2, IgD, IgE, or IgM. In some embodiments, the immunoglobulin Fc region is an IgG4 Fc, the amino acid sequence of which is set forth in SEQ ID NO: 44.

[0118] In some embodiments, the MUCl binding molecules described herein are heavy chain antibodies that further comprise a heavy chain constant region, such as a constant region of a camelid heavy chain antibody or a cartilaginous fish heavy chain antibody.

[0119] The present disclosure also includes derivatives and analogs of the antibodies. "Derivatives" and "analogs" refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present disclosure. Derivatives or analogs of the present disclosure can be (i) polypeptides having a substituent group in one or more amino acid residues, or (ii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iii) polypeptides formed by fusion of an additional amino acid sequence to this polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). According to the teachings herein, these derivatives and analogs are within the scope known to those skilled in the art.

[0120] Without materially affecting the activity of the antibody, those skilled in the art may modify one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more) amino acids in the sequences of the present disclosure to obtain variants of the antibody or its functional fragment sequence. These variants include (but are not limited to): deletion, insertion, and / or substitution of one or more (generally 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, as well as addition of one or more (generally within 20, preferably within 10, and more preferably within 5) amino acids to the C-terminus and / or N-terminus. In the art, conservative substitution with amino acids having similar or similar properties generally does not alter protein function. For example, amino acids with similar properties may be substituted in the FR and / or CDR regions of the variable region. Amino acid residues that can be conservatively substituted are well known in the art. Such substituted amino acid residues may or may not be encoded by the genetic code. For another example, adding one or more amino acids to the C-terminus and / or N-terminus generally does not change the function of the protein and is considered to be within the scope of protection of the present disclosure.

[0121] Variant forms of the antibodies described herein include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize under high or low stringency conditions to DNA encoding the antibodies of the present disclosure, and polypeptides or proteins obtained using antisera raised against the antibodies of the present disclosure.

[0122] In some embodiments, the sequence of the variants described in the present disclosure may be at least 95%, 96%, 97%, 98% or 99% identical to the sequence from which it is derived. The sequence identity described in the present disclosure can be measured using sequence analysis software. For example, the computer program BLAST, particularly BLASTP or TBLASTN, is used with default parameters. The present disclosure also includes molecules having antibody heavy chain variable regions with CDRs, as long as their CDRs have greater than 90% (preferably greater than 95%, and most preferably greater than 98%) homology to the CDRs identified herein.

[0123] The antibodies of the present disclosure can be prepared using conventional methods in the art, such as hybridoma technology well known in the art. The heavy chain antibodies of the present disclosure can be prepared using conventional methods in the art, such as phage display technology well known in the art. Alternatively, the antibodies or heavy chain antibodies of the present disclosure can be expressed in other cell lines. Suitable mammalian host cells can be transformed with sequences encoding the antibodies of the present disclosure. Transformation can be carried out using any known method, for example, including packaging the nucleic acid molecule in a virus (or viral vector) and transducing the host cell with the virus (or vector). The transformation procedure used depends on the host to be transformed. Methods for introducing heterologous nucleic acid molecules into mammalian cells are well known in the art and include dextran-mediated transfection, calcium phosphate precipitation, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of nucleic acid molecules in liposomes, and direct microinjection of DNA into the nucleus. Mammalian cell lines that can be used as hosts for expression are well known in the art and include, but are not limited to, a variety of immortalized cell lines available from the American Type Culture Collection (ATCC), including, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., HepG2), etc. Particularly preferred cell lines are selected by determining which cell lines have high expression levels and produce antibodies with substantial MUCl binding properties.

[0124] Fusion protein

[0125] The present disclosure also includes fusion proteins comprising the MUC1 binding molecules described herein and other polypeptides. In some embodiments, the other polypeptides are located at the N-terminus and / or C-terminus of the binding molecule. In some embodiments, the other polypeptides are selected from polypeptides that localize the binding molecule to different organelles, tags for purification or tags for immune response, transmembrane proteins or their transmembrane regions, chimeric antigen receptor components (extracellular domain, hinge region, transmembrane region, signal transduction domain, costimulatory domain, etc.). In some embodiments, the fusion protein is a chimeric antigen receptor whose antigen binding domain comprises the MUC1 binding molecule. The chimeric antigen receptor comprises: an optional signal peptide sequence, a MUC1 binding molecule comprising a MUC1 single domain antibody, a hinge region, a transmembrane region, and an intracellular region.

[0126] The chimeric antigen receptor further has one or more characteristics selected from the following:

[0127] The signal peptide includes CD8 signal peptide, CD28 signal peptide, CD4 signal peptide or light chain signal peptide,

[0128] The hinge region includes a CD8 hinge region, an IgD hinge region, an IgG1 Fc CH2CH3 hinge region or an IgG4 Fc CH2CH3 hinge region,

[0129] The transmembrane region includes a CD28 transmembrane region, a CD8 transmembrane region, a CD3ζ transmembrane region, a CD134 transmembrane region, a CD137 transmembrane region, an ICOS transmembrane region or a DAP10 transmembrane region.

[0130] The intracellular region includes an intracellular costimulatory domain and / or an intracellular signaling domain,

[0131] The intracellular costimulatory domain includes the intracellular domain of CD28, CD134 / OX40, CD137 / 4-1BB, lymphocyte-specific protein tyrosine kinase, inducible T cell costimulator (ICOS) or DNAX activation protein 10,

[0132] The intracellular signaling domain includes a CD3ζ intracellular signaling domain or an FcεRIγ intracellular signaling domain.

[0133] Nucleic acid molecules and nucleic acid constructs

[0134] The present disclosure also provides nucleic acid molecules encoding the aforementioned MUC1 binding molecules or fusion proteins. Nucleic acid molecules encoding the heavy chain variable region, light chain variable region, heavy chain, light chain, and respective CDRs are provided herein. The nucleic acid molecules of the present disclosure can be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be a coding strand or a non-coding strand. RNA can be mRNA that expresses the binding molecule in vivo and / or in vitro.

[0135] The present disclosure also relates to nucleic acid molecules that hybridize to the above-mentioned nucleic acid molecule sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present disclosure particularly relates to nucleic acid molecules that hybridize to the nucleic acid molecules described in the present disclosure under stringent conditions. In the present disclosure, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) the addition of a denaturing agent during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, more preferably at least 95%. Furthermore, the polypeptide encoded by the hybridizable nucleic acid molecule has the same biological function and activity as the mature polypeptide.

[0136] The full-length nucleotide sequence of the antibodies of the present disclosure or fragments thereof can generally be obtained by PCR amplification, recombination, or artificial synthesis. One feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is relatively short. Generally, fragments with very long sequences can be obtained by first synthesizing multiple small fragments and then ligating them. In addition, the coding sequence of the heavy chain can be fused with an expression tag (such as 6His) to form a fusion protein.

[0137] Once the relevant sequence is obtained, it can be obtained in large quantities using recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the host cells after proliferation by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present disclosure include biomolecules that exist in isolated form. At present, DNA sequences encoding proteins of the present disclosure (or fragments thereof, or derivatives thereof) can be obtained completely by chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the present disclosure by chemical synthesis.

[0138] The present disclosure also relates to nucleic acid constructs comprising nucleic acid molecule sequences described herein and one or more regulatory sequences operably linked to these sequences, such as regulatory sequences suitable for expressing the DNA or RNA as a binding molecule in vivo or in vitro.

[0139] The regulatory sequence can be a suitable promoter sequence. The promoter sequence is usually operably connected to the coding sequence of the protein to be expressed. The promoter can be any nucleotide sequence that shows transcriptional activity in the selected host cell, including mutations, truncations and hybrid promoters, and can be obtained from the gene encoding the extracellular or intracellular polypeptide homologous or heterologous to the host cell. An example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive any nucleic acid molecule sequence that is operably connected thereto for high-level expression. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). Further, it is also possible to consider the use of an inducible promoter. The use of an inducible promoter provides a molecular switch that can open the expression of the nucleic acid molecule sequence that is operably connected to the inducible promoter when the deadline is expressed, and close expression when expression is undesirable.

