Ocular applications of combination therapy using statins and matrix bound vesicles (MBVS)

Abstract

Methods are disclosed for increasing retinal ganglion cell (RGC) survival and / or RGC axon regeneration and / or optic nerve survival and / or optic never regeneration in a subject in need thereof. These methods include locally administering to an eye of the subject a therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof. Combination therapy is also disclosed for use in increasing RGC survival and / or RGC axon regeneration and / or or optic nerve survival and / or optic nerve regeneration in a subject. Disclosed is therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use in increasing RGC survival, RGC axon regeneration and / or optic nerve survival and / or optic never regeneration in a subject in need thereof in a subject, wherein the isolated nanovesicles and the statin are formulated for ophthalmic administration.

Description

[0001] OCULAR APPLICATIONS OF COMBINATION THERAPY USING STATINS AND MATRIX BOUND VESICLES (MBVS) CROSS REFERENCE TO RELATED APPLICATION This claims the benefit of U.S. Provisional Application No.63 / 543,502, filed October 10, 2023, which is incorporated herein by reference. FIELD This relates to the field of ophthalmology, specifically to the use of matrix bound nanovesicles (MBVs) and a statin to increase retinal ganglion cell (RGC) survival and axon regeneration, and relates to the treatment of ophthalmic disease. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The contents of the electronic sequence listing (Sequence.xml; Size: 17,945 bytes; and Date of Creation: September 12, 2024) is herein incorporated by reference in its entirety. BACKGROUND Ocular trauma and optic neuropathies causing optic nerve degeneration and retinal ganglion cell (RGC) death are the leading causes of blindness worldwide. RGCs are the only neurons in the retina that convey visual information to the brain. Ocular trauma and optic neuropathies such as glaucoma and retinal ischemia cause damage to the optic nerve and RGC death. Incidence of ocular trauma is relatively high: 67% of facial fractures result in ocular injuries, and 4% of these patients present with optic nerve abnormalities. The annual incidence of ocular trauma is approximately 55 million and ocular injuries account for 5% to 16% of ophthalmology consultations. However, there are no FDA-approved drugs and treatments that prevent neurodegeneration and promote axonal regeneration after injury or degeneration. A need remain for combinatorial agents that synergistically increase RGC survival and can be used to treat ophthalmic conditions associated with decreased RGC and optic nerve survival and regeneration. SUMMARY Methods are disclosed herein for increasing RGC survival in a subject in need thereof. Methods are disclosed herein for increasing RCG axon regeneration in a subject in need thereof. Methods are also disclosed for increasing optic nerve survival and / or regeneration in a subject in need thereof. These methods include selecting a subject in need thereof, and locally administering to an eye of the subject a therapeutically effective amount of (1) isolated nanovesicles derived from an extracellular matrix and (2) a statin or a salt or prodrug thereof. In some aspects, the nanovesicles (i) maintain expression of F4 / 80 and CD-11b on macrophages in the subject, (ii) comprise lysyl oxidase, and (iii) do not express CD63 or CD81, or are CD63loCD81lo. In some aspects, the statin is Fluvastatin. The therapeutically effective amount of (1) isolated nanovesicles derived from an extracellular matrix and (2) a statin or a salt or prodrug thereof can be included in separate compositions or the same composition. Also disclosed herein is a therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use in increasing retinal ganglion cell survival, optic nerve survival, and / or optic nerve regeneration in a subject, wherein the isolated nanovesicles and the statin are formulated for local delivery to the eye of the subject. The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures. BRIEF DESCRIPTION OF THE DRAWINGS FIGs.1A-1G: Fluvastatin and MBV synergistically promote optic nerve regeneration and RGC protection after ONC. FIG.1A. Schema of intravitreal injections (IVT. Inj.) of PBS (Ctr), fluvastatin, MBV or the combination of MBV and fluvastatin after optic nerve crush (ONC) and analysis of CTB+retinal axon regeneration and RBPMS+RGC survival analysis in four quadrants of the peripheral and middle retina two weeks after ONC. FIG.1B. Images of CTB+axon regeneration from the retina treated with PBS (Ctr), 3mM fluvastatin, or 2.3 x 109particles / ml (P / ml) MBV two weeks after ONC. FIG.1C. Quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC. (n = 5 - 7, two-way ANOVA with Tukey’s post-hoc). FIG.1D. Images of RBPMS+RGCs in the intact retina or the injured retina treated with PBS (Ctr), 3mM fluvastatin, 2.3 x 109particles / ml (P / ml), or the combination of MBV and fluvastatin two weeks after ONC. FIG.1E. Quantitative analysis of RBPMS+RGC survival (%) in each quadrant of the peripheral and middle retina or the average of RGC survival from all four regions in the retina treated with PBS (Ctr), fluvastatin, MBV, or the combination of fluvastatin and MBV two weeks after ONC. (n = 5, two-way ANOVA with Tukey’s post-hoc for RGC survival in each region of the peripheral and middle retina; one-way ANOVA with Tukey’s post-hoc for average RGC survival). FIG.1F. Images of CTB+axon regeneration from the retina treated with PBS (Ctr) or the combination of fluvastatin and MBV two weeks after ONC. FIG.1G. Quantitative analysis of the number of regenerated axons at 400 – 2400 μm from the lesion sites in each condition two weeks after ONC. (n = 7 - 8, two-way ANOVA with Bonferroni’s test). Lesion sites marked by asterisks (FIG.1B, 1F). Data presented as mean ± SD. N.S., not significant; Scale bars represent 100 μm (FIG.1B, 1D, 1F). FIGs.2A-2F. Transcriptome profiling of the retina with MBV and fluvastatin after ONC. FIG. 2A. Schema of intravitreal injections (IVT inj.), RNA preparations and bulk RNA sequencing for transcriptome profiling in the whole retina two days after ONC. FIG.2B. The number of total annotated genes, genes with P-value < 0.05, and genes with an FDR p-value < 0.05 and a fold-change of at least 2 (referred to as top DEGs) in each treatment compared to PBS (Ctr). A Venn Diagram describes the similarities and differences of the top DEGs in the retina treated with the single or combined treatments. FIG.2C. Enriched cellular processes and pathways based on the top DEGs by each treatment. Bars indicate the degree of -log10 P value. FIG.2D. Volcano plots marked with gene name showing 20 DEGs with the highest fold-changes and an FDR p-value < 0.05 (referred to as the top 20 DEGs) by the combined treatment compared to PBS (Ctr). FIG.2E. The magnitude of expression levels of the top 20 DEGs in the retina treated with the combined treatment and analysis of expression levels of those DEGs in the retina treated with the single treatments. FIG.2F. Validation of expression of some of the top DEGs by quantitative RT- PCR in the retina treated with the combined treatment compared to PBS (Ctr) two days after ONC (n = 5, one-way ANOVA with Tukey’s post-hoc, Data presented as mean ± SD). FIGs.3A-3G. Neutrophils and monocytes are robustly infiltrated by the combination of MBV and fluvastatin after ONC. FIG.3A. Schema of intravitreal injections (IVT inj.) and preparations of the injured retina for flow cytometric analysis. FIG.3B. Representative flow cytometry dot plots of neutrophils (Ly6Ghi) against side scatter (SSC), and monocytes (CCR2hiLy6Chi) after gating on Ly6G-negative cells in the retina treated with PBS (Ctr) or the combination of MBV and fluvastatin three days after ONC. FIG.3C. Quantification of percentages of neutrophils (Ly6Ghi) and monocytes (CCR2hiLy6Chi) among the CD11b+myeloid cells in the retina treated with PBS (Ctr) or the combination of MBV and fluvastatin three or seven days after ONC. (n = 3 - 5, two-way ANOVA with Bonferroni’s test). FIG.3D. Images of neutrophils (Ly6G+), monocytes (CCR2+) and RGCs (βIII-tubulin+) in the retina treated with the combined treatment three days after ONC. FIG.3E. Images of neutrophils (Ly6G+) and monocytes (CCR2+Ly6Chi) in the retina treated with the combination of MBV and fluvastatin or PBS (Ctr) three days after ONC. FIGs.3F-3G. Quantitative analysis of the number of neutrophils (Ly6G+) and monocytes (CCR2+Ly6Chi) (FIG.3F) and localization (FIG.3G) in the retina treated with PBS (Ctr), fluvastatin, MBV and the combination of MBV and fluvastatin three days after ONC. Total number of those cells from two 300 µm (width) retinal areas adjacent to the nerve head per section were provided, and the average from five sections per animal was calculated (FIG.3F). Quantitative analysis of those immune cell the localization within the retina in three layers, 1: Intravitreal (IV), Ganglion cell layer (GCL) and Inner plexiform layer (IPL), 2: Inner nuclear layer (INL) and Outer plexiform layer (OPL), 3: Outer nuclear layer (ONL) and Outer Limiting Membrane (OLM) (FIG.3G). (n = 4, one-way ANOVA with Tukey’s post-hoc). Data presented as mean ± SD. N.S., not significant; Scale bars represent 20 μm. FIGs.4A-4E. Axon regeneration and neuroprotection are mediated by neutrophils and monocytes infiltrated by MBV and fluvastatin after ONC. FIG.4A. Schema of RBPMS+RGC survival analysis and axon regeneration after ONC in WT or Ccr2- / -mouse with intravitreal injections (IVT inj.) of PBS (Ctr) or the combination of MBV and fluvastatin post-injury and multiple intraperitoneal injections (IP inj.) of 1A8 or control IgG2a (Ctr) antibody pre- and post-injury. FIG.4B. Images of RBPMS+RGCs in the intact retina or the injured retina in each condition two weeks after ONC. FIG.4C. Quantitative analysis of RBPMS+RGC survival (%) in each quadrant of the peripheral region or the average of RGC survival in all four regions of the peripheral retina in each condition two weeks after ONC. (n = 5, two-way ANOVA with Tukey’s post-hoc for RGC survival in each region of the peripheral retina; one-way ANOVA with Tukey’s post-hoc for average RGC survival). FIG.4D. Images of CTB+regenerated axons in each condition two weeks after ONC. Lesion sites marked by asterisks. FIG.4E Quantitative analysis of the number of regenerated axons at 400 – 1200 μm from the lesion sites in each condition two weeks after ONC. (n = 5 - 8, two-way ANOVA with Tukey’s post-hoc). Data presented as mean ± SD. N.S., not significant; Scale bars represent 20 μm (FIG.4B) and 100 μm (FIG.4D). FIGs.5A-5I. CCL2, a chemokine for monocyte infiltration is upregulated in the superficial retinal layer by the combination of fluvastatin and MBV after ONC. FIGs.5A-5B. The list showing DEGs with the 21st- 30thhighest fold-changes and an FDR p-value < 0.05 based on bulk RNA-seq shown in FIG.2A includes Ccl2. Volcano plots (FIG.5B) showing Ccl2 and other top DEGs listed in (FIG.5A) (n = 3). FIG.5C. Expression of CCL2 protein in the intact and injured retina with the single and combined treatments three days after ONC. Note that CCL2 is highly upregulated by the combined treatment in GFAP+cells where vimentin is co-expressed, indicating these cells are Müller glia. FIG.5D. Quantitative analysis of fold-change of CCL2 expression in the injured retina with the single and combined treatments three days after ONC compared to the intact retina based on the mean pixel intensity of CCL2+retinal surface area (200 μm width x 20 μm depth). (n = 5, one-way ANOVA with Tukey’s post-hoc). FIG.5E. Quantification of percentages of neutrophils (Ly6Ghi) and monocytes (CCR2hiLy6Chi) among the CD11b+myeloid cells in the retina treated with PBS (Ctr) or the combination of MBV and fluvastatin three days after ONC in WT mice or Ccl2- / -mice. (n = 5, one-way ANOVA with Tukey’s post-hoc). FIGs.5F-5G. Images of RBPMS+RGCs in the intact retina or the injured retina in each condition two weeks after ONC (FIG.5F) and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina (FIG.5G). (n = 5, two-tailed unpaired t-test). FIGs.5H-5I. Reduced axon regeneration by the combination of MBV and fluvastatin in Ccl2- / -mouse compared to WT mice two weeks after ONC (FIG. 5H), and quantitative analysis of the number of regenerated axons at 400 - 1200 μm from the lesion site in each condition (FIG.5I). (n = 5, two-way ANOVA with Bonferroni’s test). Data presented as mean ± SD. N.S., not significant; Scale bars represent 20 μm (FIG.5C) and 100 μm (FIG.5F, 5H). FIGs.6A-6G: IL-33 acts synergistically with fluvastatin to enhance inflammatory monocyte infiltration, CCL2 expression and regenerative functions after ONC. FIG.6A. Quantification of percentages of neutrophils (Ly6Ghi) and monocytes (CCR2hiLy6Chi) among the CD11b+myeloid cells in the retina treated with PBS (Ctr), fluvastatin alone, 2, 10 or 50 μg / ml IL-33 alone or the combination of 2, 10 or 50 μg / ml IL-33 and fluvastatin three days after ONC. (n = 5, one-way ANOVA with Tukey’s post-hoc). FIGs.6B-6C. Images of elevated expression of CCL2 protein in the retina with the combination of 10 μg / ml IL-33 and fluvastatin in Müller glia (GFAP+cells expressing vimentin) three days after ONC compared to 10 μg / ml IL-33 alone or PBS (Ctr) (FIG.6B), and quantitative analysis (FIG.6C). (n = 5, one-way ANOVA with Tukey’s post-hoc). FIGs.6D-6E. Images of CTB+regenerated axons in each condition two weeks after ONC (FIG.6D) and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition (FIG.6E). (n = 5, two-way ANOVA with Tukey’s post-hoc). FIGs.6F-6G. Images of RBPMS+RGCs in the intact retina or the injured retina in each condition two weeks after ONC (FIG.6F), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition (FIG.6G). (n = 5, one-way ANOVA with Tukey’s post- hoc). Data presented as mean ± SD. N.S., not significant; Scale bars represent 20 μm (FIG.6B) and 100 μm (FIG.6D, 6F). FIGs.7A-7K. Extension of regenerated axons by the combination of fluvastatin, MBV and AAV2-shFnta virus after ONC. FIG.7A. Images of expression of GFP in RGCs (RBPMS+) of the retina infected with AAV2-GFP-shCtr or AAV2-GFP-shFnta viruses. FIG.7B. Validation of downregulated expression of Fnta mRNA by quantitative RT-PCR in the retina treated with AAV2-GFP-shFnta viruses compared to AAV2-GFP-shCtr viruses (n = 3, two-tailed unpaired t-test). FIGs.7C-7D. Downregulated protein expression of FNTA in the GCL (RBPMS+) by AAV2-GFP-shFnta viruses compared to AAV2- GFP-shCtr viruses (FIG.7C) and quantitative analysis of fold-change of FNTA expression in the GCL (FIG. 7D). (n = 3, two-tailed unpaired t-test). FIGs.7E-7F. Images of CTB-labeled regenerated axons in the retina treated with AAV2-GFP-shFnta or AAV2-GFP-shCtr viruses two weeks after ONC (FIG.7E), and quantitative analysis of the number of regenerated axons at 400, 800 and 1200 μm from the lesion site in each condition two weeks after ONC (FIG.7F). (n = 5, two-way ANOVA with Bonferroni’s test). FIG.7G. Schema of axon regeneration analysis four weeks after ONC in the retina with intravitreal injections (IVT inj.) of the combination of MBV and fluvastatin with AAV2-GFP-shFnta viruses or AAV2-GFP-shCtr viruses post-injury. FIG.7H. Images of CTB+regenerated axons in the retina treated with the combination of fluvastatin and MBV with AAV2-GFP-shFnta or AAV2-GFP-shCtr viruses four weeks after ONC. Tips of regenerated axons are observed near the optic chiasm, but did not reach the brain (arrows). FIG.7I. Quantitative analysis of the number of regenerated axons at 2000 – 4000 μm from the lesion site in each condition four weeks after ONC. (n = 5, two-way ANOVA with Bonferroni’s test). FIGs.7J-7K. Images of RBPMS+RGCs in the intact and injured retina in each condition four weeks after ONC (FIG.7J), and quantitative analysis of RGC survival (%) based on the average of RGC survival in all four regions of the peripheral retina in each condition (FIG.7K). (n = 5, two-tailed unpaired t-test). Lesion sites marked by asterisks (FIG.7E, 7H). Data presented as mean ± SD. N.S., not significant; Scale bars represent 20 μm (FIG.7A, 7C) and 100 μm FIGs.7E, 7H, 7J). FIGs.8A-8B. Analysis of the number of macrophages after intravitreal injections twice after ONC. FIG.8A. Images of macrophages (F4 / 80+cells) in the injured retina three days after ONC following intravitreal injections of PBS twice after ONC or without any injections. FIG.8B. Quantitative analysis of macrophages (F4 / 80+cells) in a 300 µm (width) area of the retina. (n = 3, N.S., two-tailed unpaired t-test). Data presented as mean ± SD. N.S., not significant; Scale bar represents 20 μm. FIGs.9A-9B. Size and concentrations of MBV. FIG.9A. Representative image of MBV with transmission electron microscopy. FIG.9B. The size and concentrations of MBV by Nanosight nanoparticle tracking analysis. Scale bar represents 200 nm. FIGs.10A-10B. The same magnitude of axon regeneration and RGC protection by different batches of MBV with fluvastatin after ONC. FIG.10A. Quantitative analysis of the number of regenerated axons at 400 – 2000 μm from the lesion sites in the injured retina treated with different batches of MBV (2.3 x 109particles / ml) with fluvastatin (3mM) two weeks after ONC. (n = 5 - 8, two-way ANOVA with Bonferroni’s test). FIG.10B. Quantitative analysis of RBPMS+RGC survival (%) in the average of RGC survival from all four regions in the peripheral retina treated with different batches of MBV with fluvastatin two weeks after ONC. (n = 5, two-tailed unpaired t-test). Data presented as mean ± SD. N.S., not significant. FIGs.11A-11B. Depletion of neutrophils and monocytes in the injured retina treated with MBV and fluvastatin. FIG.11A. Images of neutrophils (Ly6G+) (arrows) and monocytes (Ly6Chi) (arrowheads) in the retina treated with the combination of MBV and fluvastatin in WT mouse treated with control IgG or in Ccr2- / -mouse with 1A8 antibody. FIG.11B. Quantitative analysis of neutrophils (Ly6G+) and monocytes (Ly6Chi) in the retina treated with the combination of MBV and fluvastatin three days after ONC in WT or Ccr2- / -mouse treated with multiple intraperitoneal injections of control IgG or 1A8 antibody. Total number of those cells from two 300 µm (width) retinal areas (IV, GCL, and IPL) adjacent to the nerve head per section as shown in the cartoon were counted each condition, and the average from four sections per mouse was provided. (n = 3, one-way ANOVA with Tukey’s post-hoc). Data presented as mean ± SD; Scale bar represents 20 μm. FIG.12. Analysis of CCL2 expression in RGCs and astrocytes of the injured retina treated with MBV and fluvastatin after ONC Images of RGCs (Tuj1+cells) and astrocytes (S100B+cells) three days after ONC following intravitreal injections of MBV and fluvastatin post-injury. Note that CCL2 expression is not detected in RGCs nor astrocytes. Scale bars represent 20 μm. FIGs.13A-13B. Expression of CCR2 and CCL2 and the number of Ly6G+cells at the lesion site of the optic nerve treated with MBV and fluvastatin or PBS after ONC. FIG.13A. Images of expression of CCR2 and CCL2 and neutrophils (Ly6G+cells) at the lesion site of the optic nerve three days after ONC following intravitreal injections of MBV and fluvastatin or PBS (Ctr). FIG.13B. Quantitative analysis of CCR2 and CCL2 expression levels and the number of neutrophils (Ly6G+) at the lesion site three days after ONC following intravitreal injections of MBV and fluvastatin or PBS (Ctr). (n = 3, two-tailed unpaired t-test). Data presented as mean ± SD; Scale bar represents 20 μm. FIGs.14A-14E. Analysis of the effects of MBV and fluvastatin on other retinal cells. FIG.14A. No cataract induction by MBV and fluvastatin or PBS (Ctr) two weeks after ONC. FIGs.14B- 14C. Hematoxylin and eosin staining and analysis in the uninjured retina treated with PBS (Ctr) and injured retina treated with MBV and fluvastatin two weeks after ONC (FIG.14B) and analysis of thickness of the whole retina, inner nuclear layer (INL), and outer nuclear layer (ONL) (FIG.14C) (n = 3, two-tailed unpaired t-test at each layer). FIGs.14D-14E. Images of photoreceptors (rod: Rhodopsin; cone: PNA) and bipolar cells (PKCα) in the uninjured retina treated with PBS (Ctr) and injured retina treated with MBV and fluvastatin two weeks after ONC (FIG.14D) and analysis of the number of PNA+cells and expression of Rhodopsin and PKCα (FIG.14E) (n = 3, two-tailed unpaired t-test). Data presented as mean ± SD; Scale bars represent 20 μm. FIG.15. Porcine optic nerve crush surgery and intravitreal injections. Optic nerve crush in pigs was performed with Yasargil clips and intravitreal injections of MBV, fluvastatin and / or PBS were conducted within a few minutes, two and five days after optic nerve crush. FIGs 16A-16C. Fluvastatin and MBV enhance RGC protection after porcine ONC. FIG.16A. Images of βIII-tubulin+RGCs (arrows) in the intact retina or the injured retina treated with PBS (Ctr) or the combination of MBV and fluvastatin two weeks after ONC in pigs. FIGs.16B-16C. Quantitative analysis of the number of βIII-tubulin+RGCs in 300 µm-width five regions (#1: peripheral, #2: peripheral / middle, #3: middle, #4: middle / central, and #5: central retinal regions) of the intact and injured retina treated with PBS (Ctr) or the combination of fluvastatin and MBV two weeks after ONC (n = 3, two- way ANOVA with Tukey’s post-hoc) (FIG.16B), and RGC survival (%) based on the total number of surviving RGCs in five regions in the injured retina compared to the intact retina (n = 3, two-tailed unpaired t-test) (FIG.16C). Data presented as mean ± SD. N.S., not significant; Scale bar represents 20 μm. FIGs.17A-17E. Fluvastatin and MBV exert optic nerve protection and regeneration after porcine ONC. FIG.17A. Images of βIII-tubulin expression in the intact (Uninjured) and injured optic nerve two weeks after ONC following intravitreal injections of PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv). FIG.17B. Images of βIII-tubulin expression at 3000, 6000, 9000, and 18000 µm from the most proximal region site of the nerve two weeks after ONC following intravitreal injections of PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv). FIG.17C. Quantitative analysis of relative βIII-tubulin expression level at 3000 - 4000, 6000 - 7000, 9000 - 10000, and 18000 - 19000 µm from the most proximal region site of the nerve treated with the combination of MBV and fluvastatin (MBV + Fluv) compared to PBS (Ctr) two weeks after ONC (n = 4 - 5, two-tailed unpaired t-test at each region site). FIG.17D. Images of GAP43 expression at 0 and 11660 µm from the most proximal region site of the nerve two weeks after ONC following intravitreal injections of PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv). FIG.17E. Quantitative analysis of GAP43 area (%) at 0 - 2120, 2650 - 4770, 5300 - 7950, 8480 - 11130, and 11660 - 14310 µm from the most proximal region site of the nerve two weeks after ONC and treatments with PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv) (n = 3, two-tailed unpaired t-test at each region site). Data presented as mean ± SD. Scale bars represent 100 μm. FIGs.18A-18D. Fluvastatin and MBV modulate immune responses after porcine ONC. FIG. 18A. Images of monocytes (CCR2+) and neutrophils (CD18+ / CD11B+) in the injured retina two weeks after ONC following intravitreal injections of PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv). Arrows indicate positive cells. FIG.18B. Quantitative analysis of the total number of monocytes (CCR2+) and neutrophils (CD18+ / CD11B+) in two sectors per section two weeks after ONC following intravitreal injections of PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv) (n = 3, two- tailed unpaired t-test). FIG.18C. Images of microglia / macrophages (IBA1+) in the injured retina treated with PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv) two weeks after ONC. FIG.18D. Quantitative analysis of the total number of microglia / macrophages (IBA1+) in three sectors per section of the retina treated with PBS (Ctr) or the combination of MBV and fluvastatin (MBV + Fluv) two weeks after ONC. (n = 3, one-way ANOVA with Tukey’s post-hoc). Data presented as mean ± SD. Scale bars represent 20 μm. FIG.19. Fluvastatin and MBV attenuate loss of visual functions after porcine ONC. Visual evoked potentials (VEPs) analysis in the injured retina treated with PBS (Ctr) or MBV and fluvastatin two weeks after ONC. FIGs.20A-20B. Expression of βIII-tubulin and RBPMS in the mouse and pig retina. FIG.20A. Images of expression of βIII-tubulin and RBPMS in the mouse and pig intact retina. Note that βIII-tubulin is detected in mouse and pig RGCs, while RBPMS is detected with the antibody (Millipore, #ABN1376) in the mouse RGCs, but it is hardly observed in pig RGCs. FIG.20B. Images showing that RBPMS is undetectable in the pig intact retina with the other two antibodies for RBPMS (left, #1832; right #1830 from phosphosolutions). Scale bars represent 20 μm. FIGs.21A-21B. Expression of CD18 and CD11B in the neutrophils infiltrated by fluvastatin and MBV after mouse ONC. FIG.21A. Images of expression of CD18 and CD11B in mouse neutrophils (Ly6G+cells, arrows) three days after ONC. FIG.21A. Quantitative analysis of co-expression of Ly6G with CD18 and CD11B (%). Scale bar represents 20 μm. DETAILED DESCRIPTION Biologic scaffolds composed of extracellular matrix (ECM) have been developed as surgical mesh materials and are used in clinical applications including ventral hernia repair (Alicuban et al., Hernia. 2014;18(5):705-712), musculoskeletal reconstruction (Mase et al., Orthopedics.2010;33(7):511), esophageal reconstruction (Badylak et al., Tissue Eng Part A.2011; 17(11-12):1643-50), dura mater replacement (Bejjani et al., J Neurosurg.2007;106(6):1028-1033), tendon repair (Longo et al., Stem Cells Int.2012;2012:517165), breast reconstruction (Salzber, Ann Plast Surg.2006;57(1):1-5), amongst others (Badylak et al., Acta Biomater.2009;5(1):1-13). Matrix bound nanovesicles (MBVs) (or “nanovesicles derived from ECM”) are embedded within the fibrillar network of the ECM. These nanoparticles shield their cargo from degradation and denaturation during the ECM-scaffold manufacturing process. Exosomes are microvesicles that previously have been identified almost exclusively in body fluids and cell culture supernatant. It has been demonstrated that MBVs and exosomes are distinct. (Huleihel et al., (2016), Sci. Adv., 2(6):e1600502; Hussey et al., (2020) Science Advances, 6(12): eaay4361. The MBV differ from other microvesicles, for example, as they are resistant to detergent and / or enzymatic digestion, contain a cluster of different microRNAs, and are enriched in miR-145. MBVs do not have characteristic surface proteins found in other microvesicles such as exosomes. As disclosed herein, a combination therapy including MBVs and statins (such as, but not limited to, Fluvastatin) increases RGC survival, RGC axon regeneration, and optic nerve survival and regeneration, thereby modulating a healing response to preserve or to restore neuronal function in the retina and optic nerve . This combination therapy acts synergistically to promote optic nerve survival and regeneration. Terms Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. As used herein, “comprises” means “includes.” It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. About: Unless context indicated otherwise, “about” when used before a quantitative value, refers to a disclosure of the quantitative value itself, plus or minus 5% of that quantitative value, unless otherwise indicated (or inferred from context). For example, “about” 100 refers to 95 to 105. Acid Protease: An enzyme that cleaves peptide bonds, wherein the enzyme has increased activity of cleaving peptide bonds in an acidic pH. For example and without limitation, acid proteases can include pepsin and trypsin. Administration: The introduction of a composition (such as MBV or a pharmaceutical preparation that includes MBV) into a subject by a chosen route. The route can be local or systemic. For example, if the chosen route is intravenous, the composition is administered by introducing the composition into a vein of the subject. If the chosen route is local, the composition can be administered by introducing the composition directly into the eye of the subject. Animal: Living multi-cellular vertebrate organisms, a category that includes, for example, mammals and birds. The term “mammal” includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects. Axon: A projection of a neuron, in vertebrates, that conducts electrical impulses (action potentials) away from the nerve cell body. The function of the axon is to transmit signals to other neurons, muscles, and glands. Axons are distinguished from dendrites by several features, including shape (dendrites often taper while axons usually maintain a constant radius), length (dendrites are restricted to a small region around the cell body while axons can be much longer), and function (dendrites receive signals whereas axons transmit them). Visual information is relayed from the eye to the brain via the axons of retinal ganglion cells (RGCs). See Erskine and Herrera, Developmental Biology 308: 1-14, 2007. Biocompatible: Any material, that, when implanted in a mammalian subject, does not provoke an adverse response in the subject. A biocompatible material, when introduced into an individual, is able to perform its intended function, and is not toxic or injurious to that individual, nor does it induce immunological rejection of the material in the subject. Centrifugation: The process whereby a centrifugal force is applied to a mixture, whereby more- dense components of the mixture migrate away from the axis of the centrifuge relative to other less-dense components in the mixture. The force that is applied to the mixture is a function of the speed of the centrifuge rotor, and the radius of the spin. In most applications, the force of the spin will result in a precipitate (a pellet) gathering at the bottom of the centrifuge tube, where the remaining solution is properly called a “supernate” or “supernatant.” In other similar applications, a density-based separation or “gradient centrifugation” technique is used to isolate a particular species from a mixture that contains components that are both more dense and less dense than the desired component. During the circular motion of a centrifuge rotor, the force that is applied is the product of the radius and the angular velocity of the spin, where the force is traditionally expressed as an acceleration relative to “g,” the standard acceleration due to gravity at the Earth’s surface. The centrifugal force that is applied is termed the “relative centrifugal force” (RCF), and is expressed in multiples of “g.” Combination: Active ingredients that can be administered simultaneously or in a time frame such that the active ingredients are both resident in a tissue of interest, such as the eye, in a therapeutically effective amount, at the same time. The active ingredients can be administered in a single composition, or in separate compositions, as long as the active ingredients are both resident in a tissue of interest, in a therapeutically effective amount, at the same time. Comminute (comminution and comminuting): The process of reducing larger particles into smaller particles, including, without limitation, by grinding, blending, shredding, slicing, milling, or cutting. ECM can be comminuted while in any form, including, but not limited to, hydrated forms, frozen, air-dried, lyophilized, powdered, or sheet-form. “Comminuted ECM” includes intact collagen. Comminuted ECM has not been subjected to ultrasound or enzymatic digestion, e.g., with a protease, such as an acid protease. Contacting: Placement in direct physical association, which can be in solid or liquid form. An RGC can be contacted with an effective amount of MBV in vitro or in vivo. Control: A reference standard. In some embodiments, the control is a negative control sample obtained from a healthy patient (such as one without an ophthalmic conditition), or a subject treated with a carrier, or untreated cells from a healthy patient. In other embodiments, the control is a positive control sample obtained from a patient that has been treated with an active agent, such as an effective amount of MBV. In still other embodiments, the control is a historical control or standard reference value or range of values (such as a previously tested control sample, such as a group of patients with known prognosis or outcome, or group of samples that represent baseline or normal values). A difference between a test sample and a control can be an increase or conversely a decrease. The difference can be a qualitative difference or a quantitative difference, for example a statistically significant difference. In some examples, a difference is an increase or decrease, relative to a control, of at least about 5%, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or greater than 500%. Cytokine: The term “cytokine” is used as a generic name for a diverse group of soluble proteins and peptides that act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to, tumor necrosis factor-α, interleukin (IL)-6, IL-10, IL-12, transforming growth factor, and interferon-γ. Diagnosis: The process of identifying a disease by its signs, symptoms and results of various tests. The conclusion reached through that process is also called “a diagnosis.” Forms of diagnostic testing commonly performed include, without limitation, blood tests, medical imaging, and biopsy. Effective Amount: A quantity of a specific substance, such as an MBV, sufficient to achieve a desired effect in a subject being treated. When administered to a subject, a dosage will generally be used that will achieve target tissue concentrations (for example, in the eye) that has been shown to achieve a desired in vitro effect. For instance, this can be the amount necessary to affect RGC cell survival. Enriched: A process whereby a component of interest, such as a nanovesicle, that is in a mixture has an increased ratio of the amount of that component to the amount of other undesired components in that mixture after the enriching process as compared to before the enriching process. Extracellular matrix (ECM): A complex mixture of structural and functional biomolecules and / or biomacromolecules including, but not limited to, structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors that surround and support cells within tissues and, unless otherwise indicated, is acellular. ECM preparations can be considered to be “decellularized” or “acellular,” meaning the cells have been removed from the source tissue through processes described herein and known in the art. By “ECM-derived material,” such as an “ECM-derived nanovesicle,” “Matrix bound nanovesicle,” “MBV” or “nanovesicle derived from an ECM” it is meant a nanovesicle that is prepared from a natural ECM or from an in vitro source wherein the ECM is produced by cultured cells. Fluvastatin: A statin having the structure set forth as: (±)-(3R,5S,6E)-7-[3-(p-fluorophenyl)-1-isopropylindol-2-yl]-3,5-dihydroxy-6-heptenoic acid, which can be represented as:

[0002] cluded. Fluvastatin is approved for use to lower cholesterol levels and treat cardiovascular disease, for example, under the brand names LESCOL®, CANEF®, and VASTIN®. Glaucoma: An eye disorder characterized by retinal ganglion cell death, excavation of the optic nerve head and gradual loss of the visual field. An abnormally high intraocular pressure is commonly known to be detrimental to the eye and is one of the main risk factors in glaucoma. In glaucoma patients, high intraocular pressure can result in degenerative changes in the retina. "Ocular hypertension" refers to clinical situation in individuals with an abnormally high intraocular pressure without any manifestation of defects in the visual field or optic nerve head. Individuals with ocular hypertension carry the risk of conversion to glaucoma with the risk being correlated to higher intraocular pressure measurements. Glaucoma can be divided into open-angle form and the closed-angle forms and further classified into acute and chronic forms. There also is a normal-tension glaucoma. The glaucoma can be a primary or a secondary glaucoma. More than 80% of all glaucoma cases are chronic open angle glaucoma (COAG), also called primary open angle glaucoma. Any of these forms of glaucoma can be treated using the methods disclosed herein. “Primary angle closure glaucoma” is caused by contact between the iris, trabecular meshwork, and peripheral cornea which in turn obstructs outflow of the aqueous humor from the eye. This contact between iris and trabecular meshwork (TM) may gradually damage the function of the meshwork until it fails to keep pace with aqueous production, and the pressure rises. In over half of all cases, prolonged contact between iris and TM causes the formation of synechiae (effectively "scars"). These cause permanent obstruction of aqueous outflow. In some cases, pressure may rapidly build up in the eye, causing pain and redness (symptomatic, or so-called "acute" angle closure). In this situation, the vision may become blurred, and halos may be seen around bright lights. Accompanying symptoms may include a headache and vomiting. Diagnosis can made from physical signs and symptoms: pupils mid-dilated and unresponsive to light, cornea edematous (cloudy), reduced vision, redness, and pain. However, the majority of cases are asymptomatic. Prior to the very severe loss of vision, these cases can only be identified by examination, generally by an eye care professional. “Primary open-angle glaucoma” occurs when optic nerve damage results in a progressive loss of the visual field. Not all people with primary open-angle glaucoma have eye pressure that is elevated beyond normal. The increased pressure is caused by the blockage of the aqueous humor outflow pathway. Because the microscopic passageways are blocked, the pressure builds up in the eye and causes imperceptible very gradual vision loss. Peripheral vision is affected first, but eventually the entire vision will be lost if not treated. Diagnosis can be made by looking for cupping of the optic nerve and measuring visual field. Prostaglandin agonists work by opening uveoscleral passageways. Other forms of glaucoma are developmental glaucoma and secondary glaucoma, which can occur after uveitis, iridocyclitis, intraocular hemorrhage, trauma, or an intraocular tumor. Any form of glaucoma can be treated using the methods disclosed herein. The death of retinal ganglion cells occurs in glaucoma. Methods are disclosed herein for increasing the survival of retinal ganglion cells. Inhibiting or treating a disease or condition: Inhibiting a disease, such as, but not limited to, glaucoma, retinal degeneration or optic nerve degeneration, refers to inhibiting the full development of a disease or condition. In several examples, inhibiting a disease refers to lessening symptoms of the particular disease or condition, such as, but not limited to, vision loss. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition related to the disease. Treatment can be measured using success or indicia of success in the attenuation or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement, remission, diminishing of symptoms or making the condition more tolerable to the patient, slowing in the rate of degeneration or decline, making the final point of degeneration less debilitating, improving a subject’s physical state. The treatment may be assessed by objective or subjective parameters; including the results of a physical examination, vision tests, or biological tests. Intraocular administration: Administering agents directly into the eye, for example by delivery into the vitreous or anterior chamber. This is typically done via a needle placed through the sclera. Indirect intraocular delivery (for example by diffusion through the cornea) is not direct administration into the eye. Intraocular Pressure: The pressure of the fluid that fills the eye globe, the aqueous humor, which is determined by the interplay between the rate of aqueous humor production inside the eye and the resistance to aqueous outflow as it exits the eye through the anterior chamber angle towards Schlemm's canal. In the human eye, the rate of aqueous formation is 2.54 / minute while that in the rabbit eye is approximately 3 to 4 µL / minute. Normal IOP measurements in the human eye, according to widely acceptable consensus, range between 10 and 20 mm of mercury, with an average of 15.5 mm. Intravitreal administration: Administering agents into the vitreous cavity. The vitreous cavity is the space that occupies most of the volume of the core of the eye with the lens and its suspension system (the zonules) as its anterior border and the retina and its coating as the peripheral border. Intravitreal administration can be accomplished by injection, pumping, or by implants. Isolated: An “isolated” biological component (such as a nucleic acid, protein cell, or nanovesicle) has been substantially separated or purified away from other biological components in the cell of the organism or the ECM, in which the component naturally occurs. Nucleic acids and proteins that have been “isolated” include nucleic acids and proteins purified by standard purification methods. Nanovesicles that have been isolated are removed from the fibrous materials of the ECM. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids. Isotonic Buffered Solution: A solution that is buffered to a pH between 7.2 and 7.8 and that has a balanced concentration of salts to promote an isotonic environment. Lysyl oxidase (Lox): A copper-dependent enzyme that catalyzes formation of aldehydes from lysine residues in collagen and elastin precursors. These aldehydes are highly reactive, and undergo spontaneous chemical reactions with other lysyl oxidase-derived aldehyde residues, or with unmodified lysine residues. In vivo, this results in cross-linking of collagen and elastin, which plays a role in stabilization of collagen fibrils and for the integrity and elasticity of mature elastin. Complex cross-links are formed in collagen (pyridinolines derived from three lysine residues) and in elastin (desmosines derived from four lysine residues) that differ in structure. The genes encoding Lox enzymes have been cloned from a variety of organisms (Hamalainen et al., Genomics 11:508, 1991; Trackman et al., Biochemistry 29:4863, 1990; incorporated herein by reference). Residues 153-417 and residues 201-417 of the sequence of human lysyl oxidase have been shown to be important for catalytic function. There are four Lox-like isoforms, called LoxL1, LoxL2, LoxL3 and LoxL4. Macrophage: A type of white blood cell that phagocytoses and degrades cellular debris, foreign substances, microbes, and cancer cells. In addition to their role in phagocytosis, these cells play an important role in development, tissue maintenance and repair, and in both innate and adaptive immunity in that they recruit and influence other cells including immune cells such as lymphocytes. Macrophages can exist in many phenotypes, including phenotypes that have been referred to as M1 and M2. Macrophages that perform primarily pro-inflammatory functions are called M1 macrophages (CD86+ / CD68+), whereas macrophages that decrease inflammation and encourage and regulate tissue repair are called M2 macrophages (CD206+ / CD68+). The markers that identify the various phenotypes of macrophages vary among species. It should be noted that macrophage phenotype is represented by a spectrum that ranges between the extremes of M1 and M2. F4 / 80 (encoded by the adhesion G protein coupled receptor E1 (ADGRE1) gene) is a macrophage marker, see GENBANK® Accession No. NP_001243181.1, April 6, 2018, and NP_001965, March 5, 2018, both incorporated herein by reference. Without wishing to be bound by theory, it is believed that MBV have the ability to modulate the phenotype of macrophages, leading to an increase in M2-like, regulatory, or pro-remodeling macrophages. The effect of MBV on macrophages is further characterized in PCT Publication No. WO 2017 / 151862A1, incorporated herein by reference in its entirety. In some aspects, MBV of the present invention can be used to induce an M2 phenotype in macrophages and inhibit M1 macrophages in a subject. Mammal: This term includes both human and non-human mammals. Similarly, the term “subject” includes both human and veterinary subjects. MicroRNA: A small non-coding RNA that is about 17 to about 25 nucleotide bases in length, that post-transcriptionally regulates gene expression by typically repressing target mRNA translation. A miRNA can function as negative regulators, such that greater amounts of a specific miRNA will correlates with lower levels of target gene expression. There are three forms of miRNAs, primary miRNAs (pri-miRNAs), premature miRNAs (pre-miRNAs), and mature miRNAs. Primary miRNAs (pri-miRNAs) are expressed as stem-loop structured transcripts of about a few hundred bases to over 1 kb. The pri-miRNA transcripts are cleaved in the nucleus by an RNase II endonuclease called Drosha that cleaves both strands of the stem near the base of the stem loop. Drosha cleaves the RNA duplex with staggered cuts, leaving a 5' phosphate and 2 nucleotide overhang at the 3' end. The cleavage product, the premature miRNA (pre-miRNA) is about 60 to about 110 nucleotides long with a hairpin structure formed in a fold-back manner. Pre-miRNA is transported from the nucleus to the cytoplasm by Ran-GTP and Exportin-5. Pre-miRNAs are processed further in the cytoplasm by another RNase II endonuclease called Dicer. Dicer recognizes the 5' phosphate and 3' overhang, and cleaves the loop off at the stem-loop junction to form miRNA duplexes. The miRNA duplex binds to the RNA-induced silencing complex (RISC), where the antisense strand is preferentially degraded and the sense strand mature miRNA directs RISC to its target site. It is the mature miRNA that is the biologically active form of the miRNA and is about 17 to about 25 nucleotides in length. Modulate: To alter in a statistically significant manner. Modulation can be an increase or a decrease. One of skill in the art can identify an appropriate assay to determine a statistically significant increase or decrease in a parameter. These include, but are not limited to, a student’s t-test or a paired ratio t test. Exemplary methods are provided in the Examples section. Nanovesicle: An extracellular vesicle that is a nanoparticle of about 10 to about 1,000 nm in diameter. Nanovesicles are lipid membrane bound particles that carry biologically active signaling molecules (e.g. microRNAs, proteins) among other molecules. Generally, the nanovesicle is limited by a lipid bilayer, and the biological molecules are enclosed and / or can be embedded in the bilayer. Thus, a nanovesicle includes a lumen surrounded by plasma membrane. The different types of vesicles can be distinguished based on diameter, subcellular origin, density, shape, sedimentation rate, lipid composition, protein markers, nucleic acid content and origin, such as from the extracellular matrix or secreted. A nanovesicle can be identified by its origin, such as a matrix bound nanovesicle from an ECM (see above), protein content and / or the miR content. An “exosome" is a membranous vesicle which is secreted by a cell, and ranges in diameter from 10 to 150 nm. Generally, late endosomes or multivesicular bodies contain intralumenal vesicles which are formed by the inward budding and scission of vesicles from the limited endosomal membrane into these enclosed vesicles. These intralumenal vesicles are then released from the multivesicular body lumen into the extracellular environment, typically into a body fluid such as blood, cerebrospinal fluid or saliva, during exocytosis upon fusion with the plasma membrane. An exosome is created intracellularly when a segment of membrane invaginates and is endocytosed. The internalized segments which are broken into smaller vesicles and ultimately expelled from the cell contain proteins and RNA molecules such as mRNA and miRNA. Plasma-derived exosomes largely lack ribosomal RNA. Extra-cellular matrix derived exosomes include specific miRNA and protein components, and have been shown to be present in virtually every body fluid such as blood, urine, saliva, semen, and cerebrospinal fluid. Exosomes can express CD11c and CD63, and thus can be CD11c+and CD63+. Exosomes do not have high levels of lysyl oxidase on their surface. A “matrix bound nanovesicle,” “MBV,” “nanovesicle derived from ECM,” or an “ECM- derived nanovesicle” all refer to the same membrane bound particles, ranging in size from 10 nm-1000 nm, present in the extracellular matrix, which contain biologically active signaling molecules such as protein, lipids, nucleic acid, growth factors and cytokines that influence cell behavior. The terms are interchangeable, and refer to the same vesicles. These nanovesicles are embedded within, and bound to, the ECM and are not simply attached to the surface or circulating freely in body fluids. These nanovesicles are resistant to harsh isolation conditions, such as freeze-thawing and digestion with proteases such as pepsin, elastase, hyaluronidase, proteinase K, and collagenase, and digestion with detergents. MBV are distinct from other extracellular vesicles including exosomes and have a phospholipid composition distinct from exosomes. MBV are distinct from bone matrix vesicles which express alkaline phosphatase, as MBV do not express alkaline phosphatase, see PCT Publications Nos. WO2021 / 211885, WO2023 / 196970, and WO2023 / 250436. In certain circumstances, MBV can also be distinguished from exosomes based on the absence of certain markers commonly attributed to exosomes. In some aspects, MBV are characterized by one or more of the following features of protein expression or lipid content: MBV may not express one or more of CD63 and / or CD81 and / or CD9 or have low or barely detectable levels of CD63 and / or CD81 and / or CD9 (CD63loand / or CD81loand / or CD9lo) compared with other vesicles, such as exosomes. A variety of methods can be used to distinguish low, barely detectable, or absent expression of CD63 and / or CD81 and / or CD9 in MBV, for example, antibody-based methods, such as western blotting or flow cytometry (see, e.g., Bashashati and Brinkman, Adv Bioinformatics, 2009: 584603). In some aspects, MBV expression of CD63 and / or CD81 and / or CD9 is considered low or barely detectable compared with other vesicles where the expression of CD63 and / or CD81 and / or CD9 in MBV is at least one standard deviation or at least two standard deviations below the mean expression of other vesicles, such as exosomes; MBV have a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; MBV have a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); MBV have a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); MBV have a phospholipid content wherein 15% or greater of the total phospholipid content comprises phosphatidylinositol (PI) with the percent representing the percent of lipid concentration. In some aspects, MBV are characterized by all of the following features: do not express one or more of CD63 and / or CD81 and / or CD9 or have low or barely detectable levels of CD63 and / or CD81 and / or CD9 (CD63loand / or CD81loand / or CD9lo)( as further described above); a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); and a phospholipid content wherein 15% or greater of the total phospholipid content is phosphatidylinositol (PI). In some aspects, MBV are characterized by all of the following features: a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); and a phospholipid content wherein 15% or greater of the total phospholipid content is phosphatidylinositol (PI). In some aspects, MBV are characterized by one or more of the following features: a phospholipid content wherein at least 55% of total phospholipids comprise phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination; a phospholipid content wherein 10% or less of total phospholipids comprise sphingomyelin (SM); a phospholipid content wherein 20% or less of total phospholipids comprise phosphatidylethanolamine (PE); and a phospholipid content wherein 15% or greater of the total phospholipid content is phosphatidylinositol (PI). In some aspects, MBV are characterized by one or more of the following features: do not contain detectable levels of alkaline phosphatase; do not contain detectable levels of osteopontin; do not contain detectable levels of osteoprogeterin; do not contain detectable levels of complement C5; and / or do not contain detectable levels of c-reactive protein. In some aspects, MBV contain IL33 and are IL33+. The ECM from which MBV are isolated can be an ECM from a tissue, can be produced from cells in culture, or can be purchased from a commercial source. Optic nerve: A paired cranial nerve that transmits visual information from the retina to the brain. In humans, the optic nerve is composed of retinal ganglion cell axons and glial cells; it extends from the optic disc to the optic chiasma and continues as the optic tract to the lateral geniculate nucleus, pretectal nuclei, and superior colliculus. Pharmaceutically acceptable: A substance that can be taken into a subject without significant adverse toxicological effects on the subject. The term "pharmaceutically acceptable form" means any pharmaceutically acceptable derivative or variation, such as stereoisomers, stereoisomer mixtures, enantiomers, solvates, hydrates, isomorphs, polymorphs, pseudomorphs, neutral forms, salt forms, and prodrug agents. Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers useful in this invention are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins herein disclosed. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. Pharmaceutically acceptable salt: A biologically compatible salt of a compound that can be used as a drug, which salts are derived from a variety of organic and inorganic counter ions well known in the art and include, by way of example only, sodium, potassium, calcium, magnesium, ammonium, tetraalkylammonium, and the like; and when the molecule contains a basic functionality, salts of organic or inorganic acids, such as hydrochloride, hydrobromide, tartrate, mesylate, acetate, maleate, oxalate, and the like. Pharmaceutically acceptable acid addition salts are those salts that retain the biological effectiveness of the free bases while formed by acid partners that are not biologically or otherwise undesirable, e.g., inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, and the like, as well as organic acids such as acetic acid, trifluoroacetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, benzene sulfonic acid (besylate), cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like. Pharmaceutically acceptable base addition salts include those derived from inorganic bases such as sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Exemplary salts are the ammonium, potassium, sodium, calcium, and magnesium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins, and the like. Exemplary organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine. (See, for example, S. M. Berge, et al., “Pharmaceutical Salts,” J. Pharm. Sci., 1977; 66:1-19, which is incorporated herein by reference.). Pharmaceutical agent: A chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject or a cell. “Incubating” includes a sufficient amount of time for a drug to interact with a cell. “Contacting” includes incubating an agent, such as an exosome, a miRNA, or nucleic acid encoding a miRNA, in solid or in liquid form with a cell. Phospholipid: A class of lipids having a structure consisting of two hydrophobic fatty acid tails and a hydrophilic head consisting of a phosphate group. Major classes of phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidylglycerol (PG), sphingomyelin (SM), cardiolipin (CL), phosphatidic acid (PA), and bis- monoacylglycerophosphate (BMP). Phospholipids can be measured in a variety of ways. For example, liquid chromatography–mass spectrometry (LC-MS) based global lipidomics and redox lipidomics can be used. In some aspects, specific phospholipid content is indicated as the percent concentration of the total phospholipids (such as total phospholipids in MBV), where the percent concentration is weight / weight (w / w). Polynucleotide: A nucleic acid sequence (such as a linear sequence) of any length. Therefore, a polynucleotide includes oligonucleotides, and also gene sequences found in chromosomes. An “oligonucleotide” is a plurality of joined nucleotides joined by native phosphodiester bonds. An oligonucleotide is a polynucleotide of between 6 and 300 nucleotides in length. An oligonucleotide analog refers to moieties that function similarly to oligonucleotides but have non-naturally occurring portions. For example, oligonucleotide analogs can contain non-naturally occurring portions, such as altered sugar moieties or inter-sugar linkages, such as a phosphorothioate oligodeoxynucleotide. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules. Prodrug: An inactive compound that is modified chemically through in vivo physiological action, such as hydrolysis, metabolism and the like, into an active compound following administration of the prodrug to a subject. The term “prodrug” as used throughout this text means the pharmacologically acceptable derivatives such as esters, amides and phosphates, such that the resulting in vivo biotransformation product of the derivative is the active drug as defined in the compounds described herein. Prodrugs preferably have excellent aqueous solubility, increased bioavailability and are readily metabolized into the active inhibitors in vivo. Prodrugs of a compounds described herein may be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either by routine manipulation or in vivo, to the parent compound. The term “prodrug” also is intended to include any covalently bonded carriers that release an active parent drug of the present invention in vivo when the prodrug is administered to a subject. Prophylactic: as used herein refers to a medication or a treatment designed and used to prevent a disease or disorder from occurring. As used herein, the terms “prophylactic” and “prevention” are used interchangeably. Purified: The term “purified” does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified nucleic acid molecule preparation is one in which the nucleic referred to is more pure than the nucleic in its natural environment within a cell. For example, a preparation of a nucleic acid is purified such that the nucleic acid represents at least 50% of the total protein content of the preparation. Similarly, a purified exosome preparation is one in which the exosome is more pure than in an environment including cells, wherein there are microvesicles and exosomes. A purified population of nucleic acids or exosomes is greater than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% pure, or free other nucleic acids or cellular components, respectively. Preventing or treating a disease: “Preventing” a disease refers to inhibiting the development of a disease, for example in a person who is known to have a predisposition to a disease such as gaucoma. An example of a person with a known predisposition is someone with a history of a disease in the family, or who has been exposed to factors that predispose the subject to a condition. “Treatment” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. Retina: The light (photon) sensitive portion of the eye, that contains the photoreceptors (cones and rods) for light. Rods and cones perform light perception through the use of light sensitive pigments. The light sensitive pigments are made of protein called opsin and a chromophore called retinene, which the variant is of vitamin A. The rods contain rhodopsin while the cones contains iodopsin. Rods and cones transmit signals through successive neurons that trigger a neural discharge in the output cells of the retina and the ganglion cells. The visual signals are conveyed by the optic nerve to the lateral geniculate bodies from where the visual signal is passed to the visual cortex (occipital lobe) and registered as a visual stimulus. Retinal ganglion cell (RGC): A type of neuron located near the inner surface (the ganglion cell layer) of the retina of the eye. It receives visual information from photoreceptors via two intermediate neuron types: bipolar cells and retina amacrine cells. RGCs collectively transmit image-forming and non- image forming visual information from the retina in the form of action potential to several regions in the thalamus, hypothalamus, and mesencephalon, or midbrain. RGCs have a long axon that extends to the brain; these axons form the optic nerve, optic chiasm, and optic tract. Statins: A class of small molecule drugs that are HMG-CoA reductase inhibitors. Some members of the class are commonly used as lipid-lowering medications that reduce illness and mortality in those who are at high risk of cardiovascular disease. Non-limiting examples of statins include fluvastatin, cerivastatin, simvastatin, mevastatin, lovastatin, pitavastatin, atorvastatin, rosuvastatin, and pravastatin. A statin includes pharmaceutically acceptable salts, esters and enantiomers thereof. Statins may be in the form of a salt, hydrate, solvate, polymorph, or a co-crystal. Statins may also be in the form of a hydrate, solvate, polymorph, or a co-crystal of a salt. Statins may also be present in the free acid or acetone form. In addition, the term “statin” used herein includes synthetic and natural analogs of pravastatin, pitavastatin, fluvastatin, mevastatin, atorvastatin, lovastatin, simvastatin, rosuvastatin, and cerivastatin, amongst others. Subject: Human and non-human animals, including all vertebrates, such as mammals and non- mammals, such as non-human primates, mice, rabbits, sheep, dogs, cats, horses, cows, chickens, amphibians, and reptiles. In many aspects of the described methods, the subject is a human. Therapeutically effective amount: A quantity of a specific substance, or combination of substances, such as an MBV and statins, sufficient to achieve a desired effect in a subject being treated. When administered to a subject, a dosage will generally be used that will achieve target tissue concentrations (for example, in the eye) that has been shown to achieve a desired in vitro effect. Total phospholipid content: “Total phospholipids” or “total phospholipid content”, as used herein, with respect to MBV, refers to the sum of all phospholipids present in a given quantity of isolated MBV, i.e., MBV isolated from the ECM. MBV can be isolated, for example, by enzymatic digestion of decellularized ECM and differential centrifugation. The total phospholipid content can be determined by methods such as LC-MS based global lipidomics and redox lipidomics. The total phospholipid content is measured by weight. A percentage of the total phospholipid content refers to a percent concentration on a weight / weight basis. Treating, Treatment, and Therapy: Any success or indicia of success in the attenuation or amelioration of an injury, pathology or condition, including any objective or subjective parameter such as abatement, remission, diminishing of symptoms or making the condition more tolerable to the patient, slowing in the rate of degeneration or decline, making the final point of degeneration less debilitating, improving a subject’s physical or mental well-being, or improving vision. The treatment may be assessed by objective or subjective parameters; including the results of a physical examination, neurological examination, or psychiatric evaluations. Overview Methods are disclosed for increasing retinal ganglion cell survival, retinal ganglion cell axon regeneration, optic nerve survival, and / or optic nerve regeneration in a subject in need thereof. These methods include locally administering to an eye of the subject a therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof. In aspects, these methods further include selecting the subject in need of increased retinal ganglion cell survival, retinal ganglion cell axon regeneration, optic nerve survival, and / or optic nerve regeneration. In aspect, the method increases retinal ganglion cell survival. In more aspects, the method increases retinal ganglion cell axon regeneration. In other aspects, the method increased optic nerve survival. In further aspects, the method increase optic nerve regeneration. In some aspects, the nanovesicles (i) maintain expression of F4 / 80 and CD-11b on macrophages in the subject, (ii) comprise lysyl oxidase, and (iii) do not express CD63 or CD81, or are CD63loCD81lo. In other aspects, the nanovesicles comprise miR-145 and / or miR-181. In more aspects, the statin is atorvastatin, rosuvastatin, simvastatin, pravastatin, fluvastatin, lovastatin, or pitavastatin. In further aspects, the statin is fluvastatin. In some aspects, the nanovesicles are derived from a mammalian extracellular matrix. In more aspects, the mammalian extracellular matrix is a porcine, bovine, or ovine extracellular matrix. In further aspects, the mammalian extracellular matrix is a porcine extracellular matrix. In other aspects, the extracellular matrix is esophageal, urinary bladder, small intestine, dermis, umbilical cord, pericardium, cardiac, skeletal muscle, liver, kidney, lung, large intestine, or stomach extracellular matrix. In some aspects, the extracellular matrix is urinary bladder matrix (UBM) or small intestinal submucosa (SIS). In further aspects, the isolated nanovesicles and the statin are administered intravitreally or subretinally by injection. In other aspects, the isolated nanovesicles and the statin are administered repeatedly to the eye of the subject. In more aspects, the isolated nanovesicles and the statin are each administered weekly, bimonthly, or monthly to the subject. In further aspects, the isolated nanovesicles and the statin are administered to the subject simultaneously or in succession. In some aspects, the subject has glaucoma. In more aspects, the subject has retinal ganglion cell and / or optic nerve degeneration caused by injury. In further aspects, the subject has retinal ganglion cell and / or optic nerve degeneration caused by a genetic disorder. In some additional aspects, the subject has optic neuropathy. In aspects, the optic neuropathy is pressure-independent glaucomatous optic neuropathy, ischemic optic neuropathy, inflammatory optic neuropathy, compressive optic neuropathy, or traumatic optic neuropathy. In more aspects, the optic neuropathy is arteritic ischemic optic neuropathy, arteritic ischemic optic neuropathy associated with giant cell arteritis, nonarteritic ischemic optic neuropathy, infiltrative optic neuropathy, infiltrative optic neuropathy associated with sarcoidosis, infectious optic neuropathy, infectious optic neuropathy associated with syphilis, infectious optic neuropathy associated with Lyme disease, infectious optic neuropathy associated with toxoplasmosis, infectious optic neuropathy associated with herpes zoster, optic neuritis from demyelinating disease, post-radiation optic neuropathy, hereditary optic neuropathy, hereditary optic neuropathy associated with dominant optic neuropathy, compressive optic neuropathy, compressive optic neuropathy associated with orbital pseudotumor, compressive optic neuropathy associated with thyroid eye disease, autoimmune optic neuropathy, or autoimmune optic neuropathy associated with Lupus. In more aspects, the isolated nanovesicles and the statin are formulated together in a pharmaceutical formulation further comprising a pharmaceutically acceptable carrier. In some aspects, the pharmaceutical formulation is a liquid pharmaceutical formulation. In further aspects, the isolated nanovesicles are formulated in a liquid formulation that does not include the statin. In more aspects, the statin is formulated in a liquid formulation that does not include the isolated nanovesicles. In further aspects, the statin is administered in an amount of 50 to 5000 µg per administration. In some aspects, the statin is administered in an amount of about 50 to about 1000 µg per administration. In further aspects, the statin is administered in a volume of 10 to 100 µL of a