Composition for dendritic cell activation, method for producing fermented milk for dendritic cell activation, and composition for promoting secretion of siga in saliva

Abstract

The present invention addresses the problem of providing a composition for dendritic cell activation that is highly safe and can be more easily ingested by many people. The composition for dendritic cell activation according to the present invention includes an exopolysaccharide produced from a Lactobacillaceae-family lactic acid bacterium. Moreover, the Lactobacillaceae-family lactic acid bacterium is preferably a Lactobacillus-genus lactic acid bacterium or a Lacticaseibacillus-genus lactic acid bacterium, and is preferably Lactobacillus delbrueckii, Lactobacillus delbrueckii subspecies bulgaricus, Lactobacillus gasseri, Lactobacillus paragasseri, or Lacticaseibacillus paracasei.

Description

Composition for activating dendritic cells, method for producing fermented milk for activating dendritic cells, and composition for promoting salivary SIgA secretion

[0001] The present invention relates to a composition for dendritic cell activation, a method for producing fermented milk for dendritic cell activation, and a composition for promoting salivary SIgA secretion.

[0002] Drugs that are effective against diseases such as cancer, AIDS, and herpes viruses have been proposed (see, for example, Patent Documents 1, 2, and 3). Some of these drugs improve dendritic cell activity by administering them in combination with a dendritic cell activator to a subject in need thereof, thereby treating the diseases listed above or alleviating their symptoms. It has also been found that there is a close relationship between "dendritic cell activation" and "maintenance or improvement of health status." Therefore, the development of drugs and other agents that can activate dendritic cells is becoming increasingly important in today's world, where health awareness is on the rise.

[0003] However, taking these drugs solely for the purpose of activating dendritic cells is associated with some side effects. Therefore, for example, in humans, they may not necessarily be safe, particularly for young children and the elderly. In other words, the subjects who can take these drugs are limited by their age, health condition, and other factors. Therefore, there is a need for a composition for dendritic cell activation that has fewer side effects than the drugs described above and can be easily taken by many subjects, regardless of age, etc.

[0004] Special table 2003-502008 Publication Special table 2015-513401 Publication Special table 2021-531765

[0005] An object of the present invention is to provide a composition for dendritic cell activation that is highly safe and can be more easily ingested.

[0006] To solve the above problems, the present inventors focused on exopolysaccharides produced by lactic acid bacteria of the Lactobacillaceae family and investigated the effect of ingestion of these exopolysaccharides on the activation of dendritic cells in subjects such as humans. As a result, they found that ingestion of these exopolysaccharides by subjects such as humans can activate their dendritic cells, particularly plasmacytoid dendritic cells (pDCs) and conventional dendritic cells (cDCs), and completed the present invention.

[0007] That is, the present invention is as follows: (1) A composition for dendritic cell activation, comprising exopolysaccharides produced by lactic acid bacteria of the Lactobacillus family, preferably excluding Lactobacillus kefiri and Pediococcus sp.

[0008] (2) The composition for dendritic cell activation described in (1), wherein the Lactobacillaceae lactic acid bacteria are Lactobacillus lactic acid bacteria.

[0009] (3) The composition for dendritic cell activation according to (2), wherein the Lactobacillus lactic acid bacteria have a 16S rRNA gene that has 95% or more sequence identity with the base sequence of SEQ ID NO: 1 below. <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0010] (4) The composition for dendritic cell activation according to (2), wherein the Lactobacillus lactic acid bacteria is at least one lactic acid bacterium selected from the group consisting of Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus gasseri, and Lactobacillus paragasseri.

[0011] (5) The composition for dendritic cell activation according to (4), wherein the Lactobacillus lactic acid bacterium is at least one Lactobacillus lactic acid bacterium selected from the group consisting of Lactobacillus delbrueckii OLL204989 (NITE BP-02874), Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741), Lactobacillus delbrueckii subsp. bulgaricus JCM1002T, Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716 (FERM BP-6999), and Lactobacillus paragasseri JCM1130.

[0012] (6) A composition for dendritic cell activation described in (1), wherein the Lactobacillaceae lactic acid bacteria are Lacticaceae lactic acid bacteria of the genus Lacticaseibacillus.

[0013] (7) The composition for dendritic cell activation according to (6), wherein the lactic acid bacteria of the genus Lacticaseibacillus are at least one species of lactic acid bacteria of the genus Lacticaseibacillus selected from the group consisting of Lacticaseibacillus paracasei and Lacticaseibacillus paracasei subsp. paracasei.

[0014] (8) The composition for activating dendritic cells according to (7), wherein the lactic acid bacteria of the genus Lacticaceae Bacillus is Lacticaceae Bacillus paracasei subsp. paracasei JCM 1053.

[0015] (9) A composition for activating dendritic cells described in any one of (1) to (8), wherein the dendritic cells are plasmacytoid dendritic cells (pDCs).

[0016] (10) A composition for activating dendritic cells according to any one of (1) to (8), wherein the dendritic cells are conventional dendritic cells.

[0017] (11) A composition for activating dendritic cells according to (9), which increases the proportion of CD86-positive cells among plasmacytoid dendritic cells in peripheral blood mononuclear cells (PBMCs).

[0018] (12) A composition for activating dendritic cells according to (9), which increases the amount of CD86 expression in plasmacytoid dendritic cells in peripheral blood mononuclear cells.

[0019] (13) The composition for activating dendritic cells according to (9), which increases the amount of HLA-DR expression on plasmacytoid dendritic cells in peripheral blood mononuclear cells.

[0020] (14) A composition for dendritic cell activation according to (10), which increases the proportion of CD86-positive cells among conventional dendritic cells in peripheral blood mononuclear cells.

[0021] (15) A composition for dendritic cell activation described in any one of (1) to (14), further comprising cells of a lactic acid bacterium belonging to the Lactobacillaceae family.

[0022] (16) A composition for dendritic cell activation according to any one of (1) to (15), wherein the composition is fermented milk.

[0023] (17) A method for producing fermented milk for dendritic cell activation, which comprises adding exopolysaccharide-producing lactic acid bacteria of the Lactobacillus family and Streptococcus thermophilus to a milk raw material and fermenting the milk raw material.

[0024] (18) A method for producing fermented milk that activates dendritic cells in a subject to be ingested, by adding Lactobacillus family lactic acid bacteria that produce exopolysaccharides and Streptococcus thermophilus to a milk raw material and fermenting the milk raw material.

[0025] (19) A composition for promoting salivary SIgA secretion, comprising exopolysaccharides produced by Lactobacillus casei lactic acid bacteria.

[0026] (20) A composition for promoting SIgA secretion in saliva described in (19), further containing cells of a lactic acid bacterium belonging to the Lactobacillus family.

[0027] (21) A composition for promoting salivary SIgA secretion according to (19) or (20), which is achieved by dendritic cell activation.

[0028] The present invention also encompasses the following inventions: (22) A method for activating dendritic cells in a subject in need thereof, comprising administering to the subject a composition containing exopolysaccharides produced by a lactic acid bacterium of the Lactobacillus family.

[0029] (23) Use of exopolysaccharides produced by Lactobacillus casei lactic acid bacteria to activate dendritic cells.

[0030] (24) An exopolysaccharide produced by a lactic acid bacterium of the Lactobacillus family, used as an active ingredient in a composition for dendritic cell activation.

[0031] (25) Use of exopolysaccharides produced by Lactobacillus casei lactic acid bacteria for the manufacture of a composition for activating dendritic cells.

[0032] (26) A method for promoting SIgA secretion in the saliva of a subject in need thereof, comprising administering to the subject a composition containing exopolysaccharides produced by a Lactobacillus casei lactic acid bacterium.

[0033] (27) An exopolysaccharide produced by a lactic acid bacterium of the Lactobacillus family, used as an active ingredient in a composition for promoting SIgA secretion in saliva.

[0034] (28) Use of exopolysaccharides produced by Lactobacillus casei lactic acid bacteria to promote SIgA secretion in the saliva of a subject.

[0035] (29) Use of exopolysaccharides produced by Lactobacillus casei lactic acid bacteria for the manufacture of a composition that promotes SIgA secretion in the saliva of a subject.

[0036] (30) Use of exopolysaccharides produced from Lactobacillus sp. of the Lactobacillus family for the manufacture of a dendritic cell-activating composition that promotes SIgA secretion in the saliva of a subject.

[0037] (31) A method for activating dendritic cells in a subject in need thereof, comprising administering to the subject exopolysaccharides produced by lactic acid bacteria of the Lactobacillaceae family, wherein the lactic acid bacteria of the Lactobacillaceae family preferably exclude the genera Lactobacillus kefiri and Pediococcus.

[0038] The present invention provides a composition for dendritic cell activation that is safer and easier to ingest than conventional methods, and by administering this composition to a subject in need thereof, the subject's dendritic cells can be activated.

[0039] Recently, one of the diseases that people are prone to contract on a daily basis is upper respiratory tract infection (URTI). Secretory immunoglobulin A (SIgA) in saliva is thought to act as an initial defense mechanism against URTI. Therefore, it is known that a decrease in SIgA secretion in saliva increases the incidence of URTI. According to the present invention, SIgA secretion in saliva of a subject who has ingested the above-described composition for promoting SIgA secretion in saliva can be promoted. As a result, the incidence of URTI can be reduced in a subject who has ingested the composition for activating dendritic cells according to the present invention.

[0040] The above-mentioned effects can maintain or improve the health status of a subject who takes the above-mentioned composition.

[0041] 1 is a graph showing the change in the CD86 positivity rate of pDC in the R-1 lactic acid bacteria intake group and the placebo intake group. 2 is a graph showing the change in the CD86 positivity rate of cDC in the R-1 lactic acid bacteria intake group and the placebo intake group. 3 is a graph showing the change in SIgA concentration in saliva in the R-1 lactic acid bacteria intake group and the placebo intake group. 4 is a graph showing the expression level of CD86 in pDC by R1-EPS. 5 is a graph showing the expression level of HLA-DR in pDC by R1-EPS. 6 is a graph showing the expression level of HLA-DR in pDC by EPS of Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus gasseri, and Lactobacillus paragasseri. 7 is a graph showing the expression level of HLA-DR in pDC by EPS of Lacticaceibacillus paracasei subsp. paracasei. 1 is a graph showing the CD86 expression levels of pDCs induced by EPS from Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, and Lacticaseibacillus paracasei subsp. paracasei.

