Candida for treating cancer and reducing cancer recurrence

Abstract

The inventor discovered that Candida albicans extract alone is effective in the treatment of cervical cancer. Disclosed herein are methods and kits for the treatment of cancer and prevention of recurrence of cancer, e.g., cervical cancer or head and neck squamous cell carcinoma (HNSCC) using Candida albicans extract. The Candida albicans extract may be administered in combination with additional therapies, e.g., surgical therapies, immunotherapies, and / or targeted therapies.

Description

[0001]169852.00146 CANDIDA FOR TREATING CANCER AND REDUCING CANCER RECURRENCE CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims the benefit of priority to United States Provisional Patent Application No. 63 / 591,185, filed on October 18, 2023, United States Provisional Patent Application No. 63 / 647,486, filed on May 14, 2024, and United States Provisional Patent Application No.63 / 682,256, filed on August 12, 2024, the content of each of which is incorporated herein by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH This invention was made with government support under grant numbers CA143130 and UL1TR003107 awarded by the National Institutes of Health. The government has certain rights in this invention. REFERENCE TO A SEQUENCE LISTING A Sequence Listing accompanies this application and is submitted as an xml file of the sequence listing named “169852_00146.xml” which is 11,507 bytes in size and was created on October 14, 2024. The sequence listing is electronically submitted via Patent Center and is incorporated herein by reference in its entirety. BACKGROUND Cervical intraepithelial neoplasia (CIN) 2 / 3 is a precursor of cervical cancer which is the fourth most common cancer among women globally, with annual global incidence of 604,127 cases and mortality of 341,831 cases.1,2It is mostly caused by human papillomavirus (HPV), which is estimated to be responsible for 5.2% of cancer cases in the world.3,4Standard surgical treatments of CIN2 / 3, such as loop electrical excision procedure (LEEP), are effective but may cause cervical incompetency resulting in increased preterm delivery rates,5-8increased premature rupture of membrane,9and lower birth weight.9Therefore, current treatment guidelines recommend 1–2 years of close observation in women with CIN2, who are less than 25 years in age or who plan to have children. For CIN3, treatment is recommended.6,10Non-surgical Atty. Dkt. No.169852.00146 alternatives which would leave the cervix anatomically intact, such as therapeutic vaccines, are needed. Further, head and neck cancers (HNCs) account for approximately 4% of all cancers in the United States. These cancers are more than twice as common among men as they are among women. HNCs are diagnosed more often among people over age 50 than they are among younger people. Researchers estimated that more than 65,000 men and women in this country would be diagnosed with HNCs in 2017. A large number of these cases are associated with a patient’s use of alcohol and tobacco. However, the incidence of cases related to a human papilloma virus (HPV) infection, is growing. Recent studies have shown 70% of oropharynx, 25% of head and neck squamous cell carcinomas, 24% of laryngeal, and 23% of oral cavity cancers are linked to HPV. Human papilloma viruses are a group of more than 200 related viruses. More than 40 HPV types can be easily spread through direct sexual contact, from the skin and mucous membranes of infected people to the skin and mucous membranes of their partners. About 14 million new genital HPV infections occur each year. The Centers for Disease Control and Prevention (CDC) estimates that more than 90% and 80% of sexually active men and women, respectively, will be infected with at least one type of HPV at some point in their lives. Around one-half of these infections are with a high-risk HPV type. High-risk HPVs can cause cancer. About a dozen high-risk HPV types have been identified. Two of these, HPV types 16 and 18, are responsible for most HPV-caused cancers. HPV type 16 is associated with 90% of HNC associated with HPV. High-risk genotypes of HPV, specifically type 16, are found in a discrete subset of squamous cell carcinoma of head and neck. Cases of HPV-related HNC may be prevented with vaccines. Inducing appropriate HPV virus specific immune responses may aid in prevention and treatment efforts. Infection by HPV may be averted by neutralizing antibodies specific for the viral capsid proteins. In clinical trials, vaccines comprised of HPV virus-like particles (VLPs) have shown great promise as prophylactic HPV vaccines. However, given that capsid proteins are not expressed at detectable levels by infected basal keratinocytes, vaccines with therapeutic potential must target other non-structural viral antigens. HPV transformation of squamous epithelium to a malignant phenotype is mediated by two early gene products, E6 and E7. Both viral proteins interact with products of cellular human tumor- suppressor genes: the E6 protein can bind and promote degradation of cell-encoded p53, and the Atty. Dkt. No.169852.00146 E7 protein interacts with the retinoblastoma susceptibility gene product. Expression of E6 and E7 proteins has been shown to be necessary and sufficient for HPV-16 transformation of human cells. Therefore, the E6 and E7 proteins are potential molecular targets for new preventive and therapeutic modalities. Our group has developed a vaccine that uses antigens from the E6 protein since the T-cell immune responses to the HPV-16 E6 protein are associated with HPV clearance and SIL regression. Therefore, therapeutic vaccines targeting E6 and E7 may have potential to control HPV-associated malignancies. Positive results from experimental vaccination systems in animal models have led to several prophylactic and therapeutic vaccine clinical trials. These investigations include administering these proteins in live vectors, peptides or protein, nucleic acid form, as components of chimeric VLPs, or as cell-based vaccines. These vaccines may prove invaluable for the prevention of HPV infection and life-threating cancers these infections may bring. Although numerous preclinical and clinical trials have evaluated prophylactic HPV vaccines during the past few decades, these vaccines do not help those who already have established HPV infections. Clinical trials have demonstrated excellent vaccine efficacy in women negative for HPV-16 or HPV-18, but the duration of protection remains to be determined, and a study of the bivalent vaccine showed no evidence of enhanced viral clearance in women with preexisting HPV infections. Therefore, therapeutic vaccines are needed for cases in which HPV infection is already established and in which HPV-related diseases have already developed, particularly because the prophylactic vaccine coverage rate in the targeted group (girls, ages 13-17 years) reportedly is low nationally. SUMMARY In an aspect of the current disclosure, methods of treating a cancer having epithelial lesions or a precancerous condition having epithelial lesions in a subject are provided. In some embodiments, the methods comprise: excising the epithelial lesions using a surgical procedure and administering a composition comprising a recall antigen in a subject in need thereof; wherein the subject is afflicted with a cancer caused by human papilloma virus (HPV) with cancerous epithelial lesions or afflicted with precancerous epithelial lesions caused by HPV and the composition comprising a recall antigen does not comprise an antigen of the cancer or of HPV. In another aspect of the current disclosure, methods of treating cancer in a subject in need thereof are provided. In some embodiments, the methods comprise administering an effective Atty. Dkt. No.169852.00146 amount of a pharmaceutical composition comprising a Candida albicans extract to the subject to treat the cancer. In another aspect of the current disclosure, methods of reducing recurrence of a cancer in a subject are provided. In some embodiments, the methods comprise administering an effective amount of a pharmaceutical composition comprising a Candida albicans extract to the subject to reduce recurrence of the cancer in the subject. BRIEF DESCRIPTION OF THE FIGURES FIG.1 shows a diagram of the enrolled population for a clinical trial to test a peptide-based human papillomavirus therapeutic vaccine or Candida adjuvant alone, the results of which make up Example 1. FIGs.2A and 2B show histological responses and subgroup comparisons Panel A shows the analyses of the intention-to-treat populations and panel B shows the analyses of the per- protocol analyses. Both panels used the stringent criterion in which only the complete responders (regression to no CIN) were considered to have had responses. The Clopper-Pearson method was used to determine the 95% confidence intervals (CIs). FIGs.3A, 3B, 3C, and 3D show immune responses assessed using IFN- ^ ELISPOT assay, bulk T cell receptor ^ deep sequencing, and single-cell sequencing. The data from IFN- ^ ELISPOT assay of 71 of 76 patients whose results were technically adequate are summarized along with the results of epitope spreading (32 of 33 patients with technically adequate results). Putatively vaccine-specific T cells were determined by performing bulk TCR ^ deep sequencing using PBMC samples of patients with new HPV 16 E6 ELISPOT responses in at least 2 of 3 post-vaccination samples using a beta-binomial model50(n=15). Vaccine-induced HPV-specific CD8-positive and CD8-negative (i.e., CD4) T cells were selected on the basis of interferon- ^ production upon stimulation with peptides from the HPV region(s) identified by ELISPOT assays for persistent post-vaccination responses (i.e., present in at least 2 of 3 post-vaccination visits) which were statistically significant (two-sided paired t-test). These regions were HPV 16 E6 aa136-aa158 for Patient 32, E6 aa121-aa145 for Patient 39, E6 aa16-aa40 and aa46-aa70 for Patient 46, E6 aa121- aa145 and aa136-aa158 for Patient 51, and E646-aa70 and E7aa16-aa40 for Patient 58. The presence of these vaccine-induced HPV-specific T cells in PBMC and cervix (n=5) were determined by examining CDR3 ^ amino acid sequences of bulk TCR ^ deep sequencing