[0140] The regulatory sequence may also be a suitable transcription terminator sequence, a sequence recognized by the host cell to terminate transcription. The terminator sequence is operably linked to the 3' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice may be used in the present disclosure. The regulatory sequence may also be a suitable leader sequence, an untranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in the host cell of choice may be used in the present disclosure.

[0141] In some embodiments, the nucleic acid construct is a vector, such as a cloning vector, an expression vector, and an integration vector. Usually, the expression of the nucleic acid molecule sequence of the present disclosure is achieved by operably connecting the nucleic acid molecule sequence of the present disclosure to an expression vector. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters that can be used to regulate the expression of the desired nucleic acid sequence. Integration vectors contain components that integrate the target sequence into the cell genome. These vectors can be used to transform appropriate host cells to enable them to express proteins. Vectors usually contain sequences that are used for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences.

[0142] In addition, the type of vector is not limited, for example, plasmids, phagemids, phage derivatives, animal viruses and cosmids, and can be changed according to the host cell to be introduced. Viral vector technology is well known in the art and is described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses and lentiviruses.

[0143] To assess expression of the polypeptide or portion thereof, the vector introduced into the cell may also contain either or both a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected by the viral vector.

[0144] In some embodiments, the nucleic acid construct further comprises a coding sequence for a transposase, which is used to transpose the coding sequence of the chimeric antigen receptor, for example, to integrate the coding sequence or expression cassette of the transposed chimeric antigen receptor into the genome. The coding sequence of the chimeric antigen receptor is located between the recognition sequences of the transposase.

[0145] In some embodiments, the nucleic acid construct comprises an expression cassette for CAR. The nucleic acid construct further comprises an expression cassette for a transposase. The one or two expression cassettes are contained in one or more vectors. For example, the nucleic acid construct comprises: a vector comprising (a) an expression cassette for CAR and optionally (b) an expression cassette for a transposase; or two vectors comprising an expression cassette for CAR and an expression cassette for a transposase, respectively.

[0146] In some embodiments, the nucleic acid construct is mRNA, which can be directly transduced into cells for transient expression. In some embodiments, the mRNA comprises, in the 5'-3' direction, a 5' cap structure, a 5' UTR, an open reading frame (ORF), a 3' UTR, and poly (A), wherein the open reading frame contains the sequence of the nucleic acid molecule.

[0147] cell

[0148] Host cells can be prokaryotic cells, such as bacterial cells; lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 or Sf9; and animal cells such as CHO, COS7, and 293 cells.

[0149] Host cells suitable for introducing the nucleic acid constructs described herein can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; animal cells of CHO, COS7, 293 cells, etc. Examples of mammalian cells include immune cells, preferably immune effector cells. "Immune effector cells" are immune cells that can perform immune effector functions, including: T cells, NK cells, TIL cells, peripheral blood mononuclear cells (PBMC), neutrophils, eosinophils, hematopoietic stem cells. T cells suitable for the present disclosure can be various types of T cells from various sources.

[0150] Methods for introducing nucleic acids or vectors into mammalian cells are known in the art. The vectors can be transferred into the cells by physical, chemical, or biological methods. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl2 using procedures well known in the art. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc. In some embodiments, the transduced or transfected immune effector cells are propagated in vitro after the introduction of the nucleic acid or vector.

[0151] The fusion protein is a chimeric antigen receptor (CAR), whose antigen binding domain comprises the MUC1 binding molecule, and cells expressing the chimeric antigen receptor can be produced by the following methods: (1) contacting the cells with an activator for activation; (2) contacting the cells with a nucleic acid molecule encoding the CAR, the nucleic acid molecule encoding the CAR being on a vector to introduce the nucleic acid molecule into the cells; and (3) harvesting the cells. Cells expressing the chimeric antigen receptor can be produced in vitro using a viral vector or a non-viral vector; cells expressing the chimeric antigen receptor can also be produced directly in the patient's body using a viral vector.

[0152] In some embodiments, the nucleic acid molecule encoding CAR is DNA, and the vector is a plasmid vector. In some embodiments, the vector is a plasmid vector containing a transposon, and the transposon comprises a nucleic acid molecule encoding CAR, and the step (2) cell is also contacted with a transposase or a nucleic acid molecule encoding a transposase. The transposon and transposase belong to the same transposon system, and the transposon system is selected from the group consisting of: Tol1 transposon system, Tol2 transposon system, Frog Prince transposon system, Minos transposon system, Hsmar1 transposon system, Helaizer transposon system, ZB transposon system, BZ transposon system, Intruder transposon system, SPINON transposon system, TcBuster transposon system, Passer transposon system, JL transposon system, Yabusame-1 transposon system, Uribo2 transposon system, PiggyBac (PB) transposon system, SleepingBeauty (SB) transposon system, and various variants or derivatives of the above transposon systems. In some embodiments, the transposon system is a PB transposon system, a BZ transposon system, or a JL transposon system. The JL transposon system is the JL transposon system described in any embodiment of CN202310081106.8, and this application incorporates its entire content into this article by reference.

[0153] In some embodiments, the nucleic acid molecule encoding the transposase is DNA or RNA. In some embodiments, the cell is contacted with a transposase or a nucleic acid molecule encoding the transposase, and cell transduction is performed by electroporation. In some embodiments, the introduction adopts electroporation. The step (2) includes: contacting the cell with a DNA vector comprising a JL transposon and an mRNA encoding the JL transposase, wherein the JL transposon includes a CAR gene expression cassette and an inverted terminal repeat sequence located on both sides of the CAR gene expression cassette. In some embodiments, the CAR gene expression cassette is loaded on a viral vector that infects T cells, and the viral vector is injected into the patient to directly produce CAR-T in vivo.

[0154] In some embodiments, the nucleic acid molecule encoding CAR is RNA, such as mRNA, saRNA, and the carrier is LNP, LPX, VLP, inorganic nanoparticles or exosomes. The mRNA or saRNA encoding CAR can be transduced into cells by electroporation, or the mRNA or saRNA can be transduced into cells by carriers such as LNP to obtain a cell that transiently expresses CAR.

[0155] In some embodiments, the cells can express a therapeutic agent and / or a coding sequence containing a therapeutic agent, and step (2) the cells are also contacted with a nucleic acid molecule of a therapeutic agent to introduce the nucleic acid molecule of the therapeutic agent into the cell. In some embodiments, the therapeutic agent is an antibody (e.g., a single-chain antibody, a single-domain antibody, a bispecific antibody) or a cytokine. In some embodiments, the therapeutic agent is an immune checkpoint inhibitor. The immune checkpoint inhibitor is an antibody or fragment thereof targeting any one or more of PD-1, LAG-3, TIM3, B7-H1, CD160, P1H, 2B4, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), TIGIT, CTLA-4, BTLA and LAIR1. In some embodiments, the therapeutic agent is an antibody targeting PD-1, preferably a single-domain antibody targeting PD-1. The sequence of the single-domain antibody targeting PD-1 is the single-domain antibody targeting PD-1 described in any embodiment of patent CN202011582908.X, and this application incorporates its entire contents into this document by reference. In some embodiments, the therapeutic agent is an antibody targeting CTLA-4, preferably a single-domain antibody targeting CTLA-4. The sequence of the single-domain antibody targeting CTLA-4 is the single-domain antibody targeting CTLA-4 described in any embodiment of patent CN202111152925.4, and this application incorporates its entire contents into this document by reference. In some embodiments, the therapeutic agent is a bispecific antibody containing a first functional region targeting PD-1 and a second functional region targeting CTLA4. In some embodiments, the bispecific antibody is the bispecific antibody described in any embodiment of patent CN CN202310338674.1, and this application incorporates its entire contents into this document by reference.