[0042] The composition according to an embodiment of the present invention contains exopolysaccharides produced by Lactobacillus lactic acid bacteria and has the function of activating dendritic cells. Furthermore, the composition according to an embodiment of the present invention can promote SIgA secretion in saliva. Preferably, the composition is fermented milk. The definitions of each term in the present invention are described in detail below.

[0043] 1. Lactobacillus family lactic acid bacteria Lactobacillus family lactic acid bacteria are classified according to the classification described in Reference 4 below, unless otherwise specified.

[0044] Reference 4: Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): 2782-2858

[0045] Specifically, the Lactobacillaceae family includes the genera Lactobacillus, Paralactobacillus, Holzapfelia, Amylolactobacillus, Bombilactobacillus, Companilactobacillus, Lapidilactobacillus, Agrilactobacillus, Schleiferilactobacillus, Loigolactobacilus, Lacticaseibacillus, Latilactobacillus, and Della glioa genus, Liquorilactobacillus genus, Ligilactobacillus genus, Lactiplantibacillus genus, Furfurilactobacillus genus, Paucilactobacillus genus, Limosilactobacillus genus, Fructilactobacillus genus, Acetilactobacillus genus, Apilactobacillus genus, Levilactobacillus genus, Secundilactobacillus genus, Lentilactobacillus genus, Pediococcus They are classified into 31 genera: Convivina, Leuconostoc, Fructobacillus, Oenococcus, and Weissella.The composition according to the embodiment of the present invention preferably contains exopolysaccharides produced by Lactobacillus lactic acid bacteria or Lacticaseibacillus lactic acid bacteria. Lactobacillus lactic acid bacteria and Lacticaseibacillus lactic acid bacteria are described in detail below.

[0046] 1-1. Lactobacillus Lactic Acid Bacteria The Lactobacillus lactic acid bacteria according to the embodiment of the present invention are a general term for all bacteria taxonomically recognized as belonging to the genus Lactobacillus, and are not limited by species or strain. Although Lactobacillus lactic acid bacteria are sometimes classified as plant-derived or animal-derived depending on their origin, both plant-derived and animal-derived lactic acid bacteria can be used in the present invention. The Lactobacillus lactic acid bacteria strain of the present invention is preferably one or more strains of Lactobacillus that can produce fermented milk (e.g., yogurt) that has been widely consumed. Here, the Lactobacillus lactic acid bacteria are preferably lactic acid bacteria belonging to Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus gasseri, or Lactobacillus paragasseri. Each of these lactic acid bacteria is described in detail below.

[0047] (1) Lactobacillus delbrueckii Lactobacillus delbrueckii is preferably Lactobacillus delbrueckii OLL204989. Here, Lactobacillus delbrueckii OLL204989 was deposited by Meiji Co., Ltd. on February 5, 2019, at the Patent Microorganism Deposit Center of the National Institute of Technology and Evaluation (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan, Room 122), and then on April 1, 2019, it was deposited under the accession number: NITE BP-02874.

[0048] Lactobacillus delbrueckii OLL204989 is capable of producing polysaccharides, and is characterized by producing phosphorus-containing polysaccharides composed of galactose and glucose extracellularly. Lactobacillus delbrueckii OLL204989 is a Lactobacillus delbrueckii strain classified into Cluster I in the MLSA classification based on seven housekeeping genes consisting of the fusA gene, the gyrB gene, the hsp60 gene, the ileS gene, the pyrG gene, the recA gene, and the recG gene, and satisfies the following conditions (i) to (vii): (i) possessing a fusA gene having an allele number of 2 or 14, (ii) possessing a gyrB gene having an allele number selected from 3, 17, 18, and 25, (iii) possessing an hsp60 gene having an allele number selected from 4, 18, 26, and 27, and (iv) possessing an ileS gene having an allele number selected from 16, 20, 21, 30, and 33. (v) possessing a pyrG gene with allele number 22 or 23, (vi) possessing a recA gene with allele number selected from 2, 7, 24, and 28, and (vii) possessing a recG gene with allele number 3, and is classified in the same subcluster as Lactobacillus delbrueckii that satisfies all of the above conditions (i) to (vii) in the MLSA classification based on seven housekeeping genes consisting of the fusA gene, gyrB gene, hsp60 gene, ileS gene, pyrG gene, recA gene, and recG gene. The exopolysaccharide produced by Lactobacillus delbrueckii classified as Lactobacillus delbrueckii OLL204989 in the MLSA classification can have the effects of the present invention.

[0049] (2) Lactobacillus delbrueckii subsp. bulgaricus Lactobacillus delbrueckii subsp. bulgaricus is preferably Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 or Lactobacillus delbrueckii subsp. bulgaricus JCM1002T. Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 was deposited by Meiji Dairies Co., Ltd. (later Meiji Co., Ltd.) with the National Institute of Advanced Industrial Science and Technology (AIST), Patent Organism Depositary (Tsukuba Center, Central No. 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture) on February 22, 1999, and was deposited on the same day under the accession number FERM P-17227. This deposit was transferred from the original deposit to a deposit under the Budapest Treaty on November 29, 2006. At the time of this transfer, the deposit number FERM BP-10741 was assigned. Incidentally, the patent microorganism deposit business of the National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary was succeeded by the National Institute of Technology and Evaluation (NIET) Patent Organism Depositary on April 1, 2012, and the National Institute of Technology and Evaluation (NIET) Patent Organism Depositary was relocated to the National Institute of Technology and Evaluation (NIET) office at Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan on April 1, 2013. Lactobacillus delbrueckii subsp. bulgaricus JCM1002T can be obtained from the Japan Collection of Microorganisms (RIKEN BRC-JCM, Japan) under the JCM number JCM1002T. The "T" at the end of the number indicates that this is the "type strain (taxonomic type strain)."

[0050] Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 and Lactobacillus delbrueckii subsp. bulgaricus JCM1002T are capable of producing polysaccharides, and are characterized by extracellularly producing phosphorus-containing polysaccharides composed of galactose and glucose.

[0051] (3) Lactobacillus gasseri and Lactobacillus paragasseri Lactobacillus gasseri and Lactobacillus paragasseri are preferably Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716, and Lactobacillus paragasseri JCM1130. Furthermore, Lactobacillus gasseri and Lactobacillus paragasseri, Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, and Lactobacillus paragasseri JCM1130, can be obtained from the Japan Collection of Microorganisms, RIKEN BioResource Center (RIKEN BRC) (RIKEN BRC-JCM, Japan) under JCM numbers JCM5813, JCM1130, and JCM1131. Lactobacillus gasseri OLL2716 was deposited by Meiji Dairies Co., Ltd. (later Meiji Co., Ltd.) on May 24, 1999, with the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry (1-1-3 Higashi, Tsukuba, Ibaraki Prefecture, Japan), and subsequently received the accession number FERM BP-6999 on January 14, 2000. This deposit was transferred from the original deposit to a deposit under the Budapest Treaty on the same date. The patent microorganism deposit operations of the National Institute of Bioscience and Human-Technology, Agency of Industrial Science and Technology, Ministry of International Trade and Industry, were later consolidated at the Patent Organism Depositary Center, National Institute of Technology and Evaluation (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu, Chiba Prefecture, Japan).

[0052] According to a recent reclassification of lactic acid bacteria (Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, Wuyts S, Felis GE, Ganzle MG, Lebeer S.: A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol. 2020 Apr; 70(4): 2782-2858), this deposited strain is classified as Lactobacillus paragasseri.

[0053] Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716 and Lactobacillus paragasseri JCM1130 are capable of producing polysaccharides, and are characterized by extracellularly producing phosphorus-containing polysaccharides composed of galactose and glucose.

[0054] (4) Others As the Lactobacillus lactic acid bacteria according to the embodiment of the present invention, strains substantially equivalent to the above-mentioned deposited strains can also be used. The substantially equivalent strains include, for example, any of the following:

[0055] - A strain belonging to the genus Lactobacillus, the sequence of whose 16S rRNA gene has 90% or more, preferably 95% or more, more preferably 98% or more, even more preferably 98.5% or more, even more preferably more than 98.7%, even more preferably 99% or more, and even more preferably 100% sequence identity with the sequence of base SEQ ID NO: 1 shown below (i.e., the entire 16S rRNA gene sequence or a characteristic portion thereof (such as the V1 region, V2 region, V3 region, or the entire or a portion of the V1 region, V2 region, and V3 region, or a portion including the V1 region, V2 region, and V3 region, etc.)); - A strain having the same mycological properties as the deposited strain.

[0056] Regarding criteria for determining species identity based on 16S rRNA gene sequences, those skilled in the art can refer to Stackebrandt E, Ebers J. Taxonomic parameters revisited: tarnished gold standards. Microbiol Today 2006;33:152-155.

[0057] For example, the sequence of the V1 to V3 regions of the 16S rRNA gene of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (corresponding to the 34th to 535th bases in the full-length sequence of the 16S rRNA gene) is SEQ ID NO: 1 (sometimes referred to as the "nucleotide sequence") as follows:

[0058] (Sequence Listing) <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT

[0059] For example, the sequence of the V1 to V3 regions of the 16S rRNA gene of Lactobacillus gasseri OLL2716 (corresponding to the 34th to 535th bases in the full-length sequence of the 16S rRNA gene) is shown below as SEQ ID NO: 1 (sometimes referred to as the "nucleotide sequence").

[0060]

[0061] In embodiments of the present invention, unless otherwise specified, the term "sequence identity" refers to the percentage of the number of matching bases shared between two sequences when the two sequences are optimally aligned. Analysis of base sequence identity can be performed using algorithms or programs well known to those skilled in the art (e.g., BLASTN, BLASTP, BLASTX, ClustalW). When using a program, parameters can be appropriately set by those skilled in the art, or the default parameters of each program may be used. Specific techniques for these analysis methods are also well known to those skilled in the art. Commercially available genetic information processing software may be used to calculate identity.