results. Atty. Dkt. No.169852.00146 B. In histological non-responders (stringent), significant increase in the number of putatively vaccine-specific T cells (p=0.02, Friedman test) were demonstrated suggesting that the lack of histological response is not due to poor systemic T cell responses. C. CD8-positive interferon- ^ producing T cells from 5 patients were enriched by FACS and subjected to single-cell RNA-seq analysis. Seven clusters were identified by clustering analysis, as shown in the UMAP plots. T cells isolated from a responder mostly were found in cluster 1, 2 and 3. D. The expression levels of granzymes (GZMA and GZMH), CCR5 and EOMES in interferon- ^ producing CD8 T cells in cluster 1, 2 and 3 were elevated in a responder, compared to non-responders (p<1x10-90for all comparisons, Seurat v4.4.0). FIGs. 4A and 4B show plasma cytokine levels before and after vaccinations show that Candida may mediate CIN2 / 3 regression through altering key plasma cytokines. A. A heatmap of significant cytokine level changes (i.e., Padj<0.05) is shown comparing levels at post-2 vaccination, 6-month visit, and 12-month visit to the baseline. Light orange represents increased levels from the baseline with Padj between 0.01 and 0.04. Light blue represents decreased levels from the baseline with Padjbetween 0.01 and 0.04 while dark blue represents Padjof <0.01. Eight of 51 cytokines that are undetectable in more than 50% of participants were excluded from the analysis (α-NGF, IFN-α2, IL-2, IL-3, IL-5, IL-7, IL-15, and VEGF), and are not shown. P-values determined using the Wilcoxon-rank sum test, and were adjusted for multiple comparisons using the Benjamini-Hochberg method. B. Violin plots of 6 cytokines which were significantly decreased in the Candida group and in the histological responders. FIGs.5A and 5B show analyses of HPV clearance by risk groups and HPV 16 viral load A. The percentages of HPV clearance (i.e., detected at entry but not at the exit visit) by HPV types grouped as (1) HPV 16, (2) HPV 16-related types other than HPV 16 [i.e., HPV types 31, 33, 35, 52, 58, and 67], (3) high-risk HPV types not including HPV 16 / HPV16-related [i.e., HPV types 18, 39, 45, 51, 53, 56, 59, 66, 68, 69, 70, 73, and 82], and (4) low-risk HPV types [i.e., HPV types 6, 11, 40, 42, 54, 61, 62, 71, 72, 81, 83, 84, and CP6108] are shown. B. HPV 16 viral loads in patients who were HPV 16-positive at entry. Wilcoxon matched-pairs signed rank test (two-sided) was used. FIG.6 shows a schema for conducting the clinical trial investigation described in Example 4. FIG.7 shows an exemplary trial design. Atty. Dkt. No.169852.00146 FIGs.8A and 8B show Histological responses and subgroup comparisons. Panel A shows the analyses of the intention-to-treat populations and panel B shows the analyses of the per- protocol analyses. Both panels used the lenient criterion in which the complete responders (regression to no CIN) and partial responders (regression to CIN 1) were considered to have had responses. The Clopper-Pearson method was used to determine the 95% confidence intervals. FIG.9 shows representative ELISPOT assay results. ELISPOT assays were performed, for patients who completed the 6-month visit, testing 10 regions within the HPV 16 E6 protein at visit 1 (pre-vaccination), visit 3 (post-2 vaccinations), 6-month visit, and 12-month visit. Patients 39 and 58 were histological complete responders (i.e., regressed to no CIN) while patients 23 and 46 were histological non-responders (i.e., had persistent CIN2 / 3). Patients 39, 46, and 58 received PepCan while patient 23 received Candida. Epitope spreading to HPV 35 E6 protein was examined for subject 46 since she was HPV 35-positive at entry, but epitope spreading was not detected. Subject 58 was HPV 16-positive at entry, and demonstrated epitope spreading to HPV 16 E7 protein. The numbers in boxes show positivity indices of 2 or greater. P-values less than 0.05 before rounding (two-sided paired t-test) are shown for statistically significant increases in T cell responses after vaccination. FIGs. 10A, 10B, 10C, 10D, 10E, and 10F show T cell responsiveness. Panel A shows comparisons of Th1, Th2, Treg, MDSC1 and MDSC2 between histological responders and non- responders (stringent) at pre-vaccination, post-2 vaccination, post-6 months, and post-12 months for patients who completed the 6-month visit in both treatment groups. Panel B shows comparisons of Th1, Th2, Treg, MDSC1 and MDSC2 between histological responders and non-responders (stringent) at pre-vaccination, post-2 vaccination, post-6 months, and post-12 months for patients who completed the 6-month visit in the PepCan group. Panel C shows comparisons of Th1, Th2, Treg, MDSC1 and MDSC2 between histological responders and non-responders (stringent) at pre- vaccination, post-2 vaccination, post-6 months, and post-12 months for the patients who completed the 6-month visit in the Candida group. Panel D shows percentages of Th1, Th2, Tregs, MDSC1, and MDSC2 at pre-vaccination, post-2 vaccination, post-6 months, and post-12 months for the patients who completed the 6-month visit in both treatment groups. Panel E shows percentages of Th1, Th2, Tregs, MDSC1, and MDSC2 at pre-vaccination, post-2 vaccination, post-6 months, and post-12 months for the patients who completed the 6-month visit in the PepCan group. Panel F shows percentages of Th1, Th2, Tregs, MDSC1, and MDSC2 at pre-vaccination, post-2 Atty. Dkt. No.169852.00146 vaccination, post-6 months, and post-12months for the patients who completed the 6-month visit the Candida group. Unadjusted p-values (two-sided paired t-test) less than 0.05 before rounding, and corresponding adjusted p-values (shown as “q”) are shown (Benjamini and Hochberg method). FIGs.11A, 11B, 11C, 11D, 11E, and 11F show Differential abundance of taxa. ALDEx2 (ANOVA-like differential expression, version 2) was utilized to examine differential abundance of individual taxa. Panel A shows effect plots comparing taxa between histological responders and non-responders (stringent) at baseline for patients who completed the 6-month visit in both, PepCan, or Candida groups. No individual taxa were associated with histological response. Panel B shows differentially abundant taxa in both groups comparing microbiota at 6 month or 12 month to the baseline. Panel C shows differentially abundant taxa in the PepCan group comparing microbiota at 6 month or 12 month to the baseline. Panel D shows differentially abundant taxa in the Candida group comparing microbiota at 6 month or 12 month to the baseline. Panel E shows differentially abundant taxa in histological responders (stringent) comparing microbiota at 6 month or 12 month to the baseline. Panel F shows differentially abundant taxa in the histological non- responders comparing microbiota at 6 month or 12 month to the baseline. The red dots indicate significantly differentially abundant taxa using Benjamini-Hochberg corrected p-value of Wilcoxon test. FIGs.12A, 12B, 12C, and 12D show Observed HLA frequencies for patients in comparison to the estimates for the United States population based on racial distributions. Panel A shows the A alleles, panel B shows the B alleles, panel C show the C alleles, and panel D shows the DR / DQ alleles. The filled black circles show the frequency patients who received at least one vaccination, the line shows its 95% confidence interval (Pearson-Klopper method), and the red “x” shows estimated frequency in the United States population. DETAILED DESCRIPTION The present invention provides methods for treating cancer and preventing recurrence of cancer, e.g., cervical cancer and head and neck squamous cell carcinoma (HNSCC). The inventor conducted a clinical trial to test the efficacy of a therapeutic vaccine comprising human papillomavirus (HPV) antigens alone versus Candida albicans extract alone for the treatment of cervical cancer. Surprisingly, Candida albicans extract was as effective as the therapeutic HPV vaccine. Therefore, this disclosure provides methods of treating cancer or precancerous lesions or of reducing recurrence of a cancer comprising administration of a recall Atty. Dkt. No.169852.00146 antigen and in particular administration of a Candida albicans extract, e.g., Candin®. The Examples demonstrate that a Candida albicans extract is effective in the treatment of cervical cancer and in particular HPV related cancers. Candida albicans extract may also be effective for the treatment of head and neck cancers, e.g., HNSCCs, including those HNSCCs that are associated with, or caused by, infection with human papilloma virus (HPV). Similar administration procedures of a recall antigen or Candida albicans extracts may be used to treat other epithelial cell cancers as well. Methods Methods of treating cancer in a subject in need thereof are provided. The methods of treating cancer provided here include treating HPV-related cancers, cancers having epithelial lesions, precancerous conditions having epithelial lesions, and squamous cell carcinomas in a subject. The methods comprise administering an effective amount of an extract comprising a recall antigen to the subject. In the Examples, the inventors used Candin®, but other recall antigens are likely to work in the assay as the Candida albicans extract is not directed to antigens found in the cancer or precancerous tissue. The methods may further include excising the epithelial lesions using a surgical procedure prior to, at the same time as or after administering a composition comprising a recall antigen. The cancer or precancerous lesion may be caused by human papilloma virus (HPV). In some embodiments, the composition comprising a recall antigen or Candida albicans extract does not comprise an antigen of the cancer or of HPV. The compositions for administration may consist of the recall antigen or Candida albicans extract or consist essentially of the recall antigen or Candida albicans extract with the addition of a pharmaceutically acceptable carrier of excipient. Candida albicans extract belongs to a family of antigens used in immunological testing called “recall antigens” that include commonly experienced antigens to which there is a fairly consistent and widespread exposure in the human population such that exposure to the antigen via direct injection