[0156] The obtained transformants can be cultured with conventional methods to express the polypeptide encoded by the gene of the present disclosure. Depending on the host cell used, the culture medium used can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced using a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0157] The polypeptide in the above method can be expressed intracellularly, on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical, and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and various other liquid chromatography techniques and combinations of these methods.

[0158] Therapeutic uses and pharmaceutical compositions

[0159] By constructing a library of nanobodies, the inventors discovered, expressed, and purified a plurality of nanobodies that can bind to the MUC1 protein. All aspects of the antibodies described herein can be used to prepare medicaments for preventing or treating various conditions and diseases described herein, particularly diseases or conditions associated with cells expressing MUC1. In some embodiments, the conditions and diseases are cancers, including but not limited to breast cancer, kidney cancer, ovarian cancer, gastric cancer, pancreatic cancer, lung cancer, colon cancer, osteosarcoma, adenocarcinoma, bladder cancer, colorectal cancer, cervical cancer, head and neck cancer, fallopian tube cancer, multiple myeloma, bile duct cancer, gallbladder cancer, esophageal cancer, prostate cancer, or glioblastoma.

[0160] The pharmaceutical compositions herein contain the binding molecules described herein, and pharmaceutically acceptable excipients, including but not limited to diluents, carriers, solubilizers, emulsifiers, preservatives and / or adjuvants. Excipients are preferably non-toxic to the recipient at the dosage and concentration employed. Such excipients include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. In certain embodiments, the pharmaceutical composition may contain substances for improving, maintaining or retaining, for example, the pH, permeability, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, absorption or penetration of the composition. These substances are known in the prior art. The optimal pharmaceutical composition can be determined based on the intended route of administration, delivery method, and desired dosage.

[0161] Pharmaceutical compositions for in vivo administration are typically provided as sterile formulations. Sterilization is achieved by filtration through a sterile filtration membrane. When the composition is lyophilized, this method can be used for sterilization before or after lyophilization and rehydration. The pharmaceutical compositions of the present disclosure may be selected for parenteral delivery. Compositions for parenteral administration may be stored in lyophilized form or in solution. For example, they may be prepared by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. Parenteral compositions are typically placed in a container with a sterile access port, such as an intravenous solution strip or vial with a stopper pierceable by a hypodermic needle. Alternatively, the composition may be selected for inhalation or delivery through the digestive tract (such as orally). The preparation of such pharmaceutically acceptable compositions is within the skill of the art. Other pharmaceutical compositions will be apparent to those skilled in the art, including formulations comprising the antibody in sustained or controlled release delivery formulations. Techniques for formulating a variety of other sustained or controlled delivery methods (such as liposomal carriers, bioerodible microparticles or porous beads, and depot injections) are also known to those skilled in the art.

[0162] Once the pharmaceutical composition is formulated, it is stored in a sterile vial in the form of a solution, suspension, gel, emulsion, solid, crystal or in the form of a dehydrated or lyophilized powder. The formulation can be stored in a ready-to-use form or in the form of rehydration (e.g., lyophilization) before administration. The present disclosure also provides a kit for producing a single-dose administration unit. The kit of the present disclosure can each contain a first container with a dried protein and a second container with an aqueous formulation. In certain embodiments of the present disclosure, a kit containing a single-lumen and multi-lumen prefilled syringe (e.g., a liquid syringe and a lyophilizing syringe) is provided.

[0163] The present disclosure also provides methods for treating a patient (particularly a patient with a MUCl-related disease) by administering a binding molecule or pharmaceutical composition thereof according to any embodiment of the present disclosure. As used herein, the terms "patient," "subject," "individual," and "subject" are used interchangeably to include any organism, preferably an animal, more preferably a mammal (e.g., rat, mouse, dog, cat, rabbit, etc.), and most preferably a human. "Treatment" refers to administering a treatment regimen described herein to a subject to achieve at least one positive therapeutic effect (e.g., a decrease in the number of cancer cells, a decrease in tumor volume, a decrease in the rate of cancer cell infiltration into peripheral organs, or a decrease in the rate of tumor metastasis or tumor growth). The treatment regimen that effectively treats a patient can vary depending on a variety of factors, such as the patient's disease state, age, weight, and the ability of the therapy to elicit an anti-cancer response in the subject.

[0164] The therapeutically effective amount of the pharmaceutical composition containing the binding molecules of the present disclosure that will be adopted will depend on, for example, treatment degree and target. It will be appreciated by those skilled in the art that the appropriate dosage level for the treatment of will depend in part on the size (body weight, body surface or organ size) and / or condition (age and general health) of the molecule, indication, route of administration and the patient that are delivered and change. In certain embodiments, the clinician can titrate the dosage and change the route of administration to obtain best therapeutic effect. For example, about 10 micrograms / kg body weight-about 50 milligrams / kg body weight every day.

[0165] The frequency of administration will depend on the pharmacokinetic parameters of the binding molecule in the formulation used. The clinician typically administers the composition until a dose is achieved that achieves the desired effect. The composition can thus be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infusion via an implantable device or catheter.

[0166] The pharmaceutical composition is administered orally, by injection via the intravenous, intraperitoneal, intracerebral (intracerebral), intracerebroventricular, intramuscular, intraocular, intraarterial, portal vein or intralesional routes; by sustained release systems or by implantation devices.

[0167] Diagnostics, Tests, and Kits

[0168] The binding molecules of the present disclosure, due to their high affinity for MUC1, can be used in assays, such as binding assays, to detect and / or quantify MUC1 expressed in tissues or cells. Binding molecules, such as single domain antibodies, can be used in studies to further investigate the role of MUC1 in disease. Methods for detecting MUC1 are generally as follows: obtaining a cell and / or tissue sample; and detecting the level of MUC1 in the sample.

[0169] The MUC1 binding molecules of the present disclosure can be used for diagnostic purposes to detect, diagnose, or monitor diseases and / or conditions associated with MUC1. The present disclosure provides methods for detecting the presence of MUC1 in a sample using classical immunohistological methods known to those skilled in the art. Detection of MUC1 can be performed in vivo or in vitro. Examples of methods suitable for detecting the presence of MUC1 include ELISA, FACS, RIA, and the like.

[0170] For diagnostic applications, binding molecules such as single domain antibodies are typically labeled with a detectable labeling group. Suitable labeling groups include, but are not limited to, radioisotopes or radionuclides (e.g., 3H, 14C, 15N, 35S, 90Y, 99Tc, 111In, 125I, 131I), fluorescent groups (e.g., FITC, rhodamine, lanthanide phosphors), enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotinyl groups, or predetermined polypeptide epitopes recognized by secondary reporters (e.g., leucine zipper pair sequences, binding sites for secondary antibodies, metal binding domains, epitope tags), MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents. Various methods for labeling proteins are known in the art and can be used to perform the present disclosure.

[0171] Another aspect of the present disclosure provides methods for detecting the presence of a test molecule that competes with an antibody of the present disclosure for binding to MUC1. One example of such an assay involves measuring the amount of free antibody in a solution containing a certain amount of MUC1 in the presence or absence of a test molecule. An increase in the amount of free antibody (i.e., antibody that is not bound to MUC1) would indicate that the test molecule is able to compete with the antibody for binding to MUC1. In one embodiment, the antibody is labeled with a labeling group. Alternatively, the test molecule is labeled and the amount of free test molecule is monitored in the presence or absence of the antibody.