[0062] The mycological properties of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 are as follows:

[0063] (4-1) Morphological characteristics Cell shape: rod-shaped Motility: none Presence or absence of spores: none Gram staining: positive

[0064] (4-2) Growth on Medium The strain was spread on a BL agar medium (Eiken Chemical) plate and cultured at 37° C. for 48 hours by the steel wool method, resulting in the formation of opaque, rough colonies.

[0065] (4-3) Physiological properties Nitrate reduction: negative Indole production: negative Gelatin liquefaction: negative Catalase activity: negative Attitude towards oxygen: facultative anaerobic Produces D(-) lactic acid from glucose by homolactic fermentation, and in BL liquid medium (which does not produce gas), growth at 10°C is negative, and growth at 45°C is positive Arginine decomposition: negative Gas production from malic acid: negative Decomposition of various carbohydrates (positive +, negative -) Arabinose - Xylose - Rhamnose - Ribose - Glucose + Mannose + Fructose + Galactose - Sucrose - Maltose - Cellobiose - Lactose + Trehalose - Melibiose - Raffinose - Melezitose - Dextrin - Starch - Glycogen - Inulin - Mannitol - Sorbitol - Inositol - Esculin - Salicin -

[0066] The bacteriological properties of Lactobacillus gasseri OLL2716 are as follows: Morphology: rod-shaped bacterium. No gas production from glucose. GC content: 36.4%. Gram-positive. Catalase-negative. Lactic acid optical rotation: DL-type. No growth at 15°C. Produces acid by assimilating glucose, mannose, fructose, galactose, sucrose, cellobiose, lactose, trehalose, starch, and dextrin.

[0067] 1-2. Lacticaseibacillus Lactic acid bacteria of the genus Lacticaseibacillus are a genus established by splitting off from the genus Lactobacillus, with Lacticaseibacillus caei as the type species (Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mattarelli P, O'Toole PW, Pot B, Vandamme P, Walter J, et al. A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae. Int J Syst Evol Microbiol 2020; 70:2782-2858.). The genus Lacticaceibacillus includes 21 species in total, including Lacticaceibacillus casei, Lacticaceibacillus paracasei, and Lacticaceibacillus paracasei subsp. paracasei. Examples of Lacticaceibacillus paracasei include Lacticaceibacillus paracasei YIT9029 (formerly classified as Lacticaceibacillus casei YIT9029), Lacticaceibacillus paracasei subsp. paracasei NY1301, Lacticaceibacillus paracasei subsp. paracasei P2303502, and Lacticaceibacillus paracasei subsp. paracasei JCM 1053. Lacticasei Bacillus paracasei YIT9029 has been deposited at the National Institute of Technology and Evaluation, Patent Organism Depositary (Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, 292-0818) under accession number FERM BP-1366 (deposit date: May 1, 1981). Lacticasei Bacillus paracasei YIT9029 can be isolated from Yakult 400 manufactured by Yakult Honsha Co., Ltd. by a conventional method using a selective medium for lactobacillus.Lacticase Bacillus paracasei subsp. paracasei NY1301 can be isolated by conventional methods using a selective medium for lactobacillus from Pircul 400 (manufactured by Nisshin York Co., Ltd.). Lacticase Bacillus paracasei subsp. paracasei P2303502 is available for sale at the Meiji Innovation Center of Meiji Co., Ltd. (1-29-1 Shichikuni, Hachioji, Tokyo, Japan, 192-0919). Lacticase Bacillus paracasei subsp. paracasei JCM 1053 can be obtained from the Japan Collection of Microorganisms (RIKEN BRC-JCM, Japan) under JCM number JCM 1053.

[0068] Lacticase Bacillus paracasei YIT9029, Lacticase Bacillus paracasei subsp. paracasei NY1301, Lacticase Bacillus paracasei subsp. paracasei P2303502, and Lacticase Bacillus paracasei subsp. paracasei JCM 1053 are capable of producing polysaccharides.

[0069] 2. Exopolysaccharides The exopolysaccharides according to the embodiment of the present invention are produced by the Lactobacillus family lactic acid bacteria described above. The exopolysaccharides are preferably produced by Lactobacillus lactic acid bacteria or Lacticaseibacillus lactic acid bacteria. As described above, the Lactobacillus lactic acid bacteria are preferably at least one lactic acid bacterium selected from the group consisting of Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus gasseri, and Lactobacillus paragasseri. Furthermore, it is more preferable that the Lactobacillus lactic acid bacteria is at least one species of lactic acid bacteria selected from the group consisting of Lactobacillus delbrueckii OLL204989, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1, Lactobacillus delbrueckii subsp. bulgaricus JCM1002T, Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716, and Lactobacillus paragasseri JCM1130. Furthermore, as described above, the Lacticaceibacillus lactic acid bacteria is preferably Lacticaceibacillus paracasei. Furthermore, the Lacticase Bacillus paracasei is preferably at least one lactic acid bacterium selected from the group consisting of Lacticase Bacillus paracasei YIT9029 and Lacticase Bacillus paracasei subsp. paracasei NY1301.

[0070] The exopolysaccharide according to an embodiment of the present invention is preferably a polysaccharide containing galactose and glucose as constituent sugars, more preferably a polysaccharide containing galactose and glucose as constituent sugars, even more preferably a polysaccharide containing galactose and glucose as constituent sugars and containing phosphorus, and particularly preferably a polysaccharide containing galactose and glucose as constituent sugars and containing phosphorus. Furthermore, the exopolysaccharide preferably contains a phosphorylated polysaccharide. Furthermore, the exopolysaccharide may contain a non-phosphorylated polysaccharide, but preferably does not contain a sulfated polysaccharide.

[0071] In addition to the above-mentioned strains, other Lactobacillus family lactic acid bacteria that produce such polysaccharides extracellularly include Lactiplantibacillus plantarum C88 (see Reference 5), Lactobacillus johnsonii strain 151 (see Reference 6), L. delbrueckii subsp. bulgaricus NCFB2074 (see Reference 7), Lacticaseibacillus casei CG11 (see Reference 8), Lacticaseibacillus rhamnosus E / N (see Reference 9), Lactobacillus fermentum TDS030603 (see Reference 10), and Lactobacillus gasseri FR4 (see Reference 11).

[0072] Appendix 5: Zhang, L., Liu, C., Li, D., Zhao, Y., Zhang, X., Zeng, X., Yang, Z., Li, S., 2013. Antioxidant activity on exopolysaccharide isolated from Lactobacillus plantarum C88. Int. J. Biol. Macromol. 54, 270-2 References:Gorska-Froczek, S., Sandstrom, C., Kenne, L., Paociak, M., Brzozowska, E., Strus, M., Heczko, P., Gamian, A., 2013. Structure and immunoreactivity of exopolysaccharide isolated from Lactobacillus johnsonii strain 151. Carbohydr. Res. 378 , 148–153 . References7:Harding, LP, Marshall, VM, Hernandez, Y., Gu, Y., Maqsood, M., Mclay, N., Laws, AP, 2005. Structural characterization of a highly branched exopolysaccharide produced by Lactobacillus delbrueckii ssp. bulgaricus NCFB2074. Carbohydr. Res. 340, 1107–1111. References 8:JCMC Cerning, CMGC Renard, JF Thibault, C Bouillanne, M Landon, M Desmazeaud & L Topisirovic: Appl. Approx. Microbiol., 60, 3914 (1994). Environmental Protection9:M. Polak-Berecka, A. Wasko, D. Szwajgier & A. Choma: Pol. J. Microbiol., 62, 181 (2013).Reference 10: K. Fukuda, T. Shi, K. Nagami, F. Leo, T. Nakamura, K. Yasuda, A. Senda, H. Motoshima & T. Urashima: Carbohydr. Polym., 79, 1040 (2010). Reference 11: International Journal of Biological Macromolecules Volume 109, 1 April 2018, Pages 772-783.

[0073] The exopolysaccharides referred to herein are not particularly limited as long as they have the desired effect, but are preferably those produced by fermenting raw milk (preferably a raw material containing milk as defined in the Milk and Milk Products Ordinance) using the above-mentioned lactic acid bacteria. The exopolysaccharides used in the embodiments of the present invention may be one type or a combination of two or more types. Furthermore, exopolysaccharides produced by fermenting plants themselves (seeds, etc.) or plant-derived raw materials using the above-mentioned lactic acid bacteria may be excluded. Furthermore, exopolysaccharides produced by fermenting a medium or substrate that does not contain one or more of glucose, galactose, and lactose using the above-mentioned lactic acid bacteria may be excluded.

[0074] 3. Dendritic Cells Dendritic cells are one of the cells contained in peripheral blood mononuclear cells (PBMCs) and are broadly classified into classical dendritic cells (conventional dendritic cells, cDCs) and plasmacytoid dendritic cells (plasmacytoid dendritic cells, pDCs). As described in the Examples below, compositions according to embodiments of the present invention activate cDCs and pDCs. CD86 and HLA-DR are known as indicators (activation markers) for confirming the activation of cDCs and pDCs. The degree of activation of cDCs or pDCs can be confirmed by determining the positivity rate or expression level of CD86 or the expression level of HLA-DR in cDCs and pDCs. The positivity rate and expression level of CD86 and the expression level of HLA-DR can be confirmed by the methods described in the Examples below.

[0075] 4. Secretory Immunoglobulin A (SIgA) Secretory immunoglobulin A (SIgA) is primarily present in mucosal secretions such as saliva, respiratory secretions, tears, and milk. SIgA exhibits various activities, including virus neutralization, bacterial aggregation, prevention of bacterial adhesion to mucosal epithelial cells, and binding to various food allergens. These activities allow SIgA to block the invasion of pathogenic microorganisms into the mucosa, and it is known to be particularly effective against upper respiratory tract infections (URTIs). Therefore, promoting SIgA secretion in saliva can reduce the incidence of URTIs.

[0076] 5. Compositions The term "compositions" as used herein includes preparations such as liquid diets, pharmaceuticals, supplements, and food additives, foods and beverages (excluding animals and plants themselves), and food and beverage compositions (including processed foods and beverages) that can be ingested by animals (including humans). Food and beverages may also include fermented milk (yogurt).

