Use of OBF1 transcription factor in plant chromosome doubling and transgenic plant cultivation method

Abstract

Disclosed in the present invention are the use of an OBF1 transcription factor in plant chromosome doubling and a transgenic plant cultivation method. The present invention introduces the OBF1 gene into plant cells or tissue under treatment with kanamycin, so as to obtain a transgenic cell line or transgenic plant with doubled chromosomes, the gene sequence of the OBF1 transcription factor being shown as SEQ ID NO: 1, and the plant being Petunia hybrida, Solanum lycopersicum and Nicotiana tabacum.

Description

Application of OBF1 transcription factor in plant chromosome doubling and transgenic plant breeding methods Technical Field

[0001] The present invention relates to the field of genetic engineering technology and genetics, and specifically relates to the application of OBF1 transcription factor in plant chromosome doubling and a transgenic plant breeding method. Background Art

[0002] Plant ploidy alterations are a key research topic in plant biology, plant biotechnology, and plant breeding. Compared to diploids, autopolyploids exhibit enlarged organs and increased metabolite content, offering excellent breeding value for crops whose vegetative organs are harvested and for asexual propagation. Therefore, chromosome doubling holds significant theoretical and commercial value.

[0003] Existing methods often use chemical agents and physical treatments to induce chromosome doubling in plant cells. For example, colchicine, nitrous oxide, heat treatment, methylaminopropylphosphonate, trifluralin, oryzanol, and propionamide have been used to produce a variety of plant chromosome-doubling lines. Additionally, 8-hydroxyquinoline, monobromonaphthalene, a mixture of monobromonaphthalene and colchicine, and a mixture of colchicine and 8-hydroxyquinoline can also be used to double plant chromosomes.

[0004] Among the above many methods, colchicine is commonly used as a doubling agent, but the doubling effect of colchicine on plants is difficult to meet the needs of the above research, and the main problem is that colchicine is greatly damaged to the plant material processed, often causing abnormal plant growth, deformity or even the death of the processed material, and easily causing plants to be unable to self-pollinate. In addition, colchicine is highly toxic and has greater toxicity and potential carcinogenicity to mammals including humans, and has a greater harm to the health and environmental safety of operators. Another kind of material commonly used for chromosome doubling is nitrous oxide gas, but nitrous oxide gas is not as effective as colchicine, which limits the application of nitrous oxide gas in chromosome doubling technology. Therefore, research and development of a brand-new plant chromosome doubling method has become one of the technical barriers faced by researchers in this area.

[0005] Summary of the Invention

[0006] The first object of the present invention is to provide an application of OBF1 transcription factor in plant chromosome doubling.

[0007] Specifically, the present invention provides the following technical solutions:

[0008] An application of an OBF1 transcription factor in plant chromosome doubling, wherein the gene sequence of the OBF1 transcription factor is shown in SEQ ID NO: 1, and the protein sequence thereof is shown in SEQ ID NO: 2.

[0009] Specifically, under the treatment of kanamycin, the OBF1 gene is introduced into the original plant cells or tissues to obtain a transgenic cell line or transgenic plant with doubled chromosomes.

[0010] Specifically, an existing plant expression vector can be used to construct a recombinant expression vector containing the OBF1ORF fragment, wherein the vector is a plant expression vector carrying kanamycin resistance.

[0011] When using the constructed OBF1 recombinant plant expression vector, any enhanced promoter or constitutive promoter, or chemically inducible promoter can be added before its transcription initiation nucleotide. These promoters can be used alone or in combination with other plant promoters.

[0012] To facilitate the identification and screening of transgenic plant cells or plants, all plant expression vectors can be modified, such as by adding a gene encoding an enzyme or luminescent compound that can be expressed in plants (such as the GUS gene or luciferase gene). Alternatively, the addition of a selectable marker gene can be omitted, and transformed plants can be screened directly based on chromosome doubling.

[0013] Specifically, the recombinant expression vector can be inserted into the plant expression vector multiple cloning site into the deoxyribonucleic acid from position 1 to position 486 from the 5' end of the sequence shown in SEQ ID NO: 1 to obtain the OBF1 overexpression vector.