[0172] The present disclosure also provides a detection kit for detecting MUC1 levels, which includes an antibody that recognizes the MUC1 protein, a lysis medium for dissolving the sample, and common reagents and buffers required for detection, such as various buffers, detection labels, detection substrates, etc. The detection kit can be an in vitro diagnostic device.

[0173] The present invention will be described below with reference to specific examples. It should be understood that these examples are illustrative only and are not intended to limit the scope of the present invention. The methods and materials used in the examples are conventional in the art unless otherwise indicated.

[0174] Example

[0175] Example 1 Alpaca Immunization

[0176] 1.1 Immunogen Preparation:

[0177] According to the MUC1 protein sequence queried on NCBI, it was fused with the human IgG Fc fragment sequence and commissioned to Suzhou Jinweizhi Company to synthesize and construct a eukaryotic expression vector of the pCDNA3.4 (Thermo) plasmid. The synthesized plasmid was expressed using the EXpiCHOTM (Thermo Fisher) expression system. After expression, a 5 mL Protein A pre-packed column (GE) was used for one-step affinity purification. The purified sample was replaced into PBS buffer, and the purity was identified by SDS-PAGE electrophoresis gel and HPLC. After the activity was identified by ELISA, it was packaged and frozen in a -80 degree refrigerator for subsequent immunization.

[0178] 1.2 Alpaca Immunity:

[0179] For the first immunization, 1000 μg of antigen (MUC1-hFc) was mixed with an adjuvant (GERBU FAMA) and injected subcutaneously at four sites on the back of alpacas, with a 1 mL dose per site. A second immunization was performed three weeks apart. For immunizations 2 to 9, 500 μg of antigen was injected subcutaneously at four sites on the back of alpacas, with a 1 mL dose per site. Each immunization was performed one week apart.

[0180] 1.3 Immune serum titer detection:

[0181] 1.3.1 Protein level titer detection

[0182] The plates were coated with MUC1-His antigen overnight at 4°C. After blocking and washing, serially diluted serum was added to the ELISA plate and incubated with anti-llama IgG HRP (Abcam). After washing, the plates were developed with TMB colorimetric buffer. The reaction was terminated with 2M HCl, and the absorbance at OD450 nm was measured using a microplate reader. The results are shown in Figure 1. After five immunizations, the alpaca titer reached a high level (>72,9000).

[0183] Example 2 Construction and Screening of a Single Domain Antibody Immune Library Against MUC1

[0184] (1) After the five immunizations, 50 mL of peripheral blood lymphocytes were collected from the camels and total RNA was extracted. RNA extraction was performed according to the instructions for the RNAiso reagent from TAKARA.

[0185] (2) Using RNA as template and oligo dT as primer, synthesize the first strand of cDNA according to the instructions of TAKARA reverse transcriptase.

[0186] (3) Using PrimeSTAR high-fidelity DNA polymerase, nested PCR was performed to obtain the variable region encoding gene of the heavy chain antibody. Nested PCR was used to amplify the variable region fragment of the heavy chain antibody:

[0187] First round of PCR:

[0188] Upstream primer: GTCCTGGCTGCTCTTCTACAAGGC (SEQ ID NO: 45)

[0189] Downstream primer: GGTACGTGCTGTTGAACTGTTCC (SEQ ID NO: 46)

[0190] The fragment between the heavy chain antibody guide peptide and antibody CH2 was amplified, annealed at 55°C for 30 cycles; a DNA fragment of approximately 600 bp was recovered and used as a template for the second round of PCR.

[0191] Second round of PCR:

[0192] Upstream primer: GATGTGCAGCTGCAGGAGTCTGGRGGAGG (SEQ ID NO: 47)

[0193] Downstream primer: GGACTAGTGCGGCCGCTGGAGACGGTGACCTGGGT (SEQ ID NO: 48)

[0194] The fragments between the heavy chain antibody FR1 region and the long and short hinge regions (long fragments and short fragments) were amplified, annealed at 55°C for 30 cycles, and the target fragment was recovered. The results showed that the size of the fragment was approximately 500 bp, that is, the electrophoresis band of the single domain antibody gene was approximately 500 bp.

[0195] (4) The phagemid pME207 and the PCR amplification product were double-digested with Sfi I and Not I (NEB), respectively. After recovery and quantification, the two fragments were ligated with T4 DNA ligase (TaKaRa) at a molar ratio of 1:3 at 16°C overnight.

[0196] (5) After ethanol precipitation, the ligation product was dissolved in 100 μL sterile water and electroporated into Escherichia coli TG1 ten times. Take 100 μL of the bacterial solution after electroporation and culture, dilute it in multiple proportions, spread it on the ampicillin LB culture plate, calculate the storage capacity, and spread the rest on the ampicillin 2×YT culture plate, and culture it upside down at 37°C for 13 to 16 hours. Use 10 mL of 2×YT culture medium to scrape the bacterial moss on the culture plate, add glycerol to a final concentration of 25%, divide it into aliquots, and store it at -80°C for later use. The storage capacity is 4.3×10 9 To detect the insertion rate of the library, 48 clones were randomly selected for colony PCR, and the results showed that the insertion rate had reached more than 90%.

[0197] (6) Based on the calculated reservoir capacity, 10 times the reservoir capacity of live cells was inoculated into 200 mL of 2×YT (containing 2% glucose and 100 μg / mL ampicillin) and cultured at 37°C, 200 r / min until the OD600 reached 0.5. Helper phage was added at a multiplicity of infection of 20:1. The cells were allowed to stand at 37°C for 30 min and then cultured at 37°C, 200 r / min for 30 min. The culture was centrifuged and the pellet was resuspended in 200 mL of 2×YT (containing 100 μg / mL ampicillin and 50 μg / mL kanamycin). After incubation at 37°C, 250 r / min overnight, the supernatant was centrifuged at 8000 rpm, 5×PEG / NaCl solution was added, the culture was placed on ice for 60 min, and the supernatant was centrifuged at 8000 rpm for 30 min. The pellet was resuspended in 5 mL of PBS to obtain an anti-MUC1 single domain antibody (VHH) immune library. 10 μL was taken for titer determination, and the rest was aliquoted and stored at -80°C for future use.

[0198] (7) MUC1 protein was coated on the ELISA plate at 5 μg / mL, 100 μL per well, and placed at 4°C overnight. A negative control was also set up. The next day, 200 μL of 3% BSA was added to each of the five wells and blocked at room temperature for 2 hours. After 2 hours, the plate was washed three times with PBST (PBS containing 0.05% Tween 20). After washing, 100 μL of phage (2-3×10 11A tfu-immunized camel single-domain antibody phage display gene library was used for 1.5 hours at room temperature. The supernatant after negative screening was then transferred to the target antigen-coated wells and incubated at room temperature for 1.5 hours. Unbound phage were washed 12 times with PBST (PBS containing 0.05% Tween 20) to remove unbound phage. Phage specifically bound to MUC1 were dissociated with Glycine (SIGMA). The eluted phage were neutralized with Tris (Invitrogen, 1M, pH 8.0) and infected with TG1 cells in the logarithmic phase. After multiplication and amplification, the next round of "adsorption-elution" was performed. Finally, the eluted phage were infected with TG1 cells, which were induced to express the single-domain antibody using IPTG (Thermo). The supernatant of the TG1 expression was used for ELISA binding and blocking activity assays. ELISA binding was performed using an anti-c-myc antibody (HRP, Bethyl) as the secondary antibody, blocking the biotinylated human B7-1 / CD80 protein. Fc molecule binding was detected using an HRP-conjugated streptavidin secondary antibody (Thermo). TG1 expression supernatant was also analyzed by FACS on 293T-overexpressing MUC1 cells. The primary antibody used was a biotin-anti-his antibody (GenScript), and the fluorescent antibody used was PE-streptavidin (Biolegend).