to an individual results in a rapid memory B and T cell response. Recall antigens may include, e.g., Candida albicans extract, mumps antigen, or trichophyton extract. Candida albicans Skin Test Antigen for Cellular Hypersensitivity (CANDIN®) is a clear, colorless, sterile solution with a pH of 7.0 - 8.5. The antigen should be administered intradermally according to the directions included under DOSAGE AND ADMINISTRATION information provided with the formulation. CANDIN® is made from the culture filtrate and cells of two strains Atty. Dkt. No.169852.00146 of Candida albicans. The fungi are propagated in a chemically defined medium consisting of inorganic salts, biotin and sucrose. Lyophilized source material is extracted with a solution of 0.25% NaCl, 0.125% NaHCO3and 50% v / v glycerol. The concentrated extract is diluted with a solution of 0.5% NaCl, 0.25% NaHCO3, 0.03% Albumin (Human) USP, 8 ppm polysorbate 80 and 0.4% phenol. As used herein, “treating” or grammatical variations thereof, refer to improvements in one or more sign or symptom related to the cancer. Treating cancer includes, but is not limited to, reducing the number of cancer cells or the size of a cancer in the subject, reducing progression of a cancer to a more aggressive form, reducing proliferation of cancer cells or reducing the speed of growth, killing of cancerous cells, reducing metastasis of cancer cells or reducing the likelihood of recurrence of a cancer in a subject. Treating may also include reducing the frequency or slowing the progression of a precancerous lesion to a cancer, reducing the grade of a cancer or precancer, slowing progression, improved speaking or swallowing, etc. Treating a subject as used herein refers to any type of treatment that imparts a benefit to a subject afflicted with a disease or at risk of developing the disease, including improvement in the condition of the subject (e.g., in one or more symptoms), delay in the progression of the disease, delay the onset of symptoms or slowing the progression of symptoms, etc. The disclosed methods may further comprise administering a surgical treatment or procedure (surgical treatment and surgical procedure are used interchangeably) before administering a recall antigen, e.g., Candida albicans extract, administering a surgical treatment concurrently with administering the Candida albicans extract, or administering a surgical treatment after administering the Candida albicans extract. The surgical treatment may be administered 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, or more before the Candida albicans extract or after the Candida albicans extract. The surgical treatment may be administered 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks or more before the Candida albicans extract or after the Candida albicans extract. The surgical treatment may be administered 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or more before the Candida albicans extract or after the Candida albicans extract. The surgical procedure or treatment has the purpose of excising at least a portion of the cancer or precancerous lesion. Atty. Dkt. No.169852.00146 The subject may have an epithelial lesion, e.g., of the cervix or head and neck, and the subject may receive or have previously received a surgical treatment consistent with clinical guidelines, e.g., loop electrical excision procedure (LEEP) or cold cone knife procedure, and, subsequently, is administered the recall antigen or Candida albicans extract. Without wishing to be limited by any theory or mechanism, the sequence of treatment in this embodiment may reduce recurrence of certain cancers, e.g., cervical or head and neck cancers, by first removing cancerous or pre-cancerous tissue then administering the Candida albicans extract to stimulate an immune response which, though initially targeted to Candida antigens, targets the cancerous and / or virally infected tissue. As used herein, an “epithelial lesion” refers to an abnormal growth of epithelial cells, which may be determined by a physician, e.g., a pathologist. A “pre-cancerous epithelial lesion” is a lesion that comprises abnormal epithelial cells that are considered “pre-cancerous” and are considered likely to transform into malignant or cancerous cells. A subject in need thereof, as used herein, may comprise a mammal that has been diagnosed with a cancer, e.g., cervical cancer or head and neck cancer. The mammal may be a mammal that has a cancer or a precancer e.g., a precancerous lesion, and has been diagnosed as HPV positive. The mammal may be a human or other mammal, e.g., a dog, a cat, a horse, a rat, a mouse, etc. The cancer treated by the disclosed methods may be squamous cell cancer or precancer, head and neck cancer, colorectal adenoma, penile intraepithelial neoplasia, vaginal intraepithelial neoplasia, vulvar intraepithelial neoplasia, breast cancer, colorectal cancer, pancreatic cancer, leukemia, lymphoma, multiple myeloma, gastric cancer, lung cancer, ovarian cancer, glioblastoma, prostate cancer, or thyroid cancer. In one embodiment the cancer or precancer is a cervical intraepithelial neoplasia lesion, and may be a cervical intraepithelial neoplasia lesion grade 2 or 3. As the inventor discovered that Candida albicans extract alone is effective at treating cancer, the methods may exclude co-administering a vaccine, e.g., a peptide vaccine. Accordingly, the recall antigen may be described as not comprising an antigen of the cancer or, in the case of HPV infected subject, may be described as not comprising an antigen derived from HPV. In another aspect of the current disclosure methods of reducing recurrence of a cancer in a subject in need thereof are provided. As used herein, “reducing recurrence” refers to reducing the likelihood or reducing the actual recurrence of a primary tumor after treatment. The treatment Atty. Dkt. No.169852.00146 may include the disclosed methods, and / or treatment with another therapy, e.g., a chemotherapy, a radiation therapy, a surgical therapy, an immunotherapy, or any combination thereof. The reduction in the likelihood of recurrence after administering an effective amount of the recall antigen or Candida albicans extract is relative to the likelihood without this administration in a control subject. The recurrence may be reduced by 10%, 15%, 20%, 25%, 30%, 40%, 50%, 60% or more. The recurrence may also be slowed, such that no recurrence is observed for 1 year, 2 years, 3 years, 4years, 5, years, 6 years or more after treatment. The control subject is a subject with a similar cancer or precancer who was not administered the recall antigen or Candida albicans extract. As used herein, an “effective amount” or a “therapeutically effective amount” refers to the amount of the Candida albicans extract sufficient to either treat the cancer, reduce recurrence of the cancer, or both, as defined above. An effective amount may comprise 0.5 mls of the Candida albicans extract, e.g., Candin®, and may be administered in a particular sequence to the subject, e.g., intradermally. As commercially available Candida albicans extracts are generated from Candida albicans cells and are defined by potency, about 0.5 mls of the Candida albicans extract is to be understood to be equivalent to the potency of about 0.5 mls of Candin®, which is determined lot to lot by the manufacturer. One of skill in the art will understand methods and procedures to test the relative potency of Candida albicans extract in comparison to Candin®. In some embodiments, the Candida albicans extract is not heat killed or chemically treated, e.g., is not treated with a fixative, e.g., formaldehyde, formalin, or methanol. The amount of Candida albicans extract administered may optionally be between 0.1mL and 1.0mL or any value in between the two, including 0.2mL, 0.3mL, 0.4mL, 0.5mL, 0.6mL, 0.7mL, 0.8mL, or 0.9mL. The Candida albicans extract may be administered more than one time. The extract may be administered 5-10 times. In one embodiment, the extract is administered 7 times over a few months. In this embodiment the extract is administered once every 3 weeks for the first 4 rounds of administration, then administered every three months for a following 3 rounds of administration, i.e., 4 rounds of 1 injection every three weeks followed by 3 rounds of 1 injection every 3 months. Additional rounds of administration or dosing regimens are contemplated in this disclosure. In the Examples the extract is administered intradermally. The intradermal administration need not be in the location of the cancer or precancerous lesion. In one embodiment the intradermal injection is in a limb of the subject, such as on the inside of the forearm. Other locations for the Atty. Dkt. No.169852.00146 administration can be used. The recall antigen or extract is suitably not injected into or in proximity to the cancer, precancer or epithelial cell lesion. The subject may be administered a pharmaceutical composition comprising, consisting essentially of, or consisting of the recall antigen, e.g., Candida albicans extract. As used herein, “consisting essentially of the recall antigen” refers to a pharmaceutical composition where the only active ingredient is the recall antigen, e.g., Candida albicans extract, and the pharmaceutical composition may further comprise appropriate / necessary diluents or excipients. The recall antigens or Candida albicans extracts may be used to make pharmaceutical compositions. Pharmaceutical compositions consisting essentially of the recall antigens or Candida albicans extracts may also comprise a pharmaceutically acceptable carrier, excipient or diluent. A pharmaceutically acceptable carrier is any carrier suitable for in vivo administration. Examples of pharmaceutically acceptable carriers suitable for use in the composition include, but are not limited to, water, buffered solutions, glucose solutions, oil-based or culture fluids from growth of the recall antigen. Additional components of the compositions may suitably include, for example, excipients such as stabilizers, preservatives, diluents, emulsifiers and lubricants. Examples of pharmaceutically acceptable carriers or diluents include stabilizers such as carbohydrates (e.g., sorbitol, mannitol, starch, sucrose, glucose, dextran), proteins such as