solution comprising about 2 mM to about 15 mM of the statin. In some aspects, the volume is about 25-50 µL. In some aspects, the nanovesicles are administered in a volume of 10 to 100 µL of a solution comprising about 1x109to about 1x1011nanovesicles / mL. In more aspects, the volume is about 25-50 µL. Also disclosed is a therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use in increasing retinal ganglion cell survival, optic nerve survival, and / or optic nerve regeneration in a subject, wherein the isolated nanovesicles and the statin are formulated for ophthalmic administration. In some aspects, the nanovesicles (i) maintain expression of F4 / 80and CD-11b on macrophages in the subject, (ii) comprise lysyl oxidase, and (iii) do not express CD63 or CD81, or are CD63loCD81lo. In more aspects, the nanovesicles comprise miR- 145 and / or miR-181. In more aspects, the statin is atorvastatin, rosuvastatin, simvastatin, pravastatin, fluvastatin, lovastatin, or pitavastatin. In further aspects, the statin is fluvastatin. Combinations are also of use. In some aspects, the nanovesicles are derived from a mammalian extracellular matrix. In further aspects, the mammalian extracellular matrix is a porcine, bovine, or ovine extracellular matrix. In other aspects, the mammalian extracellular matrix is a porcine extracellular matrix. In further aspects, the extracellular matrix is esophageal, urinary bladder, small intestine, dermis, umbilical cord, pericardium, cardiac, skeletal muscle, liver, kidney, lung, large intestine, or stomach extracellular matrix. In more aspects, the extracellular matrix is urinary bladder matrix (UBM) or small intestinal submucosa (SIS). In some aspects, the nanovesicles are for administration intravitreally or subretinally. In further aspects, the nanovesicles are for repeated administration to the eye of the subject. In more aspects, the nanovesicles are for weekly, bimonthly or monthly administration. In further aspects, the subject that has glaucoma. the subject has retinal ganglion cell and / or optic nerve degeneration caused by injury. In some aspects, the subject has retinal ganglion cell and / or optic nerve degeneration caused by a genetic disorder. In further aspects, the subject has optic neuropathy. In aspects, the optic neuropathy is pressure-independent glaucomatous optic neuropathy, ischemic optic neuropathy, inflammatory optic neuropathy, compressive optic neuropathy, or traumatic optic neuropathy. In some aspects, the optic neuropathy is arteritic ischemic optic neuropathy, arteritic ischemic optic neuropathy associated with giant cell arteritis, nonarteritic ischemic optic neuropathy, infiltrative optic neuropathy, infiltrative optic neuropathy associated with sarcoidosis, infectious optic neuropathy, infectious optic neuropathy associated with syphilis, infectious optic neuropathy associated with Lyme disease, infectious optic neuropathy associated with toxoplasmosis, infectious optic neuropathy associated with herpes zoster, optic neuritis from demyelinating disease, post-radiation optic neuropathy, hereditary optic neuropathy, hereditary optic neuropathy associated with dominant optic neuropathy, compressive optic neuropathy, compressive optic neuropathy associated with orbital pseudotumor, compressive optic neuropathy associated with thyroid eye disease, autoimmune optic neuropathy, or autoimmune optic neuropathy associated with Lupus. In more aspects, the isolated nanovesicles and the statin are formulated together in a pharmaceutical formulation further comprising a pharmaceutically acceptable carrier. In some aspects, the pharmaceutical formulation is a liquid pharmaceutical formulation. In other aspects, the isolated nanovesicles are formulated in a liquid formulation that does not include the statin. In further aspects, the statin is formulated in a liquid formulation that does not include the isolated nanovesicles. In some aspects, the statin is for administration in amount of about 50 µg to about 5000 µg. In more aspects, the statin is for administration in an amount of about 50 µg to about 1000 µg. In further aspects, the statin is formulated at a concentration of about 2 mM to about 15 mM and is for administration in a volume of about 10 µL to about 100 µL. In more aspects, the volume is about 25 µL to about 50 µL. In yet other aspects, the nanovesicles are formulated at a concentration of about 1x109to about 1x1011nanovesicles / mL and for administration in a volume of about 10 µL to about 100 µL. In more aspects, the volume is about 25 µL to about 50 µL. In some aspects, a therapeutically effective amount of one or more agents that lower intraocular pressure are also administered to the subject. The one or more agents can be a prostaglandin analog, a beta- adrenergic blocker, an alpha-adrenergic agonist, and / or a cholinergic agonist. Combinations are also of use. Matrix Bound Nanovesicles (MBV) Derived from an Extracellular Matrix (ECM) Nanovesicles derived from ECM (also called matrix bound nanovesicles, “MBV”) are generally described in PCT Publication Nos. WO 2017 / 151862, WO 2018 / 204848, WO 2019 / 213482, WO2021 / 81231, WO 2021 / 211885, WO 2023 / 196970, and WO 2023 / 250436, all incorporated herein by reference. It is disclosed that MBV are embedded in the extracellular matrix. These MBV can be isolated and are biologically active. MBV do not express CD63 and CD81 or are CD63loCD81loand do not contain alkaline phosphatase. The MBV can contain IL-33. These MBV can be used for therapeutic purposes. In some aspects, the MBV do not contain alkaline phosphatase, osteopontin, osteoprogeterin, complement C5, and / or c-reactive protein. An extracellular matrix is a complex mixture of structural and functional biomolecules and / or biomacromolecules including, but not limited to, structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors that surround and support cells within mammalian tissues and, unless otherwise indicated, is acellular. Generally, the disclosed MBV are embedded in any type of extracellular matrix (ECM), and can be isolated from it. Thus, MBV are not detachably present on the surface of the ECM, and are not exosomes (also known as extracellular vesicles or EV). Extracellular matrices are disclosed, for example and without limitation, in U.S. Patent Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,414; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273; 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666; each of which is incorporated by reference in its entirety). However, an ECM can be produced from any tissue, or from any in vitro source wherein the ECM is produced by cultured cells and comprises one or more polymeric components (constituents) of native ECM. ECM preparations can be considered to be “decellularized” or “acellular”, meaning the cells have been removed from the source tissue or culture. In some aspects, the ECM is isolated from a vertebrate animal, for example, from a mammalian vertebrate animal including, but not limited to, human, monkey, pig, cow, sheep, etc. For example, ECM may be isolated from pig (porcine), sheep (ovine), or cow (bovine) sources. Such ECM may be described as ECM derived from pig or “porcine ECM,” ECM derived from sheep or “ovine ECM,” or ECM derived from cow or “bovine ECM.” Accordingly, MBV can be isolated from ECM derived from a human, monkey, pig, cow or sheep. For example, MBV can be isolated from ECM derived from pig (porcine), sheep (ovine), or cow (bovine) sources. Such MBV may be described as MBV derived from porcine ECM or porcine ECM MBV, MBV derived from ovine ECM or ovine ECM MBV, or MBV derived from bovine ECM or bovine ECM MBV, for example. The ECM may be derived from any organ or tissue, including without limitation, urinary bladder, intestine (such as small intestine or large intestine), heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. Accordingly, MBV can be isolated from ECM derived from any organ or tissue, including without limitation, urinary bladder, intestine (such as small intestine or large intestine), heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In specific non-limiting examples, the extracellular matrix is isolated from esophageal tissue, urinary bladder (such as urinary bladder matrix (UBM) or urinary bladder submucosa), small intestinal submucosa (SIS), dermis, umbilical cord, pericardium, cardiac tissue, or skeletal muscle. Accordingly, MBV can be isolated from ECM derived from esophageal tissue, urinary bladder (such as urinary bladder matrix or urinary bladder submucosa), small intestinal submucosa, dermis, umbilical cord, pericardium, cardiac tissue, or skeletal muscle. For example, the ECM may be derived from UBM, and the MBV may isolated from UBM. The ECM can comprise any portion or tissue obtained from an organ, including, for example and without limitation, submucosa, epithelial basement membrane, tunica propria, etc. In one non-limiting aspect, the ECM is isolated from urinary bladder. Accordingly, MBV may be derived from urinary bladder ECM, such as urinary bladder matrix (UBM). MBV may be derived from small intestinal submucosa. MBV may be derived from esophageal ECM. MBV may derived from dermal ECM. MBV may be derived from muscle ECM. In some aspects, the ECM is from a human subject. In other aspects, the ECM is from a porcine subject. In some aspect, the ECM is not porcine ECM. In some embodiments, the ECM is not from bone. In other aspects, the MBV are derived from bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS). The ECM can be from any mammal, such as, but not limited to, a pig, cow, or sheep. The ECM may or may not include the basement membrane. In another non-limiting aspect, the ECM includes at least a portion of the basement membrane. The ECM material may or may not retain some of the cellular elements that comprised the original tissue such as capillary endothelial cells or fibrocytes. In some aspects, the ECM contains both a basement membrane surface and a non-basement membrane surface. In some aspects, the ECM is harvested from porcine urinary bladders (also known as urinary bladder matrix or UBM). Briefly, the ECM is prepared by removing the urinary bladder tissue from a mammal, such as a pig, and trimming residual external connective tissues, including adipose tissue. All residual urine is removed by repeated washes with tap water. The tissue is delaminated by first soaking the tissue in a de- epithelializing solution, for example and without limitation, hypertonic saline (e.g., 1.0 N saline), for periods of time ranging from ten minutes to four hours. Exposure to hypertonic saline solution removes the epithelial cells from the underlying basement membrane. Optionally, a calcium chelating agent may be added to the saline solution. The tissue remaining after the initial delamination procedure includes the epithelial basement membrane and tissue layers abluminal to the epithelial basement membrane. The relatively fragile epithelial basement membrane is invariably damaged and removed by any mechanical abrasion on the luminal surface. This tissue is next subjected to further treatment to remove most of the abluminal tissues but maintain the epithelial basement membrane and the tunica propria. The outer serosal, adventitial, tunica muscularis mucosa, tunica submucosa and most of the muscularis mucosa are removed from the remaining deepithelialized tissue by mechanical abrasion or by a combination of enzymatic treatment (e.g., using trypsin or collagenase) followed by hydration, and abrasion. Mechanical removal of these tissues is accomplished by removal of mesenteric tissues with, for example and without limitation, Adson-Brown forceps and Metzenbaum scissors and wiping away the tunica muscularis and tunica submucosa using a longitudinal wiping motion with a scalpel handle or other rigid object wrapped in moistened gauze. Automated robotic procedures involving cutting blades, lasers and other methods of tissue separation are also contemplated. After these tissues are removed, the resulting ECM consists mainly of epithelial basement membrane and subjacent tunica propria. In another aspect, the ECM is prepared by abrading porcine bladder tissue to remove the outer layers including both the tunica serosa and the tunica muscularis using a longitudinal wiping motion with a scalpel handle and moistened gauze. Following eversion of the tissue segment, the luminal portion of the tunica mucosa is delaminated from the underlying tissue using the same wiping motion. Care is taken to prevent perforation of the submucosa. After these tissues are removed, the resulting ECM consists mainly of the tunica submucosa (see FIG.2 of U.S. Patent No.9,277,999, which is incorporated herein by reference). ECM can also be prepared as a powder. Such powder can be made according to the method of Gilbert et al., Biomaterials 26 (2005) 1431-1435, herein incorporated by reference in its entirety. For example, UBM sheets can be lyophilized and then chopped into small sheets for immersion in liquid nitrogen. The snap frozen material can then be comminuted so that particles are small enough to be placed in a rotary knife mill, where the ECM is powdered. Similarly, by precipitating NaCl within the ECM tissue the material will fracture into uniformly sized particles, which can be snap frozen, lyophilized, and powdered. In one non-limiting aspect, the ECM is derived from small intestinal submucosa or SIS. Commercially available preparations include, but are not limited to, SURGISIS™, SURGISIS-ES™, STRATASIS™, and STRATASIS-ES™ (Cook Urological Inc.; Indianapolis, Ind.) and GRAFTPATCH™ (Organogenesis Inc.; Canton Mass.). In another non-limiting aspect, the ECM is derived from dermis. Commercially available preparations include, but are not limited to PELVICOL™ (sold as PERMACOL™ in Europe; Bard, Covington, Ga.), REPLIFORM™ (Microvasive; Boston, Mass.) and ALLODERM™ (LifeCell; Branchburg, N.J.). In another aspect, the ECM is derived from urinary bladder. Commercially available preparations include, but are not limited to UBM (ACell Corporation; Jessup, Md.). MBV can be derived from (released from) an extracellular matrix using the methods disclosed below. For example, MBV may be obtained from extracellular matrix according to the methods disclosed in U.S. Patent Application Publication No.2019 / 0117837, the contents of which are incorporated by reference herein for all purposes. In some aspects, the ECM is digested with an enzyme, such as pepsin, collagenase, elastase, hyaluronidase, and / or proteinase K, and the MBV are isolated. In other aspects, the MBV are released and separated from the ECM by changing the pH with solutions such as glycine HCL, citric acid, ammonium hydroxide, use of chelating agents such as, but not limited to, EDTA, EGTA, by ionic strength and or chaotropic effects with the use of salts such as, but not limited to potassium chloride (KCl), sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, or by exposing ECM to denaturing conditions like guanidine HCl or Urea. The MBV may be derived from extracellular matrix of urinary bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, and / or esophagus. In specific non-limiting examples, the MBV are derived from urinary bladder matrix (UBM), small intestinal submucosa (SIS), or urinary bladder submucosa (UBS). In one aspect, the MBV are derived from dermis. In another aspect, the MBV are derived from UBM. In further aspects, the MBV are derived from extracellular matrix from a mammalian vertebrate from a human, monkey, pig, cow, or sheep. In specific non-limiting examples, the MBV are from a non-human mammal. In some aspects, the MBV are not derived from bone ECM. In some aspects, the MBV are not derived from heart (cardiac) ECM. In some aspects, the MBV are not derived from heart (cardiac) ECM or bone ECM. In particular aspects, the MBV are prepared following digestion of an ECM with an enzyme, such as pepsin, elastase, hyaluronidase, proteinase K, salt solutions, and / or collagenase, or combinations thereof. The ECM can be freeze-thawed, or subject to mechanical degradation. In some aspects, expression of CD63, CD81, and / or CD9 cannot be detected on the MBV. Thus, in some aspects the MBV do not express CD63 and / or CD81 and / or CD9. In one specific example, CD63, CD81, and CD9 cannot be detected on the nanovesicles. In other aspects, the MBV have barely detectable levels of CD63, CD81, and CD9, such as that detectable by Western blot. These MBV are CD63loCD81loCD9lo. In other aspects, MBV do not express detectable levels of one or more of CD63, CD81, or CD9. In other aspects, MBV express barely detectable levels of one or more of CD63, CD81, or CD9. One of skill in the art can readily identify MBV that are CD63loand / or CD81loand / or CD9lo, using, for example, antibodies that specifically bind CD63, CD81, and CD9. A low level of these markers can be established using procedures such as fluorescent activated cell sorting (FACS) and fluorescently labeled antibodies to determine a threshold for low and high amounts of CD63, CD81, and CD9. In some examples, the disclosed MBV do not contain detectable alkaline phosphatase, osteopontin, osteoprogeterin, complement C5, and / or c-reactive protein. The disclosed MBV differ from nanovesicles, such as exosomes that may be transiently attached to the surface of the ECM due to their presence in biological fluids, as MBV in vivo are bound within the ECM and not found in biological fluids. MBV have distinctive phospholipid content, for example, in comparison to exosomes. In some aspects, the total phospholipid content of the MBV is at least about 50%, 55%, 60%, 65%, 70%, 75%, 85%, or 90%, or about 50%-90%, 50%-65%, 50%-60%, 50%-70%, 60%-70%, 60%-90%, or 70%-90% of phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination. In specific aspects, the total phospholipid content of the MBV is at least about 55% of phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination. In specific aspects, the total phospholipid content of the MBV is at least 60% of phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination. In some aspects, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio of less than 8:1 (for example, less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, or less than 2:1). In some aspects, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio in the range of 0.5-1:1, or in the range of 1:0.5-1, or in the range of 0.5-1:2, or in the range of 2:0.5-1, or in the range of 0.8-1:1, or in the range of 1:0.8-1. In one aspect, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio of about 1:1. In specific aspects, the phospholipid content of the MBV comprises a phosphatidylcholine (PC) to phosphatidyl inositol (PI) ratio of about 0.9:1. In some aspects, the total phospholipid content of the MBV is about 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4% or less, or about 5%-10%, 5%-15%, 10%-15%, or 8%-12% of sphingomyelin (SM). In specific aspects, the total phospholipid content of the MBV is about 10% or less of sphingomyelin (SM). In some aspects, the total phospholipid content of the is about 15% or less of sphingomyelin (SM), 14% or less of sphingomyelin, 13% or less of sphingomyelin, about 12% or less of sphingomyelin, 11% or less of sphingomyelin, 10% or less of sphingomyelin, about 9% or less of sphingomyelin, 8% or less of sphingomyelin, 7% or less of sphingomyelin, about 6% or less of sphingomyelin, 5% or less of sphingomyelin, or 4% or less of sphingomyelin. In some aspects, the total phospholipid content of the MBV is about 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% or less, or about 10%-20%, 15%-20%, 14%-18%, or 12%-16% of phosphatidylethanolamine (PE). In specific aspects, the total phospholipid content of the MBV is 20% or less of phosphatidylethanolamine (PE). In some aspects, the total phospholipid content of the MBV is about 5%, 10%, 12%, 15%, 18%, 20%, 25%, or 30% or greater, or about 5%-30%, 10%-20%, 10-25%, 15%-25%, or 12%-18% of phosphatidylinositol (PI). In specific aspects, MBV include a phospholipid content of about 15% or greater of phosphatidylinositol (PI). In specific aspects, the total phospholipid content of the MBV comprises about 15% or more phosphatidylinositol, about 20% or less phosphatidylethanolamine, and about 10% or less sphingomyelin. In specific aspects, the total phospholipid content of the MBV is about 15% or more phosphatidylinositol and about 20% or less phosphatidylethanolamine. In specific aspects, the total phospholipid content of the MBV is about 15% or more phosphatidylinositol and about 10% or less sphingomyelin. In specific aspects, the total phospholipid content of the MBV comprises about 20% or less phosphatidylethanolamine and about 10% or less sphingomyelin. In specific aspects, the total phospholipid content of the MBV is more than about 15% phosphatidylinositol, about 20% or less phosphatidylethanolamine, about 10% or less sphingomyelin, and at least about 55% of phosphatidylinositol and phosphatidylcholine in combination. In one aspect, the total phospholipid content of the MBV is at least about 55% phosphatidylcholine (PC) and phosphatidyl inositol (PI) in combination and about 10% or less sphingomyelin (SM). In specific aspects, the total phospholipid content of the MBV is at least about 55% of phosphatidylinositol and phosphatidylcholine in combination and more than about 15% phosphatidylinositol. In specific aspects, the total phospholipid content of the MBV is about 55% of phosphatidylinositol and phosphatidylcholine in combination and about 20% or less phosphatidylethanolamine. The MBV may also comprise lysyl oxidase (Lox). Generally, nanovesicles derived from the ECM have a higher Lox content than exosomes. Lox is expressed on the surface of MBV. Nano-LC MS / MS proteomic analysis can be used to detect Lox proteins. Quantification of Lox can be performed (see, e.g., Hill RC, et al., Mol Cell Proteomics.2015;14(4):961-73, incorporated herein by reference in its entirety). In some aspects, MBV are characterized by one or more of the following features: do not contain detectable levels of alkaline phosphatase; do not contain detectable levels of osteopontin; do not contain detectable levels of osteoprogeterin; do not contain detectable levels of complement C5; and / or do not contain detectable levels of c-reactive protein. In some aspects, MBV are characterized by one or more of the following features: contain low or do not contain detectable levels of epithelial cell adhesion molecule (EpCAM), contain low or do not contain detectable levels of Annexin (ANX)A5, contain low or do not contain detectable levels of tumor susceptibility gene (TSG)101; contain low or do not contain detectable levels of flotillin (FLOT)1; contain low or do not contain detectable levels of intracellular adhesion molecule (ICAM1); contain low or do not contain detectable levels of glolgi matrix protein (GM)130; and / or contain low or do not contain detectable levels of ALG-2-interacting protein (ALIX). In one embodiment, MBV are characterized by low or undetectable levels of ANXA5, TSG101, and ICAM1. In one embodiment, MBV are characterized by low or undetectable levels of CD81, CD63, ANXA5, TSG101, and ICAM1. In certain aspects, the MBV comprise one or more miRNA. In specific non-limiting examples, the MBV comprise one, two, or all three of miR-143, miR-145 and miR-181. MiR-143, miR-145 and miR-181 are known in the art. The miR-145 nucleic acid sequence is provided in MiRbase Accession No. MI0000461, incorporated herein by reference. A miR-145 nucleic acid sequence is CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCU GGAAAUACUGUUCUUGAGGUCAUGGUU (SEQ ID NO: 1). An miR-181 nucleic acid sequence is provided in miRbase Accession No. MI0000269, incorporated herein by reference. A miR-181 nucleic acid sequence is: AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGU UUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA (SEQ ID NO: 2). The miR-143 nucleic acid sequence is provided in NCBI Accession No. NR_029684.1, March 30, 2018, incorporated herein by reference. A DNA encoding an miR-143 nucleic acid sequence is: GCGCAGCGCC CTGTCTCCCA GCCTGAGGTG CAGTGCTGCA TCTCTGGTCA GTTGGGAGTC TGAGATGAAG CACTGTAGCT CAGGAAGAGA GAAGTTGTTC TGCAGC (SEQ ID NO: 3). Following administration, the MBV maintain expression of F4 / 80 (a macrophage marker) and CD- 11b on macrophages in the subject. MBV treated macrophages are predominantly F4 / 80 + Fizz1 + indicating an M2 phenotype. The MBV disclosed herein can be formulated into pharmaceutical compositions for pharmaceutical delivery. Isolation of MBV from ECM MBV can be produced from ECM that is produced by any cells of interest, or they be isolated from a commercial source of ECM, as described supra. The MBV can be produced from the same species as, or a different species than, the subject being treated. In some aspects, these methods include digesting the ECM with an enzyme to produce digested ECM. In specific aspects, the ECM is digested with one or more of pepsin, elastase, hyaluronidase, collagenase a metalloproteinase, and / or proteinase K, or combinations thereof. In a specific non-limiting example, the ECM is digested with only elastase and / or a metalloproteinase. In another non-limiting example, the ECM is not digested with collagenase and / or trypsin and / or proteinase K. In other aspects, the ECM is treated with a detergent. In further aspects, the method does not include the use of enzymes. In specific non-limiting examples, the method utilizes chaotropic agents or ionic strength to isolate MBV such as salts, such as potassium chloride. In additional aspects, the ECM can be manipulated to increase MBV content prior to isolation of MBV. Techniques for isolating MBV from ECM are described, for example, in U.S. Patent Application Publication No. 2019 / 0117837, the contents of which are incorporated by reference herein for all purposes. Techniques for isolating MBV are also disclosed in Quijano et al., Tissue Eng Part C Methods.2020 Oct;26(10):528-540, also incorporated by reference herein. In some aspects, the ECM is digested with an enzyme. The ECM can be digested with the enzyme for about 12 to about 48 hours, such as about 12 to about 36 hours. The ECM can be digested with the enzyme for about 12, about 24 about 36 or about 48 hours. In one specific non-limiting example, the ECM is digested with the enzyme at room temperature. However, the digestion can occur at about 4 ºC, or any temperature between about 4ºC and 25ºC. Generally, the ECM is digested with the enzyme for any length of time, and at any temperature, sufficient to remove collagen fibrils. The digestion process can be varied depending on the tissue source. Optionally, the ECM is processed by freezing and thawing, either before or after digestion with the enzyme. The ECM can be treated with detergents, including ionic and / or non-ionic detergents. The digested ECM is then processed, such as by centrifugation, to isolate a fibril-free supernatant. In some aspects the digested ECM is centrifuged, for example, for a first step at about 300 to about 1000g. Thus, the digested ECM can be centrifuged at about 400g to about 750g, such as at about 400g, about 450g, about 500g or about 600g. This centrifugation can occur for about 10 to about 15 minutes, such as for about 10 to about 12 minutes, such as for about 10, about 11, about 12, about 14, about 14, or about 15 minutes. The supernatant including the digested ECM is collected. In some aspects, the MBV comprise Lox. In some aspects, methods for isolating such MBV include digesting the extracellular matrix with elastase and / or metalloproteinase to produce digested extracellular matrix, centrifuging the digested extracellular matrix to remove collagen fibril remnants and thus to produce a fibril-free supernatant, centrifuging the fibril-free supernatant to isolate the solid materials, and suspending the solid materials in a carrier. In some aspects, digested ECM also can be centrifuged for a second step at about 2000g to about 3000g. Thus, the digested ECM can be centrifuged at about 2,500g to about 3,000g, such as at about 2,000g, 2,500g, 2,750g or 3,000g. This centrifugation can occur for about 20 to about 30 minutes, such as for about 20 to about 25 minutes, such as for about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29 or about 30 minutes. The supernatant including the digested ECM is collected. In additional aspects, the digested ECM can be centrifuged for a third step at about 10,000 to about 15,000g. Thus, the digested ECM can be centrifuged at about 10,000g to about 12,500g, such as at about 10,000g, 11,000g or 12,000g. This centrifugation can occur for about 25 to about 40 minutes, such as for about 25 to about 30 minutes, for example for about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39 or about 40 minutes. The supernatant including the digested ECM is collected. One, two or all three of these centrifugation steps can be independently utilized. In some aspects, all three centrifugation steps are utilized. The centrifugation steps can be repeated, such as 2, 3, 4, or 5 times. In one aspect, all three centrifugation steps are repeated three times. In some aspects, the digested ECM is centrifuged at about 500g for about 10 minutes, centrifuged at about 2,500 g for about 20 minutes, and / or centrifuged at about 10,000g for about 30 minutes. These step(s), such as all three steps are repeated 2, 3, 4, or 5 times, such as three times. Thus, in one non-limiting example, the digested ECM is centrifuged at about 500g for about 10 minutes, centrifuged at about 2,500 g for about 20 minutes, and centrifuged at about 10,000g for about 30 minutes. These three steps are repeated three times. Thus, a fibril-free supernatant is produced. The fibril-free supernatant is then centrifuged to isolate the MBV. In some aspects, the fibril-free supernatant is centrifuged at about 100,000g to about 150,000g. Thus, the fibril-free supernatant is centrifuged at about 100,000g to about 125,000g, such as at about 100,000g, about 105,000g, about 110,000g, about 115,000g or about 120,000g. This centrifugation can occur for about 60 to about 90 minutes, such as about 70 to about 80 minutes, for example for about 60, about 65, about 70, about 75, about 80, about 85 or about 90 minutes. In one non-limiting example, the fiber-free supernatant is centrifuged at about 100,000g for about 70 minutes. The solid material is collected, which is the MBV. These MBV then can be re-suspended in any carrier of interest, such as, but not limited to, a buffer. In further aspects the ECM is not digested with an enzyme. In these methods, ECM is suspended in an isotonic saline solution, such as phosphate buffered saline. Salt is then added to the suspension so that the final concentration of the salt is greater than about 0.1 M. The concentration can be, for example, up to about 3 M, for example, about 0.1 M salt to about 3 M, or about 0.1 M to about 2M. The salt can be, for example, about 0.1M, 0.15M, 0.2M, 0.3M, 0.4 M, 0.7 M, 0.6 M, 0.7 M, 0.8M., 0.9M, 1.0 M, 1.1 M, 1.2 M, 1.3 M, 1.4 M, 1.5M, 1.6 M, 1.7 M, 1.8M, 1.9 M, or 2M. In some non-limiting examples, the salt is potassium chloride, sodium chloride or magnesium chloride. In other aspects, the salt is sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, a sodium salt, a lithium salt, a cesium salt or a calcium salt. In some aspects, the ECM is suspended in the salt solution for about 10 minutes to about 2 hours, such as about 15 minutes to about 1 hour, about 30 minutes to about 1 hour, or about 45 minutes to about 1 hour. The ECM can be suspended in the salt solution for about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115 or 120 minutes. The ECM can be suspended in the salt solution at temperatures from 4°C to about 50°C, such as, but not limited to about 4°C to about 25°C or about 4°C to about 37°C. In a specific non-limiting example, the ECM is suspended in the salt solution at about 4°C. In other specific non-limiting examples, the ECM is suspended in the salt solution at about 22ºC or about 25°C (room temperature). In further non-limiting examples, the ECM is suspended in the salt solution at about 37°C. In some aspects, the method includes incubating an extracellular matrix at a salt concentration of greater than about 0.4 M; centrifuging the digested extracellular matrix to remove collagen fibril remnants, and isolating the supernatant; centrifuging the supernatant to isolate the solid materials; and suspending the solid materials in a carrier, thereby isolating MBV from the extracellular matrix. Following incubation in the salt solution, the ECM is centrifuged to remove collagen fibrils. In some aspects, digested ECM also can be centrifuged at about 2000g to about 5000g. Thus, the digested ECM can be centrifuged at about 2,500g to about 4,500g, such as at about 2,500g, about 3,000g, 3,500, about 4,000g, or about 4,500g. In one specific non-limiting example, the centrifugation is at about 3,500g. This centrifugation can occur for about 20 to about 40 minutes, such as for about 25 to about 35 minutes, such as for about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33 about 34 or about 35 minutes. The