[0199] (8) After sequence analysis, combined with ELISA and FACS test results, 11 single-domain antibodies with blocking activity were selected as candidate antibodies.

[0200] Example 3 Expression and purification of candidate antibodies

[0201] The single-domain antibody was constructed into the pCDNA3.4-IgG4 vector and constructed into VHH-IgG4 format, and then TM The protein was expressed using the Thermo Fisher expression system. After one week of expression, the supernatant was collected and purified using Protein A (GE). Protein quality was then measured using Nanodrop and purity was determined by HPLC. The resulting protein purity and yield met the requirements of subsequent experiments.

[0202] Example 4 Characterization of candidate antibodies

[0203] (1) Protein level ELISA test:

[0204] The affinity of the antibody for the human MUC1-His antigen was determined using an enzyme-linked immunosorbent assay (ELISA). MUC1 antigen was diluted to 2 μg / mL with coating buffer and 100 μL / well was added to a 96-well plate. The plate was incubated at 37°C for 2 hours. The plate was washed three times. After washing, 100 μL of 3% BSA blocking buffer was added to each well and the plate was incubated at 37°C for 2 hours. The plate was washed three times. Eight 4-fold dilutions were added (100 μL / well) of MUC1 antibody, starting at 4 μg / mL. The plate was incubated at 37°C for 1 hour. Each plate was washed three times. 100 μL of enzyme-labeled secondary antibody was added to each well and incubated for 30 minutes. The plate was washed three times. 100 μL of TMB was added to each well and color was developed for 5 minutes. The reaction was terminated by adding 100 μL of hydrochloric acid stop solution to each well and the plate was read at 450 nm. The test results are shown in FIG2 . The MUC1 antibody has good binding activity with the MUC1 antigen. The fitting curve shows that the EC50 is less than 1 nM.

[0205] (2) Protein level affinity detection:

[0206] Surface plasmon resonance (SPR) was used to determine the binding kinetics and affinity of the antibodies to the human MUC1-His antigen. The purified antibodies were passed through a sensor chip pre-immobilized with protein A, where they were captured by protein A. Five different concentrations of MUC1-His protein were then used as the mobile phase, with association and dissociation times of 30 and 60 minutes, respectively. Biacore Evaluation Software 2.0 (GE) was used to analyze the association rate (ka), dissociation rate (kd), and equilibrium constant (KD). BMK1 is an IgG4 antibody in the scFv (VH-VL) format, prepared based on the antibody sequences SEQ ID NO: 73 and SEQ ID NO: 75 in GENUS Oncology's patent US 2016 / 0340442 A1. BMK2 is an IgG4 antibody in the scFv (VH-VL) format, prepared based on the sequences SEQ ID NO: 24 and SEQ ID NO: 25 in Peptron's patent US 20200024361 A1. The protein level affinity test results are shown in Table 4 below, and the binding kinetic curves are shown in Figure 3.

[0207] Table 4. Affinity test results of different antibodies

[0208] (3) Cell-level binding activity detection

[0209] MB468 tumor cells expressing MUC1 protein were plated in 96-well plates at 3×10 cells per well. 5MB468 cells were then incubated with serially diluted candidate antibodies at 2-8°C. After half an hour, the cells were washed and incubated with the detection antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008). The cells were then detected using a CytoFLEX flow cytometer. Isotype is an isotype control (negative control, sequence derived from SEQ ID NO: 2 of patent CN 106146653A). The results for the candidate antibodies are shown in Figure 4. As can be seen from Figure 4, the candidate antibodies exhibited high, medium, and low binding activity against MB468 tumor cells. Among them, NBL502-1-C4, NBL502-EFP-B02, NBL502-EFP-B03, NBL502-1D2-2, and NBL502-AI-201 had the highest binding activity against MB468 tumor cells, with positive rates exceeding 90%. The binding activity of NBL502-1-A2, NBL502-AI-120, NBL502-AI-121, NBL502-AI-181, and NBL502-A12-6-LST-D5-2 to the tumor cell MB468 was relatively weak, with positive rates ranging from 45% to 90%. The binding activity of NBL502-AI212 to the tumor cell MB468 was the weakest.

[0210] Example 5: Validation of VHH Antibody Specificity

[0211] 1) Tissue cross-reactivity

[0212] Frozen sections were prepared from 34 tissue types, air-dried at room temperature, and fixed with acetone. Blocking was performed using Reagents A and B of the Endogenous Biotin Blocking Kit (Sanggong, E674001). The biotin-labeled antibody samples were incubated for 30 minutes, washed, and then incubated with horseradish peroxidase-labeled streptavidin (Abcam, ab7403) for 15 minutes. DAB was used for color development and hematoxylin counterstained, then mounted with neutral plastic and air-dried for microscopic examination. Two positive controls were used: the anti-MUC1 antibody [SM3] (ab22711 from Abcam) and BMK2; the negative control was an IgG4 isotype control.

[0213] The test results are shown in Table 5. The results demonstrate that across all 34 tissues tested, the candidate antibody exhibited no higher levels of tissue binding than the positive controls SM3 and BMK2. The MUC1 candidate antibody showed no strong binding to normal tissues, and showed negative or no significant binding in several key tissues, including the lung, kidney, pancreas, stomach, and brain. These data demonstrate the candidate antibody's excellent tissue safety.

[0214] Table 5. Summary of cross-reactivity test results for 34 human tissues

[0215] Example 6: Expression and purification of MUC1 single domain antibody mutants

[0216] The full-length nucleic acid sequence was synthesized based on the sequence of the MUC1 single-domain antibody. The sequence of the MUC1 single-domain antibody is shown in Table 6. Antibodies other than NBL502-1-C4 are all mutants of NBL502-1-C4.

[0217] Table 6: MUC1 single domain antibody amino acid sequence

[0218] Suzhou GeneWeiZi was commissioned to synthesize and construct a eukaryotic expression vector based on the pCDNA3.4 (Thermo) plasmid. The single-domain antibody was then constructed into the pCDNA3.4-IgG4 vector, resulting in a VHH-IgG4 format. The protein was then expressed using the EXpiCHO™ (Thermo Fisher) expression system. After one week of expression, the supernatant was collected and purified using Protein A (GE). Protein quality was then measured using Nanodrop and purity was determined using HPLC. The resulting protein met the requirements for subsequent experiments, both in terms of purity and yield.

[0219] Example 7, Characterization of Candidate Mutant Antibodies

[0220] (4) Protein level ELISA test:

[0221] The affinity of the antibody for the human MUC1-His antigen was determined using an enzyme-linked immunosorbent assay (ELISA). MUC1 antigen was diluted to 2 μg / mL with coating buffer, and 100 μL / well was added to a 96-well plate. The plate was incubated at 37°C for 2 hours. The plate was washed three times. After washing, 100 μL of 3% BSA blocking buffer was added to each well and the plate was incubated at 37°C for 2 hours. The plate was washed three times. Then, 100 μL / well of MUC1 antibody was added, starting at 4 μg / mL, and eight 4-fold dilutions were made. The plate was incubated at 37°C for 1 hour. Each plate was washed three times. 100 μL of enzyme-labeled secondary antibody was added to each well and incubated for 30 minutes. The plate was washed three times. 100 μL of TMB was added to each well and color was developed for 5 minutes. The reaction was terminated by adding 100 μL of hydrochloric acid stop solution to each well, and the plate was read at 450 nm. The results, as shown in Figures 5-6, show that the mutated MUC1 antibody binds to the MUC1 antigen.