[0077] As described above, compositions according to embodiments of the present invention contain the above-described exopolysaccharides produced by Lactobacillus lactic acid bacteria. Exopolysaccharides are a type of metabolite produced by the cultivation and fermentation of these lactic acid bacteria. For example, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741), a lactic acid bacterium of the genus Lactobacillus (hereinafter, sometimes referred to as "R-1 lactic acid bacteria"), is known to produce exopolysaccharides during cultivation (hereinafter, exopolysaccharides will be referred to as "EPS," and in particular, exopolysaccharides produced by R-1 lactic acid bacteria will be referred to as "R1-EPS"). Compositions according to embodiments of the present invention contain such exopolysaccharides as active ingredients. In the composition according to the embodiment of the present invention, the lower limit of the daily intake of these exopolysaccharides is 10 μg, preferably 15 μg, more preferably 25 μg, even more preferably 100 μg, even more preferably 200 μg, particularly preferably 500 μg, even more particularly preferably 1.0 mg, even more preferably 2.0 mg, and even more preferably 3.0 mg. The upper limit is not particularly limited, but may be, for example, 200 mg, preferably 100 mg, more preferably 70 mg, even more preferably 30 mg, even more preferably 8.0 mg, and particularly preferably 5.0 mg. In the composition according to the embodiment of the present invention, the range of the daily intake of the exopolysaccharides can be set by freely combining the above upper and lower limits.

[0078] In the production of the composition according to the embodiment of the present invention, the stage of blending the exopolysaccharide can be appropriately selected. The stage of blending is not particularly limited as long as the properties of the exopolysaccharide are not significantly impaired. For example, a culture containing exopolysaccharide obtained by culturing an exopolysaccharide-producing lactic acid bacterium of the Lactobacillus family, or a crude or purified product thereof, can be mixed with the raw materials and blended.

[0079] The composition according to the embodiment of the present invention may contain not only the bacterial cells themselves, but also substances derived from the bacterial cells, such as disrupted bacterial cells. When the composition according to the embodiment of the present invention is used as a composition for activating dendritic cells, the effective amount (intake amount) of the composition according to the embodiment of the present invention is preferably 1×10 6 lactic acid bacteria cells per day for humans. ５ 5×10 pieces or more １０ in the range of 1×10 or less, more preferably 1×10 ６ 5×10 pieces or more １０ in the range of 1×10 or less, more preferably 1×10 ７ 5×10 pieces or more １０ in the range of 10 or less, more preferably 2 x 10 ７ More than 1×10 pieces ９ in the range of 10 or less, more preferably 2 x 10 ７ 3×10 pieces or more ８ It is desirable to contain the lactic acid bacteria so that they are ingested in a range of 100 or less. The lactic acid bacteria according to the embodiment of the present invention may be live or dead, and are preferably live. The upper and lower limits can be freely combined.

[0080] Furthermore, when the composition according to the embodiment of the present invention is used as a composition for promoting SIgA secretion in saliva, the effective amount (intake) per day for humans is preferably 1×10 ５ 5×10 pieces or more １０ in the range of 1×10 or less, more preferably 1×10 ６ 5×10 pieces or more １０ in the range of 1×10 or less, more preferably 1×10 ７ 5×10 pieces or more １０ in the range of 10 or less, more preferably 2 x 10 ７ More than 1×10 pieces ９ in the range of 10 or less, more preferably 2 x 10 ７ 3×10 pieces or more ８ It is desirable that the lactic acid bacteria contained in the food be ingested in an amount of not more than 1000. The lactic acid bacteria according to the embodiment of the present invention may be live or dead, and are preferably live.

[0081] Alternatively, commercially available products containing the lactic acid bacteria of the present invention may be used for convenience. For example, Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 can be isolated from "Meiji Probio Yogurt R-1" sold by Meiji Co., Ltd. When Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 of the present invention is ingested together with other ingestible ingredients, there are no limitations on the other ingestible ingredients, but dairy ingredients are preferably used, for example. "Dairy ingredients" refers to compositions containing milk (animal milk) itself or dairy ingredients obtained by processing milk, and includes all ingredients containing dairy ingredients, such as raw milk (such as cow's milk), reconstituted milk (milk powder, cream, butter), fermented milk (yogurt, cheese), and dairy preparations (whey, casein, lactose, whey minerals, permeate), and the origin and form of these ingredients are not particularly limited.

[0082] When the composition according to the embodiment of the present invention is used for dendritic cell activation, from the viewpoint of enhancing the dendritic cell activation effect, it is preferably taken continuously for at least one day, more preferably for at least three days, even more preferably for at least one week, even more preferably for at least two weeks, even more preferably for at least three weeks, still more preferably for at least six weeks, even more preferably for at least eight weeks, still more preferably for at least 12 weeks, even more preferably for at least 16 weeks, and particularly preferably for at least 20 weeks.

[0083] Furthermore, when the composition according to the embodiment of the present invention is used as a composition for promoting SIgA secretion in saliva, from the viewpoint of enhancing the effect of promoting SIgA secretion in saliva, it is preferably taken continuously for 5 days or more, more preferably for 1 week or more, even more preferably for 2 weeks or more, still more preferably for 4 weeks or more, even more preferably for 5 weeks or more, still more preferably for 8 weeks or more, even more preferably for 12 weeks or more, even more preferably for 16 weeks or more, and particularly preferably for 20 weeks or more.

[0084] The composition according to an embodiment of the present invention may be in the form of a unit package per serving, and may also be in the form of a unit package containing an effective amount of exopolysaccharide.

[0085] For example, the exopolysaccharide active ingredient per unit package is preferably contained so that it is ingested at a concentration of 1 μg / g to 1000 μg / g, more preferably 10 μg / g to 800 μg / g, even more preferably 50 μg / g to 500 μg / g, still more preferably 100 μg / g to 500 μg / g, and even more preferably 200 μg / g to 400 μg / g, or 250 μg / g to 350 μg / g. Note that these upper and lower limits can be freely combined.

[0086] When packaging the composition according to an embodiment of the present invention per unit package, known packaging can be used. For example, there are no particular limitations on the packaging materials, such as paper, plastic, glass, nylon, stainless steel, aluminum, iron, copper, silver, bamboo, etc. However, considering that lactic acid bacteria are facultative anaerobes, it is preferable to use a form that does not come into contact with air or oxygen. For example, it is preferable to include a step in the manufacturing process or packaging process of the composition according to an embodiment of the present invention to eliminate the possibility of exposure to oxygen, and it is also preferable to select a packaging material that does not allow oxygen to penetrate into the package during storage after packaging.

[0087] The composition according to the embodiment of the present invention may be taken orally, although the route of intake is not particularly limited. Furthermore, the form of intake of the composition when taken orally is not particularly limited, although oral intake as "fermented milk" is particularly preferred.

[0088] Furthermore, the intake form of the composition according to the embodiment of the present invention is not limited to the above-mentioned "fermented milk," and may be, for example, chocolate, jelly, ice cream, frozen dessert, beverage, chewable tablet, tablet, gummy candy, cheese, spread, health food (nutrient functional food, food for specified health use, dietary supplement, functional food, supplement, etc.), pharmaceutical, quasi-drug, etc. Furthermore, in the present invention, "functional food" includes health food to which a health claim based on the food standards of Codex Alimentarius (Joint FAO / WHO Food Standards Commission) is applied.

[0089] 6. Fermented Milk As described above, the composition according to an embodiment of the present invention is preferably ingested as "fermented milk." As described above, the fermented milk according to an embodiment of the present invention refers to milk (animal milk) obtained by fermentation, and includes, but is not limited to, "fermented milk," "lactic acid bacteria beverage," "milk beverage," and "natural cheese" as defined in the Ministerial Ordinance on the Compositional Standards of Milk and Dairy Products (Milk and Dairy Products Ordinance). For example, the fermented milk refers to "fermented milk" as defined in the Milk and Dairy Products Ordinance, i.e., milk such as raw milk, cow's milk, special cow's milk, raw goat's milk, pasteurized goat's milk, raw sheep's milk, adjusted milk, low-fat milk, non-fat milk, and processed milk, or milk containing an equivalent or higher non-fat milk solids, fermented with lactic acid bacteria or yeast, and made into a solid (hard type), pasty (soft type), or liquid (drink type), or a frozen version of these, but is not limited to these.

[0090] The fermented milk according to the embodiment of the present invention can be produced by mixing and blending a culture containing exopolysaccharides or a crude or purified product thereof with raw materials or fermented fermented milk. The fermented milk according to the embodiment of the present invention can also be produced by adding exopolysaccharide-producing lactic acid bacteria as a starter to raw milk and fermenting the mixture to produce exopolysaccharides from the lactic acid bacteria. These fermented milks contain exopolysaccharides.

[0091] In the fermented milk according to the embodiment of the present invention, the concentration of non-fat milk solids is, for example, preferably in the range of 4.0% to 12.0% by mass, more preferably in the range of 6.0% to 10.0% by mass, and even more preferably in the range of 7.0% to 9.0% by mass. The concentration of milk fat is, for example, preferably in the range of 0.2% to 4.0% by mass, more preferably in the range of 0.3% to 3.0% by mass, and even more preferably in the range of 0.4% to 2.0% by mass.

[0092] A typical example of fermented milk is yogurt. The international standards defined by the Food and Agriculture Organization of the United Nations (FAO) / World Health Organization (WHO) also stipulate that "products called yogurt are made from dairy products such as milk and skim milk powder through the lactic acid fermentation of both Streptococcus thermophilus and Lactobacillus delbrueckii subsp. bulgaricus, with the two bacteria surviving in large quantities in the final product." In the present invention, "yogurt" encompasses the yogurt defined by the FAO / WHO. Examples of such yogurt include plain yogurt, hard yogurt (set yogurt), soft yogurt, and drinkable yogurt. As the yogurt according to the embodiment of the present invention, hard yogurt is particularly preferred from the viewpoint of satisfying texture and satisfaction. Furthermore, when the subject is elderly, hard yogurt is particularly preferred from the viewpoint of preventing aspiration.