albumin or casein, protein- containing agents such as bovine serum or skimmed milk and buffers (e.g., phosphate buffer). Especially when such stabilizers are added to the compositions, the composition is suitable for freeze-drying or spray-drying. The composition may also be emulsified. Human papilloma virus (HPV) is categorized by type, several of which are most often associated with cellular transformation or tumorigenesis: HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68. Of the preceding HPV types, HPV 16 is most often associated with cancer of the head and neck. As nearly all instances of cervical cancer are caused by HPV, a subject in need thereof may have been exposed to HPV, e.g., as determined by a detailed patient history, or may be infected with HPV, e.g., as determined by PCR test. However, the disclosed methods are thought to be effective in treatment of HPV-negative individuals. The disclosed methods may be used with further therapies, e.g., surgical therapies as discussed above, as well as immunotherapies, e.g., a immune checkpoint inhibitor (ICI) therapy, a CCR5 inhibitor, or a TGF-beta inhibitor. The immunotherapy may be an immune checkpoint Atty. Dkt. No.169852.00146 inhibitor (ICI), e.g., a PD-1 antagonist (e.g., pembrolizumab, nivolumab), a PD-L1 antagonist (e.g., atezolizumab, durvalumab), or a CLTA-4 antagonist (e.g., ipilimumab). The targeted therapy may be an inhibitor of CCR5 (e.g., miravoc or leronlimab) or an inhibitor of TGF-beta (e.g., galunisertib, metformin, or trabedersen). Kits In another aspect of the current disclosure, kits are provided. Typical administration of a Candida albicans extract is done in 0.1 ml doses to test for delayed-type hypersensitivity reactions in subjects. The inventor has discovered that administration of 0.5 mls or more of the extracts is effective in the treatment of cancer. The disclosed kits may comprise at least seven 0.5 ml doses of a Candida albicans extract packaged for individual use. Suitable packaging may comprise ampules or single use containers. The kits may further comprise instructions for administering the seven 0.5 ml doses of the Candida albicans extract, e.g., specify administering the at least seven 0.5 ml doses of the Candida albicans extract in a sequence comprising: 4 rounds of 1 injection every three weeks followed by 3 rounds of 1 injection every 3 months. The Candida albicans extract may be Candin®. The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g., "such as") provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof, as Atty. Dkt. No.169852.00146 well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of” and “consisting of” those certain elements. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise. No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference, unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or description found in the cited references. The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims. EXAMPLES Example 1 - A Randomized Trial of a Peptide-Based Human Papillomavirus Therapeutic Vaccine, PepCan, or Candida Adjuvant Alone Revealing Possible Cytokine- Mediated Regression of Cervical Intraepithelial Neoplasia 2 / 3 with Candida Atty. Dkt. No.169852.00146 Cervical intraepithelial neoplasia (CIN) 2 / 3 is a precursor of cervical cancer which is the fourth most common cancer among women globally, with annual global incidence of 604,127 cases and mortality of 341,831 cases.1,2It is mostly caused by human papillomavirus (HPV), which is estimated to be responsible for 5.2% of cancer cases in the world.3,4Standard surgical treatments of CIN2 / 3, such as loop electrical excision procedure (LEEP), are effective but may cause cervical incompetency resulting in increased preterm delivery rates,5-8increased premature rupture of membrane,9and lower birth weight.9Therefore, current treatment guidelines recommend 1–2 years of close observation in women with CIN2, who are less than 25 years in age or who plan to have children. For CIN3, treatment is recommended.6,10Non-surgical alternatives which would leave the cervix anatomically intact, such as therapeutic vaccines, are needed. As the World Health Organization has declared a call to action to accelerate elimination of cervical cancer through increasing prevention, detection, and treatment by 2030,11the need for HPV therapeutic vaccines is great. HPV transformation of squamous epithelium to a malignant phenotype is mediated by two early gene products, E6 and E7,12and their expression is necessary for HPV 16 transformation of human cells.13,14T cell responses to HPV 16 E6 protein have been associated with favorable clinical outcomes such as viral clearance15and regression of cervical lesions.16,17Therefore, the E6 protein is an attractive target for immunotherapy. Traditionally, recall antigens, which typically include a panel of Candida, mumps, and Trichophyton, were used as controls to indicate intact cellular immunity when patients were being tested for Tuberculosis by placement of purified protein derivative (PPD) intradermally. A number of studies demonstrated that recall antigen injections can be used to treat common warts, and several have shown that treating warts with recall antigens is effective not only for injected warts but also distant, untreated warts.18,19Furthermore, in vitro studies have demonstrated that Candida can induce interleukin-12 expression and T cell proliferation.20,21Therefore, we utilized Candida for the first time as a vaccine adjuvant in a Phase 1 clinical trial (NCT01653249) of our group’s HPV therapeutic vaccine, PepCan, which is comprised of four synthetic peptides covering HPV 16 E6 protein and Candida. PepCan’s safety was demonstrated, and the lowest dose was most efficacious.22,23Furthermore, a systemic increase of Th1 cells and higher clearance rates of non- HPV 16 types in comparison to HPV 16 suggested that the adjuvant, Candida, exerted notable immune enhancement.22,23This provided the rationale for testing Candida by itself along with Atty. Dkt. No.169852.00146 PepCan in this Phase 2 clinical trial. Therefore, patients were randomized in a double-blind manner to PepCan or Candida (NCT02481414). The hypothesis was that PepCan would induce HPV- specific immune responses resulting in high-grade squamous intraepithelal regression when the T cells reach the disease sites. While Candida is expected to have some immune enhancement effects, it was expected to be less effective than PepCan. Here, we report the unexpected outcome of Candida alone being effective in regressing CIN2 / 3 in comparison to a historical placebo group.2Methods Patients Patients (n=99) were screened between November 2015 and June 2021 at the University of Arkansas for Medical Sciences Medical Center, and those with biopsy-proven CIN2 / 3 (n=81) were eligible and were randomly assigned to the PepCan or Candida arm (Figure 1). Exclusion criteria included immunosuppression, pregnancy, breast feeding, allergy to Candida, severe asthma, and history of invasive squamous cell carcinoma of the cervix. A full description of eligibility criteria are in the trial protocol submitted with this manuscript. Vaccine Composition and Delivery The vaccine consisted of four current good manufacturing production-grade synthetic peptides covering the HPV 16 E6 protein [amino acid (aa)1-45, 46-80, 81-115, and 116-158] (CPC Scientific, San Jose, CA; Curia, Albany, NY).21Lyophilized peptides (50 ^g per peptide) were reconstituted with sterile water and were mixed in a syringe with 0.3 mL of Candida extract (Candin®, Nielsen Biosciences, San Diego, CA). This is an extract of Candida, and is not heat- killed nor fixed. The mixture was administered intradermally in any limb, but most often in the anterior forearm. In the Candida arm, 0.3 mL of Candida extract was also used. Trial Design and End Points This clinical trial was a randomized, double-blind, single-center, Phase 2 study in which patients were assigned to PepCan or Candida at a one-to-one ratio using a computer-generated randomization scheme created by the study statistician. The patients and all study personnel were blinded to which vaccine the patients received except for the research pharmacists. Four injections were given 3 weeks apart, and the patients returned for observational visits 6 and 12 months after the last injection. A liquid-based cytology sample (Thin-Prep, Hologic, Marlborough, MA) was collected for HPV-DNA testing for 37 individual HPV types (Linear Array HPV Genotyping Test, Roche Molecular Diagnostics, Pleasanton, CA) at the screening visit, 6-month visit, and 12-month Atty. Dkt. No.169852.00146 visit. HPV 16 viral load was also determined22,24for subjects who were HPV 16-positive at the screening visit. The primary endpoint was histological regression, which was assessed using four quadrant biopsies collected at the 12-month visit. At least one biopsy was taken from each quadrant with visible lesion under acetic acid application. Random biopsies were taken from quadrants without visible lesions. Endocervical curettage was performed per standard of care. Biopsies were examined by two pathologists who were blinded to each other's diagnosis. For patients who exited the study after the 6-month visit, the results of the biopsy (performed if colposcopy showed possible progression with acetic acid application) and / or LEEP were used to assess histological responses. The secondary endpoint was safety, which was assessed from the time informed consent was obtained until the 6- or 12-month visit according to the National Cancer Institute Common Terminology Criteria for Adverse Events, Version 4.03. A patient with no dysplasia was considered a complete responder, a patient with CIN1 was considered a partial responder, and a patient with CIN2 / 3 was considered a non-responder. Only patients with no CIN were considered histological responders with a stringent criterion, and those with no CIN or CIN1 were considered to be responders with a lenient criterion. Additional endpoints involved examination of peripheral immune responses by examining T cell activity to 10 regions (aa1-25, 16-40, 31-55, 46-70, 61-85, 76-100, 91-115, 106-130, 121- 145, and 136-158) of the HPV 16 E6 protein using an interferon- ^ enzyme-linked immunospot (ELISPOT) assay (n=71). Epitope