supernatant is then collected. In additional aspects, the supernatant then can be centrifuged for a third step at about 100,000 to about 150,000g. Thus, the digested ECM can be centrifuged at about 100,000g to about 125,000g, such as at about 100,000g, 110,000g or 120,000g. This centrifugation can occur for about 30 minutes to about 2.5 hour, such as for about 1 hour to about 3 hours, for example for about 30 minutes, about 45 minutes, about 60 minutes, about 90 minutes, or about 120 minutes (2 hours). The solid materials are collected and suspended in a solution, such as buffered saline, thereby isolating the MBV. In yet other aspects, the ECM is suspended in an isotonic buffered salt solution, such as, but not limited to, phosphate buffered saline. Centrifugation or other methods can be used to remove large particles (see below). Ultrafiltration is then utilized to isolate MBV from the ECM, particles between about 10 nm and about 10,000 nm, such as between about 10 and about 1,000 nm, such as between about 10 nm and about 300 nm. In specific non-limiting examples, the isotonic buffered saline solution has a total salt concentration of about 0.164 mM, and a pH of about 7.2 to about 7.4. In some aspects, the isotonic buffered saline solution includes 0.002 M KCl to about 0.164 M KCL, such as about 0.0027 M KCl (the concentration of KCL in phosphate buffered saline). This suspension is then processed by ultracentrifugation. Following incubation in the isotonic buffered salt solution, the ECM is centrifuged to remove collagen fibrils. In some aspects, digested ECM also can be centrifuged at about 2000g to about 5000g. Thus, the digested ECM can be centrifuged at about 2,500g to about 4,500g, such as at about 2,500g, about 3,000g, 3,500, about 4,000g, or about 4,500g. In one specific non-limiting example, the centrifugation is at about 3,500g. This centrifugation can occur for about 20 to about 40 minutes, such as for about 25 to about 35 minutes, such as for about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33 about 34 or about 35 minutes. Microfiltration and centrifugation can be used and combined to remove large molecular weight materials from the suspension. In one aspect, large size molecule materials, such as more than 200 nm are removed using microfiltration. In another aspect, large size materials are removed by the use of centrifugation. In a third aspect both microfiltration and ultracentrifugation are used to remove large molecular weight materials. Large molecular weight materials are removed from the suspended ECM, such as materials greater than about 10,000 nm, greater than about 1,000 nm, greater than about 500 nm, or greater than about 300 nm. The effluent for microfiltration or the supernatant is then subjected to ultrafiltration. Thus, the effluent, which includes particle of less than about 10,000 nm, less than about 1,000 nm, less than about 500 nm, or less than about 300 nm is collected and utilized. This effluent is then subjected to ultrafiltration with a membrane with a molecular weight cutoff (MWCO) of 3,000 to 100,000. Statins Statins are competitive inhibitors of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) reductase, a key enzyme in the cholesterol biosynthesis pathway. This inhibition depletes cholesterol in liver cells, which causes the liver cells to remove cholesterol from the blood. Rodenburg, J. et al. Pediatr. Endocrinol. Rev., 2004, 2(Suppl 1):171-80; Gylling, H. et al. Curr. Opin. Investig. Drugs., 2006 March, 7(3):214-8. Statins slow down the body's production of cholesterol and inhibit the bioconversion of hydroxymethylglutaryl- coenzyme A to mevalonic acid catalyzed by the enzyme HMG-CoA reductase. Statins are widely prescribed for treatment of hypercholesterolemia. Statins can reduce LDL cholesterol by up to 40 percent. Statins may also help the body reabsorb cholesterol from plaques that accumulate on the walls of the arteries, thus making them less likely to cause complications such as heart attack or stroke. The disclosed methods include the administration of a statin to the subject. A statin includes pharmaceutically acceptable salts, esters and enantiomers thereof. Also disclosed are pharmaceutical compositions that include a statin and nanovesicles derived from an extracellular matrix, for use in increasing retinal ganglion cell and / or optic nerve survival and / or regeneration in a subject. The statin is administered, for example, to the eye. Administration may be by injection, e.g., through the sclera into the intravitreal or subretinal space. In an aspect, the statin can include, or is, fluvastatin. Pharmaceutically acceptable salts, enantiomers and esters are also of use. In another aspect, the statin can include, or is, atorvastatin. As used herein, the term “atorvastatin” refers to a compound known in the art as atorvastatin, which is also know by the brand name LIPITOR®, and pharmaceutically acceptable salts and esters thereof. Atorvastatin may be formulated for delivery to the eye, see Yadav et al., Drug Del. Trans. Res.10: 919-944, 2020. Pharmaceutically acceptable salts and esters are also of use. In a further aspect, the statin can include, or is, lovastatin. As used herein, the term “lovastatin” refers to a compound known in the art as lovastatin, which is also known by the brand names ALTOCOR®or MEVACOR®, and pharmaceutically acceptable salts and esters thereof. In another aspect, the statin can include, or is, pravastatin. As used herein, the term “pravastatin” refers to a compound known in the art as pravastatin, which is also known by the brand name PRAVACHOL®, and pharmaceutically acceptable salts and esters thereof. In yet another aspect, the statin can include, or is, rosuvastatin, which is also known by the brand name CRESTOR®, and pharmaceutically acceptable salts and esters thereof. In an aspect, the statin can include, or is, pitavastatin. As used herein, the term “pitavastatin” refers to a compound known in the art as pitavastatin, and pharmaceutically acceptable salts and esters thereof. Pitavastatin is also known by the brand names LIVALO®, ZYPITAMAG®, and LIVAZO®. In a further aspect, the statin can include, or is, tenivastatin. As used herein, the term “tenivastatin” refers to a compound known in the art as tenivastatin, and pharmaceutically acceptable salts and esters thereof. In an aspect, the statin can include, or is, simvastatin. As used herein, the term “simvastatin” refers to a compound known in the art as simvastatin, which is also known by the brand name ZOCOR®, and pharmaceutically acceptable salts and esters thereof. In another aspect, the statin can include, or is, rivastatin. As used herein, the term “rivastatin” refers to a compound known in the art as rivastatin, and pharmaceutically acceptable salts and esters thereof. In a further aspect, the statin can include, or is, mevastatin. As used herein, the term “mevastatin” refers to a compound known in the art as mevastatin and pharmaceutically acceptable salts and esters thereof. In yet another aspect, the statin can include, or is, cerivastatin. As used herein, the term “cerivastatin” refers to a compound known in the art as cerivastatin, and pharmaceutically acceptable salts and esters thereof. Combinations of statins also are of use. Compositions of use in the disclosed methods can include a therapeutically effective amount of more than one statin, such as 2 different statins. However, combinations of 3, 4, or 5 statins are also of use. Enantiomers and salts are also included. Methods and Compositions for Increasing RGC Survival, RGC Axon Regeneration, Optic Nerve Survival and Regeneration Methods are disclosed herein for increasing RGC survival in a subject in need thereof. Methods are disclosed herein for increasing RGC axon regeneration in a subject in need thereof. Methods are also disclosed for increasing optic nerve survival and / or regeneration in a subject in need thereof. These methods include selecting a subject in need thereof, and locally administering to an eye of the subject a therapeutically effective amount of a combination comprising (1) isolated nanovesicles derived from an extracellular matrix and (2) a statin or a salt or ester thereof. In some aspects, the nanovesicles (i) maintain expression of F4 / 80 and CD-11b on macrophages in the subject, (ii) comprise lysyl oxidase, and (iii) do not express CD63 or CD81, or are CD63loCD81lo. In some aspects, the statin is fluvastatin. The use of a combination of a therapeutically effective amount of isolated nanovesicles derived from extracellular matrix (also referred to herein as “MBV” or “matrix bound vesicles”), and a therapeutically effective amount of a statin, produces a synergistic effect in the methods disclosed herein. Also disclosed herein is a combination therapy for use in increasing RGC survival in a subject. In addition, disclosed herein is a combination therapy for use in increasing RGC axon regeneration in a subject. Further disclosed is a combination therapy for use in increasing optic nerve survival and / or regeneration in a subject. These combination therapies include the use of a therapeutically effective amount of a (1) isolated nanovesicles derived from an extracellular matrix and (2) a statin (or salts or esters thereof). The statin and the nanovesicles may be formulated together in a single composition for administration locally to the eye. However, the methods and uses disclosed herein also contemplate that the statin and the nanovesicles are administered separately as two separate compositions, where each composition is formulated for administration locally to the eye. The use of a combination of a therapeutically effective amount of MBV, and a therapeutically effective amount of a statin, produces a synergistic effect in the methods of treatment or uses disclosed herein in comparison to either of the agents, e.g., MBV alone, or e.g., statin alone, administered alone, e.g., not as a combination therapy. The subject can be a veterinary subject or a human. The subject can be a mammal. The subject can be avian or a domestic pet, such as a cat, dog or rabbit. The subject can be a non-human, primate, or livestock, including swine, ruminants, horses, and poultry. In certain examples, the subject receiving the combination therapy is a human. The methods include selecting a subject in need of treatment to increase RGC survival, RGC axon regeneration, optic nerve survival, and / or optic nerve regeneration, and administering to the subject a therapeutically effective amount of a combination therapy comprising a therapeutically effect amount of (1) MBVs and (2) a statin or a pharmaceutically acceptable salt or prodrug thereof. The MBVs can be derived from the same or a different species than the subject in need of increased retinal ganglion cell survival. In one embodiment, the subject is human, and the MBVs are derived from bovine tissue. In some aspects, the subject has glaucoma. The subject can have open angle glaucoma, closed angle glaucoma, or normotensive glaucoma. The glaucoma can be a primary glaucoma or a secondary glaucoma. Any of these subjects can be selected for treatment. Intraocular pressure (IOP), the fluid pressure within the eye, can be measured in units of millimeters of mercury (mmHg) or kilopascals (kPa). Normal intraocular pressure is typically considered to be between 10 mmHg and 20 mmHg. The average value of intraocular pressure is 15.5 mmHg with fluctuations of about 2.75-3.50 mmHg. Elevated intraocular pressure (above 21 mmHg or 2.8 kPa) is the most important and only modifiable risk factor for glaucoma. In some aspects a subject is selected that has elevated intraocular pressure. In other aspects a subject is selected who has less than elevated intraocular pressure, but who has evidence of glaucomatous damage. For example, the subject may have cupping of the optic disc and an increased or increasing cup-to-disk ratio (for example greater than 0.3, 0.5 or 0.7). In other aspects the subject may have a slightly elevated IOP in the presence of glaucomatous optic nerve damage (such as a progression in the cup-to-disc ratio). Testing for glaucoma can include measurements of the intraocular pressure, such as using tonometry, anterior chamber angle examination or gonioscopy, and examination of the optic nerve to identify damage, change in the cup-to-disc ratio, rim appearance and detection of vascular changes. Visual field testing can be performed. The retinal nerve fiber layer can be assessed with imaging techniques such as optical coherence tomography, scanning laser polarimetry, and / or scanning laser ophthalmoscopy (Heidelberg retinal tomogram). Additional tests include tonometry, ophthalmoscopy, perimetry, gonioscopy, pachymetry, and nerve fiber analysis. These methods can be performed in order to select a subject for treatment according to the methods disclosed herein. In other aspects, the subject to be treated according to the methods disclosed herein has RGC degeneration and / or optic nerve degeneration caused by injury. In further aspects, the subject has RGC or optic nerve degeneration caused by a genetic disorder. In yet additional aspects, the subject to be treated according to the methods disclosed herein has optic neuropathy. For example, the optic neuropathy can be pressure-independent glaucomatous optic neuropathy, ischemic optic neuropathy, inflammatory optic neuropathy, compressive optic neuropathy, or traumatic optic neuropathy. In other non-limiting examples, the optic neuropathy can be arteritic ischemic optic neuropathy, arteritic ischemic optic neuropathy associated with giant cell arteritis, nonarteritic ischemic optic neuropathy, infiltrative optic neuropathy, infiltrative optic neuropathy associated with sarcoidosis, infectious optic neuropathy, infectious optic neuropathy associated with syphilis, infectious optic neuropathy associated with Lyme disease, infectious optic neuropathy associated with toxoplasmosis, infectious optic neuropathy associated with herpes zoster, optic neuritis from demyelinating disease, post- radiation optic neuropathy, hereditary optic neuropathy, hereditary optic neuropathy associated with dominant optic neuropathy, compressive optic neuropathy, compressive optic neuropathy associated with orbital pseudotumor, compressive optic neuropathy associated with thyroid eye disease, autoimmune optic neuropathy, or autoimmune optic neuropathy associated with Lupus. The subject can have ocular phototoxicity, specifically photic retinopathy, also called photic maculopathy. In some aspects, the photic retinopathy is caused by exposure to the sun. In other aspects, the photic retinopathy is caused by exposure to the artificial light. The subject can be at risk for photic retinopathy, also known as photic maculopathy. For example, the subject can be undergoing laser procedures to the eye, or can be a welder. The subject can have retinal degeneration and / or optic nerve degeneration resulting from trauma, such as exposure to an explosive device. The subject can have had a retinal laser procedure. In further aspects, the subject has a disease in which neuronal (i.e., non-photoreceptor) degeneration occurs. These include, but are not limited to, glaucoma, retinal artery occlusions, and retinal vein occlusions. In some aspects, administration can be systemic. Exemplary routes of administration include, but are not limited to, intravenous, intraperitoneal, or subcutaneous administration. In some aspects, administration can be local to the eye, such as using intravitreal or subretinal administration. Administration can also be to the anterior chamber of the eye. In other aspects, administration can be to the vitreous of the eye. In some aspects, administration to the vitreous of the eye is accomplished using intravitreal injection, pumps or implants. In some aspects, administration to the eye is by injection. For example, intraocular injection may be achieved by inserting a needle through the sclera, for example, into the intravitreal or subretinal space; as such, the therapeutic agents are administered directly into the eye. In some examples, local administration to the eye may be achieved by instillation of ophthalmic drops or ointment topically to the surface of the eye, for example, comprising a statin or comprising MBV, or both; in such cases, the active ingredients diffuse through the cornea and / or sclera into the eye and therefore reach the interior of the eye indirectly. The statin can be mevastatin, lovastatin, pravastatin, simvastatin, fluvastatin, cerivastatin, atorvastatin, tenivastatin, rosuvastatin, pitavastatin and combinations thereof. In some examples, the statin is can be atorvastatin, rosuvastatin, simvastatin, pravastatin, fluvastatin, lovastatin, and Pitavastatin. The statin can be, for example, fluvastatin. The statin can be, for example, pravastatin. The statin can be, for example, atorvastatin. Combinations are also of use. The statin can be delivered locally to the eye of the subject. In some aspects, the dose of the statin used in the methods and compositions described herein is according to the dose used in Li et al. Cell Rep, 2016.16(2): p.545-558. Solid lipid nanoparticles or contact lenses may be used according to the methods disclosed herein for delivery of atorvastatin as eye drops (See, e.g., Yadav et al., Drug. Deliv. Trans. Res. 10: 919-944, 2020; Pereira-da-Mata et al., J. Control. Release 348: 431-443, 2022. The compositions that include a statin can be formulated as topical ophthalmic suspensions or solutions, with a pH of from about 4 to about 8. The establishment of a specific dosage regimen for each individual is left to the discretion of the clinicians. The active ingredient (e.g., statin) will normally be contained in these formulations in an amount from about 0.01% to about 10% by weight of the composition or formulation, such as from about 0.01% to about 5% by weight, and such as in an amount from about 0.05% to about 2%, for example in an amount of from about 0.1 to about 1.0% by weight. The dosage form may be a solution or suspension microemulsion. In aspects, for topical application, 1 to 2 drops of these formulations would be delivered to the surface of the eye from about 1 to about 4 times per day according to the discretion of a skilled clinician. The compositions can be administered as a single dose or as multiple doses. The compositions can be administered for one day or multiple days and the composition of the present invention can be administered for consecutive days or can be administered on a schedule where a treatment occurs on one day but not on the next day. In other words, the treatment can occur on non- consecutive days. The treatment can occur for at least two consecutive days, at least three consecutive days, or more. Furthermore, multiple dosages can occur on the same day, over consecutive days, or over non- consecutive days. Dosing regimens and formulations of statins are disclosed, for example, in U.S. Published Patent Application No.2005 / 0239871 A1, incorporated herein by reference. After acute optic nerve injury, intravitreal injections of statin can maximize the effects on RGC protection and optic nerve regeneration. In other cases such as chronic ocular diseases, at the early stages of neurodegeneration, statin should be intravitreally injected or administrated on the surface of the eye. Without being bound by theory, after acute optic nerve injury, intravitreal injections of a statin can maximize the effects on RGC protection and optic nerve regeneration. In other cases such as chronic ocular diseases, at the early stages of neurodegeneration, statin can be administered to the eye, such as by intravitreally injection or topical administration to the eye. In some aspects, of statins are administered at about 100 mM to about 300mM. In other aspects, statins are administered at about 100, 150, 175, 200, 250 or 300 mM. In some embodiments, the statin is administered to the eye, e.g., via intraocular injection, in an amount of 50 µg to about 5000 µg per administration. For example, the statin is administered in an amount of about 50 µg to about 1000 µg, or 50 µg to about 500 µg, or 100 µg to about 400 µg, or 200 µg to about 600 µg, or about 500 µg to about 1000 µg, or about 1000 µg to about 2000 µg. The statin may be formulated in a liquid, e.g., aqueous, formulation, or as an oil-based formulation, for example, or as an oil- in-water emulsion, for example. The volume of the dose should be selected so that administration does not cause an undue increase in ocular pressure. For example, the volume of the formulation to be administered to the eye may be in the range of, for example, about 25 µL to about 100 µL, such as about 50 µL to about 100 µL, or such as about 25 µL to about 50 µL, or such as about 25 µL to about 75 µL. For example, the volume may be about 50 µL. Accordingly, the formulation should be prepared to a suitable concentration to deliver the desired dose in the desired volume. For example, the concentration of the statin in the formulation may be about 1 to about 100 mM. For example, the concentration of the statin in the formulation may be about 1 mM to about 50 mM. For example, the concentration of the statin in the formulation may be about 50 mM to about 100 mM. For example, the concentration of the statin in the formulation may be about 100 mM to about 200 mM. For example, the concentration of the statin in the formulation may be about 200 mM to about 300 mM. For example, the concentration of the statin in the formulation may be about 1 mM to about 20 mM. For example, the concentration of the statin in the formulation may be about 5 mM to about 15 mM. For example, the concentration of the statin in the formulation may be about 1 mM to about 20 mM. For example, the concentration of the statin in the formulation may be about 20 mM to about 50 mM. In some aspects, the statin and the MBV are administered locally to the eye of the subject. Thus, the disclosed compositions, including a statin and / or the MBV, can be formulated for local delivery to the eye. The therapeutically effective amount of the MBV and the statin can be included in the same composition. The therapeutically effective amount of the MBV can be in a first composition, and the therapeutically effective amount of the statin can be in second composition. In aspects, the statin can be formulated for deliver in an eye drop or a contact lens. In more aspects, the MBV can be formulated for injection into the eye. In further aspects, the statin can be formulated for injection into the eye. The MBV and the statin can be injected into the eye in separate compositions. The MBV and the statin can be injected into the eye in a single composition. The injection(s) can be an intravitreal injection. The method can include administration of both the first composition and the second composition, in a dosing schedule such that the MBV and the statin are present together in the eye, such that they act synergistically. The compositions can be administered simultaneously or in a time frame such that the active ingredients are both resident in the eye at the same time, e.g., by consecutive administration, such that one composition is administered first, followed by the second composition, e.g., within about an hour or less, or within about 30 minutes or less. In certain embodiments, the consecutive administration is by intraocular injection for both the MBV and for the statin. In other embodiments, the consecutive administration is by intraocular injection for the MBV and by instillation or ophthalmic drops for the statin. In some aspects, a pharmaceutical formulation can be a liquid pharmaceutical formulation. In more aspects, the isolated nanovesicles are formulated in a liquid formulation that does not include the statin. In further aspects, the statin is formulated in a liquid formulation that does not include the isolated nanovesicles. The administration may be a single dose schedule or a multiple dose schedule to ultimately deliver the therapeutically effective amount of the combination therapy, specifically the MBV and the statin. The doses can be intermittent. Moreover, the subject may be administered as many doses as appropriate. The MBVs and the statin do not need to be administered at the same time or in the same composition. In some aspects, the effective amount of the statin is administered to the subject, and the therapeutically effective amount of the MBV is administered to the subject, within about 2 to about 22 hours, such as within about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 or 22 hours, such as about 2 to about 4 hours, about 2 to about 8 hours, about 2 to about 12 hours, or about 2 to about 16 hours. However, the effective amount of the statin and the MBV can be administered, for example, within about 1 minute to about an hour, such as within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, or 60 minutes. In aspects, the effective amount of the statin and the MBV can be administered, for example, within about 2 minutes to about 20 minutes, about 2 to about 15 minutes, about 2 to about 10 minutes, or about 2 to about 5 minutes. Any range within these values is contemplated. In some aspects, the method can include administering to the subject a single pharmaceutical composition that includes an effective amount of MBV and an effective amount of the statin. Thus, a pharmaceutical composition is provided that an effective amount of MBV and an effective amount of the statin. In other aspects, the method can include administering to the subject a first pharmaceutical composition that includes an effective amount of MBV and a second pharmaceutical composition that includes an effective amount of the statin. Individual doses are typically not less than an amount required to produce a measurable effect on the subject, and may be determined based on the pharmacokinetics and pharmacology for absorption, distribution, metabolism, and excretion ("ADME") of the subject composition or its by-products, and thus based on the disposition of the composition within the subject. This includes consideration of the route of administration as well as dosage amount, which can be adjusted for local and systemic (for example, intravenous) applications. Effective amounts of dose and / or dose regimen can readily be determined empirically from preclinical assays, from safety and escalation and dose range trials, individual clinician- patient relationships, as well as in vitro and in vivo assays. Generally, these assays will evaluate the retinal ganglion cells, or expression of a biological component (cytokine, specific inflammatory cell, microglia, etc.) that affects the degeneration of these cells. A therapeutically effective amount of MBVs can be suspended in a pharmaceutically acceptable carrier, for example, in an isotonic buffer solution at a pH of about 3.0 to about 8.0, preferably at a pH of about 3.5 to about 7.4, 3.5 to 6.0, or 3.5 to about 5.0. In some embodiments, the pH is about 7.0 to about 7.4, or about 7.2 to about 7.3. Useful buffers include sodium citrate-citric acid and sodium phosphate- phosphoric acid, and sodium acetate / acetic acid buffers. Other agents can be added to the compositions, such as preservatives and anti-bacterial agents, and optionally the statin. These compositions can be administered locally to the eye, such as by intravitreous or subretinal intraocular injection. A therapeutically effective amount of a statin (e.g., fluvastatin, atorvastatin, or pravastatin) can be suspended in a pharmaceutically acceptable carrier, for example, in an isotonic buffer solution at a pH of about 3.0 to about 8.0, preferably at a pH of about 3.5 to about 7.4, 3.5 to 6.0, or 3.5 to about 5.0. In some embodiments, the pH is about 7.0 to about 7.4, or about 7.2 to about 7.3. Combinations of statins also can be used. Useful buffers include sodium citrate-citric acid and sodium phosphate-phosphoric acid, and sodium acetate / acetic acid buffers. Other agents can be added to the compositions, such as preservatives and anti-bacterial agents. These compositions can be administered locally to the eye, such as by intravitreous or subretinal intraocular injection. The compositions also can be administered topically, such as in eye drops or using a contact lens. The MBVs and the statin can be administered in the same composition, or as two separate compositions. The MBVs and the statin can be administered according to different times and dosing schedules as needed to provide the patient with a therapeutically effective amount of the combination therapy. The compositions can be ophthalmic formulations for delivery to the eye (e.g., topically, intracamerally, or via an implant) for delivery to the eye. The compositions may include ophthalmologically acceptable preservatives, viscosity enhancers, penetration enhancers, buffers, sodium chloride, and water to form an aqueous, sterile ophthalmic suspension or solution. Ophthalmic solution formulations may be prepared by dissolving the active ingredient in a physiologically acceptable isotonic aqueous buffer. Further, the ophthalmic solution may include an ophthalmologically acceptable surfactant to assist in dissolving the active ingredient. Furthermore, the ophthalmic solution may contain an agent to increase viscosity, such as hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropylmethylcellulose, methylcellulose, polyvinylpyrrolidone, or the like. Gelling agents can also be used, including, but not limited to, gellan and xanthan gum. In order to prepare sterile ophthalmic ointment formulations, the active ingredient is combined with a preservative in an appropriate vehicle, such as, mineral oil, liquid lanolin, or white petrolatum. Sterile ophthalmic gel formulations may be prepared by suspending the active ingredient in a hydrophilic base prepared from the combination of, for example, carbopol-974, or the like, according to the published formulations for analogous ophthalmic preparations; preservatives and tonicity agents can be incorporated, see Published U.S. Application No.2005 / 0239871A1. Local modes of administration include, by way of example, intraocular, intraorbital, subconjunctival, sub-Tenon’s, subretinal or transscleral routes. Administration can also be to the anterior chamber of the eye. In an aspect, significantly smaller amounts of the components (compared with systemic approaches) may exert an effect when administered locally (for example, intravitreally) compared to when administered systemically (for example, intravenously). Subretinal injections can be made directly into the macular, e.g., submacular injection. Exemplary methods include intraocular injection (e.g., retrobulbar, subretinal, submacular, intravitreal and intrachoridal), iontophoresis, eye drops, and intraocular implantation (e.g., intravitreal, sub-Tenons and sub- conjunctival). In some aspects, a therapeutically effective amount of MBVs and / or statin is administered by intravitreal injection. Procedures for intravitreal injection are known in the art (see, for example Peyman, et al. (2009) Retina 29(7):875-912 and Fagan and Al-Qureshi,. (2013) Clin. Experiment. Ophthalmol. 