[0093] An example of a method for preparing fermented milk according to an embodiment of the present invention is a method in which raw milk is sterilized and cooled, a lactic acid bacteria starter containing the above-described lactic acid bacteria is added to the raw milk, and the raw milk containing the lactic acid bacteria starter is fermented at a fermentation temperature and for a fermentation time that results in a predetermined lactic acid acidity. The exopolysaccharides are produced by Lactobacillus subtilis family lactic acid bacteria during fermentation. In this method, the lactic acid acidity is, for example, 0.6 to 1.2. Preferably, the lactic acid acidity is 0.6 to 0.8. The fermentation temperature is, for example, 40 to 45°C. The fermentation time is, for example, 2 to 12 hours. Preferably, the fermentation time is 3 to 8 hours.

[0094] From the viewpoints of production efficiency and palatability, it is preferable to use Streptococcus lactic acid bacteria or Streptococcus thermophilus as a lactic acid bacteria starter in combination with Lactobacillus family lactic acid bacteria. Furthermore, when the Lactobacillus family lactic acid bacteria is Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1, the Thermophilus bacteria is more preferably Streptococcus thermophilus 1131 or Streptococcus thermophilus OLS3059. Note that Streptococcus thermophilus OLS3059 was deposited by Meiji Dairies Co., Ltd. (later Meiji Co., Ltd.) on February 29, 1996, with the National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary (Tsukuba Center Central 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture) and was deposited on the same day under the accession number FERM P-15487. This deposit was transferred from the original deposit to a deposit under the Budapest Treaty on November 29, 2006. At the time of this transfer, the deposit number FERM BP-10740 was assigned. Meanwhile, the patent microorganism deposit operations of the National Institute of Advanced Industrial Science and Technology (AIST) Patent Organism Depositary Center were transferred to the National Institute of Technology and Evaluation (NITE) Patent Organism Depositary Center on April 1, 2012, and the NITE Patent Organism Depositary Center was relocated to the NITE office at Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan, on April 1, 2013. Streptococcus thermophilus 1131 can be isolated from Meiji Bulgaria Yogurt "LB81 (Registered Trademark)" manufactured by Meiji Co., Ltd. using M17 agar medium, BCP-added plate count agar, or FS agar medium. When Streptococcus thermophilus strain 1131 is isolated on a plate count agar medium containing BCP, it is isolated as a spherical colony.

[0095] In addition, lactic acid bacteria other than Lactobacillus family lactic acid bacteria and Streptococcus genus lactic acid bacteria, as well as fermentation microorganisms such as bifidobacteria and yeast may be added as a lactic acid bacteria starter or for the purpose of imparting functionality, or the product may not contain bifidobacteria, yeast, etc.

[0096] The fermented milk according to the embodiment of the present invention can be easily ingested. Furthermore, fermented milk has been widely consumed, is highly safe, and has no risk of side effects, so consumers can ingest it with peace of mind.

[0097] By packaging the fermented milk according to the embodiment of the present invention in a single package in an amount appropriate for one ingestion, the fermented milk according to the embodiment of the present invention can be ingested appropriately and easily, which is preferable from the standpoint of usability. Although the appropriate amount for one ingestion varies from person to person, in the case of fermented milk with a non-fat milk solids content of 8.0% by mass, the amount per ingestion is preferably in the range of 10 mL to 1000 mL, more preferably in the range of 30 mL to 500 mL, even more preferably in the range of 50 mL to 200 mL, and preferably in the range of 80 mL to 120 mL. Alternatively, the amount per ingestion is preferably in the range of 10 g to 1000 g, preferably in the range of 30 g to 500 g, preferably in the range of 50 g to 200 g, more preferably in the range of 80 g to 150 g, and even more preferably in the range of 100 g to 120 g.

[0098] In the embodiments of the present invention, the "form of a single package" includes all forms, for example, common packaging forms such as a container with a lid, a bottle with a cap, an individual bag, a pouch, a tube, etc. In the embodiments of the present invention, the use of the fermented milk according to the embodiments of the present invention can be clarified by describing the use, effects, intake method, etc. of the fermented milk according to the embodiments of the present invention in each individual package or in a package including multiple individual packages, and / or by enclosing an item or the like on which such an explanation is written, and / or by displaying an item or the like on which such explanation is written, such as a separate pamphlet.

[0099] From the viewpoint of enhancing the dendritic cell activation effect, the fermented milk according to the embodiment of the present invention is preferably ingested continuously for at least 3 days, preferably for at least 5 days, preferably for at least 1 week, preferably for at least 2 weeks, preferably for at least 4 weeks, more preferably for at least 6 weeks, even more preferably for at least 8 weeks, even more preferably for at least 10 weeks, even more preferably for at least 12 weeks, even more preferably for at least 24 weeks, and particularly preferably for at least 36 weeks. Since the fermented milk according to the embodiment of the present invention has sufficient dietary experience and can be safely ingested, there is no particular upper limit to the intake period, and it can be continued indefinitely. However, if an upper limit is imposed, it may be, for example, 60 weeks or less. This upper limit may be, for example, 120 weeks or less, 100 weeks or less, or 80 weeks or less. The preferred mode of intake is oral ingestion.

[0100] Furthermore, from the viewpoint of enhancing the effect of promoting SIgA secretion in saliva, the fermented milk according to the embodiment of the present invention is preferably taken continuously for 5 days or more, more preferably for 1 week or more, even more preferably for 2 weeks or more, still more preferably for 4 weeks or more, even more preferably for 5 weeks or more, still more preferably for 8 weeks or more, even more preferably for 12 weeks or more, even more preferably for 16 weeks or more, and particularly preferably for 20 weeks or more. The preferred mode of intake is oral intake.

[0101] It is preferable to label the composition according to the embodiment of the present invention with an explanation of its use, efficacy, function, type of active ingredient, method of use, etc. The term "labeling" as used herein includes all labeling intended to inform consumers of the above-mentioned effects. This labeling may be any labeling that can recall or infer the above-mentioned content, and may include any and all labeling regardless of the purpose, content, or object or medium on which it is displayed. Specifically, the term "labeling" includes labeling the above-mentioned explanation on product packaging or containers, displaying or distributing the above-mentioned explanation in product advertisements, price lists, or transaction documents, providing information containing these contents via electromagnetic means (e.g., the Internet), and sales pitches. The term "labeling" as used herein also includes labeling that recommends the intake of the composition according to the embodiment of the present invention to a specific target, i.e., so-called "notifications" (including notifications in dietary management apps, nutritional management apps, healthcare apps, etc.).

[0102] It is preferable that a product containing a packaged composition according to an embodiment of the present invention be labeled with, for example, "activates dendritic cells," "maintains the activity of dendritic cells," "reduces the risk of decreased activity of dendritic cells," "acts on dendritic cells," "easily activates dendritic cells," "easily maintains the activity of dendritic cells," "for activating dendritic cells," "for maintaining the activity of dendritic cells," "activates dendritic cells, which are the control center of the immune system," "helps activate dendritic cells," "helps enhance dendritic cells," "helps enhance dendritic cells," "helps activate dendritic cells, which are the control center of the immune system," "helps enhance dendritic cells," etc. Note that a period such as "temporary" or "long-term" may be added to the beginning of each phrase, as appropriate.

[0103] In addition to the examples mentioned above, it is preferable that products containing a packaged composition according to an embodiment of the present invention be labeled with, for example, "Promotes SIgA secretion in saliva," "Easily promotes SIgA secretion in saliva," "For promoting SIgA secretion in saliva," etc.

[0104] The wording used to make the above-mentioned display is not limited to the above-mentioned example, and may be a wording that has the same meaning as the above-mentioned.

[0105] The above-mentioned composition can also be made into the form of a food for special dietary uses, a comprehensive nutritional food, a nutritional supplement, a food for specified health uses, a food with functional claims, a processed food, or the like.

[0106] In an embodiment of the present invention, the composition may contain other ingestible ingredients, various additives, pharmaceutical raw materials, etc. as ingredients other than lactic acid bacteria.

[0107] The fermented milk can also be made into a variety of forms, including special dietary foods, comprehensive nutritional foods, dietary supplements, foods for specified health uses, foods with functional claims, and processed foods. It can also be incorporated into beverages other than yogurt drinks, liquid diets, and other compositions (as defined by the U.S. Food and Drug Administration (FDA)). The fermented milk can also be used after drying or concentration. A food supplement is a product that supplements the normal diet and contains concentrated nutrients or other substances, either alone or in combination, that have nutritional or physiological effects. The product is labeled as a "food supplement." A dietary supplement is a product (excluding tobacco) intended to supplement the diet, contains one or more of the target ingredients, and is labeled as a "dietary supplement."

[0108] The composition or fermented milk according to the embodiment of the present invention is suitable for ingestion or administration to subjects for whom dendritic cell activation is desirable. The subject referred to here is not particularly limited, but specific examples include subjects who wish to maintain their health, subjects who are aware of their frail constitution, subjects who are aware of vague symptoms, and subjects for whom dendritic cell activation effects are desired (including healthy individuals, elderly people (those aged 65 or older according to the WHO definition), children (preferably young children (1 to 4 years old), more preferably adolescents (11 to 17-19 years old), and particularly preferably older children (5 to 10 years old)), and sick individuals). Healthy adults aged 18 to 60 years (those without specific chronic diseases and who have no difficulty in daily activities) are particularly preferred.

[0109] The present invention will be described in more detail below based on examples, but the present invention is not limited to these examples.

[0110] In this example, two verifications were conducted: "(A) a randomized, placebo-controlled, double-blind, parallel-group comparative study" and "(B) an evaluation test of cDC activity of EPS derived from Lactobacillus delbrueckii subsp. bulgaricus using human peripheral blood mononuclear cells."

[0111] (A) Randomized, placebo-controlled, double-blind, parallel-group comparative study 1. Test food and control food (1) Test food The test food was yogurt (cup yogurt with a content of 112 g per cup) containing Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741) (hereinafter sometimes referred to as "R-1 lactic acid bacteria").