spreading to HPV 16 E7 protein, HPV 18 E6 protein, HPV 35 E6 protein, or HPV 52 E6 protein was also examined (n=32) for patients testing positive for respective HPV type at entry. In patients who completed the 12-month visit and demonstrated sustained T cell response to the HPV 16 E6 protein, bulk T cell receptor (TCR) ^ deep sequencing of peripheral blood mononuclear cells (PBMCs) and liquid-based cervical cytology samples was performed (n=15). If post-vaccination responses were statistically significant, single-cell RNA- seq and TCR sequencing were also performed (n=5) to identify vaccine-induced HPV-specific T cells. Immune profiling (n=76) measuring Th1 cells, Th2 cells, regulatory T cells (Tregs),22,23and myeloid-derived suppressor cells (MDSCs)25,26was also performed using fluorescent- activated cell sorter (FACS) with blood samples drawn at visit 1, visit 3, 6-month visit, and12- month visit. To identify potential biomarkers predictive of vaccine response and to examine effects of vaccination, patient samples from those who completed the 6-month visit (n=76) were examined Atty. Dkt. No.169852.00146 for plasma cytokines (n=51), and plasma metabolomics (n=1,454). As our pilot data demonstrated that about a third of cytokines levels were significantly different when the blood samples were processed at 2 hours versus 1 hour,22we used plasma samples that were processed within 1 hour of blood draw. If the blood was processed after 1 hour but within 2 hours, data for the labile cytokines were not used (n=1). None of the blood samples were processed beyond 2 hours. The detailed methods are described in the Supplementary Appendix. HLA Typing Using DNA extracted from PBMC, low-resolution typing for HLA class I A, B, and C and class II DRB1, DQB1, and DPB1 was performed (n=80) with MicroSSP Generic DNA Typing Trays according to the manufacturer’s instructions (One Lambda, Los Angeles, CA). See Supplementary Appendix for more details. Cervical Microbiome As the phase I results suggested potential negative roles of phyla Caldithrix and Nitrospirae in vaccine response,27cervical microbiome was examined using the DNA extracted from liquid- based cytology samples through amplification and sequencing of the 16S rRNA gene (see details in the Supplementary Appendix). Statistical Analysis It was estimated that a sample size of 35 would provide 93% power to detect a difference in response rate of 31% (60% in PepCan group versus a 29% in historical placebo group).2This historical placebo group was selected because patients with CIN2 / 3 were treated with a placebo in one arm and were observed for regression to no CIN during the same length of time (i.e., 15 months from the treatment initiation).2The sample size was estimated based on exact test statistic and a two-sided type I error of 5%. The goal was to start vaccinating 40 patients in each group to account for attrition. The study was not powered to show differences between the Candida and placebo groups since the Candida group was expected to be less efficacious than PepCan. Likewise, we did not expect to see a significant difference between the PepCan and Candida groups. Each group was compared to the historical placebo using the exact binomial test (two-sided). The PepCan and Candida groups were compared using Pearson’s χ2-tests (two-sided). The Clopper-Pearson method was used to determine 95% confidence intervals (CIs). A two-sided p-value of less than 0.05 was used to determine statistical significance, and corrections for multiple comparisons were Atty. Dkt. No.169852.00146 made where appropriate. A more detailed descriptions of statistical methods are described in the Statistical Analysis Plan. Results Patients and Treatment Thirty-nine patients were randomly assigned to the PepCan arm and 42 patients were assigned to the Candida arm (the intention-to-treat population). Their baseline characteristics were well balanced (Table 1 and Figure 1). Limited demographic information for age, ethnicity, and current oral contraceptive use was available for the historical placebo group.2The placebo group had a significantly higher percentage of patients younger than 25 years old (p<0.001 with PepCan and p=0.005 with Candida), and significantly more current use of oral contraceptives (p<0.001 with PepCan and p=0.04 with Candida). Efficacy In comparison to the historical placebo group, the Candida group, but not the PepCan group, demonstrated significantly higher histological regression rates in the intention-to-treat (47.6%, 95% CI, 32 to 63.6; p<0.001) and per-protocol (62.1%, 95% CI, 42.3 to 79.3; p<0.001) populations. There were no significant differences in histological response rates of the PepCan and Candida groups in both analyses. Therefore, both groups combined and separately were analyzed for stringent histological responses in the intention-to-treat (Figure 2A) and per-protocol populations (Figure 2B) as well as in subgroups characterized by age, initial diagnosis, and initial number of cervical quadrants involved. Analogous analyses were performed using the lenient criterion for histological response (Figure 8A and 8B). No significant differences were found between the subgroups examined except with the comparisons of initial diagnoses between “CIN2” and “>CIN2”. In the intention-to-treat population for both treatment groups combined, “CIN2” had response rate of 61.5% while “>CIN2” had 29.1% (relative risk [RR], 2.12; 95% CI, 1.26 to 3.53; p=0.01) using the stringent criterion. With the lenient criterion, the response rate for “CIN2” was 73.1% and that of “>CIN2” was 36.4% (RR, 2.01; 95% CI, 1.31 to 3.08; p=0.004) for both groups, the response rate for “CIN2” was 87.5% and that of “>CIN2” was 38.5% (RR, 2.28, 95% CI, 1.39 to 3.99; p=0.003) for the Candida group. No cases of invasive cervical cancer were detected within the 12-month follow-up time. Safety Atty. Dkt. No.169852.00146 Treatment-related commonly occurring (with 5% or more of injections) adverse events (AEs) are summarized in Table 2, and all AEs, regardless of relatedness to treatments are summarized in Supplementary Table 1. No dose-limiting toxicity (DLT) was reported, and the most frequent AE was immediate injection site reaction for both treatment groups. Delayed injection site reaction (p=0.02) and myalgia (p<0.001) were significantly more frequently observed in the PepCan group in comparison to the Candida group (Table 2). No patients discontinued due to AEs. Immune Responses Following vaccination, new CD3 T cell responses to at least one region of the HPV 16 E6 protein were detected in 18 of 33 patients (54.5%) in the PepCan group and in 17 of 38 (44.7%) patients in the Candida group. Therefore, exogenous HPV antigens were not necessary to induce anti-HPV T cell responses. Anti-HPV 16 E6 T cell responses were detectable prior to vaccination in 7 of 33 patients (21.2%) in the PepCan group and in 13 of 38 patients (34.2%) in the Candida group. The histological responders demonstrated new E6 response in 14 of 31 (45.2%) and non- responders in 21 of 40 (52.5%). Pre-existing E6 responses were present in 12 of 31 (38.7%) of responders and 8 of 40 (20%) of non-responders. Representative assay results are shown in Figure 9. Epitope spreading was demonstrated in 7 of 18 patients (38.9%) in the PepCan group, in 8 of 14 (57.1%) patients in the Candida group, 6 of 10 (60%) histological responders, and 9 of 22 (40.9%) histological non-responders (Figure 3A). None of these comparisons reached statistical significance. TCR ^ deep sequencing analyses of PBMC samples in patients with sustained new HPV 16 E6 responses demonstrated by the ELISPOT assay (n=15) did not show any difference between the PepCan and Candida groups when the number of putatively vaccine-specific T cells were compared. However, there was a significant increase of such T cells among histological non- responders (p=0.02), but not in histological responders suggesting that the lack of histological response is not due to poor peripheral response (Figure 3B). Analogous analyses using the fraction of putatively vaccine-specific T cells yielded the same results (data not shown). The putatively vaccine specific T cells in the cervix were detected in 7 of 8 (87.5%) responders and 6 of 7 (85.7%) non-responders. Using single-cell TCR-seq, the presence of vaccine-induced HPV-specific CD4 and CD8 T cells were confirmed in 5 of 5 patients in peripheral blood and in cervix (Figure 3A). The percentages of vaccine-induced HPV-specific T cells in cervix varied from 1.7% to 14.1% Atty. Dkt. No.169852.00146 (Table 15). As only 1 of 5 patients was a histological responder, the mere presence of HPV-specific T cells is not the determining factor in histological response. Single-cell RNA-seq revealed increased expression of granzymes, CCR5, and EOMES in a histological responder compared to non-responders (Figure 3C / D), suggesting that the abundance of terminally exhausted T cells might be associated with a histological response (p<1x10-90for all comparisons).28,29When correlations between pre-vaccination individual plasma cytokines (n=51) and metabolites (n=1,454) were examined in histological responders and non-responders (stringent) in hopes of identifying potential biomarkers of vaccine response, none were identified (see Tables S2 and S3 in Supplementary Appendix). When changes over time were examined in order to gain insight into how the vaccines work, significant differences from the baseline were observed for 11 of 51 plasma cytokines examined (Figure 4A). None were significant among the 1,454 metabolites examined (data not shown). Most of the significant cytokine changes were decreases from the baseline. Only a few changes were noted in the PepCan group and histological non-responders while the Candida group and histological responders both demonstrated decreased levels of 7 and 11 cytokines respectively (Figure 4A). The Candida group and the responders shared decreases of CCL4 [MIP-1β](padj=0.01 at 6 months, padj=0.02 at 12 months for Candida, and padj=0.005 at 6 months, padj<0.001 at 12 months for responders) CCL5 [RANTES]( padj<0.001, padj=0.005, padj=0.002, and padj<0.001 respectively), IL-9 (padj=0.01, padj=NS, padj=0.003, and padj=0.002 respectively), lymphotoxin-α (LT-α) [TNF-β(padj=0.03, padj=NS, padj=0.008, and