41(5):500-7). Other methods of intraocular administration are known in the art, and include subretinal administration. A general method for intravitreal injection may be illustrated by the following brief outline. This example is merely meant to be illustrative of one way to carry out an intraocular injection, and is in no way meant to be limiting. Briefly, a subject for intravitreal injection may be prepared for the procedure by pupillary dilation, sterilization of the eye, and administration of anesthetic. Any suitable mydriatic agent known in the art may be used for pupillary dilation. Adequate pupillary dilation may be confirmed before treatment. Sterilization may be achieved by applying a sterilizing eye treatment, e.g., an iodide-containing solution such as povidone-iodine (BETADINE®). A similar solution may also be used to clean the eyelid, eyelashes, and any other nearby tissues (e.g., skin). Any suitable anesthetic may be used, such as lidocaine or proparacaine, at any suitable concentration. Anesthetic may be administered by any method known in the art, including without limitation topical drops, gels or jellies, and subconjuctival application of anesthetic. Prior to injection, a sterilized eyelid speculum may be used to clear the eyelashes from the area. The site of the injection may be marked with a syringe. The site of the injection may be chosen based on the lens of the patient. For example, the injection site may be 3-3.5 mm from the limus in pseudophakic or aphakic patients, and 3.5-4 mm from the limbus in phakic patients. The patient may look in a direction opposite the injection site. During injection, the needle can be inserted perpendicular to the sclera and pointed to the center of the eye. The needle can be inserted such that the tip ends in the vitreous, rather than the subretinal space. Any suitable volume known in the art for injection may be used. After injection, the eye can be treated with a sterilizing agent such as an antibiotic. The eye can also be rinsed to remove excess sterilizing agent. Intravitreal injection (or administration by any other route of administration) of a therapeutically effective amount of MBVs and / or statins can be performed once, or can be performed repeatedly, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 times. Administration can be performed biweekly, weekly, every other week, monthly, or every 2, 3, 4, 5, or 6 months. Intraocular injection, such as intravitreal injection, may be accomplished by using sterile 27 to 31 gauge needle. In some examples, the length is typically between 0.5 and 0.62 inches (12.7 and 15.75 mm) as longer needles may increase risk of injury. However, a longer needle may be used as necessary to reach the appropriate portion of the eye that is the target of the injection. Pharmaceutical compositions that include a therapeutically effective amount of MBVs and / or a statin can be formulated in unit dosage form, suitable for individual administration of precise dosages. The amount of active compound(s) administered will be dependent on the subject being treated, the severity of the affliction, and the manner of administration, and is best left to the judgment of the prescribing clinician. Within these bounds, the formulation to be administered will contain a quantity of the active component(s) in amounts effective to achieve the desired effect in the subject being treated. In some aspects, the disclosed compositions are effective in a method that increases the survival of retinal ganglion cells when administered to the eye of a subject. In more aspects, the disclosed compositions are effective in a method that increases optic nerve survival and / or regeneration. The use of a combination of a therapeutically effective amount of MBV, and a therapeutically effective amount of a statin, produces a synergistic effect. Any suitable dosage can be used in the methods and compositions provided herein. For example, the MBV may be formulated in an appropriate carrier. For example, the MBV may be formulated in an ophthalmically suitable buffer such as physiological saline or phosphate buffered saline. The concentration of MBV in the formulation can be determined based on the desired dose and the volume of the dose. The volume of the dose should be selected so that administration does not cause an undue increase in ocular pressure. For example, example, the volume of the formulation to be administered to the eye may be in the range of, for example, about 10 µL to about 100 µL, such as about 25 µL to about 100 µL, such as about 50 µL to about 100 µL, or such as about 25 µL to about 50 µL, or such as about 25 µL to about 75 µL. For example, the volume may be about 50 µL. Accordingly, the formulation should be prepared to a suitable concentration to deliver the desired dose in the desired volume. The concentration of the MBV in the formulation may be about 1 x 108MBV / mL to about 1 x 1012MBV / mL. For example, the concentration of the MBV in the formulation may be about 1 x 108MBV / mL to about 1 x 1010MBV / mL, or about 1 x 107MBV / mL to about 1 x 1012, or 1 x 109MBV / mL to about 1 x 1013MBV / mL, or about 1 x 109MBV / mL to about 1 x 1011MBV / mL. For example, the concentration of MBV in the formulation may be about 1 x 1010MBV / mL to about 1 x 1012MBV / mL. For example, the concentration of MBV in the formulation may be about 1 x 1010MBV / mL. For example, the concentration of MBV in the formulation may be about 1 x 1011MBV / mL. For example, the concentration of MBV in the formulation may be about 1 x 109MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of 1 x 108MBV / mL to about 1 x 1012MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of about 1 x 108MBV / mL to about 1 x 1010MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of 1 x 107MBV / mL to about 1 x 1012. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of 1 x 109MBV / mL to about 1 x 1013MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of about 1 x 109MBV / mL to about 1 x 1011MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of about 1 x 1010MBV / mL to about 1 x 1012MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of 1 x 1010MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of about 1 x 1011MBV / mL. For example, the dose of MBV is about 10 µL to about 100 µL, e.g., about 25 µL to about 50 µL of about 1 x 109MBV / mL. The individual dose of MBV can be 0.0001 to 0.2 mL of MBV (e.g.,at 1010MBV / mL), such as 0.01 to 0.2 mL, 0.01 to 0.1 mL, 0.01 to 0.05 mL, 0.05 to 0.1 mL, 100-200 µL, 1-100 µL, 1-50 µL, 1-25 µL, or 10-50 µL of MBV (at 1010MBV / mL), or an equivalent amount of MBV administered at a different concentration. The individual dose of statin (such as Fluvastatin) can be 0.0001 to 0.2 mL of statin (e.g., at 6 mM), such as 0.01 to 0.2 mL, 0.01 to 0.1 mL, 0.01 to 0.05 mL, 0.05 to 0.1 mL, , 100-200 µL, 1-100 µL, 1- 50 µL, 1-25 µL, or 10-50 µL of statin (e.g.,at 6mM), or an equivalent amount of statin administered at a different concentration. When the statin and the MBVs are contained in the same composition, the concentration of each of the statin and MBV may be adjusted so that the volume administered does not exceed the volume that can be tolerated by the eye without causing undue increase in intraocular pressure. For example, the statin and MBV are formulated to be administered in dose volume of about10 µL to about 100 µL, e.g., about 50 to about 100 µL, or about 25 µL to about 100 µL. In one example, the method of the invention administers fluvastatin and MBV, e.g., MBV derived from UBM, intraocularly into the vitreous. The subject can be administered additional therapeutic agents, in the same composition or in a different composition. These therapeutic agents include, but are not limited to, an agent that lowers intraocular pressure. The agent can be a) a prostaglandin analog, b) a beta-adrenergic blocker, c) an alpha- adrenergic agonist, or d) a cholinergic agonist. Exemplary agents include latanoprost, bimatorpost, travoprost, timolol, betaxolol, brimonidine, pilocarpine, dorzolamide, brinzolamide, and acetazolamide. In some specific non-limiting examples, the agent is a) latanoprost, b) timolol, c) brimonidine, or d) pilocarpine. The subject can be administered a Rho-kinase inhibitor, such as, but not limited to, ripasudil or netarsudil. Additional agents that can be administered to the subject include antibacterial and antifungal antibiotics, as well as non-steroidal anti-inflammatory agents to reduce risk of infection and inflammation. Additional agents can be administered by any route. The additional agents can be formulated separately, or in the same composition as the MBVs. Additional agents of use include minoglycosides (for example, amikacin, apramycin, arbekacin, bambermycins, butirosin, dibekacin, dihydrostreptomycin, fortimicin(s), gentamicin, isepamicin, kanamycin, micronomicin, neomycin, neomycin undecylenate, netilmicin, paromomycin, ribostamycin, sisomicin, spectinomycin, streptomycin, tobramycin, trospectomycin), amphenicols (for example, azidamfenicol, chloramphenicol, florfenicol, thiamphenicol), ansamycins (for example, rifamide, rifampin, rifamycin sv, rifapentine, rifaximin), β-lactams (for example, carbacephems (e.g., loracarbef), carbapenems (for example, biapenem, imipenem, meropenem, panipenem), cephalosporins (for example, cefaclor, cefadroxil, cefamandole, cefatrizine, cefazedone, cefazolin, cefcapene pivoxil, cefclidin, cefdinir, cefditoren, cefepime, cefetamet, cefixime, cefmenoxime, cefodizime, cefonicid, cefoperazone, ceforanide, cefotaxime, cefotiam, cefozopran, cefpimizole, cefpiramide, cefpirome, cefpodoxime proxetil, cefprozil, cefroxadine, cefsulodin, ceftazidime, cefteram, ceftezole, ceftibuten, ceftizoxime, ceftriaxone, cefuroxime, cefuzonam, cephacetrile sodium, cephalexin, cephaloglycin, cephaloridine, cephalosporin, cephalothin, cephapirin sodium, cephradine, pivcefalexin), cephamycins (for example, cefbuperazone, cefmetazole, cefininox, cefotetan, cefoxitin), monobactams (for example, aztreonam, carumonam, tigemonam), oxacephems, flomoxef, moxalactam), penicillins (for example, amdinocillin, amdinocillin pivoxil, amoxicillin, ampicillin, apalcillin, aspoxicillin, azidocillin, azlocillin, bacampicillin, benzylpenicillinic acid, benzylpenicillin sodium, carbenicillin, carindacillin, clometocillin, cloxacillin, cyclacillin, dicloxacillin, epicillin, fenbenicillin, floxacillin, hetacillin, lenampicillin, metampicillin, methicillin sodium, mezlocillin, nafcillin sodium, oxacillin, penamecillin, penethamate hydriodide, penicillin G benethamine, penicillin g benzathine, penicillin g benzhydrylamine, penicillin G calcium, penicillin G hydrabamine, penicillin G potassium, penicillin G procaine, penicillin N, penicillin O, penicillin V, penicillin V benzathine, penicillin V hydrabamine, penimepicycline, phenethicillin potassium, piperacillin, pivampicillin, propicillin, quinacillin, sulbenicillin, sultamicillin, talampicillin, temocillin, ticarcillin), other (for example, ritipenem), lincosamides (for example, clindamycin, lincomycin), macrolides (for example, azithromycin, carbomycin, clarithromycin, dirithromycin, erythromycin, erythromycin acistrate, erythromycin estolate, erythromycin glucoheptonate, erythromycin lactobionate, erythromycin propionate, erythromycin stearate, josamycin, leucomycins, midecamycins, miokamycin, oleandomycin, primycin, rokitamycin, rosaramicin, roxithromycin, spiramycin, troleandomycin), polypeptides (for example, amphomycin, bacitracin, capreomycin, colistin, enduracidin, enviomycin, fusafungine, gramicidin s, gramicidin(s), mikamycin, polymyxin, pristinamycin, ristocetin, teicoplanin, thiostrepton, tuberactinomycin, tyrocidine, tyrothricin, vancomycin, viomycin, virginiamycin, zinc bacitracin), tetracyclines (for example, apicycline, chlortetracycline, clomocycline, demeclocycline, doxycycline, guamecycline, lymecycline, meclocycline, methacycline, minocycline, oxytetracycline, penimepicycline, pipacycline, rolitetracycline, sancycline, tetracycline), and others (e.g., cycloserine, mupirocin, tuberin). Agents of use also include synthetic antibacterials, such as 2,4-Diaminopyrimidines (for example, brodimoprim, tetroxoprim, trimethoprim), nitrofurans (for example, furaltadone, furazolium chloride, nifuradene, nifuratel, nifurfoline, nifurpirinol, nifurprazine, nifurtoinol, nitrofurantoin), quinolones and analogs (for example, cinoxacin, ciprofloxacin, clinafloxacin, difloxacin, enoxacin, fleroxacin, flumequine, grepafloxacin, lomefloxacin, miloxacin, nadifloxacin, nalidixic acid, norfloxacin, ofloxacin, oxolinic acid, pazufloxacin, pefloxacin, pipemidic acid, piromidic acid, rosoxacin, rufloxacin, sparfloxacin, temafloxacin, tosufloxacin, trovafloxacin), sulfonamides (for example, acetyl sulfamethoxypyrazine, benzylsulfamide, chloramine-b, chloramine-t, dichloramine t, mafenide, 4’-(methylsulfamoyl)sulfanilanilide, noprylsulfamide, phthalylsulfacetamide, phthalylsulfathiazole, salazosulfadimidine, succinylsulfathiazole, sulfabenzamide, sulfacetamide, sulfachlorpyridazine, sulfachrysoidine, sulfacytine, sulfadiazine, sulfadicramide, sulfadimethoxine, sulfadoxine, sulfaethidole, sulfaguanidine, sulfaguanol, sulfalene, sulfaloxic acid, sulfamerazine, sulfameter, sulfamethazine, sulfamethizole, sulfamethomidine, sulfamethoxazole, sulfamethoxypyridazine, sulfametrole, sulfamidocchrysoidine, sulfamoxole, sulfanilamide, sulfanilylurea, n-sulfanilyl-3,4-xylamide, sulfanitran, sulfaperine, sulfaphenazole, sulfaproxyline, sulfapyrazine, sulfapyridine, sulfasomizole, sulfasymazine, sulfathiazole, sulfathiourea, sulfatolamide, sulfisomidine, sulfisoxazole) sulfones (for example, acedapsone, acediasulfone, acetosulfone sodium, dapsone, diathymosulfone, glucosulfone sodium, solasulfone, succisulfone, sulfanilic acid, p-sulfanilylbenzylamine, sulfoxone sodium, thiazolsulfone), and others (for example, clofoctol, hexedine, methenamine, methenamine anhydromethylene-citrate, methenamine hippurate, methenamine mandelate, methenamine sulfosalicylate, nitroxoline, taurolidine, xibornol). Additional agents of use include antifungal antibiotics such as polyenes (for example, amphotericin B, candicidin, filipin, fungichromin, hachimycin, hamycin, lucensomycin, mepartricin, natamycin, pecilocin, perimycin), others (for example, azaserine, griseofulvin, oligomycins, neomycin undecylenate, pyrrolnitrin, siccanin, tubercidin, viridin) allylamines (for example, butenafine, naftifine, terbinafine), imidazoles (for example, bifonazole, butoconazole, chlordantoin, chlormiidazole, cloconazole, clotrimazole, econazole, enilconazole, fenticonazole, flutrimazole, isoconazole, ketoconazole, lanoconazole, miconazole, omoconazole, oxiconazole nitrate, sertaconazole, sulconazole, tioconazole), thiocarbamates (for example, tolciclate, tolindate, tolnaftate), triazoles (for example, fluconazole, itraconazole, saperconazole, terconazole) others (for example, acrisorcin, amorolfine, biphenamine, bromosalicylchloranilide, buclosamide, calcium propionate, chlorphenesin, ciclopirox, cloxyquin, coparaffinate, diamthazole dihydrochloride, exalamide, flucytosine, halethazole, hexetidine, loflucarban, nifuratel, potassium iodide, propionic acid, pyrithione, salicylanilide, sodium propionate, sulbentine, tenonitrozole, triacetin, ujothion, undecylenic acid, zinc propionate). Antineoplastic agents can also be of use including (1) antibiotics and analogs (for example, aclacinomycins, actinomycin, anthramycin, azaserine, bleomycins, cactinomycin, carubicin, carzinophilin, chromomycins, dactinomycin, daunorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin, epirubicin, idarubicin, menogaril, mitomycins, mycophenolic acid, nogalamycin, olivomycines, peplomycin, pirarubicin, plicamycin, porfiromycin, puromycin, streptonigrin, streptozocin, tubercidin, zorubicin), (2) antimetabolites such as folic acid analogs (for example, denopterin, edatrexate, methotrexate, piritrexim, pteropterin, trimetrexate), (3) purine analogs (for example, cladribine, fludarabine, 6- mercaptopurine, thiamiprine, thioguanine), (4) pyrimidine analogs (for example, ancitabine, azacitidine, 6- azauridine, carmofur, cytarabine, doxifluridine, emitefur, enocitabine, floxuridine, fluorouracil, gemcitabine, tagafur). Steroidal anti-inflammatory agents can also be used such as 21-acetoxypregnenolone, alclometasone, algestone, amcinonide, beclomethasone, betamethasone, budesonide, chloroprednisone, clobetasol, clobetasone, clocortolone, cloprednol, corticosterone, cortisone, cortivazol, cyclosporine, deflazacort, desonide, desoximetasone, dexamethasone, diflorasone, diflucortolone, difluprednate, enoxolone, fluazacort, flucloronide, flumethasone, flunisolide, fluocinolone acetonide, fluocinonide, fluocortin butyl, fluocortolone, fluorometholone, fluperolone acetate, fluprednidene acetate, fluprednisolone, flurandrenolide, fluticasone propionate, formocortal, halcinonide, halobetasol propionate, halometasone, halopredone acetate, hydrocortamate, hydrocortisone, loteprednol etabonate, mazipredone, medrysone, meprednisone, methylprednisolone, mometasone furoate, paramethasone, prednicarbate, prednisolone, prednisolone 25-diethylamino-acetate, prednisolone sodium phosphate, prednisone, prednival, prednylidene, rimexolone, tixocortol, triamcinolone, triamcinolone acetonide, triamcinolone benetonide, and triamcinolone hexacetonide. In addition, non-steroidal anti-inflammatory agents can be used. These include aminoarylcarboxylic acid derivatives (for example, enfenamic acid, etofenamate, flufenamic acid, isonixin, meclofenamic acid, mefenamic acid, niflumic acid, talniflumate, terofenamate, tolfenamic acid), arylacetic acid derivatives (for example, aceclofenac, acemetacin, alclofenac, amfenac, amtolmetin guacil, bromfenac, bufexamac, cinmetacin, clopirac, diclofenac sodium, etodolac, felbinac, fenclozic acid, fentiazac, glucametacin, ibufenac, indomethacin, isofezolac, isoxepac, lonazolac, metiazinic acid, mofezolac, oxametacine, pirazolac, proglumetacin, sulindac, tiaramide, tolmetin, tropesin, zomepirac), arylbutyric acid derivatives (for example, bumadizon, butibufen, fenbufen, xenbucin), arylcarboxylic acids (for example, clidanac, ketorolac, tinoridine), arylpropionic acid derivatives (for example, alminoprofen, benoxaprofen, bermoprofen, bucloxic acid, carprofen, fenoprofen, flunoxaprofen, flurbiprofen, ibuprofen, ibuproxam, indoprofen, ketoprofen, loxoprofen, naproxen, oxaprozin, piketoprolen, pirprofen, pranoprofen, protizinic acid, suprofen, tiaprofenic acid, ximoprofen, zaltoprofen), pyrazoles (for example, difenamizole, epirizole), pyrazolones (for example, apazone, benzpiperylon, feprazone, mofebutazone, morazone, oxyphenbutazone, phenylbutazone, pipebuzone, propyphenazone, ramifenazone, suxibuzone, thiazolinobutazone), salicylic acid derivatives (for example, acetaminosalol, aspirin, benorylate, bromosaligenin, calcium acetylsalicylate, diflunisal, etersalate, fendosal, gentisic acid, glycol salicylate, imidazole salicylate, lysine acetylsalicylate, mesalamine, morpholine salicylate, 1-naphthyl salicylate, olsalazine, parsalmide, phenyl acetylsalicylate, phenyl salicylate, salacetamide, salicylamide o-acetic acid, salicylsulfuric acid, salsalate, sulfasalazine), thiazinecarboxamides (for example, ampiroxicam, droxicam, isoxicam, lornoxicam, piroxicam, tenoxicam), .epsilon.-acetamidocaproic acid, s-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, .alpha.-bisabolol, bucolome, difenpiramide, ditazol, emorfazone, fepradinol, guaiazulene, nabumetone, nimesulide, oxaceprol, paranyline, perisoxal, proquazone, superoxide dismutase, tenidap, and zileuton. Implants are also of use in the methods disclosed herein. The implants can be inserted into the eye by a variety of methods, including placement by forceps or by trocar following making an incision in the sclera (for example, a 2-3 mm incision) or other suitable sites. In some cases, the implant can be placed by trocar without making a separate incision, but instead by forming a hole directly into the eye with the trocar. The method of placement can influence the release kinetics. For example, implanting the device into the vitreous or the posterior chamber with a trocar may result in placement of the device deeper within the vitreous than placement by forceps, which may result in the implant being closer to the edge of the vitreous. The location of the implanted device may influence the concentration gradients of the therapeutic agent surrounding the device, and thus influence the release rates (for example, a device placed closer to the edge of the vitreous may result in a slower release rate, see U.S. Patent No.5,869,079 and U.S. Patent No. 6,699,493). In one aspect, an implant is formulated with a bioerodible polymer matrix. Generally, when implants are used, the MBVs and / or the statin(s) are homogeneously distributed through the polymeric matrix, such that it is distributed evenly enough that no detrimental fluctuations in rate of release occur because of uneven distribution of the immunosuppressive agent in the polymer matrix. The selection of the polymeric composition to be employed varies with the desired release kinetics, the location of the implant, patient tolerance, and the nature of the implant procedure. The polymer can be included as at least about 10 weight percent of the implant. In one example, the polymer is included as at least about 20 weight percent of the implant. In another aspect, the implant comprises more than one polymer. These factors are described in detail in U.S. Patent No.6,699,493. Characteristics of the polymers generally include biodegradability at the site of implantation, compatibility with the agent of interest, ease of encapsulation, and water insolubility, amongst others. Generally, the polymeric matrix is not fully degraded until the drug load has been released. The chemical composition of suitable polymers is known in the art (for example, see U.S. Patent No.6,699,493). Administration may be provided as a single administration, a periodic bolus or as continuous infusion. In some aspects, administration is from an internal reservoir (for example, from an implant disposed at an intra- or extra-ocular location (see, U.S. Pat. Nos.5,443,505 and 5,766,242)) or from an external reservoir (for example, from an intravenous bag). Components can be administered by continuous release for a specific period from a sustained release drug delivery device immobilized to an inner wall of the eye or via targeted transscleral controlled release into the choroid (see, for example, International Publication Nos. WO2000 / 040089 or , WO2002 / 089767, Ambati et al., Invest. Opthalmol. Vis. Sci. 41:1181-1185, 2000, and Ambati et al., Invest. Opthalmol. Vis. Sci.41:1186-1191, 2000). A variety of devices suitable for administering components locally to the inside of the eye are known in the art. See, for example, U. S. Patent No.6,251,090, U. S. Patent No.6,299,895, U. S. Patent No.6,416,777, U. S. Patent No.6,413,540, and International Publication No. WO 2001 / 028474. In some aspects, the method includes the step of detecting that a therapeutic benefit has been achieved. Measures of therapeutic efficacy will be applicable to the particular disease being modified, and will recognize the appropriate detection methods to use to measure therapeutic efficacy. The subject can be evaluated for response using any methods known in the art. These include, but are not limited to, ophthalomosccopy, perimetry, gonioscopy, pachymetry, or nerve fiber analysis. In some aspects, retinal ganglion cell number and / or viability can be assessed. One of skill in the art can readily determine that the disclosed methods are effective. For example it can be determined by whether the cup-to-disc ratio has stabilized. Scanning laser polarimetry or optical coherence tomography could be used, for example to perform retinal nerve fiber layer analysis. A visual field test could be used to monitor progression of glaucoma. For any of the disclosed methods, therapeutic efficacy in treating a vision deficiency can as an alteration in the individual's vision. Therapeutic efficacy can also be assessed by measuring cytokine produced by microglia and / or astrocytes. In some aspects, cytokine is IL-1β, IL-6, or TNF-α. Methods for measuring cytokines are known in the art, and include, without limitation, bioassays, radioimmunoassay (RIA) and enzyme linked immunosorbent assays (ELISA). Exemplary methods are disclosed below. EXAMPLES Central nervous system (CNS) neurons in humans have little or no capacity for axon regeneration after injury or as a result of neurodegenerative disease. Optic nerve damage resulting from trauma and in optic neuropathies causes the death of retinal ganglion cells (RGCs), ultimately leading to vision loss. A major barrier in the field is the lack of clinically viable therapies that can be applied after injury to mitigate RGC death and optic nerve degeneration or stimulate RGC axon regeneration. Ideally, the lag time between nerve injury and the first treatment should be kept to a few days as the survival rate for RGCs after injury diminishes dramatically thereafter. Following optic nerve crush (ONC) in mice, a preclinical mouse model for optic neuropathy, RGCs begin to die within three days and ~60% of RGCs die within five to seven days (Kingston et al. PLoS Genet 17, e1009885, 2021; Yang et al. Cells 9, 2020). Thus, there is an urgent need for effective neuroprotective and regenerative therapies that can be applied shortly after acute trauma and neuropathies. Extracellular matrix (ECM)-based biological scaffold materials have been broadly applied for regenerative medicine in humans (Hussey et al., Nat. Rev. Mater.3, 159–173, 2018). The ECM is a complex structure containing more than 300 proteins, many of which favorably affect the immune response (Boyd et al., Cytokine 98, 79-86, 2017). Studies have identified matrix-bound nanovesicles (MBV) as a potent functional component of the ECM (Huleihel et al., Sci Adv 2, e1600502, 2016). MBV are nanometer-sized lipid-bound vesicles, well-tolerated, and not toxic to the whole organism (Crum et al., Sci Adv 2, e1600502, 2023). Intriguingly, MBV contain cytokines such as IL-33 and microRNAs (miRNAs) that target genes relevant to immune responses (Huleihel et al., Tissue Eng Part A 23, 1283-1294, 2017; Hussey et al., J Immunol Regen Med 3, 26-35, 2019; Cramer et al., Tissue Eng Part A 28, 867-878, 2022; Turner et al., Tissue Eng Part A, 2022). Indeed, MBV elicit crucial immunomodulatory functions in several rodent disease models (Crum et al., Sci Adv 9, eadf9016, 2023; Crum et al., NPJ Regen Med 7, 13, 2022). In particular, in an ocular hypertension model, MBV exert RGC protective effects by immunomodulation and inhibiting the secretion of neurotoxic cytokines in microglia and astrocytes (van der Merwe et al., Sci Rep 9, 3482, 2019). Thus, MBV may serve as functional modulators of inflammation for neuroprotection and other cellular context in diseases. It is disclosed herein that co-intravitreal injections of statin / fluvastatin and MBV robustly enhance optic nerve regeneration and RGC protection after optic nerve crush (ONC) in mice. The mechanisms by which fluvastatin and MBV act were revealed by bulk RNA sequencing and flow cytometric analysis that as a result of infiltration of monocytes and neutrophils, RGC protection and axonal regeneration were enhanced. Furthermore, the combination of fluvastatin and MBV or IL-33, an MBV-associated cytokine regulates monocyte infiltration via elevation of CCL2 expression in the superficial layer of the retina. It is also demonstrated that combinatorial treatments using fluvastatin, MBV and adeno-associated virus (AAV)- based gene therapy blocking anti-regenerative protein prenylation pathways in RGCs enabled regenerated axons to extend longer. Taken together, this study provides novel molecular insights into enhanced axon regeneration and neuroprotection, leading to a significant advance in identification of the therapeutic intervention, as the effects are synergistic. Example 1: Materials and Methods in Murine Model Animals All mice experiments were performed according to the guidelines. C57BL / 6J mice (referred to as WT, Jackson Laboratory, JAX: 000664), Ccr2- / -mice (Jackson Laboratory, JAX: 004999), and Ccl2- / -mice (Jackson Laboratory, JAX: 004434) were used in the study. Male and female mice were used in this study with equal distributions for all experiments. All mice were housed in a pathogen-free barrier facility and were maintained in a 12 h light / dark cycle with access to standard laboratory chow and water ad libitum. As previously described (Kingston et al., PLoS Genet 17, e1009885, 2021) for surgeries and intravitreal injections, 8-week-old animals were anesthetized with an intraperitoneal injection of ketamine / xylazine (100 / 10 mg / kg body weight). Before and after surgeries and injections, bupivicaine (4mg / kg, <0.2ml) and buprenorphine (0.1mg / kg, <0.3ml) were subcutaneously injected. After surgeries and injections, proparacaine and vetropolycin were dropped on the surface of the eyes. For euthanasia, CO2 was used with the flow rate, 30 -70% per minute. Optic nerve crush The optic nerve in the left eye was crushed using #5 Dumont forceps, applying pressure for 5s at ~5 mm behind the optic disc, while the right eye remained uninjured with an intact retina. Following various time points after optic nerve crush, animals were humanely euthanized with CO2 and perfused with 4% paraformaldehyde (PFA) following PBS. The heads were cut and post-fixed in 4% PFA overnight at 4°C and washed with PBS for further analysis. For double-immunostaining with antibodies for GFAP and Vimentin, the whole retina was fixed with 4% PFA for 30 mins without perfusion. Intravitreal injection For intravitreal injections, glass micropipettes made by a micropipette puller was used. Fluvastatin (Sigma, SML0038) was dissolved in the sterile ddH2O or PBS at 37°C, and stored at -20°C. To make the combination of 3mM fluvastatin with 2.3 x 109particles / mL MBV or 2, 10 or 50 μg / mL IL-33 (Pepro Tech, 210-33), 6mM fluvastatin solution was mixed with 4.6 x 109particles / mL MBV or 4, 20 or 100 μg / mL IL-33 in a 1:1 ratio prior to injections. A hole in the middle region of the retina was made with the glass micropipette to inject 2 μL of the first treatments or PBS within a few minutes after optic nerve crush (ONC), and then the second treatments or PBS were injected through the same retinal hole two days after ONC. For axon regeneration assay, 2 μL of 2 μg / μL of Alexa Fluor 555 conjugated cholera toxin β subunit (CTB) (ThermoFisher, C22843) was injected into the retina 2 days before euthanasia.2 μL of AAV2-CMV- GFP-shCTR virus (control sequences: AGTATATCTATGCTTCTATCCGCTCAGGTGTATATCCTTGGATAGTGGCGTAACAACG, 4x10^13 GC / ml, VIROVEK, SEQ ID NO: 4) (Kingston et al., PLoS Genet 17, e1009885, 2021) or AAV2-CMV- GFP-shFnta virus (target sequences: CCGGGAACTACATCACTGCGATAATCTCGAGATTATCGCAGTGATGTAGTTCTTTTTTG, 4x10^13 GC / ml, VIROVEK, SEQ ID NO: 5) were intravitreally injected two weeks before ONC or four days after ONC. Intraperitoneal injection Anti-mouse Ly6G antibody (clone 1A8) (200 µg, Bio Cell, BE0075-1) or control IgG2a antibody (200 µg, Bio Cell, BE0089) was diluted in the sterile PBS, and intraperitoneally injected into C57BL / 6J and Ccr2- / -mice two days and one day before ONC and a few minutes and one, two and three days after ONC. Preparation and quality control of MBV MBV were be prepared from porcine urinary bladder ECM (UBM-ECM) as previously described (Huleihel et al., Sci Adv 2, e1600502, 2016; Crum et al., Acta Biomater 155, 113-122, 2023; Crum et al., Sci Adv 9, eadf9016, 2023; Huseey et al., Sci Adv 6, eaay4361, 2020). Porcine urinary bladders were obtained from Animal Biotech Industries. The luminal urothelial cells of the tunica mucosa within the bladders were dissociated from the basement membrane by washing with deionized water, and then decellularized and digested by agitation in 0.1% peracetic acid with 4% ethanol for 2 hours at 300 rpm. The tissue was washed with 1× PBS (pH 7.4) and sterile deionized water, and then lyophilized and milled into particulate. To isolate MBV, the UBM-ECM was then digested with LIBERASE™ TL (highly purified collagenase I and collagenase II) in buffer (50 mM tris (pH 7.5), 5 mM CaCl2, and 150 mM NaCl) for 24 hours at room temperature. Digested tissues were then subjected to centrifugation at 10,000g for 30 min at 4°C and filtered through a 0.22 μm filter. The supernatant was then centrifuged at 100,000g (Beckman Coulter Optima L- 90K Ultracentrifuge) at 4°C for 70 min to pellet the MBV. MBV were then resuspended in sterile 1×PBS (pH 7.4), and particle concentration was determined using particle nanotracking analysis. The size and concentration of freshly isolated MBV were measured using Nanosight nanoparticle tracking analysis (Malvern Panalytical). The Brownian motion of the vesicles was used to determine the size distribution as measured across three replicates of 45 second videos for each sample. Vesicle dosages of 0.58 x 109particles / mL, 2.3 x 109particles / mL, 9.2 x 109particles / mL were prepared as described above. Transmission electron microscopy (TEM) imaging was performed as previously described (Hussey et al., J Immunol Regen Med 3, 26-35, 2019). Immunohistochemistry and imaging Procedures and methods for whole mount immunofluorescent staining of the injured and intact retina were previously described (Kingston et al., PLoS Genet 17, e1009885, 2021). Each retina with a small cut only in the peripheral ventral region was incubated with primary antibodies in PBS containing 0.4% Triton X-100 (PBST) overnight at 4°C and then washed with PBST three times. The retina was incubated with following secondary antibodies in PBST overnight at 4°C and washed with PBST three times. The dorsal, nasal and temporal regions in the intact and injured retina were also cut with micro scalpels on the microscope slide and mounted with Fluoro-Gel mounting medium (Electron Microscopy Sciences, 17985- 11). For cryosectioning, the retina was incubated in 30% sucrose in PBS overnight at 4°C, and then embedded with Tissue-Tek O.C.T..14 μm retinal cryosections were prepared and immunostained described above. For immunostaining with antibodies for Ly6G, Ly6C, CCR2, CCL2, GFAP, Vimentin, Rhodopsin, S100B, F4 / 80, PNA and PKCα, cryosections were incubated with MeOH for 2 mins and washed with PBS, and sections were incubated with the primary antibodies in PBS overnight at room temperature and with the secondary antibodies in PBS for a few hours at room temperature. Immunolabeling was performed with the following primary antibodies: rabbit βIII-tubulin (1:500, Abcam, ab52623), guinea pig RBPMS (1:500, Millipore, ABN1376), chick GFAP (1:500, ThermoFisher, PA1-10004), mouse CCR2 (1:500, R&D systems, MAB150), mouse CCL2 / MCP-1 (1:300, ThermoFisher, MA5-17040), Alexa Fluor 594 Ly6G (1:300, Biolegend, 127636), and Alexa Fluor 488 Ly6C (1:300, Biolegend, 128021), chick GFP (1:600, Abcam, ab13970), rabbit Vimentin (1: 500, ThermoFisher, PA5-27231), rabbit FNTA (1:400, SantaCruz, sc-374262), rabbit S100B (1: 300, ThermoFisher, PA5-78161), rat F4 / 80 (1: 300, BioRad, MCA497RT), mouse Rhodopsin (1D4, 50 