[0112] The test food, R-1 lactic acid bacteria-containing yogurt, was produced by fermenting raw milk, skim milk powder, sugar, stevia, raw water, and dairy ingredients containing R-1 lactic acid bacteria with Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 and Streptococcus thermophilus OLS3059 (FERM BP-10740) (hereinafter referred to as "Thermophilus bacteria"). The nutritional components of the yogurt were 89 kcal of energy, 3.9 g of protein, 3.4 g of fat, and 10.8 g of carbohydrates. The test food contained more than 3.3 mg of exopolysaccharides (hereinafter referred to as "EPS"). Furthermore, the R-1 lactic acid bacteria and total lactic acid bacteria counts of the test food were measured using the pour plate culture method, and were confirmed to be within the standard range for fermented milk as defined by the Ministry of Health, Labour and Welfare. Furthermore, the test food contained 1.0 x 10 R-1 lactic acid bacteria. ６ cfu / g or more, and Streptococcus thermophilus OLS3059 at 1.0 x 10 ７ In addition, the R-1 lactic acid bacteria count and the Thermophilus bacteria count in the test food were confirmed to be 2.0 × 10 ７ The presence of EPS in the test food, the yogurt containing R-1 lactic acid bacteria, was confirmed by the phenol-sulfuric acid method. The thermophilus strains were used to satisfy the requirements for yogurt in the Codex Alimentarius standard and to promote fermentation of the yogurt.

[0113] (2) Control Food The control food (placebo) was acidic milk, which did not contain lactic acid bacteria and was made from the same ingredients as the test food, but with the addition of thickeners, flavorings, and lactic acid to give it the same flavor, physical properties, acidity, and nutritional components as the test food.

[0114] The control food (placebo) was made from raw milk, skim milk powder, sugar, stevia, raw water, and milk ingredients (same ingredients as the test food) that did not contain R-1 lactic acid bacteria, and to which thickeners, flavorings, and lactic acid were added to achieve flavor, physical properties, acidity, and nutritional content equivalent to that of the test food. Because the control food (placebo) is acid milk with the above-mentioned composition, it clearly does not contain EPS. Furthermore, the control food (placebo) was confirmed to be coliform-negative, with a general bacterial count of 10 cfu / g or less.

[0115] Furthermore, a third party not directly involved in the study confirmed that the test food and the control food (placebo) were indistinguishable.

[0116] (3) Packaging The product was packaged in a plain white paper cup (with a barrier) sealed with an aluminum lid.

[0117] (4) Safety The test food and control food were manufactured using the following ingredients, and it was determined that there were no safety issues.

[0118] (a) Test Foods (a-1) Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 is the strain used in Meiji Probio Yogurt R-1 (registered trademark), which has been commercially available since 2009. Yogurt containing the above-mentioned lactic acid bacteria has had a satisfactory sales record since its release in 2009, and no serious side effects thought to be caused by this product have been reported in the past.

[0119] (a-2) Other raw materials and food additives Raw milk, skim milk powder, sugar and stevia are commonly available food ingredients and food additives, and are used in compliance with the usage standards stipulated in the Food Sanitation Act.

[0120] (b) Control food (placebo) (b-1) Acidic milk The thickener, flavoring, and lactic acid used are commonly available food ingredients and food additives, and are used in compliance with the usage standards stipulated in the Food Sanitation Act.

[0121] (b-2) Other raw materials and food additives Raw milk, skim milk powder, sugar and stevia are commonly available food ingredients and food additives, and are used in compliance with the usage standards stipulated in the Food Sanitation Act.

[0122] (5) Storage Method The test foods were stored in a refrigerator at 10°C or below.

[0123] 2. Details of the Study As described above, the study was a randomized, placebo-controlled, double-blind, parallel-group comparative study. The purpose of the study was to obtain data on dendritic cell activation in subjects before (week 0), 2 weeks after, and 4 weeks after ingestion of the test food, as well as data on the promotion of SIgA secretion in saliva. Data on dendritic cell activation was obtained by testing the CD86 positivity rate of pDC and cDC. In addition, the study also evaluated the promotion of SIgA secretion in saliva. The test conditions are described in detail below.

[0124] (1) Subjects Healthy Japanese men and women aged 35 to 60 years old at the time of obtaining consent were selected as subjects according to the following criteria. In addition, when selecting subjects, the results of a screening test (hereinafter referred to as the "SCR test") conducted on 224 potential subjects were fully taken into consideration. The SCR test included a questionnaire regarding the inclusion and exclusion criteria, blood pressure and pulse rate measurements, height and weight measurements, a medical interview by a doctor, and hematology tests, blood biochemistry tests, and infectious disease tests to determine health status.

[0125] The inclusion and exclusion criteria for subjects were as follows:

[0126] <Inclusion criteria> a) Individuals who have received a full explanation of the purpose and contents of this study, are capable of consent, have fully understood the content, and have volunteered of their own free will and agreed to participate in writing b) Individuals who selected "Tired" at least once in question 26 of "POMS2" in the SCR test, and who selected a value of 3 or less in question 9 of "SF-36v2" "Did you feel tired?" (i.e., individuals who feel tired) <Exclusion criteria> a) Individuals suffering from, undergoing treatment for, or with a history of serious diseases such as diabetes, kidney / liver disease, or heart disease, thyroid disease, adrenal gland disease, or other metabolic diseases b) Individuals with a chronic disease who regularly take medication c) Individuals with a current or past medical history of drug or alcohol dependence d) Individuals who, for the past month or more, have regularly used (at least 3 days a week) foods containing lactic acid bacteria such as yogurt or lactic acid bacteria drinks, foods for specified health uses, foods with nutrient functions, health foods, or supplements e) Persons whose usual alcohol intake exceeds 1,000 mL of beer (5%) per day (40 g of alcohol equivalent) f) Persons who cannot abstain from alcohol for one day before the SCR test or any other test g) Persons who selected 1 in question 9 of the SF-36v2 for the SCR test, "A) Were you full of energy?" (i.e., full of energy) h) Persons with smoking habits i) Persons who have visited a medical institution due to hay fever within the past year, or who plan to take prescription medication for the treatment or prevention of hay fever during the study period j) Persons with a history of gastrointestinal disease or gastrointestinal surgery that affects digestion and absorption k) Persons with dental or oral problems accompanied by bleeding, whose symptoms are expected to continue during the study period l) Persons who wish to receive an influenza vaccine during the study period m) Persons whose hemoglobin level in the blood test administered for the SCR test is 12 g / dL or less for men and 11 g / dL or less for women n) Persons who test positive for infectious diseases administered for the SCR test o) Pregnant individuals, individuals who plan or hope to become pregnant during the study period, and individuals who are breastfeeding. p) Individuals who are prone to diarrhea when consuming dairy products. q) Individuals who have declared a food allergy. r) Individuals who have participated in other clinical trials or monitoring studies within one month prior to the SCR test, or individuals who plan or hope to participate in other clinical trials or monitoring studies during the study period. s) Individuals who are otherwise deemed unsuitable as study subjects by the principal investigator.

[0127] (2) Subject Allocation and Blinding The allocation of test food intake groups for this study was determined by the allocation manager, who referred to a list of 110 registered healthy adults selected as subjects, sorted them using age and gender as stratification factors, and then randomly assigned 55 subjects to the R-1 lactic acid bacteria intake group and 55 subjects to the placebo intake group. During this process, care was taken to ensure equality between groups in terms of "fatigue and stress levels (POMS2, SF-36v2 scores)," "whether or not night shift work was performed," and "whether or not exercise habits were performed" in the SCR test conducted prior to the start of the study. Furthermore, a test food management manager (different from the allocation manager) who was not directly involved in the study assigned unique numbers (test food identification numbers) to the test food and placebo, prepared a test food identification table listing the combination of the test food and test food identification numbers, and stored it in a sealed form. The allocation manager arbitrarily assigned test food identification numbers to each group, prepared an allocation decision form listing the combination of the test food identification number and the subject number, and stored it in a sealed form. The test food identification sheet and allocation decision form were kept securely by the test food management manager and allocation manager without disclosure to third parties until the key was opened, thereby maintaining blindness.

[0128] (3) Subject Background As described above, the SCR test was conducted on 224 potential subjects who consented to participate. Of these, 89 were deemed inappropriate based on the inclusion and exclusion criteria, and 10 declined to participate. Of the remaining 125, 110 were selected as subjects for this study, and 55 were randomly assigned to either the R-1 lactobacillus intake group or the placebo intake group. During the study period, one subject each from the R-1 lactobacillus intake group and the placebo intake group declined to participate, leaving 54 subjects in each group who completed the study. The intake rate of the test food, R-1 lactobacillus-containing yogurt or acidic milk (hereinafter, these two foods may be collectively referred to as the "test food") among the subjects who completed the study was 99.9±0.1% in both groups. Four subjects in the R-1 lactobacillus intake group and one subject in the placebo intake group were excluded from the analysis because the principal investigator determined that their use of nonsteroidal anti-inflammatory drugs or synthetic corticosteroids would affect the efficacy evaluation. Missing values ​​are shown below. One subject in the R-1 lactobacillus intake group had blood contamination in the saliva collected at the two-week test. Therefore, the value related to the salivary SIgA concentration at the two-week test was left as a missing value. Furthermore, one subject in the placebo intake group was unable to visit the clinic at four weeks due to personal reasons, and blood and saliva could not be collected. Therefore, the values ​​related to dendritic cell activity and salivary SIgA concentration at the four-week test were left as missing values. Furthermore, one subject in the placebo intake group had an insufficient number of PBMCs at the four-week test, so the value related to dendritic cell activity was left as a missing value.

[0129] (4) Intake method: Subjects in the R-1 lactobacillus intake group were instructed to take one container of yogurt containing R-1 lactobacillus, and subjects in the placebo intake group were instructed to take one container of acidic milk (112 g / container) per day for four consecutive weeks (subjects were free to choose the time of day to take the test food). However, the test food was not taken on the day of the test, but was taken after the test was completed.