[0014] Expression vectors carrying coding genes can be used to transform cells or tissues through biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultivated into plants.

[0015] The second object of the present invention is to provide a plant breeding method.

[0016] The method may include the following technical solutions:

[0017] (1) crossing at least first and second parent plants to produce a heterozygous plant comprising a selected genetic background;

[0018] (2) producing a diploid progeny plant derived from the hybrid plant;

[0019] In embodiments of the present invention, the initial plant can be further defined as a diploid plant, wherein the T1 generation plant is a doubled diploid plant. The initial plant can be an interspecific hybrid plant or an intraspecific hybrid plant. Such a hybrid plant can be a member of a heterologous plant population, such as a plant population from open pollination. The hybrid plant can be obtained from any hybrid material, including local varieties, composites of different genetic backgrounds, and other plant collections.

[0020] The starting plant used in the present invention can be a dicotyledonous plant. Examples of dicotyledonous plants include tomato, tobacco and petunia.

[0021] (3) at the developmental stage of the initial plant forming pollen, cotyledons, hypocotyls, and young leaves, the plant is transformed with the overexpression OBF1 vector treated with kanamycin, the plant including the pollen, cotyledons, hypocotyls, and young leaves of the initial plant and the development of the plant after transformation;

[0022] In an embodiment of the present invention, the initial plants are treated with a selected concentration (pressure) of kanamycin. The selected pressure for the initial generation of kanamycin is 100 mg / g, or may be from about 100 mg / g to about 150 mg / g. In a further embodiment of the present invention, the plants are treated with kanamycin for a period of time, which may be the time required from wound callus to rooting, with the specific treatment duration varying depending on the species.

[0023] In an embodiment of the present invention, the TO generation seed is processed with the kanamycin of selected concentration (pressure).The selected pressure of second generation kanamycin is 25mg / g, also can be about 15mg / g to about 30mg / g.In a further embodiment of the present invention, with kanamycin, process seed for a period of time, the time period of selection can be from seed to the required time of germination, because of species difference, then specifically process duration difference.

[0024] (4) The T0 generation plants are self-pollinated to obtain homozygous strains, which have the characteristics of organ enlargement and chromosome doubling.

[0025] (5) selecting doubled diploid progeny plants derived from self-pollination, wherein the progeny plants have a desired genetic background; the plant chromosome doubling trait can be stably inherited.

[0026] (6) Self-pollination of the starting plants and the doubled plants can be performed by any method, including natural self-pollination and artificial self-pollination.

[0027] The OBF1 gene provided by the present invention can be introduced into plant cells or tissues using any vector that carries kanamycin resistance and can direct exogenous gene expression in plants. Under treatment with a certain kanamycin concentration, transgenic cell lines and transgenic plants with chromosome doubling can be efficiently obtained. The plant chromosome doubling can specifically involve the enlargement of plant bodies, plant organs, plant tissues, or cultured plant cells, resulting in chromosome doubling.

[0028] The research results show that when the OBF1 gene of the present invention is transferred into petunia, tomato and tobacco, and the gene is overexpressed in the plants under a certain pressure of kanamycin selection, the transgenic plants show enlarged leaves, flowers, seeds and stems, and increased cell size; the transgenic plants are easy to self-pollinate, and the chromosome doubling trait can be stably inherited.

[0029] Furthermore, the transgenic plants are resistant to gray mold pathogens. In pathogen infection experiments, T2 generation plants carrying the OBF1 gene showed resistance to pathogen infection, indicating that the OBF1 gene and its encoded protein provided by the present invention can significantly improve plant disease resistance.

[0030] Specifically, the present invention provides a method for cultivating OBF1 transgenic plants, comprising the following steps:

[0031] (1) Primers were designed for the ORF region of the OBF1 gene to obtain primers OE_F1 and OE_R1; wherein the sequence for amplifying the OBF1 ORF fragment is shown in SEQ ID NO: 3-4,

[0032] OE_F1:ATCTCGAGATGGCATCTTCTAGTGGAAA;

[0033] OE_R1: ATGAGCTCTCACATACTGATAGAACATAT.