padj=0.003 respectively)], platelet-derived growth factor-ββ (PDGF-ββ)(padj=0.02, padj=0.03, padj=0.009, and padj=0.002 respectively),, and tumor growth factor-β1 (TGF-β1)(padj=0.04, padj=0.04, padj=0.02, and padj=0.01 respectively), levels suggesting that histological regression of CIN2 / 3 may be mediated through Candida modulating these systemic immune mediators (Figure 4B). The most pronounced decreases were observed for CCL5. The FACS analysis of peripheral immune cells for both groups revealed the percentage of Tregs was higher in histological non-responders in comparison to responders (stringent) pre- vaccination and at 12 months as reported in our Phase 1 study of PepCan;22however, the comparisons were no longer significant after adjustments for multiple analyses in Phase 2 (Figure 10A). No changes in Th1 cells, Th2 cells, Tregs, and MDSCs following vaccinations that were consistent and significant after adjustments for multiple analyses were found (Figure 10D). HPV Atty. Dkt. No.169852.00146 When clearance of HPV infection at exit visit (6- or 12-month visit) by risk groups was examined, no significant differences were found between the PepCan and Candida groups (Figure 5A). For patients who were HPV 16-positive at the screening visit, the HPV 16 viral load was examined. A trend for HPV 16 viral load decreasing at the 6-month visit was observed in the Candida group, suggesting the HPV antigens may not be necessary for reducing viral loads (Figure 5B; p=0.05). HLA Typing There were no significant associations with HLA types with histological responses (stringent) after correcting for multiple comparisons (Table S5). However, some HLA types were found at significantly higher proportions in the patient population compared to the general population. These included HLA B14, B15, B40, B49, C03, DR03, and DQ03. In particular, DQ03 was found to be nearly ten times more frequent in the patient population (38.1%) in comparison to the United States population (3.9%)(Figure 12D). The increased frequencies of HLA B14, B15, B40, C03, DR03, and DQ03 were also observed in our Phase I study.22,23The increased risk for cervical neoplasia in people with DQ03 has also been reported by others.30-32Cervical Microbiome No differences in pre-vaccination α diversity matrices between histological responders and non-responders (stringent) were found (Table 9), and none of the taxa examined correlated with histological responses (Figure 11A). On the other hand, significant increases in α diversity from the baseline were observed at 6-month visit using the Faiths’ Phylogenetic analysis in all subjects and subgroups examined [i.e., PepCan. Candida, histological responders (stringent) and histological non-responders](Table 10). Furtheremore , at 12-month visit, increases in α diversity from the baseline were observed using all three matrices (Pielou Evenness, Faith’s Phylogenetic, and Shannon Diversity) in all subjects and in subgroups (Table 10). Therefore, α diversity increases significantly after vaccinations in a manner unrelated to vaccine efficacy. Furthermore, the number of taxa were differentially expressed after vaccination in all patients as well as in the subgroups (Figure 11B, 11C, 11D, 11E, 11F, and Table 11). Discussion CIN2 / 3 is a premalignant lesion of the uterine cervix that poses a significantly higher risk of progressing to malignancy in comparison to its lower grade counterpart, CIN1. While CIN2 / 3 lesions are usually treated with surgical resection such as LEEP, observation is desirable for Atty. Dkt. No.169852.00146 women younger than 25 and women who are planning to become pregnant due to possible adverse obstetric outcomes.5-8The availability of an effective HPV therapeutic vaccine that would promote regression of CIN without affecting the cervical anatomy is an unmet need; however, none has been approved by the Food and Drug Administration to date although many different versions have been tested in clinical trials.33In this study, the effectiveness of PepCan and Candida were examined. Surprisingly, our findings revealed that only Candida was significantly more effective in regressing CIN2 / 3 in comparison to a historical placebo group.2Given that PepCan with higher amounts of HPV 16 E6 peptides was less effective in regressing CIN2 / 3 and in mounting anti-HPV T cell responses in our Phase 1 study,22,23it may be possible that the HPV peptides in this formulation may have some unexpected inhibitory effects. Such effects can be inferred from our cytokine data which demonstrate much more robust changes in Candida group compared to the PepCan group (Figure 4). While Candida was not shown to be more effective than PepCan, these results demonstrate that the adjuvant effect may be more important than the immune stimulation by the exogenous HPV antigens for therapeutic vaccines. It is possible that the immune system is targeting viral antigens from prior natural infection. A comparison was made between the two treatment arms in the current study and the historical placebo2using the stringent criterion of regression to no CIN. Therefore, the regression rates may seem low as many other studies use a less stringent criterion of regression to less than CIN2.34The use of historical placebo has its limitations in that the study designs were similar but not exactly the same. For example, in our current study, quadrant biopsies were performed for the final histological assessment and the highest grade was resulted, while the comparison study only mentioned “biopsy” being performed.2While the designated primary end points for both studies were 15 months after treatment initiation, the comparison study used a wider definition of “regression” in terms of the time of assessment as being “complete biopsy response (or endocervical curettage if biopsy not available) at 15, 9, 12, 21, or 27 months”.2Therefore, the criterion used to define histological regression was much stricter in our current study. In addition, there may have been differences in disease presentation, referral patterns, and regional practices. In fact, significant demographic differences were observed in that the placebo group was younger and had higher use of oral contraceptives. Although the higher proportion of younger patients in the placebo group would expect to increase its regression rate, the Candida group still had a Atty. Dkt. No.169852.00146 significantly higher rate of regression. While retention was excellent with 76 of 81 (93.8%) of enrolled patients completing the study, some exited after the 6-month visit due to persistent / progressive disease. While not allowing this option would have been unethical and unsafe, this lowered the number of patients completing the 12-month visit. Despite these concerns, Candida would be the chosen investigative product to proceed with a Phase 3 trial. Safety of PepCan and Candida has been demonstrated, as there were no DLTs reported during the study. Interestingly, fever and myalgia were more frequently reported in the PepCan group suggesting that it was caused at least in part by the HPV peptides. As demonstrated in our Phase I study,22,23the presence of new T cell responses to HPV 16 E6 after vaccination was not correlated with histological responses. Putatively vaccine-specific T cells and vaccine-induced HPV-specific T cells were demonstrated in blood and cervix of both histological responders and non-responders (Figure 3A). Single-cell RNA-seq of vaccine-induced HPV-specific T cells demonstrated elevated expression of granzymes, CCR5, and EOMES in a histological responder (Figure 3C / D). The elevated levels of granzymes and EOMES are understandable since granzymes are serine proteases secreted by cytotoxic cells and EOMES is a T-bet-like T-box transcription factor expressed by natural killer cells and activated CD8 T cells.35On the other hand, the elevated level of CCR5 is perplexing given the CCL4- and CCL5- reducing effects of Candida. Nevertheless, a larger number of patients are needed to confirm these findings. Furthermore, it is possible that in addition to the T cell phenotype, the local cervical environments may also influence histological response. For example, the number of Tregs in tumor microenvironment has been correlated with CIN2 progression.36Another unexpected finding from this clinical trial was the exploratory role cytokines may be playing in inducing CIN2 / 3 regression including by chemokines, CCL4, and CCL5. Chemokines are a family of small cytokines that can induce directional movement of many cell types including various leukocytes, endothelial cells and epithelial cells, and tumor cells. CCL4 can be produced by monocytes, CD8 T cells, natural killer cells, B cells, dendritic cells, neutrophils, and pulmonary vascular smooth cells.37CCL5 is mainly produced by T cells and monocytes. CCL4 and CCL5 are thought to promote tumor progression by enhancing migration of inhibitory immune cells to tumor microenvironment and promoting tumor metastasis.37-39CCR5 (also known as CD195) is the main receptor of CCL4 and CCL5, and it is expressed on T cells, smooth muscle endothelial cells, epithelial cells, parenchymal cells, and tumor cells. CCR5 and / or Atty. Dkt. No.169852.00146 CXCR4 are most commonly used by HIV-1 to enter target immune cells and are commonly targeted for developing anti-HIV therapies.39More recently, several clinical trials have been initiated to treat multiple types of cancer utilizing CCR5 inhibitors with or without checkpoint inhibitors.38,39IL-9, LT-α (formerly known as TNF-β), PDGF-ββ, and TGF-β1 were also significantly decreased in both the Candida and the histological responder groups after vaccinations (Figure 4). IL-9 is a pleiotropic cytokine produced by a variety of immune cells including mast cells, natural killer T cells, Th2, Th17, Tregs cells, group 2 innate lymphoid cells, and Th9 cells.40IL-9’s main role is to mount immune responses against parasites. It can also induce the proliferation of hematological malignancies, including Hodgkin’s lymphoma.40LT-α is an inflammatory cytokine and is a member of the tumor necrosis factor superfamily. It is produced by activated lymphocytes and it has been shown to promote tumor angiogenesis in head and neck squamous cell carcinoma by modulating glycolysis in a PFKFB3 (a gene