[0222] (5) Protein level affinity detection:

[0223] Surface plasmon resonance (SPR) was used to determine the binding kinetics and affinity of the antibody to the human MUC1-His antigen. The purified antibody was passed through a sensor chip pre-immobilized with protein A, where it was captured by protein A. Five different concentrations of MUC1.his protein were then used as the mobile phase, with association and dissociation times of 30 min and 60 min, respectively. Biacore Evaluation Software 2.0 (GE) was used to analyze the association rate (ka), dissociation rate (kd), and equilibrium constant (KD). BMK1 is an IgG4 antibody in the form of a scFv (VH-VL) prepared based on the antibody sequence SEQ ID NO: 73 in GENUS Oncology's US 2016 / 0340442 A1 patent. The results of protein-level affinity testing are shown in Table 7 below.

[0224] Table 7. Affinity test results of different antibodies

[0225] (6) Cell-level binding activity detection

[0226] Tumor cells MB468, H226, RPMI8226 and SKOV3 expressing MUC1 protein were plated in 96-well plates at 3×10 5 MB468 cells were then incubated with serially diluted candidate antibodies at 2-8°C. After half an hour, the cells were washed and incubated with the detection antibody anti-human IgG PE (Jackson Immuno Research, Code: 109-117-008). The cells were then analyzed using a CytoFLEX flow cytometer. Isotype was used as an isotype control (negative control, sequence derived from SEQ ID NO: 1 of patent CN 106146653A). The results for the candidate antibodies are shown in Figures 7-10, demonstrating varying binding activity between the candidate antibodies and different tumor cell lines.

[0227] Example 8, VHH Antibody Immunohistochemical Verification

[0228] Frozen sections of normal tissue and nine tumor tissue types were prepared, air-dried at room temperature, and fixed with acetone. Blocking was performed using Reagents A and B of the Endogenous Biotin Blocking Kit (Sanggong, E674001). The biotin-labeled antibody samples were incubated for 30 minutes, washed, and then incubated with horseradish peroxidase-labeled streptavidin (Abcam, ab7403) for 15 minutes. DAB was used for color development and hematoxylin counterstained, then mounted with neutral plastic and air-dried for microscopic examination. Two positive controls were used: the anti-MUC1 antibody [SM3] (ab22711 from Abcam) and BMK1; the negative control was an IgG4 isotype control.

[0229] The test results are shown in Tables 8-10, which show that the mutated MUC1 binding molecule has no staining on normal tissues but exhibits good staining on tumor tissues, while 1C4 also stains on normal tissues, which may cause damage to normal tissues.

[0230] Table 8. Results of immunohistochemistry tests on normal tissues of candidate antibodies

[0231] Table 9. Immunohistochemical test results of 9 human tumor tissues

[0232] Table 10. Immunohistochemistry test results

[0233] Example 9: Construction of MUC1 CAR-T cell plasmid

[0234] The chimeric antigen receptor structure involved in Example 9 is: CD8 signal peptide (SEQ ID NO: 88), antigen binding domain, CD8 hinge region (SEQ ID NO: 89), CD8 transmembrane domain (SEQ ID NO: 90), costimulatory domain 4-1BB (SEQ ID NO: 91), and activation domain CD3ζ (SEQ ID NO: 92). The CAR-T number and sequence of the antigen binding domain are shown in Table 11. 1C4 contains the MUC1 single-domain antibody NBL502-1-C4 provided by the present invention as the antigen binding domain, and the antigen binding domains of 555, 1C4-z7, and 1C4-z25 are mutants of NBL502-1-C4. The chimeric antigen receptor BMK6.3 is derived from CN109715670A, and the sequence of the antigen binding domain of BMK6.3 is shown in SEQ ID NO: 93.

[0235] Table 11: Antigen binding domain sequences involved in Example 9

[0236] By constructing plasmids using MUC1 CAR and BMK3 CAR derived from single-domain antibodies of different sequences and transferring the genes into PBMCs from healthy subjects by electroporation, MUC1 CAR-T cells were constructed. The in vitro performance of CAR-T cells, including proliferation ability, CAR positivity rate, cell phenotype, and in vitro killing ability of target cells, was verified.

[0237] Experimental instruments: conventional PCR instrument (Jena, TRIO), electrophoresis instrument (Bio-Rad, 1645050), electrophoresis tank (Bio-Rad, 1704483), desktop microcentrifuge (Thermo, Pico17), metal bath heating module (Thermo, DCD), electric constant temperature water bath (Shanghai Yiheng, DK-8D), automatic gel imager (Tianneng Tanon, 2500)

[0238] Experimental reagents

[0239] Experimental methods

[0240] Based on the sequences of the MUC1 single-domain antibody and BMK6.3, a full-length nucleic acid sequence and primers were synthesized. PCR was performed to obtain a large amount of the target fragment. The PC23S vector was double-digested with EcoR1 and Sal1 to obtain a vector fragment. The target fragment and the vector fragment were ligated using DNA ligase to obtain a plasmid. The constructed vector was sequenced, and after the sequence was confirmed, the plasmid was extracted in large quantities. The sequence of the PC23S vector is shown in SEQ ID NO: 94.

[0241] Example 10, Preparation of CAR-T cells targeting MUC1

[0242] Mock-T and MUC1 CAR-T were prepared by electroporation.

[0243] Experimental instruments: electroporator (Lonza4D), automated cell counter (CellomterK2), microscope (Jiangnan XD-202), biological safety cabinet (Thermo Fisher Scientific), refrigerator (Qingdao Haier), carbon dioxide incubator (Thermo), desktop low-speed centrifuge (Xiangyi), Pico17 desktop microcentrifuge (Thermo).

[0244] Use AIM-V medium (containing 2% FBS) to resuscitate PBMCs, inoculate them into culture flasks at 5E6 / mL, and place them in an incubator (37°C; 5% CO2) overnight. Use 5ug / mL anti-CD3 and anti-CD28 to coat 6-well plates or culture flasks at 4°C overnight. Inoculate the PBMCs that have been placed overnight into the coated 6-well plates or culture flasks and stimulate them for 48 hours. Collect the cells and electroporate them using a Lonza 4D electroporator. The electroporation process is optimized according to the operating steps in the electroporator manual. Resuspend 5×10 6 to 7×10 6 PBMC cells, 6ug of the above-prepared plasmid was added to the cell suspension, and 20ug of PBase mRNA (the amino acid sequence of PBase is shown in SEQ ID NO: 99) and 200IU of RNase inhibitor were added to the electroporation system, and electroporation was performed using the EO-115 program. After electroporation, the cells were allowed to stand at room temperature for 10 minutes. Afterwards, the PBMCs were transferred to a 6-well plate containing 2mL of AIM-V (containing 2% FBS and 100IU / mL IL-2) culture medium (needs to be preheated to 37°C in advance), placed in an incubator (37°C; 5% CO2) and cultured for 24h-48h, and then the culture medium was replenished to 4mL. The first passage was performed on the 3rd day after electroporation, the second passage was performed on the 6th day, and the CAR-T cell preparation was completed on the 9th day. During the passage process, PBMCs were cultured in AIM-V culture medium containing 2% FBS and 100IU / ml IL-2, and the cell density was 5×10 5 During and after the CAR-T cell preparation process, flow cytometry was used to detect the cell surface CAR positivity rate and other surface markers.

[0245] Example 11, MUC1 CAR-T cell proliferation, positive rate and cell phenotype detection in vitro

[0246] The purpose of this experiment is to evaluate the quality of the prepared mock-T, BMK CAR-T cells, and MUC1 CAR-T cells by proliferation and positive rate.

[0247] Experimental instruments: automated cell counter (Cellomter K2), microscope (Jiangnan XD-202), biological safety cabinet (Thermo Fisher Scientific), refrigerator (Qingdao Haier), carbon dioxide incubator (Thermo), desktop low-speed centrifuge (Xiangyi), flow cytometer (Beckman Coulter CytoFLEX S Flow Cytometer), Pico17 desktop microcentrifuge (Thermo).