µg / µl, Donated by Krzysztof Palczewski Lab), Alexa Fluor 488 PNA (1:500, ThermoFisher, L21409) and mouse PKCα (1:400, ThermoFisher, MA1-157). Secondary antibodies were used at 1:500 and purchased from Lifetechnology: goat anti-Guinea Pig IgG 647 (A21450), goat anti-Rabbit IgG 594 (A-11037), donkey anti-Mouse IgG 647 (A-31571), donkey anti-Rabbit IgG 647 (A-31573), and goat anti-Chick IgG 488 (A11039), donkey anti-Goat IgG 488 (A-11055). DAPI was used at 1:500 and purchased from ThermoFisher (D1306). Olympus Fluoview 1000 laser scanning microscope with Fluoview software, a 20× objective lens (PlanSApo, NA=0.85) and a 40× objective lens (UPlanFL N NA=1.3) was used for imaging. Flow cytometry Each injured left retina with defined treatments was dissected out in cold PBS three days after ONC and collected for flow cytometry. The whole retina was treated with collagenase type I (84 U / cornea; Sigma- Aldrich), dissociated and incubated for an hour at 37°C. The single-cell suspension of each retina was then filtered through a 40 μm cell strainer cap (BD Labware) and washed with FACS buffer. Cell suspensions were then exposed to Fc block and Zombie Viability Dye in Zombie Aqua™ fixable viability kit (BioLegend, 423101) for 15 minutes at 4°C. After washing with PBS + 2% FBS, cells were stained with the fluorescent antibodies, PE CD11b (BioLegend, 101207), BV605 CD192 (CCR2) (BioLegend, 150615), BV650 Ly6G (BioLegend, 127641) and FITC Ly6C (BD Pharmingen, 553104). After a 20-minute incubation, cells were washed two times with PBS + 2% FBS. Cells were then fixed with 4% PFA and analyzed by flow cytometer (Beckman Coulter, Cytoflex LX) with FlowJo software (TreeStarInc., Ashland, OR). Quantitative Polymerase Chain Reaction (PCR) Procedures and methods for quantitative RT-PCR of the whole retina were previously described (Kingston et al., PLoS Genet 17, e1009885, 2021). Quantitative PCR was performed in duplicate using iTaq Universal SYBR Green (BioRad, 1725121) and the CFX384 Touch Real-Time PCR Detection System (BioRad). Results were presented as linearized Ct values normalized to Actb gene. The results of qRT-PCR in the injured retina treated with the combined treatment were normalized to the mean value of the injured retina with PBS two days after ONC. Experiments were repeated each condition with specific primers described in PrimerBank: Cxcr2 (Forward: 5’-ATGCCCTCTATTCTGCCAGAT-3’ (SEQ ID NO: 6), Reverse: 5’-GTGCTCCGGTTGTATAAGATGAC-3’ (SEQ ID NO: 7)), Atp8b4 (Forward: 5’- GAGAAGTTCCAGTATGCGGAC-3’ (SEQ ID NO: 8), Reverse: 5’-TGACAGCCGTCATCGAGATCA-3’ (SEQ ID NO: 9)), Ccr2 (Forward: 5’-ATCCACGGCATACTATCAACATC-3’ (SEQ ID NO: 10), Reverse: 5’-CAAGGCTCACCATCATCGTAG-3’ (SEQ ID NO: 11)), H2-Aa (Forward: 5’- TCAGTCGCAGACGGTGTTTAT-3’ (SEQ ID NO: 12), Reverse: 5’-GGGGGCTGGAATCTCAGGT-3’ (SEQ ID NO: 13)), Cd209a (Forward: 5’-CTGGCGTAGATCGACTGTGC-3’ (SEQ ID NO: 14), Reverse: 5’-AGACTCCTTGCTCATGTCAATG-3’ (SEQ ID NO: 15)), and Actb (Forward: 5’- GGCTGTATTCCCCTCCATCG-3’ (SEQ ID NO: 16), Reverse: 5’-CCAGTTGGTAACAATGCCATGT-3’ (SEQ ID NO: 17)). To validate Fnta knockdown efficiency, the intact retinae infected with AAV2-CMV- GFP-shCTR virus and AAV2-CMV-GFP-shFnta virus two weeks after infection were collected, and quantitative PCR was performed in triplicate with specific primers for Fnta described in PrimerBank: Fnta (Forward: 5’-CCCTATGGACGACGGGTTTC-3’ (SEQ ID NO: 18), Reverse: 5’- TGATCTGGACCACTGGGTTAG-3’ (SEQ ID NO: 19)). RNA Sequencing Preparations of the retina for bulk RNA-seq and data analysis were previously described (Kingston et al., PLoS Genet 17, e1009885, 2021). Injured retinae treated with the single or combined treatments two days after ONC were collected, and RNA was extracted using TRIzol RNA isolation reagent (ThermoFisher). This sample preparation was conducted in triplicates for each condition. RNA quality was verified by the University of Pittsburgh Health Genomics Core using Agilent Tapestation RNA and Qubit Fluorometric Quantification. RNA samples with the RNA integrity number of (RIN) >7 were utilized to synthesize cDNA. Library preparation was conducted with TruSeq Total RNA library kit (Illumina) using at least 1 µg of total RNA following the manufacture’s instruction. Libraries were sequenced using NextSeq500 (Illumina) with 75 base paired end reads resulting in 40M reads per sample. FASTQ files were analyzed using CLC Genomics Grid Workbench v22.0.2. For RNA sequencing analysis, sequenced reads were aligned to the mouse genome (GRCm39). Read counts were generated and differentially expressed genes were obtained using CLC Genomic Workbench v22.0.2. Transcripts with more than 10 read events in two samples of either treatments or control PBS with a p-value lower than 0.05 among three were collected for further analysis. For further expression shown in volcano plots and GO-pathway analysis, transcripts which show the false discovery rate (FDR) p-value (<0.05) and a fold change higher than 2 or the highest changes were selected. Volcano plots were generated using CLC Genomic Workbench v23.0.1 and GraphPad – Prism 9.0. Ingenuity Pathway Analysis was performed on DEGs with an FDR p-value < 0.05 and a Fold Change ≥ 2. Pathway z-scores were generated using the Expression Log Ratio. To draw Venn diagrams, Venn diagram online analysis provided by VIB / UGent Bioinformatics & Evolutionary Genomics was used (https: / / bioinformatics.psb.ugent.be / webtools / Venn / ). RGC survival analysis RGC survival analysis in the whole mount retina was performed by counting the RBPMS+RGCs in a 400 µm x 600 µm area in four quadrants, ventrotemporal (VT), ventronasal (VN), dorsotemporal (DT) and dorsonasal (DN) of the peripheral or the middle retina of the injured left eye and intact contralateral right eye in the same animal. The region-specific RGC survival (%) was provided by dividing the RGC number in each corresponding region of the injured retina by the number in the intact retina. The average RGC survival in all retinal regions (%) was provided by dividing the total RGC number from all four retinal regions of both peripheral and middle or peripheral injured retina by the total number from those regions in the intact retina. Immune cell infiltration analysis of cryosectioned retinal samples For quantification of Ly6G+cells and CCR2+Ly6Chi, five 14 μm non-consecutive cryosections of the central retina were examined. Total number of Ly6G+cells or CCR2+Ly6Chifrom two 300 µm (width) retinal areas adjacent to the nerve head per section was provided as shown in FIG.3F, and the average from five sections per animal was calculated. To provide the localization preference of those immune cells within the retina (%), those counted immune cells were sorted based on three retinal layers, 1: Intravitreal (IV), Ganglion cell layer (GCL) and Inner plexiform layer (IPL), 2: Inner nuclear layer (INL) and Outer plexiform layer (OPL), 3: Outer nuclear layer (ONL) and Outer Limiting Membrane (OLM), and the number of those infiltrating cells in each layer was divided by the total number of infiltrating immune cells per section, and the analysis was repeated in five sections per animal. To examine the magnitude of depletion of monocytes and neutrophils, four 14 μm non-consecutive cryosections of the central retina were examined. The total number of Ly6G+cells or Ly6Chicells in the intravitreal (IV), ganglion cell layer (GCL) and inner plexiform layer (IPL) from two 300 µm (width) retinal areas adjacent to the nerve head per section was provided, and the average from four sections per animal was calculated. Expression analysis of cryosectioned retinal and optic nerve samples For quantification of CCL2 fluorescent signals, four 14 μm non-consecutive retinal cryosections in the temporal retina where the single or combined treatments or PBS were intravitreally injected, were used per retina. Images were taken with the same setting of the inverted confocal microscope. The mean pixel intensity of 200 µm x 20 µm area centered on CCL2+retinal surface was measured with Fiji software in each cryosection. After the average of the mean pixel intensity in the control conditions from four sections per animal such as intact retina or injured retina with PBS was obtained, the fold change of CCL2 expression in each condition based on the average value in the control samples was calculated. For quantification of FNTA fluorescent signals, three 14 μm non-consecutive retinal cryosections in the retina were used per retina, and imaged with the same setting of the inverted confocal microscope. The mean pixel intensity of 200 µm x 20 µm area centered on the FNTA+RGC layer was measured and the average of pixel intensity was provided from three sections per retina. The fold-change of FNTA expression was calculated in the retina treated with AAV2-GFP-shFnta virus compared to AAV2-GFP-shCtr virus. For quantification of F4 / 80+cells, four 14 μm non-consecutive retinal cryosections per animal were prepared, and F4 / 80+cells from two 300 µm (width) retinal areas close to the optic nerve head were counted, provided the average number per section, and repeated the analysis in four sections to obtain the final average number per animal. For quantification of PNA+cells and Rhodopsin or PKCα fluorescent signals, four 14 μm non- consecutive retinal cryosections per animal were prepared. PNA+cells or measured signal intensities of Rhodopsin or PKCα with Fiji software within 200 µm (width) retinal areas adjacent to the nerve head per section were counted, and then the average number or fold change of expression per animal were provided. For quantification of CCR2 or CCL2 fluorescent signals at the lesion site of the nerve, two 14 μm non-consecutive optic nerve cryosections per animal were prepared. The signal intensities of CCR2 or CCL2 were measured with Fiji software in 300 µm (width) lesion areas, and then provided the average fold change of expression per animal. For quantification of Ly6G+cells at the lesion site of the nerve, three 14 μm non- consecutive optic nerve cryosections per animal were prepared. Ly6G+cells in 300 µm (width) lesion areas were counted, and then the average number per animal were provided. Hematoxylin and eosin staining and analysis Hematoxylin and eosin staining was performed following the manufacture’s instruction (Abcam, ab245880). Six 14 μm non-consecutive retinal cryosections per animal were prepared, and the thickness of all retinal layers, inner nuclear layer (INL) and outer nuclear layer (ONL) at two middle regions of each retinal section was measured, and the average was provided per animal. Bright field microscope (Olympus) was used for imaging. Analysis of regenerated axons Methods of clearing CTB-labeled optic nerves have been previously described (Kingston et al., PLoS Genet 17, e1009885, 2021) based on reagents used in ClearT(Kuwajima et al., Development 140, 1364-1368, 2013) and ScaleS (Hama et al., Nat Neurosci 8, 1518-1529, 2015). CTB-labeled regenerated retinal axons were imaged on the confocal microscope with a 20x objective lens, and ~50 images with 3 µm steps were provided per optic nerve. Each image was stitched to generate the whole optic nerve image. For counting axon number from the lesion site, a line transecting at every 400 or 1000 µm from the lesion site was drawn in the merged images, and the total number of the CTB-labeled axons crossing the transection line was provided per animal. Statistical analysis Both male and female adult mice were randomly used in each sample group because this study was not intended to test for differences between males and females. Animals were randomized to experimental groups. For experimental analysis, one investigator was responsible for animal surgery and injections and sent images or gave dissociated samples with only codes (#1, #2, #3) to other investigators, who counted RGCs, regenerated axons, and / or immune cells, and performed flow cytometric analysis or qPCR. For bulk RNA-seq analysis, details of experimental group were provided before the analysis to avoid analytical mistakes. Although no statistical methods were used to predetermine sample sizes, the sample size was determined based studies in the field. All data were analyzed, and graphs were constructed using Fiji (version 1.0) and Microsoft Excel. All error bars represent the standard deviation (SD), and statistical analysis was determined using unpaired two-tailed Student’s t-test, or one-way ANOVA or two-way ANOVA followed by the Tukey’s post hoc test or Bonferroni’s test, as indicated in the figure legends associated with each figure. A p-value < 0.05 was considered significant. All statistical tests were performed using GraphPad Prism 7. The number of animals used in each experiment was also indicated in each plot in the figures. Data Availability Raw RNA-seq data are available at National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) website, Data Sets: GSE226780. Code Availability No custom code was used in the collection of data. Fluorescence imaging was performed with Olympus Fluoview 1000 laser scanning microscope with Fluoview software. Hematoxylin and eosin staining imaging was performed with bright field microscope (Olympus). qRT- PCR was performed in duplicate using iTaq Universal SYBR Green (BioRad, 1725121) and the CFX384 Touch Real-Time PCR Detection System (BioRad). RNA-seq data was collected with NextSeq500 (Illumina). Analysis of fluorescence signal intensity and counting cells were performed with Fiji (version 1.0). All statistical tests were performed using GraphPad Prism 7. FASTQ files by RNA-seq were analyzed using CLC Genomics Grid Workbench v22.0.2. Read counts were generated and differentially expressed genes were obtained using CLC Genomic Workbench v22.0.2. Heatmaps and volcano plots were generated using CLC Genomic Workbench v23.0.1 and GraphPad – Prism 9.0. Venn diagram online analysis provided by VIB / UGent Bioinformatics & Evolutionary Genomics was used. Example 2: Synergistic effects of fluvastatin and MBV on optic nerve regeneration and RGC protection after ONC In the mouse studies, first it was investigated whether intravitreal injections of fluvastatin promote retinal axon regeneration after optic nerve crush (ONC) in 8-week old wild-type (WT) C57BL / 6J mice (FIGs.1A-1C). Fluvastatin requires a ~100-fold greater concentration than cerivastatin to enhance axon outgrowth to the same extent in vitro (Li et al., Cell Rep 16, 545-558, 2016). Therefore two μL of 1 mM, 3 mM and 9 mM fluvastatin or PBS as a negative control were tested. The frequency of injections was increased from once to twice, administered a few minutes and two days after ONC (FIG.1A). Repeated intravitreal injections potentially cause damage to the lens of the ONC-injured eye that augments the inflammatory responses by activated macrophages (Leon et al., J Neurosci 20, 4615-4626, 2000). Thus, to test whether intravitreal injections affect inflammation after ONC, we intravitreally injected PBS twice after ONC and analyzed the number of macrophages (F4 / 80+cells) three days after ONC. The number of F4 / 80+cells in the ONC-injured retina treated with PBS is comparable to that in the ONC-injured retina without any injections. Thus, at least intravitreal injections twice after ONC led to no increase in macrophages (FIGs. 8A-8B). The number of regenerated axons from the lesion site was quantified using the anterograde axonal tracer Alexa Fluor 555-conjugated cholera toxin subunit B (CTB) two weeks after ONC. Among three different concentrations, 3 mM fluvastatin showed the greatest number of regenerated axons at 400 μm from the lesion site and regenerated axons extended up to 800 μm from the lesion site (FIG.1C). However, the 1 mM and 9 mM concentrations also generated statistically significant axon regeneration as compared to control. It is known that RGC death and neurodegeneration do not occur evenly across the retina in optic neuropathies (Lee et al., PLoS One 11, e0157388, 2016) and previous work demonstrated molecular mechanisms underlying ventral-region specific RGC death (Kingston et al., PLoS Genet 17, e1009885, 2021). With this heterogeneous distribution, RGC survival was quantified in four quadrants: ventrotemporal (VT), ventronasal (VN), dorsotemporal (DT) and dorsonasal (DN) of the peripheral and middle retina (400 μm x 600 μm area) two weeks after ONC. It was found that 3 mM fluvastatin showed two-fold increase in RGC survival when compared to PBS in the peripheral DT, DN and VT retina, while it had no neuroprotective effects in peripheral VN retina or any regions of the middle retina (FIGs.1D-1E). The average of RGC survival rates from all retinal regions showed a 1.5-fold increase in RGC survival for fluvastatin when compared to PBS. Thus, fluvastatin promoted optic nerve regeneration and showed RGC protective effects in the peripheral retina. Next, identification of complementary RGC protective agents to increase the number of surviving RGCs treated with fluvastatin after ONC were studied. Matrix-bound nanovesicles (MBV) as a neuroprotective agent were focused on because MBV, which were prepared from porcine urinary bladders, inhibit RGC death in an ocular hypertension rat model, and MBV also stimulate RGC axon outgrowth in vitro (van der Merwe et al., Sci Rep 9, 3482, 2019). In this study, MBV derived from the same source, porcine urinary bladders, were used and examined to determine whether intravitreal injections of MBV a few minutes and two days after ONC promote axon regeneration and RGC protection after ONC (FIG.1A). To minimize batch-to-batch variations, quality control was performed to ensure the size and concentrations of particles by Nanosight nanoparticle tracking analysis and imaging with transmission electron microscopy (TEM) (FIGs.9A-9B). Since intravitreal injections of 1 μL of 5 μg / mL of MBV attenuated RGC death in an ocular hypertension rat model (van der Merwe et al., Sci Rep 9, 3482, 2019), 2 μL of 5, 20 and 80 μg / mL (0.58 x 109, 2.3 x 109and 9.2 x 109particles / mL, respectively) of MBV were tested (FIG.1A). It was found that 2.3 x 109particles / ml of MBV more robustly enhanced axon regeneration, and regenerated axons extended up to 400 μm from the lesion site (FIGs.1B-1C). However, the 0.58 x 109and 9.2 x 109particles / mL also provided statistically significant axon regeneration compared to control. Next, the effects of 2.3 x 109particles / ml MBV on RGC neuroprotection two weeks after ONC were investigated (FIGs.1D- 1E). MBV protected RGCs in all peripheral and middle retinal regions except for middle VN regions, when compared to PBS controls (FIG.1E). These data confirm that MBV show protective effects on both optic nerve regeneration and RGC protection after ONC. The effects of combining 3 mM for fluvastatin and 2.3 x 109particles / ml for MBV on RGC protection and optic nerve regeneration two weeks after ONC following intravitreal injections of fluvastatin and MBV together a few minutes and two days after ONC were investigated next (FIG.1A). The combined treatment also enhanced RGC survival in all peripheral and middle retinal regions when compared to PBS (FIGs.1D-1E). Surprisingly and unexpectedly, based on the average RGC survival rate in all retinal regions, the combined treatment of fluvastatin and MBV yielded higher neuroprotective outcomes when compared to either fluvastatin or MBV alone (FIG.1E). Furthermore, the combined treatment surprisingly and unexpectedly more robustly promoted axon regeneration when compared to PBS, fluvastatin or MBV alone (FIGs.1F-1G). For example, at 400 μm from the lesion site, 754 regenerated axons were detected in the injured nerve treated with the combination of fluvastatin and MBV, while only 112 or 108 regenerated axons were detected in the injured nerve treated with either fluvastatin or MBV alone, respectively (FIG.1C, 1G), an almost 7-fold difference. Furthermore, regenerated axons after the combined treatment of fluvastatin and MBV were detected up to 1200 μm from the lesion site, while fluvastatin or MBV alone extended regenerated axons only to 800 or 400 μm, respectively. The neuroprotective and regenerative effects of different batches of MBV with fluvastatin was measured and were confirmed to have similar outcomes (FIGs.10A-10B). Thus, surprisingly and unexpectedly, MBV and fluvastatin synergistically enhance axon regeneration and RGC protection pan-retinally. This synergistic enhancement was not predictable from axon regeneration data for MBV alone or fluvastatin alone. Example 3: Identification of differentially expressed genes by MBV and fluvastatin after ONC Next the molecular mechanisms underlying robust enhancement of axon regeneration and RGC neuroprotection by the combination therapy was studied. Within three days, RGCs begin to die (van der Merwe et al., Sci Rep 9, 3482, 2019; Yang et al., Cells 9, 2020). Prior to that, within two days after optic nerve crush or nerve transection, expression of intrinsic and extrinsic molecules relevant to RGC protection and / or axon regeneration is significantly altered (Tran et al., Neuron, 2019; Yasuda et al., PLoS One 9, e93258, 2014; Yasuda et al., Sci Rep 6, 28736, 2016). Thus, the whole retina was collected at two days after ONC following intravitreal injections of either MBV or fluvastatin alone, the combination of MBV and fluvastatin, or PBS as a negative control a few minutes after ONC, and differentially expressed genes (DEGs) were identified by bulk RNA sequencing (RNA-seq) (FIG.2A). DEGs with p-value < 0.05 revealed 4,684, 5,741 or 1,721 DEGs in the injured retina treated with either fluvastatin or MBV alone, or the combination of MBV and fluvastatin, respectively, when compared to PBS (FIG.2B). Among them, genes altered by a combination of MBV and fluvastatin include previously identified genes which are expressed in RGCs that mediate axon regeneration such as Rab34, Rab27b (Sekine et al., Cell Rep 23, 415-428, 2018), Gal, Crh (Jacobi et al., Neuron, 2022) and Gap43 (Schaden et al., J Neurobiol 25, 1570-1578, 1994). Next, DEGs with an FDR p-value < 0.05 and a fold-change of at least 2 (referred to as top DEGs) when compared to PBS were identified (FIG.2B). Among the top 192 DEGs induced by the combination of MBV and fluvastatin, surprisingly 133 (69.3%) appeared only when MBV and fluvastatin were co-injected (FIG.2B). Ingenuity pathway analysis identified the top 10 enriched cellular processes in each treatment (FIG.2C). The combination of MBV and fluvastatin broadly influenced immune cell-related pathways such as phagosome formation, Th1 and Th2 activation, complement, neuroinflammation signaling and granulocyte adhesion and diapedesis, some of which are involved in RGC survival / death and optic nerve regeneration (Baldwin et al., Proc Natl Acad Sci U S A 112, 2581-2586, 2015; Yong et al., Cell Mol Immunol 16, 540- 546, 2019). In contrast, fluvastatin alone had no effects on immune responses. MBV are involved in regulation of both non-immune cell-mediated pathways and immune cell-mediated pathways such as agranulocyte adhesion and diapedesis, and neuroinflammation signaling. Among the top DEGs, studies were focused on the 20 DEGs with the highest fold-changes and an FDR p-value < 0.05 (referred to as the top 20 DEGs) in the injured retina with combined treatment when compared to PBS (FIGs.2D-2F). These top 20 DEGs were all up-regulated by the combined treatment, and most of them showed an increase in expression levels (FIG.2D). Next, the fold-changes of these top 20 DEGs were compared to those from the single treatments (FIG.2E).13 DEGs were upregulated only when MBV and fluvastatin were co-injected. Three DEGs were upregulated by MBV alone as well; however, fold-changes by the combined treatment were surprisingly more robust than those elicited by MBV alone. The remaining four DEGs were unchanged or downregulated by the combined treatment when compared to MBV or fluvastatin alone. These top 20 DEGs include Ccr2 (Benhar et al., Nat Immunol, 2023), Sirpb1c (Weinreb et al., Science 367, 2020), Cd209a (Menezes et al., Immunity 45, 1205-1218, 2016), Ly6C2 (Jordao et al., Science 363, 2019), and Slamf7 (Maekawa et al., Blood 134, 814-825, 2019), which are normally expressed in monocytes, and Cxcr2 (Benhar et al., Nat Immunol, 2023), Atp8b4 (Rawat et al., Front Immunol 11, 587946, 2020), H2-aa (Lok et al., Proc Natl Acad Sci U S A 116, 19083-19089, 2019) and Clec4n (Jerome et al., Front Immunol 13, 912193, 2022) which are expressed in neutrophils. Among those DEGs, further analysis using qPCR confirmed that genes expressed in monocytes (Ccr2 and Cd209a) and genes expressed in neutrophils (Cxcr2, Atp8b4, and H2-aa) are significantly upregulated by the combination of MBV and fluvastatin compared to PBS two days after ONC (FIG.2F). Thus, the combination of MBV and fluvastatin more significantly stimulated gene expression related to immune responses compared to either MBV or fluvastatin alone after ONC. Example 4: Neutrophil and monocyte infiltration is enhanced by MBV and fluvastatin Since the genes indicative of monocytes and neutrophils are upregulated by the combination of MBV and fluvastatin two days after ONC, it was hypothesized that the combined treatment could enhance infiltration of monocytes and neutrophils within a few days after ONC (FIGS.3A-3G). To test the hypothesis, monocyte and neutrophil infiltration efficacy was quantified by flow cytometry at three days and at the later time point to define the duration of the effectiveness, seven days after ONC following intravitreal injections of MBV and fluvastatin or PBS as previously analyzed for neuroprotection and axon regeneration (FIG.3A). Using Ly6G (Ly6Ghi) expression in CD11b+cells, neutrophils were able to be distinguished from other myeloid-derived cells (Xie et al., Proc Natl Acad Sci U S A 118, 2021) (FIG.3B). Significantly more neutrophils infiltrated the retina in mice treated with the combined treatment compared to mice treated with PBS three days after ONC (FIG.3C). As cells highly expressing Ly6C (Ly6Chi) were plotted and defined as monocytes (Xie et al., Proc Natl Acad Sci U S A 118, 2021; Hammond et al., J Neurosci 34, 3901-3909, 2014), is was also confirmed that infiltration of CCR2+Ly6C+monocytes was greater in the retina treated with the combined treatment compared to PBS three days after ONC (FIGs.3B-3C). In contrast, at seven days after ONC, the combined treatment had no impact on enhancement of infiltration of neutrophils and monocytes within the retina. Thus, the combined treatment transiently stimulates infiltration of neutrophils and monocytes after ONC. Next, these effects were reexamined using cryosections of the injured retina three days after ONC. First it was confirmed that neutrophils (Ly6G+cells), monocytes (CCR2+cells) and RGCs (βIII-tubulin+cells) were easily distinguishable in the injured retina treated with the combined treatment (FIG.3D). Then the magnitude of infiltration of those immune cells by either fluvastatin or MBV alone to the combined treatment three days after ONC was compared (FIGs.3E-3F). It was found that the combined treatment, but not fluvastatin or MBV alone, enhanced neutrophil infiltration. Furthermore, fluvastatin had no effect on infiltration of monocytes, and MBV showed a slightly increased number of monocytes. However, the combined treatment was more effective in stimulating monocyte infiltration than MBV alone. Next the localization of these infiltrating immune cells by the combined treatment was examined (FIG.3G). ~80% of infiltrating neutrophils and monocytes were located within the ganglion cell layer (GCL), the inner plexiform layer (IPL) and in the intravitreal area within 100 µm above the GCL. Thus, the combination of MBV and fluvastatin more robustly facilitated infiltration of neutrophils and monocytes than either MBV or fluvastatin alone after ONC. Example 5: Neutrophils and monocytes infiltrated by MBV and fluvastatin regulate axon regeneration and neuroprotection It was hypothesized that RGC neuroprotection and axon regeneration by the combined treatment could be regulated by infiltrating neutrophils and monocytes. Therefore, it was investigated whether depleting these immune cells dampened RGC survival and optic nerve regeneration even though MBV and fluvastatin were co-injected (FIG.4). To deplete neutrophils, the anti-mouse Ly6G 1A8 clone antibody was used (hereafter referred to as 1A8) which has been previously utilized in the retina and other tissues (Xie et al., Proc Natl Acad Sci U S A 118, 2021; Stackowicz et al., Front Immunol 10, 3130, 2019).1A8 or an isotype-matched IgG2a antibody as a negative control were intraperitoneally injected at five intervals: two days and one day before ONC, and a few minutes, one, two and three days after ONC (FIG.4A). To deplete monocytes, the Ccr2- / -mouse was used (Boring et al., J Clin Invest 100, 2552-2561,1997), which results in a significant reduction in monocyte recruitment (Hammond et al., J Neurosci 34, 3901-3909, 2014). To deplete both immune cell types, 1A8 was intraperitoneally injected into the Ccr2- / -mouse, as above. It was confirmed that neutrophils (Ly6G+cells) and / or monocytes (Ly6Chicells) were absent after immune cell depletion even though fluvastatin and MBV were co-injected (FIGs.11A-11B). Next, it was determined whether increased RGC survival by fluvastatin and MBV after ONC was dependent on infiltrating neutrophils and / or monocytes (FIGs.4B-4C). Depletion of either neutrophils or monocytes alone, or both cell types, led to a reduction in RGC survival in all peripheral retinal quadrants, DT, DN, VT and VN, even though MBV and fluvastatin were co-injected. Furthermore, given the average RGC survival rate from all peripheral retinal regions, depletion of both neutrophils and monocytes resulted in a more significant reduction in RGC survival when compared to depletion of either neutrophils or monocytes alone. It was then investigated whether neutrophils and monocytes contributed to optic nerve regeneration two weeks after ONC. When either neutrophils or monocytes were depleted, axon regeneration efficacy (number of regenerated axons from the lesion site) was attenuated. Depletion of both neutrophils and monocytes led to minimal axonal regeneration outcomes even though MBV and fluvastatin were co-injected (FIGs.4D- 4E). These data support a model in which infiltrating neutrophils and monocytes, stimulated by fluvastatin and MBV, are required for RGC protection and axon regeneration after ONC. Example 6: Elevated CCL2 expression in the superficial layer of the retina treated with MBV and fluvastatin directs monocyte infiltration The molecular mechanisms underlying enhanced infiltration of neutrophils and / or monocytes by MBV and fluvastatin was explored next. The RNA-seq data was analyzed and searched for differentially expressed cytokines, as these could act as attractants for neutrophils and / or monocytes in the ONC retina (FIGs.2A-2F, 5A-5I). Ccl2 (Mcp-1, monocyte chemotactic protein-1) was amongst the top 30 DEGs by MBV and fluvastatin when compared to PBS (FIG.5A). Ccl2 encodes a key chemokine that mediates the recruitment of monocytes, where its receptor CCR2 is highly expressed (FIGS.3B-3G). Ccl2 is up-regulated by the combined treatment when compared to PBS, and elevated expression of Ccl2 was detected in all biological replicates (FIG.5B). The magnitude of CCL2 protein expression in the uninjured and injured retinae treated with the single or combined treatments or PBS as a control three days after ONC was assessed (FIGs.5C-5D). It was found that the combination of MBV and fluvastatin robustly increased expression of CCL2 only in the superficial retinal layer, and that CCL2 colocalized with GFAP+cells where vimentin is co-expressed, suggesting CCL2 is upregulated in Müller glia (Benhar et al., Nat Immunol, 2023). It was also tested whether CCL2 is highly upregulated by the combined treatment in other cells such as RGCs (Tuj1+cells) and / or astrocytes (S100B+cells) (Benhar et al., Nat Immunol, 2023) three days after ONC. It was found that elevation of CCL2 expression was not detected in RGCs nor astrocytes (FIG.12). In contrast, MBV alone showed low levels of CCL2 expression, while fluvastatin alone had no effect (FIG. 5C). Next, CCL2 levels in each treatment condition were quantified (FIG.5D). CCL2 expression was not significantly altered in the injured retina after ONC compared to the intact retina. In the injured retina, fluvastatin alone had no effect on CCL2 levels, but MBV alone resulted in a ~1.57-fold increase in CCL2 expression compared to PBS. The combined treatment more robustly upregulated CCL2 levels over single treatments, supporting the notion that monocyte infiltration by the combined treatment could be triggered by elevated expression of CCL2. In contrast to the retina, the combined treatment showed no increase in the number of neutrophils (Ly6G+cells) and expression of CCL2 and CCR2 at the lesion site three days after ONC when compared to PBS (FIG.13A-13B). Next, it was examined whether elevated CCL2 expression by the combined treatment contributed to monocyte infiltration after ONC (FIG.5E). Using Ccl2- / -mice (Lu et al., J Exp Med 187, 601-608, 1998) and WT mice as a positive control, flow cytometric analysis revealed that fluvastatin