that encodes the 6-phosphofructo-2- kinase / fructose-2,6-biphosphatase 3 enzyme in humans)-dependent manner.41An inhibitor of PFKFB3, PFK15, has been shown to impair tumor angiogenesis in vitro and in vivo.41PDGF-ββ is a member of the platelet-derived growth factor family, and it is one of the proteins shown to be produced by cancer-associated fibroblasts, and they can promote tumor progression through increased proliferation, migration, invasion, chemotaxis, and tumor angiogenesis. PDFG-ββ also has a role in promoting lymphatic metastasis of cholangiocarcinoma.42PDFG-ββ induces the GSK3β and P65 signaling pathways. The investigators demonstrated that by inhibiting the GSK3β pathway with CHIR-98014 and the P65 signaling pathway with PG490, cancer-associated fibroblast induced promotion of tumor growth can be prevented in vivo.42TGF-β signaling is involved in numerous cellular processes in embryogenesis and mature organisms, and it also has key roles in cancer progression. TGF-β1 is one of three isoforms. It is an inhibitory cytokine secreted by Tregs to inhibit activities of other T cells.43It can also inhibit B cells, macrophages, and monocytes.44TGF-β1, TGF-β2, and / or TGF-β3 have been targeted for cancer therapies in multiple clinical trials using small molecules that inhibit TGF-β receptor kinases, antibodies, and a bifunctional fusion protein consisting of the extracellular domain of the TGF‐βRII receptor (which would trap TGF‐β) fused to an anti-PD‐L1 antibody.45In vitro, Candida has been shown to induce T cell proliferation and secretion of IL-12.21,46However, we did not observe an increase in peripheral Th1 cells in this study, like we did in the Atty. Dkt. No.169852.00146 Phase I study.22,23Candida injected intradermally in periphery has been shown to induce a decrease in HPV 16 viral load (Figure 4B). This may be mediated through cytokine / chemokine changes induced by Candida which in turn could possibly alter the phenotype of HPV-specific T cells to be more effective in eliminating HPV infection. It is perplexing as to why PepCan which consists of HPV 16 E6 peptides and Candida was not effective in regressing CIN2 / 3 when compared to a historical placebo while Candida alone was. This is particularly true when another version of a long peptide-based therapeutic HPV vaccine emulsified with incomplete Freund’s adjuvant has shown efficacy in treating high-grade vulvar intraepithelial lesions (Kenter 2009) and HPV-associated oropharyngeal cancer in combination with an anti-PD1 checkpoint inhibitor (Masserreli 2019). Such a conundrum has been reported for neoantigen-based cancer vaccines for solid tumors. Rappaport and colleagues tested a shared neoantigen vaccine (a chimp adenovirus and self-amplifying mRNA) in combination with checkpoint inhibitors in treating solid tumors in patients with tumors expressing HLA-matched tumor mutations, mostly KRAS (Rappaport et al., 2024, Nature Medicine). Despite the fact post- vaccination T cell responses were demonstrated to the particular mutated antigens, 79% (15 of 19) patients experienced progressive disease within a few months. On the other hand, a personalized RNA neoantigen vaccines given to pancreatic ductal adenocarcinoma patients in conjunction with a checkpoint inhibitor and a four-drug chemotherapy regimen demonstrated longer median recurrence-free survival in patients with vaccine-expanded T cells in comparison to patients without such T cell expansion (p=0.003) (Rojas et al. Nature Medicine 2023). In both of these comparisons, many variables in patient characteristics, vaccine design, dosage, number of injections, treatment regimens may have contributed to the different outcomes. However, it would be difficult to tease out which variables are important among so many. In case of peptide-based vaccines, why cancer vaccine-induced T cells often do not eradicate tumors has been studied in mice (Hailemichael 2013 Nature Medicine). The authors have reported that gp100 melanoma peptide in incomplete Freund’s adjuvant primed tumor-specific T cells accumulated at the vaccination site (not tumor), became dysfunctional, and underwent antigen-mediated interferon-ɣ and Fas ligand-mediated apoptosis. “Persistent vaccine depots” have been shown to induce specific T cell segregation, malfunction and deletion. We have previously reported on the insoluble nature of the vaccine peptides in PepCan resulting the formation of microparticles (Greenfield et al., 2015), and it is possible that this created the depot effect resulting in lack of clinical efficacy. Atty. Dkt. No.169852.00146 As we have demonstrated the efficacy of Candida for treating CIN2 / 3 in comparison to a historical placebo group, the next step would be to perform a Phase 3 study. However, a placebo- controlled study may be considered unethical due to the risk of disease progression of CIN3.6,10,47Another alternative is to explore whether Candida could be more potent by increasing the volume and / or the number of injections. A multi-center Phase 2 study using Candida to treat common warts has demonstrated 65.9% efficacy (29 / 44) at the 0.3 mL dose and 79.5% efficacy (31 / 39) at the 0.5 mL dose in regressing the largest injected wart.48This is a 21% dose-dependent increase in efficacy. Therefore, it would be possible to examine Candida as an alternative to standard surgical treatments in a non-inferiority trial. According to a recent meta-analysis, the success rate of the standard surgical treatments is 71.4%, given 25.9% positive margin rate after LEEP, and 3.7% early recurrence within 18 months.49This would possibly make Candida, with an expected enhanced efficacy of 70.8% for regression to CIN1 or no CIN, a first-line option for treating CIN2 / 3. In conclusion, we have demonstrated that Candida alone was effective in regressing CIN2 / 3 in comparison to a historical placebo group. Furthermore, Candida appears to exert such an effect through reducing systemic cytokines which have been shown to promote tumor progression. Some of these cytokines may have direct effects to the tumor environments, but some may alter the phenotypes of the HPV-specific T cells as demonstrated by the single-cell analyses. We did not identify any predictive biomarkers amongst plasma cytokines, plasma metabolomics, and cervical microbiota. The vaccine-induce HPV-specific CD3 T cell responses were demonstrated in PepCan and Candida treated groups as well as in histological responders and non- responders suggesting that the induction of HPV-specific T cells alone is not sufficient for high- grade squamous intraepithelial regression. Candida may become an alternative to standard surgical treatments for CIN2 / 3. Furthermore, its addition to treatment of other premalignant and malignant diseases should be considered given its effects in reducing tumor-promoting chemokines / cytokines. Table 1. Baseline Characteristics of the Patients^ Characteristic / Group PepCan Candida Total Group Group N=81 Atty. Dkt. No.169852.00146 2 Atty. Dkt. No.169852.00146 p p p q ified for vaccination and were randomized. Table 2. A comparison of injection-related adverse events occurring in ≥ 5% of injections with PepCan or Candida PepCan n = 152 Candida n = 164 P-value* The highest grade is reported for each adverse event for a given injection SUPPLEMENTARY METHODS Atty. Dkt. No.169852.00146 HPV TYPING AND HPV 16 VIRAL LOAD HPV typing testing was performed using a Linear Array HPV Genotyping Test (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions using Thin-Prep samples (Hologic, Marlborough, MA). This test detects 37 anogenital HPV types: 6, 11, 16, 18, 26, 31, 33, 35, 39, 40, 42, 45, 51, 52, 53, 54, 55, 56, 58, 59, 61, 62, 64, 66, 67, 68, 69, 70, 71, 72, 73 [MM9], 81, 82 [MM4], 83 [MM7], 84 [MM8], IS39, and CP6108. The human β-globin signal was also assayed as a positive control for sample adequacy of DNA content. Subjects were categorized for being positive for HPV-16, other HPV-16-related types (31, 33, 35, 52, 58, and 67),1 other high-risk HPV types (18, 39, 45, 51, 53, 56, 59, 66, 68, 69, 70, 73, and 82),2 and low- risk HPV types (6, 11, 40, 42, 54, 61, 62, 71, 72, 81, 83, 84, and CP6108).1,2 The difference in HPV clearance rates between the PepCan and Candida groups were examined using Fisher’s exact test as described in the statistical analysis plan. A method previously described was followed3,4 to determine the HPV 16 viral load in subjects in whom HPV 16 was detected at the screening visit. Briefly, quantitative real time PCR was performed using iQ SYBR Green PCR Master Mix (BioRad Laboratories, Hercules, CA) with diluted DNA and HPV 16 E6 primers (5′-aaagccactgtgtcctgaaga-3′ (SEQ ID NO: 1) and 5′- ctgggtttctctacgtgttct-3′)5 (SEQ ID NO: 2) or GAPDH primers (5′-cgagatccctccaaaatcaa-3’ (SEQ ID NO: 3) and 5-catgagtccttccacgataccaa-3’ (SEQ ID NO: 4)).6 Amplifications were carried out using a BioRad CFX 96 Real-Time PCR Detection System (BioRad Laboratories) with an initial denaturation at 95oC for 5 min. This was followed by 40 cycles of 95oC for 10 sec and 55oC for 20 sec for HPV 16 E6 or 30 cycles of 95oC for 15 sec, 50oC for 30 sec, and 72oC for 20 sec for GAPDH. Data acquisition was done at 510 nm at 55oC and 72oC respectively. The standard curve for HPV was established by amplification of a serially diluted quantitative synthetic HPV 16 DNA (American Type Culture Collection, Manassas, VA) in the presence of 100pg of human placental DNA. The standard curve for GAPDH was established using serial 10-fold dilution of placental DNA starting with 250ng of DNA. The amount of DNA was converted to cell number with an assumption that 6.6pg of DNA is present in a diploid cell.4 Mean threshold cycle (CT) values of triplicate samples at each dilution were used to generate standard curves, and mean CT values of specimen duplicates were used for calculating quantities. All DNA samples from the same subjects were analyzed in the same PCR run. HPV 16 viral loads were determined using E6 copy numbers and were not meant to be an absolute quantification. The specificity of amplifications was Atty. Dkt. No.169852.00146 examined through melting curve analyses. The significance in the changes of HPV 16 viral load was examined using Wilcoxon matched-pairs signed rank test as described in the statistical analysis