[0130] (5) Evaluation Methods: Dendritic cell activation was assessed by testing the CD86 positivity rate of pDCs and cDCs. In addition to these evaluations, the promotion of SIgA secretion in saliva was also evaluated. During the study period, subjects were prohibited from consuming yogurt and lactic acid bacteria drinks other than the test food. Furthermore, subjects were prohibited from consuming supplements or health foods that could potentially affect the results of the study. Subjects were also instructed not to significantly change their dietary or exercise habits. Any medications taken during the study period were recorded in a diary. Furthermore, alcohol consumption was prohibited from the morning before the test until the end of the test on the day of the test. Subjects were required to finish dinner by 9:00 PM on the day before the SCR test and fast until the end of the test the following day (only water was allowed until one hour before the scheduled SCR test). Subjects were instructed to refrain from dental or stomatitis treatments from one week before the test (week 0), 2 weeks later, and 4 weeks later, until the end of the test on the day of the test. Subjects were instructed to brush their teeth after dinner on the day they started taking the test food (week 0), and two and four weeks later, and before going to bed on the day before the test. On the day of the test, subjects brushed their teeth after breakfast on the day they started taking the test food (week 0), and two and four weeks later, and were then prohibited from eating or drinking anything other than water until the end of the test that day. Subjects were instructed to brush their teeth even if they did not eat breakfast.

[0131] (a) Evaluation of CD86 Positivity Rate of Dendritic Cells. At each test, blood was collected from the subjects using BD Vacutainer CPT (registered trademark) mononuclear cell isolation tubes (manufactured by Nippon Becton Dickinson (BD) Corporation (hereinafter sometimes referred to as "BD")) on the day the test food intake began (week 0), and 2 and 4 weeks later. PBMCs were isolated from the blood. The isolated PBMCs were then suspended using CELLBANKER 1plus (registered trademark) (manufactured by Nippon Zenyaku Kogyo Co., Ltd.) and stored at -80°C until the day of measurement of dendritic cell activity. The PBMC suspensions stored frozen at -80°C were thawed, washed with PBS (FACS buffer) containing 2% fetal calf serum (FCS), and blocked with Human BD Fc Block (registered trademark) (manufactured by BD Biosciences) to obtain evaluation samples. Thereafter, the evaluation samples were stained by adding the cell staining dyes FVD780 (eBiosciense®) (Thermo Fisher Scientific), Anti-Lineage Cocktail 1 (containing CD3, CD14, CD16, CD19, CD20, and CD56) FITC (BD Biosciences), Anti-HLA-DR APC (BD Biosciences), Anti-CD11c BV421 (BD Biosciences), Anti-CD123 BV510 (BD Biosciences), Anti-CD304 PE (BioLegend), and Anti-CD86 PE-Cy7® (BD Biosciences), and incubated at room temperature for 20 minutes in the dark. The stained evaluation sample was then washed with FACS buffer, placed in a 5 mL polypropylene tube (Beckman Coulter) using Fixation / Permeabilization solution (BD Biosciences), and incubated at 2-8°C for 20 minutes to fix the evaluation sample. Measurement was then performed using a high-end clinical flow cytometer, Navios 3L 10C (Beckman Coulter).At this time, "cells that met the conditions of Lineage Cocktail 1 negative, HLA-DR positive, CD11c negative, CD123 positive, and CD304 positive" were defined as "pDCs." Furthermore, "cells that met the conditions of Lineage Cocktail 1 negative, HLA-DR positive, CD11c positive, and CD123 negative" were defined as "cDCs." Cells that were FVD780 positive were considered dead cells and excluded from the analysis. Subsequently, the CD86 positivity rate of pDCs and cDCs was analyzed as an activation index using Kaluza (Beckman Coulter), a flow cytometry analysis software. The above analysis was performed at Japan BioTherapy Research Institute, Inc.

[0132] The CD86 positivity rate of pDCs on the test food intake start date (week 0) was 21.2 ± 1.4% in the R-1 lactic acid bacteria intake group and 21.9 ± 1.1% in the placebo intake group. The change ratio from the test on the test food intake start date (week 0) (the test values ​​2 weeks and 4 weeks after the test food intake start date divided by the test value on the test food intake start date (week 0)) was 1.20 ± 0.08 in the R-1 lactic acid bacteria intake group 2 weeks after the test food intake start date and 1.23 ± 0.11 4 weeks after the test food intake start date. The change ratios after 2 weeks and 4 weeks in the placebo intake group were 1.04 ± 0.07 and 1.02 ± 0.06, respectively. This revealed that the CD86 positivity rate of pDC in the R-1 lactobacillus intake group remained significantly higher than that in the placebo intake group (P=0.047, see FIG. 1).

[0133] Regarding the CD86 positivity rate of cDC, the test value on the start date of test food intake (week 0) was 41.2 ± 3.0% in the R-1 lactic acid bacteria intake group and 44.1 ± 2.8% in the placebo intake group. The change ratio from the test on the start date of test food intake (week 0) (the test values ​​2 weeks and 4 weeks after the start date of test food intake divided by the test value on the start date of test food intake (week 0)) was 1.10 ± 0.05 in the R-1 lactic acid bacteria intake group 2 weeks after the start date of test food intake and 1.07 ± 0.05 4 weeks after the start date of test food intake. Furthermore, the change ratios after 2 weeks and 4 weeks in the placebo intake group were 0.98 ± 0.02 and 0.99 ± 0.03, respectively. This revealed that the CD86 positivity rate of cDCs in the R-1 lactobacillus intake group remained significantly higher than in the placebo intake group (P=0.049, see Figure 2).

[0134] (b) Evaluation of the promotion of SIgA secretion in saliva On the first day of ingestion of the test food (week 0), 2 weeks later, and 4 weeks later, the subjects sat down and held the sponge provided with the Sarstedt Salivet in their mouths for 2 minutes, allowing the sponge to soak into their saliva. The sponge was then placed in a special container and centrifuged to collect the subjects' saliva, and the SIgA concentration in the saliva was measured. The SIgA concentration was measured at Yanaihara Research Institute, Inc. Using the above method, data on the promotion of SIgA secretion in saliva was obtained.

[0135] Regarding salivary SIgA concentration, the test value on the first day of test food intake (week 0) was 95.0 ± 5.5 μg / mL in the R-1 lactic acid bacteria intake group. The test value in the placebo intake group was 97.0 ± 7.3 μg / mL. The change from the test on the first day of test food intake (week 0) (the test values ​​2 weeks and 4 weeks after the first day of test food intake were subtracted by the test value on the first day of test food intake (week 0)) in the R-1 lactic acid bacteria intake group was 8.3 ± 5.4 2 weeks after the first day of test food intake. The change 4 weeks after the first day of test food intake was 8.0 ± 4.7. The change values ​​2 weeks and 4 weeks after the first day of test food intake in the placebo intake group were 5.3 ± 4.7 and -6.6 ± 4.7, respectively. This shows that the R-1 lactic acid bacteria intake group had significantly higher values ​​in the test 4 weeks after starting intake of the test food compared to the placebo intake group (P=0.031, see Figure 3).

[0136] 3. Conclusion The results of the above randomized, placebo-controlled, double-blind, parallel-group comparative study suggest that ingestion of the test food product according to the present invention in humans can activate pDCs and cDCs. This suggests that a composition containing the exopolysaccharide of Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 as an active ingredient can activate dendritic cells. Furthermore, in this study, not only was pDC and cDC (dendritic cells) activated in the R-1 lactic acid bacteria intake group, but also an increase in the concentration of SIgA in saliva was observed. This suggests that ingestion of a composition containing the exopolysaccharide of OLL1073R-1 can activate pDCs and cDCs and increase the amount of SIgA in saliva.

[0137] (B) Evaluation test of pDC activity of EPS derived from Lactobacillus delbrueckii subsp. bulgaricus using human peripheral blood mononuclear cells. Human peripheral blood mononuclear cells (PBMCs, manufactured by Precision for Medicine) were placed in a 48-well microwell plate (manufactured by Iwaki) at 1 × 10 ６Next, R1-EPS was prepared according to a standard method (see the description in paragraph

[0140] ), and 250 μL of medium containing R1-EPS at 50, 100, 200, and 400 μg / mL, 250 μL of medium containing 2 μM CpG-A DNA (ODN2216) (manufactured by Hycult Biotech) as a positive control, and 250 μL of medium as a negative control were added to the same well plate, and incubated at 37°C and 5% CO ２Each PBMC was cultured in the same well plate for 24 hours under 50°C. Each culture was then collected into a 96-well V-bottom microwell plate, washed twice with PBS containing 2% FCS (FACS buffer), and centrifuged at 1300 rpm for 3 minutes at 4°C. The supernatant was removed from the centrifuged tube, and Human BD Fc Block (registered trademark) (BD) was added to the remaining precipitate and allowed to stand at room temperature for 10 minutes. The precipitate was then stained with the following cell staining dyes: FVD780 (eBiosciense), Anti-Human Lineage Cocktail 1 (CD3, CD14, CD16, CD19, CD20, CD56), FITC (BD), Anti-HLA-DR APC (BD), Anti-CD11c BV421 (BD), Anti-CD123 BV510 (BD), Anti-CD304 PE (BD), and Anti-CD86 PE-Cy7 (BD). The resulting mixture was incubated at 4°C for 30 minutes in the dark to obtain stained samples for evaluation. The samples were then washed twice with FACS buffer, and Fixation and Permeabilization Solution (BD) was added. The samples were then incubated at 2-8°C for 20 minutes to fix the samples. The precipitate was then washed twice with 1x Permeabilization buffer (BD), suspended in FACS buffer, and analyzed using a BD FACSVerse (BD). Cells that were Lineage Cocktail 1 negative, HLA-DR positive, CD11c negative, CD123 positive, and CD304 positive were defined as pDCs, and the expression intensities of CD86 and HLA-DR (Mean Fluorescence Intensity, MFI) were analyzed. PBMCs were purchased from Precision for Medicine. The culture medium used was RPMI 1640 (Gibco) (Thermo Fisher Scientific) supplemented with 10% FCS (BioWest) and 1% Penicillin-Streptomycin (Gibco) (Thermo Fisher Scientific).