and MBV promoted monocyte infiltration in WT mice, but not in Ccl2- / -mice three days after ONC, while neutrophil infiltration was not affected in Ccl2- / -mice. Next it was then investigated whether loss of CCL2 impacts the combined MBV and fluvastatin treatment-mediated RGC protection (FIGs.5F-5G) and axon regeneration after ONC (FIGs.5H-5I). It was found that enhancement of RGC protection and axon regeneration by the combination of MBV and fluvastatin was attenuated in Ccl2- / -mice when compared to WT mice. Thus, MBV and fluvastatin synergistically evoke CCL2 expression in the retina, leading to enhancement of monocyte infiltration, which induces RGC protection and axon regeneration. Activation of Müller glia leads to upregulation of CCL2 expression and infiltration of CCR2+monocytes after light-induced injury (Feng et al., Mol Vis 23, 765-777, 2017) or retinal detachment (Nakazawa et al., Proc Natl Acad Sci U S A 104, 2425-2430, 2007), resulting in photoreceptor degeneration (Nakazawa et al., Invest Ophthalmol Vis Sci 48, 2760-2768, 2007). An additional concern is that prolonged intraocular inflammation might induce cataracts as unwanted side effects that limit the potential clinical use. Thus, it was investigated whether MBV and fluvastatin induced cataract and affected thickness of other retinal cell layers, and / or the number of other retinal cells such as photoreceptors (FIGs.14A-14E). It was found that the combined treatment did not induce cataract two weeks after ONC as similarly seen in the injured retina treated with PBS (FIG.14A). Moreover, thickness of the whole and individual retinal layer such as INL and ONL, and other cell types like photoreceptors and bipolar cells were not affected by MBV and fluvastatin two weeks after ONC compared to the uninjured retina treated with PBS (FIGs.14B-14E). Thus, the combined treatment had little effect on induction of cataract and the number of other retinal cells. Example 7: IL-33, an MBV-contained cytokine, acts synergistically with fluvastatin to enhance monocyte infiltration The identities of MBV-contained factors that act with fluvastatin remain unknown. However, MBV derived from porcine urinary bladders and other tissues consistently contain IL-33 (Hussey et al., J Immunol Regen Med 3, 26-35, 2019). IL-33 mediates CCL2 expression in astrocytes and CCR2+monocyte recruitment upon eukaryotic parasite infection in the brain (Still et al., PLoS Pathog 16, e1009027, 2020), making it an intriguing candidate. First, it was confirmed whether ectopic expression of recombinant IL-33 alone increased monocyte infiltration after ONC, and it was found that 2 μL of 50 μg / mL, but not 2 and 10 μg / mL, of IL-33 protein significantly enhanced infiltration of monocytes three days after ONC (FIG.6A). Next, the overarching hypothesis that IL-33 in conjunction with fluvastatin could synergistically enhance monocyte infiltration as seen following treatment with the combination of MBV and fluvastatin was evaluated. It was found that 2 μL of 2 or 10 μg / mL of IL-33 alone or fluvastatin alone had little effect on monocyte infiltration, but the combination of 2 or 10 μg / ml of IL-33 and fluvastatin significantly increased monocyte infiltration after ONC to the same extent as 50 μg / ml of IL-33 alone. However, 50 μg / mL of IL-33 and fluvastatin did not show any further increased monocyte infiltration when compared to 50 μg / mL of IL- 33 alone. Thus, fluvastatin potentiates the effects of IL-33 at low concentrations on monocyte infiltrations after ONC. In contrast, neutrophil infiltration was not affected by the combined treatments. The synergistic effects of IL-33 (10 μg / mL) and fluvastatin on monocyte infiltration correlated with magnitudes of elevation of CCL2 expression was next investigated (FIGs.6B-6C), axon regeneration (FIGs. 6D-6E), and RGC protection (FIGs.6F-6G) after ONC. First, CCL2 levels in the injured retina treated with IL-33 alone, the combination of IL-33 and fluvastatin, and PBS as a negative control were quantified (FIGs. 6B-6C). Although fluvastatin had no impact on CCL2 expression (FIGs.5C-5D), the combination of IL-33 and fluvastatin more robustly increased CCL2 expression in the superficial layer of the retina, in particular by GFAP+ / vimentin+cells, Müller glia (Benhar et al., Nat Immunol, 2023) as similarly observed by MBV and fluvastatin treatment (FIGs.6B-6C). Moreover, the combination of IL-33 and fluvastatin showed more robust axon regeneration and RGC protection when compared to either IL-33 or fluvastatin alone or PBS controls two weeks after ONC. Thus, the combination of IL-33 and fluvastatin showed enhancement of CCL2 expression and consequent monocyte infiltration, leading to RGC protection and axon regeneration after ONC. However, RGC protective and regenerative outcomes by IL-33 and fluvastatin were much lower than those by MBV and fluvastatin, which could be caused by little neutrophil infiltration in the retina. Example 8: The combinatorial regenerative therapy with MBV, fluvastatin and AAV2 virus-mediated gene therapy To enable regenerated axons to extend longer in the injured retina treated with fluvastatin and MBV, the adeno-associated virus (AAV)-based gene therapy, which stimulates intrinsic regenerative signals in RGCs was focused on (FIG.7). To identify an AAV-mediated therapeutic partner, which is compatible with fluvastatin and MBV, a known statin-mediated downstream pathway, protein prenylation was targeted (Li et al., Cell Rep 16, 545-558, 2016; Holmberg et al., J Neurotrauma 23, 1366-1378, 2006). Statins inhibit protein prenylation pathways, and prenylation inhibitors, FTI and GGTI promote axon outgrowth even on inhibitory substrates in vitro and enhance retinal axon regeneration after ONC similar to the effect of statins (Li et al., Cell Rep 16, 545-558, 2016). Although FTI and GGTI each block distinct enzymes, FTase- and GGTase-I-mediated prenylation pathways respectively, farnesyltransferase (FNTA, encoded by Fnta) is a common component of both FTase and GGTase-I, suggesting that knocking down of Fnta can mimic functions of prenylation inhibitors FTI and GGTI in neurons. Thus, the effects of AAV2-shFnta viruses alone and the combination of MBV, fluvastatin and AAV2-shFnta viruses on axon regeneration after ONC were tested. First, the virus infection and knockdown efficiency of AAV2-GFP-shFnta viruses compared to AAV2-GFP-shCtr viruses two weeks after intravitreal injections was investigated. It was confirmed that two weeks after injections of AAV2-GFP-shFnta or AAV2-GFP-shCtr viruses, 92.9% or 95.5% of RGCs express GFP, respectively (n=5, 1039 RGCs in the retinae with AAV2-GFP-shFnta virus and 831 RGCs in the retinae with AAV2-GFP-shCtr virus were analyzed in total, N.S., two-tailed unpaired t-test) (FIG.7A). It was also confirmed by qPCR that Fnta mRNA levels in the whole retina were reduced by 67.0% in the AAV2-GFP-shFnta-injected retina, when compared to AAV2-shCtr virus-injected retina (FIG.7B). FNTA protein expression was detected in the ganglion cell layer (GCL) and inner plexiform layer (IPL), and the expression in the GCL was reduced by 71.0% by AAV2-GFP-shFnta viruses compared to AAV2-GFP- shCtr viruses (FIG.7C-7D). Following AAV2-GFP-shFnta or control virus infection two weeks prior to ONC, ONC was performed and then the number of regenerated axons in the injured nerve two weeks after injury were examined (FIGs.7E-7F). It was confirmed that AAV2-GFP-shFNTA virus increased the number of regenerated axons, which extended up to 800 μm from the lesion site when compared to AAV2-GFP- shCtr virus. Next, it was examined whether injections of AAV2-GFP-shFnta viruses post-injury can further robustly elongate regenerated axons in the retina treated with the combination of fluvastatin and MBV (FIGs.7G-7I). Intravitreal injections of fluvastatin and MBV a few minutes and two days after ONC were performed, and AAV2-GFP-shFnta viruses were injected four days after ONC, and axon regeneration was analyzed four weeks instead of two weeks after ONC because AAV-mediated gene transduction is slow: at least one to two weeks are needed to reach robust expression of transgenes and then enhance regenerative outcomes (FIG.7G). All combinations - fluvastatin, MBV and AAV2-GFP-shFnta viruses robustly enhanced axon regeneration and increased the number of extending regenerated axons from the lesion site. For example, at 2000 μm from the lesion site, 135 regenerated axons were detected in the injured nerve treated with the combination of fluvastatin and MBV with AAV2-GFP-shFnta viruses, while only 11 axons were extended by fluvastatin, MBV and control viruses. The regenerated axons extended up to 3000 μm from the lesion site, but the tips of regenerated axons did not reach the brain (FIGs.7H-7I). In contrast, RGC survival was slightly enhanced by all three combinations of fluvastatin and MBV with AAV2-GFP-shFnta viruses compared to fluvastatin and MBV with control viruses (FIGs.7J-7K). Thus, the combinatorial therapy with MBV, fluvastatin and AAV2 virus-mediated inhibition of prenylation pathways in RGCs is effective for promoting further regenerative outcomes post-injury. The potential synergistic effects of the combination of statin / fluvastatin and MBV on axon regeneration and RGC protection after ONC, by which infiltration of monocytes and neutrophils is enhanced was examined. It was also demonstrated that combining non-cell autonomous regenerative mechanisms by fluvastatin and MBV with blocking anti-regenerative pathways in RGCs by AAV2 viruses knocking down Fnta led to improvement of regenerative outcomes. Thus, the molecular assembly from distinct therapeutic reagents synergistically promotes neuroprotection and axon regeneration after nerve injury. This study demonstrated that infiltration of neutrophils and monocytes is enhanced by the combination of fluvastatin and MBV after ONC. Surprisingly, when MBV and fluvastatin are co-injected, neutrophils and monocytes are robustly infiltrated, resulting in enhancement of RGC protection and axon regeneration after ONC. The disclosed studies revealed that the combination of fluvastatin and IL-33, a cytokine enriched within MBV, mimics the effects of fluvastatin and MBV on enhancement of monocyte infiltration by increasing CCL2 expression by Müller glia in the superficial layer of the retina, and the other study has shown that statin and IL-2 synergistically induce IFN-γ production in peripheral blood mononuclear cells while either statin or IL-2 alone fails to upregulate IFN-γ expression (Gruenbacher et al., Cancer Res 70, 9611-9620, 2010). Thus, the present study contributes to identification of molecular mechanisms underlying neuroprotection and axon regeneration by statin and MBV via specific cytokine(s). It was confirmed that at least two different batches of MBV from the same porcine urinary bladders, when combined with fluvastatin, showed the same magnitude of RGC protection and axon regeneration after ONC. Either fluvastatin or MBV alone showed narrow therapeutic windows compared to PBS. However, the combined treatment induced significantly more robust regenerative and neuroprotective outcomes compared to PBS, and either fluvastatin or MBV alone. Thus, when they are applied together, fluvastatin and MBV retain much higher efficiency in promoting neuroprotection and axon regeneration than PBS alone, suggesting that instead of single use, the combined treatment could be clinically more beneficial. The results suggest that the combination therapy, fluvastatin and MBV could be applied as therapeutic molecular interventions acting in non-cell-autonomous manner. This data showed that fluvastatin and MBV therapy had no induction of cataract and no effects on thickness of other retinal layers and the number of photoreceptors and bipolar cells after ONC. These outcomes could be explained by two reasons: (1) infiltration of monocytes and neutrophils by the combined treatment is transient, and (2) ~80% of infiltrating neutrophils and monocytes are located only within the GCL and IPL or in the intravitreal area. Thus, the combination therapy using statin and specific cytokines enriched within MBV (e.g. IL-33) or driving intrinsic regenerative mechanisms in RGCs by the combination therapy can also augment axon regeneration and RGC protection. Example 9: Materials and Methods in Porcine Model Animals All animal experiments were performed according to appropriate guidelines. C57BL / 6J mice (referred to as WT, Jackson Laboratory, JAX: 000664) were used in the study. Both male and female mice were used in this study. All mice were housed in a pathogen-free barrier facility and were maintained in a 12 h light / dark cycle with access to standard laboratory chow and water ad libitum. Optic nerve crush To perform ONC in mice as previously described (Kingston et al., PLoS Genet 17, e1009885, 2021), 8-10-week-old mice were anesthetized with ketamine / xylazine. The optic nerve of the left eye was crushed using #5 Dumont forceps with applying pressure for 5s at ~5 mm behind the optic disc. At specific time points described in figure legends after ONC or without ONC, mice were humanely euthanized with CO2 and perfused with 4% paraformaldehyde (PFA) following PBS. The heads were post-fixed in 4% PFA overnight at 4°C and washed with PBS, and the mouse retina were dissected for further analysis. Preparations of MBV Porcine urinary bladders from market-weight pigs (Animal Biotech) were thawed, and all layers were mechanically removed leaving the lamina propria and basement membrane as previously described (Huleihel et al., Sci Adv 2, e1600502, 2016). Urinary bladder matrix (UBM) was decellularized with 0.1% peracetic acid with 4% ethanol for 2 hours at 300 rpm. The tissue was rinsed with successive PBS and sterile water washes and then lyophilized and milled into particulate with a Wiley Mill with a #60 mesh screen. MBV were prepared by digesting lyophilized UBM-ECM with 100ng / mL LIBERASE® TL (5401020001, Sigma-Aldrich Corp., St. Louis, MO) in buffer (50mM Tris pH 7.5, 5mM CaCl2, 150mM NaCl) at room temperature overnight. Digested UBM was put through successive centrifugations: 500 x g for 10 minutes, 2500 x g for 20 minutes, and 10,000 x g for 30 minutes to remove ECM debris. Supernatant was then filtered through a 0.22 µm membrane. The clarified MBV supernatant was centrifuged at 100,000 x g (Beckman Coulter Optima L-90K Ultracentrifuge) at 4˚C for 70 min to pellet the MBV. MBV purity and count were assessed by Nanosight Nanoparticle Tracking analysis and resuspended in particle-free sterile PBS. Intravitreal injection For intravitreal injections into the pig retina, 175 µL of 6mM fluvastatin (Sigma, SML0038), 25 μL of 1x1010particles of MBV, and 200 µL of PBS were prepared. Each reagent or PBS was intravitreally injected with Hamilton microsyringes within an hour, two and five days after ONC in pigs. Isolation of the pig optic nerve and retina The facial tissue and extraocular muscles were dissected away from the optic nerves and the globes. Once the optic nerve was identified and could be properly traced to the optic canal, the inferior glabella was carefully broken away piecewise. The dura was also removed to ensure appropriate mobility and access. Once the optic chiasm was identified, the optic tracts were cut posterior to the chiasm, which allowed for removal of the entire globe and optic nerve on each side. From there, the samples (entire globe and optic nerves) were placed in formalin. For processing, the optic nerves were cut in half cross-sectionally, resulting in two portions (one proximal to the globe and one distal to the globe) of each nerve, and those nerves were embedded in paraffin to make 15 µm thick paraffin sections. For processing the retinae, the anterior chamber was removed using a scalpel blade and the lens was removed, and then eye cups were fixed further for 24 hours and prepared for 10 µm thick cryosections. Immunohistochemistry and imaging For immunostaining of the pig optic nerves, paraffin nerve sections were deparaffinized by washing with xylene three times for three mins each, with 100% ethanol twice for one minute each, with 90% ethanol once for one min, with 75% ethanol once for one minute, and then with H2O for two minutes. Sections were then submerged in 1x Tris-EDTA solution for 10 minutes at 95°C, and then sections were washed with TBST (20mM Tris PH 7.5, 150mM NaCl, 0.1% Tween-20) once for three minutes for further immunostaining. TBST buffer was used for washing and immunostaining with GAP43 and secondary antibodies in the pig nerves. PBST (0.05% triton-x in PBS) was utilized for washing and immunostaining with βIII-tubulin and secondary antibodies in the pig nerves and the pig and mouse retina following incubation in MeOH for two minutes. PBS was utilized for washing and immunostaining with CCR2, CD18, CD11B, IBA1, and Ly6G antibodies and secondary antibodies in the pig and mouse retina following incubation in MeOH for two minutes. Sections were incubated with the primary antibodies overnight at room temperature only for immunostaining with CCR2, CD18, CD11B, IBA1, and Ly6G antibodies or 4°C for the rest of staining and with the secondary antibodies for a few hours at room temperature. Immunolabeling was performed with the following primary and secondary antibodies and DAPI: rabbit GAP43 (1:500, Abcam, ab232772), rabbit βIII-tubulin (1:500, Abcam, ab52623) for the retina, mouse βIII- tubulin (1:500, Lifetechnology, MA1118) for the nerve, guinea pig RBPMS (1:500, Millipore, ABN1376), rabbit RBPMS (1:500, PhosphoSolutions, 1830), guinea pig RBPMS (1:500, PhosphoSolutions, 1832), mouse CCR2 (1:500, R&D systems, MAB150), Alexa Fluor 647 Ly6G (1:300, Biolegend, 127609), Alexa FITC CD18 (1:200, Biolegend, 302105), rat CD11B (1:300, ThermoFisher, MA5-17857), mouse IBA1 (1:200, Millipore, MABN92), goat anti-Rabbit IgG 488 antibody (1:200, Lifetechnology, A-11034), donkey anti-Rabbit IgG 647 (1:500, Lifetechnology, A-31573), goat anti-Guinea Pig IgG 647 (1:500, Lifetechnology, A21450), donkey anti-Mouse IgG 647 (1:500, Lifetechnology, A-31571), goat anti-Mouse IgG 488 (1:500, Lifetechnology, A-11001), goat anti-Rat IgG 647 (1:500, Abcam, ab150159), and DAPI (1:500, ThermoFisher, D1306). Fluoromount-G (SouthernBiotech, 0100-01) and Fluoro-Gel mounting medium (Electron Microscopy Sciences, 17985-11) was utilized to mount slides for imaging. Olympus Fluoview 1000 laser scanning microscope with Fluoview software, a 10x objective lens (UPlans Apo NA=0.4) and a 40× objective lens (UPlanFL N NA=1.3) and Zeis Axiocam MRc. with 20x objective lens (LD Plan-NEOFLUAR; 20x / 0,4 Korr; 421350-9970) were used for imaging. RGC survival analysis Three 10 µm non-consecutive cryosections of the injured left eye and intact contralateral right eye in the same animal were examined. RGC survival analysis was performed by counting the βIII-tubulin+RGCs in a 300 µm-retinal column in five retinal areas (#1 - #5) as described in FIG.16B. The average RGC survival in all retinal regions (%) was provided by dividing the total RGC number from all five retinal regions of the injured retina by the total number in the intact retina. Immune cell infiltration analysis For quantification of CD18+CD11B+cells and CCR2+cells, three 10 μm non-consecutive cryosections of the injured retina per animal were examined. Total number of CD18+CD11B+cells and CCR2+cells from two 300 µm x 300 µm areas in the vitreous adjacent to the central regions of the retina per section was provided as shown in FIG.18B, and the average from three sections per animal was calculated. For quantification of IBA+cells, we examined two 10 μm non-consecutive cryosections of the injured and intact retina per animal. The total number of IBA+cells from three 300 µm-retinal columns as shown in FIG. 18D per section was provided, and the average from three sections per animal was calculated. Expression analysis on optic nerve samples For quantification of βIII-tubulin fluorescent signals, two 15 μm non-consecutive optic nerve paraffin sections were used for analysis per animal. Images were taken with the same setting of the inverted confocal microscope. The mean pixel intensity of 1000 µm-column at 3000, 6000, 9000, and 18000 µm from the most proximal region of the nerve (closest to the globe) and the expression levels at each site were measured with Fiji software, and the average of the mean pixel intensity from two sections per animal was obtained. The fold change of βIII-tubulin expression at each site, 3000, 6000, 9000, and 18000 µm in the injured nerve treated with MBV and fluvastatin based on the average value in the injured nerve treated with PBS was calculated. For quantification of GAP43 signals, 20x images were taken at each site along the entire length of both the proximal and distal portions of the nerve. To determine the GAP43 signal intensity, ImageJ was used to quantify the GAP43 intensity of each 20x image at each site of the nerve. The GAP43 intensity values were then obtained, and the average of the values at 0 - 2120, 2650 – 4770, 5300 – 7950, 8480 – 11130, and 11660 – 14310 µm from the most proximal region of the nerve (closest to the globe) were provided per animal. Statistical analysis Both male and female adult pigs were randomly included in each sample group because this study was not intended to test for differences between males and females. All data were analyzed, and graphs were constructed using Fiji (version 1.0) and Microsoft Excel. All error bars represent the standard deviation (SD), and statistical analysis was determined using unpaired two-tailed Student’s t-test, or one-way ANOVA or two-way ANOVA followed by the Tukey’s post hoc test, as indicated in the figure legends associated with each figure. A p-value < 0.05 was considered significant. All statistical tests were performed using GraphPad Prism 7. The number of animals used in each experiment was also indicated in each plot in the figures. Example 10: RGC survival is enhanced by MBV and fluvastatin after porcine ONC Using the established porcine ONC (FIG.15), it was investigated whether loss of RGCs was observed two weeks after injury, and then RGC loss was attenuated by intravitreal injections of the combination of MBV and fluvastatin when compared to PBS as a negative control (FIGs.16A-16C). To maximize the neuroprotective outcomes, concentrations, volumes, and frequencies of MBV and fluvastatin combined treatment were considered. Given the effective concentrations and volume of MBV and fluvastatin in the injured mouse retina whose vitreous volume is 20 μL, it was decided to intravitreally inject both 1.0 x 1010particles of MBV in 25 µL solution and 6mM fluvastatin in 175 µL solution or 200 µL of PBS as a negative control into the injured pig retina whose vitreous volume is 3.5 mL (Awwad et al., Eur J Pharm Biopharm 153, 130-149, 2020). Multiple intravitreal injections of MBV and fluvastatin are needed to strengthen the effects on neuroprotection and axon regeneration, but to minimize retinal damage. Based on previous studies in mice and rats (van der Merwe et al., Sci Rep 9, 3482, 2010), two intravitreal injections of MBV and fluvastatin after ONC in mice (within a few minutes and two days following injury) and three intravitreal injections of MBV after elevation of IOP in rats (within a few minutes and two and five days after injury) showed robust regenerative and neuroprotective outcomes. Thus, it was decided to intravitreally inject MBV and fluvastatin or PBS three times after ONC in pigs - within an hour and two and five days after ONC. Since βIII-tubulin and RBPMS have been broadly utilized as pan-RGC markers in the mouse retina, the expression of βIII-tubulin and RBPMS in cryosections of the intact pig retina was analyzed by immunostaining with the specific antibodies, which can recognize mouse RGCs (FIGs.20A-20B). Expression of βIII-tubulin was clearly detected in the mouse and pig retina. However, RBPMS expression was observed in the mouse retina, while the expression was hardly detected in pig retina (FIGs.20A-20B). Two different antibodies for RBPMS were tested, and they failed to detect RBPMS expression in the pig retina (FIG.20B), suggesting that specific fixation and / or preparations of the pig retinal tissues may be needed for clearly and consistently detecting RBPMS in pig RGCs. Thus, βIII-tubulin+cells in the ganglion cell layer (GCL) were utilized as RGCs in subsequent assays (FIGs.20A-20B). RGC survival in the retina treated with PBS or the combination of MBV and fluvastatin two weeks after porcine ONC was studied (FIGs.16A-16C). It was found that a significant reduction in RGCs in the injured retina treated with PBS was observed when compared to the intact retina. However, the combination of MBV and fluvastatin was still capable of maintaining RGCs to some extent in the injured retina (FIG. 16A). RGC survival (%) in the injured retina treated with the combined treatment or PBS was quantified (FIGs.16B-16C). After immunostaining with βIII-tubulin and DAPI in the intact right retina and injured left retina treated with PBS or MBV and fluvastatin in the same animal, the number of βIII-tubulin+RGCs in the five 300 µm-width sectors were counted: #1 peripheral, #2 peripheral / middle, #3 middle, #4 middle / central, and #5 central retinal regions per section of the intact and injured retina, and provided RGC survival (%) (FIG.16B). The injured retina treated with PBS showed ~50% of RGC survival in all five retinal regions. In injured retina treated with MBV and fluvastatin, RGCs in #1 peripheral and #2 peripheral / middle retina were preserved, while RGCs were slightly, but not significantly decreased in #3 middle and #4 middle / central retina, and a significant loss of RGCs in #5 central retinal retina was observed (FIG.16B). Based on the average of all five regions, it was confirmed that MBV and fluvastatin treatment demonstrated higher RGC survival than PBS two weeks after ONC (RGC survival (%): MBV + fluvatstain, 73.9 ± 1.1 %; PBS (Ctr), 48.8 ± 1.1 %) (FIG.16C). Thus, using the established porcine ONC, it was confirmed that loss of RGCs and the high RGC protective effects of MBV and fluvastatin combined treatment after injury, as similarly observed in the mouse injured retina. Example 11: MBV and fluvastatin attenuate optic nerve degeneration and enhance optic nerve regeneration after porcine ONC Next, optic nerve degeneration was studied two weeks after porcine ONC based on expression of βIII-tubulin in the optic nerve (FIGs.17A-17E), since βIII-tubulin has been utilized to evaluate the magnitude of optic nerve degeneration after mouse ONC (Mackiewicz et al., Mol Neurobiol, 2024; Rao et al., Sci Rep 13, 5592, 2023). First, the expression of βIII-tubulin in the intact nerve and injured nerve treated with PBS two weeks after ONC was examined, and it was confirmed that expression of βIII-tubulin was detected in the intact nerve, but not the injured nerve treated with PBS (FIG.17A). The effect of the combination of MBV and fluvastatin on optic nerve degeneration after porcine ONC was next examined (FIG.17A). Intriguingly, it was found that the combined treatment showed moderate expression of βIII- tubulin in the injured optic nerve (FIG.17A). The βIII-tubulin expression from the proximal region to the distal region of the nerve was examined at 3000, 6000, 9000, and 18000 µm from the most proximal region of the nerve (FIG.17B) and the expression levels at each site in the injured retina treated with MBV and fluvastatin compared to PBS two weeks after ONC were quantified (FIG.17C). βIII-tubulin+axons were detected at proximal and even distal sites of the nerve treated with MBV and fluvastatin, but not PBS (FIG. 17C). Quantitatively, the combination of MBV and fluvastatin retained higher expression of βIII-tubulin at all proximal and distal sites of the nerve when compared to PBS (FIG.17C) Thus, the combination of MBV and fluvastatin attenuated optic nerve degeneration after porcine ONC. Since the previous study revealed that the combined treatment enhances optic nerve regeneration in mouse ONC, it was investigated whether MBV and fluvastatin also promote regeneration of the porcine optic nerve two weeks after ONC (FIG.17D). Since GAP43 has been utilized as a marker for optic nerve regeneration (Kurimoto et al., J Neurosci 33, 14816-14824, 2013), expression of GAP43 in sectioned optic nerve treated with MBV and fluvastatin or PBS two weeks after ONC was examined (FIG.17D), and GAP43+area from the proximal region to the distal region of the nerve was measured (FIG.17E). Within the proximal region (up to 4770 µm from the most proximal region of the nerve), GAP43+area was comparable between the combined treatment and PBS. However, GAP43+area was much larger at the distal regions of the nerve treated with MBV and fluvastatin when compared to PBS (FIGs.17D-17E). Thus, the combination of MBV and fluvastatin attenuated optic nerve degeneration and enhanced nerve regeneration after porcine ONC. Example 12: Immunomodulation of MBV and fluvastatin after porcine ONC To investigate the mechanisms underlying enhancement of neuroprotection and axon regeneration by the combination of MBV and fluvastatin after porcine ONC, the immunomodulatory effects of the therapy was focused on, because previous work using mouse ONC revealed that infiltration of monocytes and neutrophils is enhanced by the combination of MBV and fluvastatin, and infiltrated monocytes and neutrophils lead to robust RGC protection and optic nerve regeneration. It was investigated whether the combination of MBV and fluvastatin lead to more significant infiltration of monocytes and neutrophils as compared to a PBS negative control after porcine ONC (FIGs.18A-18D). The molecular markers for porcine monocytes and neutrophils in the retina were first explored. In the mouse retina, CCR2 is highly expressed in monocytes infiltrated by the combined treatment, and loss of CCR2 leads to little monocyte infiltration and a reduction in RGC protection and axon regeneration after ONC, and CCR2 is expressed in porcine monocytes (Moreno et al., Vet Res 41, 76, 2010), suggesting that CCR2 can be used as a marker for porcine monocytes (FIG.18A). Mouse neutrophils express Ly6G, and Ly6G+neutrophil filtration is enhanced by the combined treatment after mouse ONC. However, Ly6g gene does not exist in pigs and humans. Instead of Ly6G, it has been reported that porcine neutrophils express CD18 in CD11B+leukocytes (Bator et al., Mediators Inflamm 2, 135-141, 1993; Bonilla et al., Int J Mol Sci 23, 2022). Indeed, neutrophils are not a homogeneous cell population (Sas et al., Nat Immunol 21, 1496- 1505, 2020) and the combined treatment-induced neutrophils may not express CD18 / CD11B. Thus, it was confirmed in the mouse retina treated with the combined treatment after ONC that 91.5 % of Ly6G+neutrophils express CD18 and all Ly6G+neutrophils express CD11B (FIGs.21A-21B), suggesting that CD18 / CD11B is a defined marker for porcine neutrophils, which could be infiltrated by the combined treatment (FIG.18A). It was determined whether monocytes and / or neutrophils were more robustly enhanced in the vitreous by MBV and fluvastatin than PBS as a negative control two weeks after ONC (FIGs.18A-18B). It was found that within the vitreous of the retina treated with PBS, only a few CCR2+monocytes and CD18+ / CD11B+neutrophils were detected, while MBV and fluvastatin combined treatment increased the number of monocytes and neutrophils (FIG.18A). Further quantitative analysis revealed that the combined treatment showed 9.92 fold-change of monocyte infiltration and 19.6 fold-change of neutrophil infiltration when compared to PBS (FIG.18B). As the number of microglia / macrophages increase in the retina after mouse ONC (Peterson et al., J Neurosci, 2021), and those cells have been also implicated to mediate optic nerve degeneration in mice after ONC (Au et al., Front Immunol 13, 860070, 2022), it was also examined whether MBV and fluvastatin affected the number of microglia / macrophages two weeks after ONC (FIG.18C). Based on the number of IBA1+cells which has been defined as microglia / macrophages in the porcine retina (Heng et al., JCI Insight 9, 2024; Johansson et al., Exp Eye Res 200, 108217,2020), it was found that the number of microglia / macrophages in the injured retina treated with PBS increased when compared to uninjured retina. However, MBV and fluvastatin suppressed an increased number of microglia / macrophages after ONC (FIGs.18C-18D). Taken together, MBV and fluvastatin showed the immunomodulatory effects in the retina such as enhanced infiltration of monocytes and neutrophils and suppression of the number of microglia / macrophages after porcine ONC. It also was investigated whether the combination of MBV and fluvastatin prevented visual function loss two weeks after porcine ONC by measuring visual evoked potentials (VEPs) (FIG.19). No visual function activities in the injured retina treated with PBS as a negative control were found, but , surprisingly, MBV and fluvastatin maintain the visual activities even after ONC. In view of the many possible aspects to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated aspects are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