[0034] (2) using the primers to perform PCR amplification and clone the OBF1 gene fragment; constructing the OBF1 gene overexpression fragment into a plant expression vector carrying kanamycin resistance to obtain a recombinant plasmid;

[0035] (3) 1 μl of recombinant plasmid was mixed with 100 μl of competent Agrobacterium and transferred into a 2510 electroporation cuvette. The transformation was performed by electroporation at 2510 V using an electric shock device. After transformation, the mixture was spread onto LB solid medium containing antibiotics to screen for Agrobacterium carrying the recombinant plasmid.

[0036] (4) expanding the culture of Agrobacterium carrying the recombinant plasmid; infecting the initial young plant tissues with the Agrobacterium; the young tissues include cotyledons, hypocotyls, young leaves, and pollen;

[0037] (5) The young tissue is cultured on a medium with kanamycin selection pressure to obtain callus tissue, which is then regenerated and screened to obtain new shoots; the new shoots are cut, and further cultured for seedling growth and rooting to obtain seedlings, which are then transferred to soil for further culture;

[0038] (6) After the seedlings continue to grow stably, leaf samples are taken and DNA is extracted using the CTAB method. PCR amplification is performed using the primer pair NPTII_F and NPTII_R with the extracted DNA as a template to confirm that the OBF1 gene sequence has been transferred into the plant, and a T0 generation transgenic strain is obtained.

[0039] Wherein, the sequences of NPTII_F and NPTII_R are shown in SEQ ID NO: 5-6,

[0040] NPTII_F: AAGATGGATTGCACGCAGGT;

[0041] NPTII_R:AGCTTCAAAGCAGATCCAAG.

[0042] (7) After the T0 generation transgenic lines bloom, they are self-pollinated to obtain T1 generation seeds, which are further screened on the second generation kanamycin resistance culture medium to obtain homozygous chromosome-doubled progeny, namely the T2 generation transgenic plants.

[0043] (8) The T2 generation transgenic plants were further cultured and self-pollinated. It was found that the T3 generation plants stably inherited the chromosome doubling trait.

[0044] Compared with the prior art, the present invention has the following beneficial effects:

[0045] The present invention's research results show that kanamycin treatment of young petunia tissue transformed with the OBF1 gene resulted in an increase in leaves, petals, styles, stigmas, anthers, seeds, stems, and cells in the transgenic plants, characteristics associated with chromosome doubling. Flow cytometry and cytological experiments confirmed that under a certain level of kanamycin selection pressure, OBF1 overexpression caused chromosome doubling in the plants. In addition to enlarged organs, the doubled plants exhibited normal growth, vigorous growth, and were easily self-pollinated, demonstrating that this trait is stably inherited. To further validate this phenotype, kanamycin treatment of young tomato and tobacco tissue transformed with the OBF1 gene also observed chromosome doubling in these transgenic tomatoes and tobacco. Further studies confirmed that the chromosome doubling trait was stably inherited in pureline offspring selected through self-pollination. The development of pureline chromosome-doubling plants is of great significance for the development of commercial varieties for seed crops, flowers, fruit trees, and vegetables. Homozygous chromosome-doubling plants can be directly used as commercial varieties.

[0046] Transgenic plants with doubled chromosomes exhibit resistance to biotic stresses, such as resistance to the pathogen Botrytis cinerea. This has important theoretical and practical implications for the development of biotic stress-tolerant plant varieties and can be used to cultivate and identify disease-resistant plant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 shows the phenotypes of petunia plants overexpressing and gene-silencing the OBF1 transcription factor; the overexpressing plants were named 100-2, 150-2, and 150-5; the gene-silenced plants were named 2-6, 6-3, and 8-1; the wild type was designated WT;

[0048] Figure 2 shows that overexpression of OBF1 increases the stem diameter of petunia; (A) cross section of the main stem; (B) main stem diameter;

[0049] Figure 3 shows that overexpression of the OBF1 gene increases the leaf width of petunia (the 6th leaf);