[0248] Experimental reagents

[0249] Donor cell information

[0250] Experimental methods

[0251] 1) CAR-T cell culture and passaging

[0252] By counting cells and passing them at equal density, the proliferation times of cells in each group were calculated and the cell proliferation curve was drawn. The passaging density was 5×10 5 Cells were passaged and counted on Days 3, 6, and 9; the IL-2 concentration was 100 U / mL. See the experimental procedures for details.

[0253] 2) Detection of the proportion of MUC1 CAR-T positive cells

[0254] CAR-positive rates were determined by flow cytometry during cell proliferation. See experimental procedures for details.

[0255] 3) MUC1 CAR-T cell phenotype detection

[0256] The phenotype of the CART cells we prepared was evaluated by detecting the CD3 / CD4 / CD8 and TCM / TEM of MUC1 CART by flow cytometry.

[0257] Experimental instruments: automated cell counter (Invitrogen Countess II FL Cellomter K2), microscope (Jiangnan XD-202), Pico17 tabletop microcentrifuge (Thermo), flow cytometer (Beckman Coulter CytoFLEX S Flow Cytometer)

[0258] Experimental reagents

[0259] Experimental results

[0260] The proliferation, viability, positivity, and phenotype of CAR-T cells are shown in Figures 11-14. As shown in Figures 11 and 12, the total proliferation rate of T cells in each group on D9 was approximately 15-20 times higher than that on D0, and cell viability was maintained above 90%. As shown in Figure 13, the CAR positivity rate on D9 varied significantly between groups, with 555 and 1C4 having higher positivity rates. Figure 14 shows the CD4 and CD8 ratios of CAR-T cells on D9. The proportion of CD8+ T cells in each group was significantly higher than that of CD4+ T cells.

[0261] Example 12, MUC1 CAR-T cell killing experiment

[0262] The killing effect of CAR-T cells on tumor cells was detected using the xCELLigence RTCA device (Roche Applied Science, Canada), and the detection process was carried out according to the device operating instructions. 10,000 target cells (MB468, HCT116) were resuspended in 50ul culture medium and inoculated into the microplate of the RTCA device. The tumor cells were cultured on the RTCA device for about 24 hours. When the cell index (CI, indicating cell growth) reached about 1.5, different numbers of effector cells (CAR-T cells) were resuspended in 50ul culture medium according to different effector-target ratios (effector cells: target cells), mixed with tumor cells, and continued to be cultured on the RTCA device for 48h-96h. The cell killing curve was recorded by the RTCA device, and the data were analyzed using RTCA Pro 2.3.0 software.

[0263] Figure 15 shows the time required for each CAR-T cell group to kill 50% of MB468, a type of tumor cell with high MUC1 expression, at different effector-target ratios, or KT50 values. At a 1:4 effector-target ratio, all CAR-T cells achieved KT50 within 24 hours. As the effector-target ratio decreased, the killing ability of each group also decreased, with no significant differences between the groups.

[0264] Figure 16 shows the 48-hour tumor lysis rate of each group of CAR T for HCT116 tumor cells with extremely low MUC1 expression. The results show that each group of CAR T has no killing ability for tumor cells with low MUC1 expression, proving that the CAR-T in this patent has low non-target specific killing and high safety.

[0265] Example 13, Continuous Proliferation Experiment of MUC1 CAR-T Cells

[0266] MB468 tumor cells were seeded into six-well plates one day in advance (600,000 tumor cells per well). After incubation at 37°C overnight, the tumor cells were treated with mitomycin C (25ug / mL) for 4 hours to inhibit their growth. The tumor cells were washed 5 times with PBS. CAR-positive T cells were inoculated at an effector-target ratio of 1:1, and each round lasted 5 days. After the end of one round, the cell number was counted using a cell counter, and the CAR positivity rate was detected using a flow cytometer to calculate the number of CAR-positive cells. A new round of tumor co-culture experiment was then started at an effector-target ratio of 1:1. This process was repeated until the end of the fifth round. At the same time, 24 hours after the start of each round of co-culture experiment, that is, 24 hours after CAR-T was inoculated into the tumor cell plate, part of the supernatant was collected, and the level of CAR-T cell factor release in each group was detected using the Cytokine Beads Assay detection kit.

[0267] Figure 17 shows the CAR positivity rates of the two donors after each round of co-culture. The CAR positivity rates of each group gradually increased in the first two rounds of co-culture, and began to show significant differences after the third round. 555 and 1C4 were still able to maintain a high level.

[0268] Figure 18 shows the theoretical proliferation folds of CAR-positive T cells from two donors at the end of the fifth round compared to the number of CAR-positive cells initially inoculated. For both donors, 555 and 1C4 had the highest proliferation folds.

[0269] Figure 19 shows the IFN-γ secretion of CAR T in each group in the first three rounds of the co-culture experiment. Both donors showed that in the second round of the experiment, the release of CAR cytokines in each group was the highest and began to decline in the third round, which was consistent with the results of the change in CAR positive rate.

[0270] Example 14: Preparation of MUC1 CAR-T cells secreting dual antibodies using the JL transposon system

[0271] Following the steps of Example 10, a MUC1 CAR-T cell secreting a PD1 / CTLA4 bispecific antibody was prepared using the JL transposon system. PBase mRNA was replaced with JLase mRNA at a dosage of 10 μg. 3 μg of MUC1 CAR plasmid and 1 μg of PD1 / CTLA4 bispecific antibody plasmid were added, all using a 5′ plasmid framework. The sequence of JLase is shown in SEQ ID NO:95, the sequence of the 5′ plasmid empty framework is shown in SEQ ID NO:96, and the sequence of the PD1 / CTLA4 bispecific antibody is shown in SEQ ID NO:97. The prepared CAR-T cells were co-cultured with MB468 cancer cells and normal bronchial, gastric, and renal cells at an effector-target ratio of 1:4. Cell killing was measured at 43 and 72 hours. The cell killing results for two donors are shown in Figure 20. As can be seen from the figure, the MUC1 CAR-T prepared by the JL transposon system can significantly kill MB468 cancer cells, but has a lower killing effect on normal cells.

[0272] Example 15. Preparation of MUC1 CAR-T cells by chimeric antigen receptor mRNA

[0273] (1) LNP loaded with mRNA

[0274] The ionizable lipid compound B-C14 was dissolved in anhydrous ethanol with DOPE, cholesterol, and DMG-PEG2000 (all purchased from Synopsys) at a molar ratio of 30:15:53.125:1.875 to prepare an ethanol lipid solution (total lipid concentration: 10.78 mg / mL). The structure and specific synthesis method of B-C14 are described in Chinese Patent CN116456967A. MUC1 CAR mRNA (whose CAR structure is the same as the 555CAR structure in Example 9, and the mRNA sequence is shown in SEQ ID NO: 98) was diluted with 10 mM citrate buffer (pH = 4.0) to obtain an mRNA aqueous solution (0.2 mg / mL). The ethanolic lipid solution and the mRNA aqueous solution were mixed at a volume ratio of 1:3 using a microfluidic device (Microflow S, Mingtai Medical Equipment (Shanghai) Co., Ltd.) at a total flow rate of 24 mL / min. The resulting lipid nanoparticle solution was diluted sixfold with DPBS containing 10% sucrose and filtered through a 0.2 μm sterile filter to obtain LNP formulations (lipid nanoparticles) encapsulating MUC1 CAR mRNA. Samples were frozen at -80°C until use.

[0275] (2) CAR-T preparation

[0276] Activated T cells were collected and resuspended in OPTI-MEM medium. The cells were counted using a life counter and Trypan Blue Stain staining. Activated T cells were seeded into 24-well plates at a volume of 5E5 cells / 300μL / well. Apolipoprotein ApoE4 was then added at a dose of 0.5μg / 5E5 cells / well to increase the transfection efficiency of T cells. ApoE4 was then added at a dose of 0.2μg / 5×10 5 Lipid nanoparticles were added at a dose of cells / 200 μL / well, and the plate was gently shaken to ensure sufficient mixing. The plate was then placed in a 37°C, 5% CO2 incubator for 24 hours to obtain CAR-T cells.