[0138] The above analysis revealed that R1-EPS increased the expression of CD86 and HLA-DR, which are activation markers of pDC (see Figures 4 and 5). The expression levels of these markers also increased with the positive control, CpG-A DNA (see Figures 4 and 5). These results demonstrate that EPS derived from Lactobacillus delbrueckii subsp. bulgaricus increases the expression levels of CD86 and HLA-DR on pDC, i.e., activates pDC.

[0139] 1. Preparation of extracellular polysaccharides In a 10% by mass skim milk powder medium supplemented with 0.5% by mass yeast extract, Lactobacillus delbrueckii OLL204989 (NITE BP-02874), Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741), Lactobacillus delbrueckii subsp. bulgaricus JCM1002T, Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragasseri OLL2716 (FERM BP-6999), Lactobacillus paragasseri JCM1130, Lacticase Ibacillus paracasei subsp. The exopolysaccharides (hereinafter sometimes referred to as "EPS") from cultures obtained by culturing Lactic acid bacteria P2303502 (isolated from raw milk) and Lactic acid bacteria Bacillus paracasei subsp. paracasei JCM 1053 were purified. Specifically, various lactic acid bacteria were added to the cultures, which were cultured at 37°C for 18 hours. Trichloroacetic acid was added to the cultures to a final concentration of 10% by mass to remove denatured proteins. After that, cold ethanol was added to the cultures in an amount three times the amount of the supernatant after denatured protein removal. The cultures were then allowed to stand at 4°C until the next day to obtain a precipitate containing EPS. The precipitate was dialyzed against MilliQ water using a dialysis membrane (molecular weight cutoff 6000-8000 Da). After enzymatic hydrolysis of nucleic acids and proteins, another ethanol precipitation using three times the amount of ethanol was performed to obtain a precipitate. The precipitate was dissolved in MilliQ water, dialyzed again, and then lyophilized to obtain purified EPS. As a control, the above-mentioned culture and purification procedures were carried out without adding any of the lactic acid bacteria, and a freeze-dried product was obtained.

[0140] 2. Evaluation of pDC activity Human peripheral blood mononuclear cells (PBMCs, manufactured by Precision for Medicine) were placed in a 96-well microplate (manufactured by Iwaki) at 5 × 10 ５ Next, the above-mentioned various EPSs were added to the PBMCs at a final concentration of 200 μg / mL, and the cells were incubated at 37°C, 5% CO ２ Each PBMC in the well plate was cultured for 24 hours under 5% CO. To prepare a control sample, EPS purification was performed on the PBMCs without adding bacteria, and the resulting lyophilized product was added to the PBMCs. ２The cultures were then cultured in the same well plate for 24 hours under reduced pressure. Each culture was then collected into a 96-well V-bottom microwell plate, washed twice with PBS containing 2% FCS (FACS buffer), and centrifuged at 1300 rpm for 3 minutes at 4°C. The supernatant was removed from the centrifuged tube, and Human BD Fc Block (registered trademark) (BD) was added to the remaining precipitate and allowed to stand at room temperature for 10 minutes. The precipitate was then stained with the following cell staining dyes: FVD780 (eBiosciense), Anti-Human Lineage Cocktail 1 (CD3, CD14, CD16, CD19, CD20, CD56), FITC (BD), Anti-HLA-DR APC (BD), Anti-CD11c BV421 (BD), Anti-CD123 BV510 (BD), Anti-CD304 PE (BD), and Anti-CD86 PE-Cy7 (BD). The resulting mixture was incubated at 4°C for 30 minutes in the dark to obtain stained samples for evaluation. The samples were then washed twice with FACS buffer, and Fixation and Permeabilization Solution (BD) was added. The samples were then incubated at 4°C for 20 minutes to fix the samples. The precipitate was then washed twice with 1x Permeabilization buffer (BD), suspended in FACS buffer, and analyzed using BD FACSLyric (BD). Cells that were Lineage Cocktail 1 negative, HLA-DR positive, CD11c negative, CD123 positive, and CD304 positive were defined as pDCs, and the HLA-DR expression intensity (geometric mean fluorescence intensity, gMFI) was analyzed. The analysis results are shown in Figure 6. PBMCs were purchased from Precision for Medicine. The culture medium used was RPMI 1640 (Gibco) (Thermo Fisher Scientific) supplemented with 10% FCS (BioWest) and 1% Penicillin-Streptomycin (Gibco) (Thermo Fisher Scientific).

[0141] In addition to the above, the EPS-derived Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, and Lacticaceibacillus paracasei subsp. paracasei groups were analyzed for CD86 expression intensity in pDC. The analysis results are shown in Figure 8.

[0142] 3. Experimental Results and Discussion As shown in Figures 6 to 8, in the EPS-added group, the HLA-DR expression intensity in pDC significantly increased or tended to increase compared to the control group, and the CD86 expression intensity in pDC significantly increased. This indicates that EPS derived from four bacterial species, Lactobacillus delbrueckii, Lactobacillus gasseri, Lactobacillus paragasseri, and Lacticaseibacillus paracasei, activates pDC. Therefore, it is believed that EPS derived from Lactobacillus family lactic acid bacteria, preferably EPS derived from Lactobacillus genus lactic acid bacteria, or EPS derived from Lacticaseibacillus genus lactic acid bacteria, can activate pDC.

[0143] The composition of the present invention can activate dendritic cells and promote the secretion of SIgA in saliva. Therefore, ingestion of the composition of the present invention can maintain or improve the health of humans and others.

[0144] FERM BP-6999 FERM BP-10741 FERM BP-10740 NITE BP-02874

Claims

1. A composition for activating dendritic cells, comprising an exopolysaccharide produced by a lactic acid bacterium of the Lactobacillus casei family.

2. The composition for activating dendritic cells according to claim 1, wherein the Lactobacillaceae lactic acid bacteria is a Lactobacillus lactic acid bacteria.

3. The composition for activating dendritic cells according to claim 2, wherein the Lactobacillus lactic acid bacteria has a 16S rRNA gene having 95% or more sequence identity with the base sequence of SEQ ID NO: 1 below. <16S rRNA gene (SEQ ID NO: 1)> GCTGGCGGCGTGCCTAATACATGCAAGTCGAGCGAGCTGAATTCAAAGATYCCTTCGGGRTGATTTGTTGGACGCTAGCGGCGGATGGGTGAGTAACACGTGGGCAATCTGCCCTAAAGACTGGG ATACCACTTGGAAACAGGTGCTAATACCGGATAACAACATGAATCGCATGATTCAAGTTTGAAAGGCGGCGYAAGCTGTCACTTTAGGATGAGCCCGCGGCGCATTAGCTAGTTGGTGGGGTAAAG GCCTACCAAGGCAATGATGCGTAGCCGAGTTGAGAGACTGATCGGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGACGCAAGTCTGAT GGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTGGTGAAGAAGGATAGAGGCAGTAACTGGTCTTTATTTGACGGTAATCAACCAGAAAGTCACGGCTAACTACGT 4. The composition for activating dendritic cells according to claim 2, wherein the Lactobacillus lactic acid bacteria is at least one species of lactic acid bacteria selected from the group consisting of Lactobacillus delbrueckii, Lactobacillus delbrueckii subsp. bulgaricus, Lactobacillus gasseri and Lactobacillus paragaceri.

5. The composition for activating dendritic cells according to claim 4, wherein the Lactobacillus lactic acid bacterium is at least one type of Lactobacillus lactic acid bacterium selected from the group consisting of Lactobacillus delbrueckii OLL204989 (NITE BP-02874), Lactobacillus delbrueckii subsp. bulgaricus OLL1073R-1 (FERM BP-10741), Lactobacillus delbrueckii subsp. bulgaricus JCM1002T, Lactobacillus gasseri JCM1131, Lactobacillus gasseri JCM5813, Lactobacillus paragaceri OLL2716 (FERM BP-6999) and Lactobacillus paragaceri JCM1130.

6. The composition for activating dendritic cells according to claim 1, wherein the Lactobacillaceae lactic acid bacteria is a Lacticaceae lactic acid bacterium of the genus Lacticaceae.

7. The composition for activating dendritic cells according to claim 6, wherein the Lacticaseibacillus genus lactic acid bacteria is at least one species of Lacticaseibacillus genus lactic acid bacteria selected from the group consisting of Lacticaseibacillus paracasei and Lacticaseibacillus paracasei subsp. paracasei.

8. The composition for activating dendritic cells according to claim 7, wherein the lactic acid bacteria of the genus Lacticaceae Bacillus is Lacticaceae Bacillus paracasei subsp. paracasei JCM 1053.

9. The composition for activating dendritic cells according to claim 1, wherein the dendritic cells are plasmacytoid dendritic cells.

10. The composition for activating dendritic cells according to claim 1, wherein the dendritic cells are conventional dendritic cells.

11. The composition for activating dendritic cells according to claim 9, which increases the proportion of CD86-positive cells in the plasmacytoid dendritic cells in peripheral blood mononuclear cells.

12. The composition for activating dendritic cells according to claim 9, which increases the amount of CD86 expression in said plasmacytoid dendritic cells in peripheral blood mononuclear cells.

13. The composition for activating dendritic cells according to claim 9, which increases the amount of HLA-DR expression in said plasmacytoid dendritic cells in peripheral blood mononuclear cells.

14. The composition for activating dendritic cells according to claim 10, which increases the proportion of CD86-positive cells in the conventional dendritic cells in peripheral blood mononuclear cells.

15. The composition for activating dendritic cells according to claim 1, further comprising cells of the Lactobacillus casei lactic acid bacteria.

16. The composition for activating dendritic cells according to claim 1, wherein the composition is fermented milk.

17. A method for producing fermented milk for dendritic cell activation, comprising adding exopolysaccharide-producing lactic acid bacteria of the Lactobacillus family and Streptococcus thermophilus to a milk raw material and fermenting the milk raw material.

18. A composition for promoting SIgA secretion in saliva, comprising exopolysaccharides produced by lactic acid bacteria of the Lactobacillus family.

19. A composition for promoting SIgA secretion in saliva as described in claim 18, further comprising cells of the Lactobacillus subfamily lactic acid bacteria.

20. A composition for promoting saliva SIgA secretion as described in claim 19, which is achieved by dendritic cell activation.

Images