[0050] Figure 4 shows a photograph (A) and a bar graph (B) showing that overexpression of OBF1 increases the length of the hypocotyl in petunia;

[0051] Figure 5 shows photographs (A) and a bar graph (B) showing that overexpression of OBF1 increases petunia petal size;

[0052] Figure 6 shows photographs (A) and bar graphs (B, C) showing that overexpression of OBF1 increases petunia anther size;

[0053] Figure 7 shows photographs (A) and a bar graph (B) showing that overexpression of OBF1 increases the stigma size of petunia;

[0054] Figure 8 shows photographs (A) and bar graphs (B, C) showing that overexpression of OBF1 increases the size and weight of petunia seeds;

[0055] FIG9 shows that overexpression of OBF1 increases petunia cell size;

[0056] FIG10 is flow cytometry confirmation that overexpression of OBF1 leads to chromosome doubling in petunia;

[0057] Figure 11 shows the chromosome counts at the root tips of petunias overexpressing OBF1;

[0058] Figure 12 shows flow cytometry confirmation that overexpression of OBF1 leads to chromosome doubling in tomato; the overexpressing plant was named OX21

[0059] FIG13 shows chromosome counts in root tips of tomatoes overexpressing OBF1;

[0060] FIG14 shows flow cytometry confirmation that overexpression of OBF1 leads to chromosome doubling in tobacco; the overexpressing plant is named T100-2;

[0061] FIG15 shows that OBF1 overexpression enhances the resistance of petunia to gray mold;

[0062] FIG16 shows that OBF1 overexpression enhances tomato resistance to gray mold;

[0063] FIG17 shows that OBF1 overexpression enhances tobacco's resistance to gray mold. DETAILED DESCRIPTION

[0064] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0065] Example 1 Culture method for inducing chromosome doubling and resistance in petunia

[0066] (1) Primers were designed for the ORF region of the OBF1 gene. The overexpression primer sequences are as follows (SEQ ID NO: 3-4):

[0067] OE_F1:ATCTCGAGATGGCATCTTCTAGTGGAAA;

[0068] OE_R1: ATGAGCTCTCACATACTGATAGAACATAT.

[0069] The gene silencing primer sequences are as follows (SEQ ID NO: 7-8):

[0070] rnai-F1:ATACTAGTGGCCGCCAGTGAAATCCTTCGTTCTGGT

[0071] rnai-R1:ATGGATCCATTTAAATCATTGAACCTGATGAATTTCC.

[0072] (2) Using the above primers, PCR amplification was performed to clone the OBF1 gene fragment; the OBF1 gene silencing fragment was constructed into the pGSA1285 vector; the OBF1 gene overexpression fragment was constructed into the pGSA1403 vector to obtain a recombinant plasmid;

[0073] (3) 1 μl of recombinant plasmid was mixed with 100 μl of competent Agrobacterium and transferred into an electroporation cuvette. The mixture was electroporated at 2510 V using an electric shock device. After transformation, the mixture was spread onto LB solid medium containing the antibiotic chloramphenicol to screen for Agrobacterium carrying the recombinant plasmid.

[0074] (4) Wild-type petunia seeds surface-sterilized with sodium hypochlorite were germinated in 1 / 2 MS medium and cultured in a culture room for 4 weeks;

[0075] (5) Cut the young leaves and cut them into squares of about 5 mm in length and width using a scalpel on a clean workbench;

[0076] (6) activating and expanding the culture of the Agrobacterium carrying the recombinant plasmid in step (3);

[0077] (7) Place the leaves cut in step (5) in the bacterial solution in step (6) and shake at 200 rpm for 15 to 20 minutes at room temperature;

[0078] (8) Transfer the infected young leaves to the co-cultivation medium and keep them in the dark for two days;

[0079] (9) Two days later, the leaves were transferred to regeneration medium containing the corresponding selected resistance, and the medium was changed every two to three weeks to wait for differentiation;

[0080] (10) The differentiated new shoots are transferred to a new screening medium and then to a rooting medium.

[0081] The culture conditions in the tissue culture room are: temperature 22-24°C, light / darkness: 16h / 8h, light intensity 1500-2000lx.