[0277] (3) Cultivation of CAR-T cells

[0278] CAR-T cells were harvested 24 hours after transfection by centrifugation, resuspended in OPTI-MEM medium, and seeded into 24-well plates at a concentration of 5E5 cells / 500 μL / well. The plates were incubated at 37°C, 5% CO2 in a humidified incubator for various periods of time. The CAR-T cells were characterized, with blank T cells serving as a control group. As shown in Figure 21, the cell viability in the experimental groups was greater than 90%, and LNP-delivered mRNA was non-toxic to the cells, with a positive rate exceeding 80%.

[0279] (4) Kill cancer cells

[0280] mRNA was transfected into cells to prepare CAR-T. The transfection dose of LNP was 0.5 μg / 5E5 cells, and the transfection time was 24 hours, which was recorded as "LNP-500ng"; the same dose of CAR mRNA was used by electroporation, which was recorded as "electroporation". MOCKT used eGFP mRNA, and also used LNP and electroporation methods, respectively, using the same dose of mRNA as controls, which were recorded as LNP-MOCKT and electroporation-MOCKT, respectively. Using a method similar to Example 12, target cells SKOV3 and MDA-MB468 were co-cultured with CAR-T cells or MOCKT cells at an effector-target ratio of 2:1, 1:2, 1:4, or 1:8 for 24 hours, and the killing effect of CART cells was analyzed based on the value of the cell index.

[0281] Figure 22 shows the 24-hour positive rates of transfection for each cell group. There was no significant difference in the positive rates of CAR-T cells prepared by LNP and electroporation. Figures 23 and 24 show the cytotoxicity of MAD-MB468 and SKOV3 cells at different effector-target ratios. There was little difference in the cytotoxicity of CAR-T cells prepared by LNP and electroporation. Under the same effector-target ratio, CAR-T cells showed a greater cytotoxicity against MDA-MB468 cells that highly express MUC1. At an effector-target ratio of 1:2, the cytotoxicity of MDA-MB468 cells reached 90%.

Claims

1. A MUC1 binding molecule, comprising an anti-MUC1 single domain antibody, wherein the complementarity determining region (CDR) of the single domain antibody comprises CDR1, CDR2 and CDR3; The CDR1 comprises: the sequence shown in SEQ ID NO: 2, or a sequence containing one or more of the following mutations compared to SEQ ID NO: 2: T3Q, R5D, R5H, R5K, R5E, R5Y, R6E, R6H, R6K, R6D, R6Y; The CDR2 comprises: the sequence shown in SEQ ID NO: 12, or a sequence containing one or more of the following mutations compared to SEQ ID NO: 12: I1G, T3Q, T3W, F4D, D6A, D6G, D7S, T8Q; The CDR3 comprises: the sequence shown in SEQ ID NO: 23, or a sequence containing one or more of the following mutations compared with SEQ ID NO: 23: T1Q, I3G, Y6H, Q8E, Q8Y, L9G, L9Y, L9S, S10N, D12Q.

2. The MUC1 binding molecule according to claim 1, wherein The sequence of the CDR1 is shown in SEQ ID NO: 2, the sequence of the CDR2 is shown in SEQ ID NO: 12, and the sequence of the CDR3 is shown in SEQ ID NO: 23; Or the CDR1, CDR2 and CDR3 contain mutations shown in any one of Groups A1 to A17 in Table 2 below: Table 2 3. The MUC1 binding molecule according to any one of claims 1 or 2, characterized in that The MUC1 single domain antibody contains CDR1, CDR2 and CDR3 shown in any group of SEQ ID NOs from Group B1 to Group B18 in Table 3 below: Table 3 Preferably, the amino acid sequence of the MUC1 single domain antibody is as shown in any one of SEQ ID NOs: 34, 71-87, more preferably as shown in SEQ ID NOs: 34, 71, 72, 78 or 83.

4. The binding molecule according to any one of claims 1 to 3, characterized in that The MUC1 binding molecule comprises one, two or more anti-MUC1 single domain antibodies described herein; and / or, the MUC1 binding molecule is a monovalent or multivalent single domain antibody, a multispecific single domain antibody, a heavy chain antibody or an antigen binding fragment thereof.

5. A fusion protein comprising the MUC1 binding molecule according to any one of claims 1 to 4 and other polypeptides, Preferably, the other polypeptide is located at the N-terminus and / or C-terminus of the binding molecule, and the other polypeptide is selected from polypeptides that localize the binding molecule to different organelles, tags for purification or tags for immune response, transmembrane proteins or their transmembrane regions, and chimeric antigen receptor components; More preferably, the fusion protein is a chimeric antigen receptor, the antigen binding domain of which comprises the MUCl binding molecule.

6. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises a sequence selected from the group consisting of: (1) the coding sequence of the MUC1 binding molecule according to any one of claims 1 to 4 or the fusion protein according to claim 5; (2) The complementary sequence of (1).

7. A nucleic acid construct, characterized in that The nucleic acid construct comprises the nucleic acid molecule of claim 6; preferably, the nucleic acid construct is a cloning vector, an expression vector, an integration vector or mRNA.

8. A host cell, characterized in that: (1) expressing the MUC1 binding molecule according to any one of claims 1 to 4 or the fusion protein according to claim 5; (2) comprising the nucleic acid molecule of claim 6; and / or (3) comprising the nucleic acid construct of claim 7; Preferably, the host cell is an immune effector cell, more preferably a T cell, a TIL cell or a NK cell.

9. The host cell according to claim 8, characterized in that The fusion protein is a chimeric antigen receptor, and the host cell expresses the chimeric antigen receptor and / or contains the coding sequence of the chimeric antigen receptor; Preferably, the coding sequence of the chimeric antigen receptor is DNA or mRNA; More preferably, the host cell also expresses a therapeutic agent, and / or contains a coding sequence for a therapeutic agent.

10. A method for producing a MUCl binding molecule, comprising: Cultivating the host cell of claim 8 or 9 under conditions suitable for producing the MUCl binding molecule, and optionally purifying the MUCl binding molecule from the culture.

11. A pharmaceutical composition comprising the MUC1 binding molecule of any one of claims 1 to 4, the fusion protein of claim 5, the nucleic acid molecule of claim 6, the nucleic acid construct of claim 7, or the host cell of claim 8 or 9, and a pharmaceutically acceptable excipient; preferably, the pharmaceutical composition is used to treat cancer.

12. Use of the MUCl binding molecule of any one of claims 1 to 4 in the preparation of a medicament for preventing or treating cancer.

13. A kit for detecting MUC1 for evaluating drug treatment effects or diagnosing cancer, the kit comprising the MUC1 binding molecule according to any one of claims 1 to 4, the fusion protein according to claim 5, the nucleic acid molecule according to claim 6, the nucleic acid construct according to claim 7, or the host cell according to claim 8 or 9; Preferably, the kit further comprises a reagent for detecting the binding of MUC1 to a single domain antibody, an antibody or an antigen-binding fragment thereof; More preferably, the reagent is a reagent for detecting the binding by enzyme-linked immunosorbent assay.

14. A non-diagnostic method for detecting the presence of MUC1 in a sample, the method comprising: The presence of MUC1 in the sample is determined by incubating the sample with the MUC1 binding molecule of any one of claims 1 to 4 and detecting the binding of MUC1 to the single domain antibody, antibody or antigen binding fragment thereof.

15. Use of the MUCl binding molecule of any one of claims 1 to 4 in the preparation of a kit for detecting MUCl in a sample, evaluating the effect of drug treatment or diagnosing cancer.

Images