We claim:

1. A method of increasing retinal ganglion cell survival, retinal ganglion cell axon regeneration, optic nerve survival, and / or optic nerve regeneration in a subject in need thereof, comprising locally administering to an eye of the subject a therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof; thereby increasing retinal ganglion cell survival, retinal ganglion cell axon regeneration, optic nerve survival, and / or optic nerve regeneration in the subject.

2. The method of claim 1, further comprising selecting the subject in need of increased retinal ganglion cell survival, retinal ganglion cell axon regeneration, optic nerve survival, and / or optic nerve regeneration.

3. The method of claim 1 or claim 2, wherein the nanovesicles (i) maintain expression of F4 / 80 and CD-11b on macrophages in the subject, (ii) comprise lysyl oxidase, and (iii) do not express CD63 or CD81, or are CD63loCD81lo.

4. The method of any one of claims 1-3, wherein the statin is atorvastatin, rosuvastatin, simvastatin, pravastatin, fluvastatin, lovastatin, or pitavastatin.

5. The method of any one of claims 1-3, wherein the statin is fluvastatin.

6. The method of any one of claims 1-4, wherein the nanovesicles are derived from a mammalian extracellular matrix.

7. The method of claim 6, wherein the mammalian extracellular matrix is from a porcine, bovine, or ovine extracellular matrix.

8. The method of claim 7, wherein the mammalian extracellular matrix is a porcine extracellular matrix.

9. The method of any one of claims 1-8, wherein the extracellular matrix is esophageal, urinary bladder, small intestine, dermis, umbilical cord, pericardium, cardiac, skeletal muscle, liver, kidney, lung, large intestine, or stomach extracellular matrix.

10. The method of any one of claims 1-8, wherein the extracellular matrix is urinary bladder matrix (UBM) or small intestinal submucosa (SIS).

11. The method of any one of claims 1-10, wherein the nanovesicles comprise miR-145 and / or miR-181.

12. The method of any one of claims 1-11, wherein the isolated nanovesicles and the statin are administered intravitreally or subretinally by injection.

13. The method of any one of claims 1-12, wherein the isolated nanovesicles and the statin are administered repeatedly to the eye of the subject.

14. The method of claim 13, wherein the isolated nanovesicles and the statin are each administered weekly, bimonthly, or monthly to the subject.

15. The method of any one of claims 1-14, wherein the isolated nanovesicles and the statin are administered to the subject simultaneously or in succession.

16. The method of any one of claims 1-15, wherein the subject has glaucoma.

17. The method of any one of claims 1-15, wherein the subject has retinal ganglion cell and / or optic nerve degeneration caused by injury.

18. The method of any one of claims 1-15, wherein the subject has retinal ganglion cell and / or optic nerve degeneration caused by a genetic disorder.

19. The method of any one of claims 1-15, wherein the subject has optic neuropathy.

20. The method of claim 19, wherein the optic neuropathy is pressure-independent glaucomatous optic neuropathy, ischemic optic neuropathy, inflammatory optic neuropathy, compressive optic neuropathy, or traumatic optic neuropathy.

21. The method of claim 19, wherein the optic neuropathy is arteritic ischemic optic neuropathy, arteritic ischemic optic neuropathy associated with giant cell arteritis, nonarteritic ischemic optic neuropathy, infiltrative optic neuropathy, infiltrative optic neuropathy associated with sarcoidosis, infectious optic neuropathy, infectious optic neuropathy associated with syphilis, infectious optic neuropathy associated with Lyme disease, infectious optic neuropathy associated with toxoplasmosis, infectious opticneuropathy associated with herpes zoster, optic neuritis from demyelinating disease, post-radiation optic neuropathy, hereditary optic neuropathy, hereditary optic neuropathy associated with dominant optic neuropathy, compressive optic neuropathy, compressive optic neuropathy associated with orbital pseudotumor, compressive optic neuropathy associated with thyroid eye disease, autoimmune optic neuropathy, or autoimmune optic neuropathy associated with Lupus.

22. The method of any one of claims 1-21, wherein the isolated nanovesicles and the statin are formulated together in a pharmaceutical formulation further comprising a pharmaceutically acceptable carrier.

23. The method of claim 22, wherein the pharmaceutical formulation is a liquid pharmaceutical formulation.

24. The method of any one of claims 1-21, wherein the isolated nanovesicles are formulated in a liquid formulation that does not include the statin.

25. The method of any one of claims 1-21, or 24, wherein the statin is formulated in a liquid formulation that does not include the isolated nanovesicles.

26. The method of any one of claims 1-25, wherein the statin is administered in an amount of 50 to 5000 µg per administration.

27. The method of any one of claims 1-25, wherein the statin is administered in an amount of about 50 to about 1000 µg per administration.

28. The method of any one of claim 1-27, wherein the statin is administered in a volume of 10 to 100 µL of a solution comprising about 2 mM to about 15 mM of the statin.

29. The method of claim 28, wherein the volume is about 25-50 µL.

30. The method of any one of claims 1-29, wherein the nanovesicles are administered in a volume of 10 to 100 µL of a solution comprising about 1x109to about 1x1011nanovesicles / mL.

31. The method of claim 30, wherein the volume is about 25-50 µL.

32. A therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use in increasing retinal ganglioncell survival, optic nerve survival, and / or optic nerve regeneration in a subject, wherein the isolated nanovesicles and the statin are formulated for ophthalmic administration.

33. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 32, wherein the nanovesicles (i) maintain expression of F4 / 80and CD-11b on macrophages in the subject, (ii) comprise lysyl oxidase, and (iii) do not express CD63 or CD81, or are CD63loCD81lo.

34. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 32 or 33, wherein the statin is atorvastatin, rosuvastatin, simvastatin, pravastatin, fluvastatin, lovastatin, or pitavastatin.

35. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claim 34, wherein the statin is fluvastatin.

36. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-35, wherein the nanovesicles are derived from a mammalian extracellular matrix.

37. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 36, wherein the mammalian extracellular matrix is a porcine, bovine, or ovine extracellular matrix.

38. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 35, wherein the mammalian extracellular matrix is a porcine extracellular matrix.

39. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-38, wherein the extracellular matrix is esophageal, urinary bladder, small intestine, dermis, umbilical cord, pericardium, cardiac, skeletal muscle, liver, kidney, lung, large intestine, or stomach extracellular matrix.

40. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one ofclaims 32-38, wherein the extracellular matrix is urinary bladder matrix (UBM) or small intestinal submucosa (SIS).

41. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-38, wherein the nanovesicles comprise miR-145 and / or miR-181.

42. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-41, wherein the nanovesicles are for administration intravitreally or subretinally.

43. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-42, wherein the nanovesicles are for repeated administration to the eye of the subject.

44. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 43, wherein the nanovesicles are for weekly, bimonthly or monthly administration.

45. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-44, wherein the subject that has glaucoma.

46. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-44, wherein the subject has retinal ganglion cell and / or optic nerve degeneration caused by injury.

47. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-44, wherein the subject has retinal ganglion cell and / or optic nerve degeneration caused by a genetic disorder.

48. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-47, wherein the subject has optic neuropathy.

49. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 48, wherein the optic neuropathy is pressure-independent glaucomatous optic neuropathy, ischemic optic neuropathy, inflammatory optic neuropathy, compressive optic neuropathy, or traumatic optic neuropathy.

50. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 48, wherein the optic neuropathy is arteritic ischemic optic neuropathy, arteritic ischemic optic neuropathy associated with giant cell arteritis, nonarteritic ischemic optic neuropathy, infiltrative optic neuropathy, infiltrative optic neuropathy associated with sarcoidosis, infectious optic neuropathy, infectious optic neuropathy associated with syphilis, infectious optic neuropathy associated with Lyme disease, infectious optic neuropathy associated with toxoplasmosis, infectious optic neuropathy associated with herpes zoster, optic neuritis from demyelinating disease, post-radiation optic neuropathy, hereditary optic neuropathy, hereditary optic neuropathy associated with dominant optic neuropathy, compressive optic neuropathy, compressive optic neuropathy associated with orbital pseudotumor, compressive optic neuropathy associated with thyroid eye disease, autoimmune optic neuropathy, or autoimmune optic neuropathy associated with Lupus.

51. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-50, wherein the isolated nanovesicles and the statin are formulated together in a pharmaceutical formulation further comprising a pharmaceutically acceptable carrier.

52. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 51, wherein the pharmaceutical formulation is a liquid pharmaceutical formulation.

53. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-50, wherein the isolated nanovesicles are formulated in a liquid formulation that does not include the statin.

54. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-50 or 53, wherein the statin is formulated in a liquid formulation that does not include the isolated nanovesicles.

55. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-54, wherein the statin is for administration in amount of about 50 µg to about 5000 µg.

56. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-55, wherein the statin is for administration in an amount of about 50 µg to about 1000 µg.

57. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-56, wherein the statin is formulated at a concentration of about 2 mM to about 15 mM and is for administration in a volume of about 10 µL to about 100 µL.

58. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 57, wherein the volume is about 25 µL to about 50 µL.

59. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of any one of claims 32-58, wherein the nanovesicles are formulated at a concentration of about 1x109to about 1x1011nanovesicles / mL and for administration in a volume of about 10 µL to about 100 µL.

60. The therapeutically effective amount of (a) isolated nanovesicles derived from an extracellular matrix and (b) a statin or a pharmaceutically acceptable salt thereof, for use of claim 59, wherein the volume is about 25 µL to about 50 µL.

61. The method of claim 16, further comprising administering to the subject a therapeutically effective amount of one or more agents that lower intraocular pressure.

62. The method of claim 61, wherein the one or more agents is a prostaglandin analog, a beta- adrenergic blocker, an alpha-adrenergic agonist, and / or a cholinergic agonist.

Images