[0082] Kanamycin concentration settings and culture medium configurations are shown in Table 1 below;

[0083] Table 1

[0084] (11) After the seedlings continue to grow and stabilize, leaf samples are taken and DNA is extracted using the CTAB method. PCR amplification is performed using the primer pair NPTII_F and NPTII_R (as shown in SEQ ID NOs: 5-6) with the extracted DNA as a template to confirm that the OBF1 gene sequence has been transferred into the plant.

[0085] NPTII_F: AAGATGGATTGCACGCAGGT;

[0086] NPTII_R:AGCTTCAAAGCAGATCCAAG.

[0087] The OBF1 gene-transgenic petunia was named T0 transgenic line and was transferred to a solar greenhouse for cultivation.

[0088] (12) The phenotypes of petunia plants overexpressing the transgene and those silenced by the gene are shown in Figure 1 . The sizes of the stems, leaves, hypocotyls, petals, anthers, stigmas, and seeds of the different strains are shown in Figures 2-8 .

[0089] (13) Take young petunia leaves, place them in paraformaldehyde fixative for 2 h, rinse them three times with deionized water, and tear the leaf epidermis by hand. Place them upside down on the stage of a laser confocal scanning microscope (LSM880, ZEISS) to observe the cell size of the seedling leaves, as shown in Figure 9.

[0090] (14) Flow cytometry was used to identify the ploidy of the plants, and the doubling ratios of the plants treated with different kanamycin concentrations were calculated. The results are shown in Table 2 and Figure 10. As shown in Figure 10, the chromosome doubling detection of the plants was a single peak, indicating that the doubling plants were pure lines, and no chimeras were detected, indicating that the probability of pure line plants was 100%.

[0091] Table 2 The proportion of petunia with chromosome doubling after overexpressing OBF1 under treatment with different concentrations of kanamycin

[0092] (15) The root tip of petunia was taken and pretreated, fixed, water-bathed, and stained using conventional methods. A small amount of meristem tissue from the root tip was cut and pressed into a slide for observation and chromosome counting, as shown in Figure 11.

[0093] (16) Before the anthers of the T0 generation strain matured and the petals opened, self-pollination was performed to obtain T1 generation seeds, which were then cultured and self-pollinated to obtain T2 generation seeds. The T2 generation seeds were disinfected with sodium hypochlorite and sown. -1 Screening was continued on MS medium containing kanamycin to observe the segregation of T2 generation plants. The germination rate of T2 generation seeds on MS medium containing kanamycin was 100%, and the chromosome doubling rate was 100%. These T2 generation seeds were homozygous chromosome-doubled seeds.

[0094] (17) Select T2 generation homozygous transgenic line seeds and sow them for cultivation, continue to observe plant phenotypes and other agronomic traits, and perform flow cytometry detection using the method of step (14) above;

[0095] (18) Leaves of the homozygous transgenic strain overexpressing the OBF1 gene were inoculated with the gray mold pathogen. The transgenic plant (100-2) showed a stronger disease resistance phenotype than the wild type, as shown in Figure 15.

[0096] Example 2 Cultivation Method for Inducing Chromosome Doubling of Tomatoes

[0097] (1) Tomato seeds disinfected with 15% sodium hypochlorite for 15 min and 75% alcohol for 45 s were sown in a medium containing MS / 2, Vitamins R3, and Agar 8 g / L, pH 5.7.

[0098] (2) About a week later, the seeds grew into seedlings. The cotyledons and hypocotyls were cut into small pieces and cultured in the pre-culture medium in the dark for 1 day.

[0099] (3) amplifying the culture of the Agrobacterium carrying the recombinant plasmid in step (3) of Example 1;

[0100] (4) Mix the pre-cultured explants with Agrobacterium carrying the recombinant plasmid and shake at 200 rpm for 30 min at room temperature. Use sterile filter paper to absorb the bacterial solution and place the explants on the pre-culture medium for dark culture for 2 days.

[0101] (5) The explants were transferred to the screening medium with a photoperiod of 18 / 6 h, a temperature of 22-25°C, and a humidity of 60%. The kanamycin concentration and medium configuration were as shown in Table 3.

[0102] Table 3

[0103] (4) Replace the culture medium every two weeks; after about 2-3 weeks, transfer the culture medium to the rooting medium depending on the growth of the regenerated buds of the explants.

[0104] (5) After the seedlings continue to grow and stabilize, leaf samples are taken and DNA is extracted using the CTAB method. PCR amplification is performed using the primer pair NPTII_F and NPTII_R (shown in SEQ ID NOs: 5-6) with the extracted DNA as a template to confirm that the plant is a transgenic positive strain.

[0105] (6) Flow cytometry was used to identify the ploidy of the plants, and the doubling ratios of the plants under different screening concentrations of kanamycin were calculated. The results are shown in Table 4 and Figure 12. As shown in Figure 12, the chromosome doubling detection of the plants was a single peak, indicating that the doubling plants were pure lines, and no mosaicism was detected, indicating that the probability of homozygous plants was 100%.

[0106] Table 4 The proportion of tomatoes with chromosome doubling after overexpressing OBF1 under treatment with different concentrations of kanamycin

[0107] (7) The tomato root tip was taken and pretreated, fixed, water-bathed, and stained using conventional methods. A small amount of meristem tissue was cut from the root tip and pressed into a slide for observation and chromosome counting, as shown in Figure 13.

[0108] (8) Leaves of the homozygous transgenic strain overexpressing the OBF1 gene were inoculated with the gray mold pathogen. The transgenic plant (OX21) had a stronger disease resistance phenotype than the wild type, as shown in Figure 16.

[0109] Example 3 Culture Method for Inducing Chromosome Doubling of Tobacco

[0110] (1) Wild-type tobacco seeds, surface-sterilized with 15% sodium hypochlorite for 15 minutes and 75% alcohol for 45 seconds, were germinated in 1 / 2 MS medium. After the cotyledons emerged, they were transplanted into soil and cultured in a culture room for 4–6 weeks.

[0111] (2) Cut 10-12 young leaves and disinfect their surfaces with 10% sodium hypochlorite. Use scissors to cut the leaves into squares of approximately 5 mm in length and width on a workbench.

[0112] (3) The Agrobacterium carrying the recombinant plasmid in step (3) of Example 1 was cultured; the leaves cut in step (2) were placed in the bacterial solution and soaked for 10 minutes;

[0113] (4) Transfer the leaves to the co-cultivation medium and keep them in the dark for two days;

[0114] (5) Transfer the leaves to the screening medium with the corresponding screening resistance again, change the medium every two to three weeks, and wait for differentiation;

[0115] Kanamycin concentration setting and culture medium configuration are shown in Table 5 below:

[0116] Table 5

[0117] (6) Culture conditions: Photoperiod: 18 / 6h, temperature: 25°C, humidity: 60%; culture medium should be replaced every two weeks; after approximately 2-3 weeks, depending on the growth of regenerated buds from the explants, the explants should be transferred to rooting medium;

[0118] (7) After the seedlings continue to grow and stabilize, leaf samples are taken and DNA is extracted using the CTAB method. PCR amplification is performed using the primer pair NPTII_F and NPTII_R (shown in SEQ ID NOs: 5-6) with the extracted DNA as a template to confirm that the plant is a positive transgenic line.

[0119] (8) Flow cytometry was used to identify the ploidy of the plants, and the doubling ratios of the plants under different screening concentrations of kanamycin were calculated. The results are shown in Table 6 and Figure 14. As shown in Figure 14, the chromosome doubling detection of the plants was a single peak, indicating that the doubling plants were pure lines, and no mosaicism was detected, indicating that the probability of homozygous plants was 100%.

[0120] Table 6 The proportion of chromosome doubling in tobacco plants overexpressing OBF1 under treatment with different concentrations of kanamycin

[0121] (9) The leaves of the homozygous transgenic strain overexpressing the OBF1 gene were inoculated with the gray mold pathogen. The transgenic plant (T100-2) had a stronger disease resistance phenotype than the wild type, as shown in Figure 17.

[0122] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. An application of OBF1 transcription factor in plant chromosome doubling, wherein: The gene sequence of the OBF1 transcription factor is shown in SEQ ID NO:

1.

2. The use of the OBF1 transcription factor in plant chromosome doubling according to claim 1, characterized in that: The initial plants were dicotyledonous heterozygotes.

3. The use of the OBF1 transcription factor in plant chromosome doubling according to claim 2, characterized in that: Initial plants included petunias, tomatoes and tobacco.

4. The use of the OBF1 transcription factor in plant chromosome doubling according to claim 3, characterized in that: The OBF1 gene is introduced into plant cells or tissues, and under the treatment of kanamycin, a transgenic cell line or transgenic plant with doubled chromosomes is obtained.

5. The use of the OBF1 transcription factor in plant chromosome doubling according to claim 4, characterized in that: The plants transformed by overexpressing the OBF1 vector through kanamycin treatment include pollen, cotyledon, hypocotyl, young leaves of the original plants and the development of the original plants before rooting after transformation.

6. A method for cultivating OBF1 transgenic plants, characterized in that: The following steps are involved: (1) Design primers for the ORF region of the OBF1 gene to obtain the primer pair OE_F1 and OE_R1; (2) using the primer pair to perform PCR amplification to clone the OBF1 ORF fragment; constructing the OBF1 ORF fragment into a plant expression vector with kanamycin resistance to obtain a recombinant plasmid; (3) 1 μl of the recombinant plasmid was mixed with 100 μl of competent Agrobacterium and transferred into an electroporation cup. The electroporation was performed at 2510 V using an electroporation device. After transformation, the bacterial solution was spread onto LB solid medium containing antibiotics to screen for Agrobacterium carrying the recombinant plasmid. (4) Expanding and culturing the Agrobacterium carrying the recombinant plasmid in LB liquid medium; (5) infecting the young and tender tissues of the initial plant with the expanded cultured Agrobacterium, wherein the young and tender tissues include cotyledons, hypocotyls, young leaves, and pollen; (6) culturing the infected explants using a co-cultivation medium; (7) inducing differentiation of the co-cultured explants using a primary kanamycin selection medium to obtain new shoots; (8) cutting the new shoots, transferring them to a primary kanamycin selection medium for further culture, then transferring them to a rooting medium for rooting culture, and then transferring them to soil for further culture; (9) After the seedlings continue to grow stably, leaf samples are taken and DNA is extracted using the CTAB method; PCR amplification is performed using the primer pair NPTII_F and NPTII_R with the extracted DNA as a template to determine that the plant is a positive transgenic strain, that is, a T0 generation transgenic strain; (10) before the anthers of the T0 transgenic strain mature and the petals open, artificial self-pollination is performed and seeds are obtained by continued cultivation; (11) sterilizing the seeds, further screening them with a second-generation kanamycin resistance medium, and obtaining seedlings with normal growth; (12) The normally growing seedlings are transferred to nutrient soil for further cultivation, and the obtained plants are homozygous positive transgenic plants of the T1 generation, i.e., homozygous chromosome-doubled plants.

7. The primary kanamycin selection pressure according to claim 6, characterized in that: The kanamycin treatment concentration is 100 mg / g to 150 mg / g.

8. The second generation kanamycin resistance culture medium according to claim 6, characterized in that: The kanamycin treatment concentration is 15 mg / g to 30 mg / g.

9. The method for cultivating OBF1 transgenic plants according to claim 6, characterized in that: The primer sequences for amplifying the OBF1 ORF fragment are shown in SEQ ID NO: 3-4. OE_F1:ATCTCGAGATGGCATCTTCTAGTGGAAA; OE_R1: ATGAGCTCTCACATACTGATAGAACATAT.

10. The method for cultivating OBF1 transgenic plants according to claim 6, characterized in that: The NPTII_F and NPTII_R sequences are shown in SEQ ID NOs: 5-6, NPTII_F: AAGATGGATTGCACGCAGGT; NPTII_R:AGCTTCAAAGCAGATCCAAG.

Images