plan. PERIPHERAL HPV 16-SPECIFIC T CELL RESPONSES Peripheral T cell responses specific to the HPV 16 E6 protein were assessed using an enzyme-linked immunospot (ELISPOT) assay with blood samples drawn before and after vaccinations (pre-vaccination, post-2 vaccination, at 6 month visit, and at 12 month visit). Peripheral blood mononuclear cells (PBMCs) were isolated from heparinized whole blood using a Ficoll density-gradient centrifugation method and were then cryopreserved. CD3 T cell lines were established from three or four blood draws from each patient as described previously by stimulating magnetically selected CD3 T cells with autologous monocyte-derived dendritic cells pulsed with recombinant vaccinia virus and recombinant glutathione S-transferase-fusion protein expressing HPV16 E6.3,7 The ELISPOT assay was performed on day 22 in which HPV 16 E6 (10 regions) were assessed using a method adapted from a previously published version.3,7 Briefly, 96-well plates (MultiScreen-MSIPS 4510 plates, Sigma-Aldrich, St. Louis MO) were treated with 35% EtOH in sterile PBS and rinsed immediately. They were subsequently coated with 5 ^g / ml of primary anti-interferon ^ monoclonal antibody (1-D1K, Mabtech, Sweden), washed, and blocked. Then, 2.5 x 104CD3 T cells were added per well in triplicate along with pooled peptides (10 ^M per peptide). Each peptide pool contained 3 overlapping HPV 16 E615-mer peptides. For example, the E61-25 pool contained E61-15, E66-20, and E611-25 peptides. Negative control wells contained media only, and positive control wells contained phytohaemagglutinin at 10 ^g / mL, (Remel, Lenexa, KS). Plates were incubated for 24 hours at 37oC with 5% carbon dioxide. After washing, a secondary biotin-conjugated anti-Interferon ^ monoclonal antibody (7-B6-1, Mabtech, Nacka Strand, Sweden) was added at 1 ^g / ml and incubated for 2 hours. After washing, streptavidin-horseradish peroxidase (Mabtech) was added at a dilution of one to 750 and incubated at room temperature for one hour. Wells were washed and coated with 3,3',5,5' tetramethylbenzidine (Mabtech) for 10 to 30 minutes and allowed to develop at room temperature until spots emerged. The plates were then rinsed in water and allowed to dry overnight. Peptide pools with spot forming units twice or greater to the media only control were considered to be positive. Paired t-test was used to examine the significance of increased responses as described in the statistical analysis plan. Atty. Dkt. No.169852.00146 EPITOPE SPREADING For patients who were HPV 16-positive at entry, epitope spreading to HPV 16 E7 protein was examined using ELISPOT assay as described above. For those who were HPV 18, 35, or 52- positive at entry, epitope spreading to respective E6 protein was similarly examined. These HPV types were selected for their high prevalence in earlier studies examining the patient population.8 Recombinant vaccinia virus constructs expressing HPV 35 E6 protein and HPV 52 E6 protein separately were constructed as well as recombinant GST fusion proteins containing the E6 protein of HPV types 18, 35, and 52 separately. The full-length of HPV 18 E6 gene was amplified by polymerase chain reaction (PCR) from the vector HPV 18-pBR322 (American Tissue Culture Collection, Manassas,VA). The HPV 18-pBR322 vector contains the full-length of HPV 18 genome. The amplified PCR product of HPV 18-E6 gene was cloned into pGEX-2T vector (GE Healthcare, Chicago, IL) at EcoRI site, introduced at 5’ end and 3’ end of primer sequences. The full-length of HPV 35 E6 gene was amplified by PCR from the vector HPV 35-1-pBR322 (provided by Carina Eklund, Karolinska Institutet, Stockholm, Sweden), which contains partial fragment of HPV 35 genome including the HPV 35 E6 gene. The amplified PCR product of HPV 35 E6 gene was then cloned into pGEX-2T vector at 5’ BamHI site and 3’ EcoRI site, introduced via primer sequence design. In a similar way, the full-length of HPV 52 E6 gene was amplified by PCR from the vector HPV 52-pBR322 (ATCC). The HPV 52-pBR322 contains the full-length of HPV 52 genome. The amplified PCR product of HPV 52 E6 gene was cloned into pGEX-2T vector at EcoRI sites, added at 5’ end and 3’ end of primer sequences. The primer sequences for application of HPV 18 E6 gene were 5’ ATAGAATTCCTATGGCGCGCTTTGAGG 3’ (SEQ ID NO: 5) for forward and 5’ GACGAATTCTTATACTTGTGTTTCTCTGCG 3’ (SEQ ID NO: 6) for reserves, and they contained an EcoRI sites; for HPV 35 E6 gene were 5’ ACGTGGATCCATGTTTCAGGACCCAGC 3’ (SEQ ID NO: 7) for forward and 5’ GTCAGAATTCCATGCATGATTACACCTCG 3’ (SEQ ID NO: 8) for reverse and contained BamHI and EcoRI sites; and for HPV 52 E6 gene were 5’ TGACGAATTCCCATGTTTGAGGATCCAGC 3’ (SEQ ID NO: 9) for forward and 5’ CACGGAATTCGTTACACTTGGGTCACAGG 3’ (SEQ ID NO: 10) for reverse and contained EcoRI sites. The insertion of the HPV 18-E6, HPV 35-E6, HPV 52-E6 in pGEX-2T vector was confirmed by restriction enzyme digestion and sequence analysis. Expression of the HPV 18-E6- GST, HPV 35-E6-GST, HPV 52-E6-GST fusion proteins in pGEX-2T vector was demonstrated Atty. Dkt. No.169852.00146 with Western blot using goat-anti-GST polyclonal antibody (GE healthcare) with expected 44 kD in size. Peripheral and Cervical Immune Responses The bulk T cell receptor (TCR) ^ deep sequencing of PBMCs and liquid-based cytology samples was performed (Adaptive Biotechnologies, Seattle, WA) for patients who demonstrated new HPV 16 E6 responses in at least two of three post-vaccination PBMC samples (n=15). Putatively vaccine-specific T cells were identified by comparing post-vaccination PBMC sample to the pre-vaccination PBMC sample using a beta-binomial model.9 The presence of such putatively vaccine-specific T cells were examined in cervix by searching for complementarity determining region 3 (CDR3) ^ nucleotide sequences in liquid-based cytology samples. In order to confirm whether these T cells were HPV-specific, T cells were stimulated with HPV 16 peptides from the region of statistically significantly increased ELISPOT positivity after vaccination and were sorted based on interferon- ^ secretion (Interferon- ^ Secretion Assay, Miltenyi Biotec, Auburn, CA) and CD8 staining (n=5). The CD8-positive and -negative interferon- ^ secreting T cells were analyzed using single-cell RNA-seq and TCR-seq (10X Genomics, Pleasanton, CA). The experimental procedures for the single-cell analyses have been published previously.10 Briefly, post-vaccination PBMC samples were thawed and cultured overnight in RPMI medium with 5% human serum and 1,200 IU / mL of recombinant human interleukin-2 (PeproTech, Cranbury, NJ). The cells were stimulated for 3 hours with 10 μM of HPV peptides selected from positive ELISPOT results. interferon- ^ secreting cells were labeled by the interferon- ^ catch reagent and phycoerythrin (PE)-labeled interferon- ^ detection antibody, according to manufacturer’s instruction (interferon- ^ Secretion Assay – Detection Kit, Miltenyi Biotec). interferon- ^ secreting CD8-positive and interferon- ^ secreting CD8-negative cells were enriched by FACS Aria III and subjected to single-cell sequencing analysis. Briefly, the manufacturer’s protocol for single-cell sample preparation was followed using single cell 5’ reagent kits v2 (10X Genomics, Pleasanton, CA). Single-cell sequencing for gene expression and TCR was performed using an Illumina Novaseq 6000 system. Sequencing data were first processed by a Cell Ranger pipeline (v6.1.2; 10X Genomics). Gene expression sequencing data were mapped to human reference (GRCh38-2020-A) dataset. The single-cell data were further analyzed by Seurat v.4.4.0, by following the recommended steps and settings. The low-quality cells and doublets were filtered out by the following setting: percentage of mitochondrial genes > 5%, number of detected genes Atty. Dkt. No.169852.00146 < 1000 and number of detected genes > 5000. The clustering was performed with the resolution setting at 0.2. The UMAP (Uniform Manifold Approximation and Projection) plot, violin plots, feature plots, and p-values were also generated by Seurat v4.4.0. TCR sequencing data were mapped to human TCR reference (GRCh38-alts-ensembl-5.0.0) dataset, and they were further analyzed by Loupe V(D)J Browser (v4.0.0; 10X Genomics). T cell clonotypes were defined based on TCR Vβ CDR3 amino acid sequences. PERIPHERAL IMMUNE CELLS Thawed PBMCs were stained with appropriate isotype controls and combinations of monoclonal antibodies to analyze T-helper type 1 (Th1, promoting cellular immunity), T-helper type 2 (Th2, promoting antibody production and is anti-Th1), regulatory T-cells (Tregs, promoting immune suppression), and myeloid-derived suppressor cells (MDSCs). As there is no consensus in the literature as to how to analyze MDSCs; two commonly used methods were used to measure MDSC111 and MDSC2.12,13 To analyze Th1 cells (CD4- and Tbet-positive), Th2 cells (CD4- and GATA3-positive), and Tregs (CD4-, CD25-, and FoxP3-positive), thawed PBMCs were stained using fluorescein isothiocyanate-labeled anti-human CD4 (clone RPA-T4, Thermo Fisher Scientific, Hillsboro, OR), phycoerythrin-labeled anti-human / mouse T-bet (clone 4B10, Thermo Fisher Scientific), PerCP-Cy5.5-labeled anti-human CD25 (clone BC96, Thermo Fisher Scientific), allophycocyanin-labeled anti-human Foxp3 (clone PCH101, Thermo Fisher Scientific ), and phycoerythrin -Cy7 labeled anti-human / mouse GATA3 (clone L50-823, BD, Franklin, NJ). Cells were initially stained with antibodies for surface markers CD3, CD4, and CD25. Intracellular staining for T-bet, GATA3, and Foxp3 was performed using the Foxp3 staining kit (Thermo Fisher Scientific). For the analyses of MDSC1 (CD33-, IL4Ralpha-, CD11b- CD14- positive and HLA-DR- intermediate / negative) and MDSC2 (CD14-positive and HLA-DR-low / negative), thawed PBMCs were treated with Fc receptor blocker (Innovex Biosciences, Richmond, CA) first. Then, they were stained with anti-CD11b / Mac-1 Pacific Blue (BD), anti-CD14-APC-Cy7 (BD), anti-CD33-APC (BD), anti-IL4Ralpha (R&D, Minneapolis, MN) and anti-HLA-DR Brilliant Violet 711 (Biolegend, San Diego, CA). Flow cytometric analysis was performed with FACS Fortessa using FACS Diva software (BD) in the University of Arkansas for Medical Sciences Microbiology and Immunology Flow Atty. Dkt. No.169852.00146 Cytometry Core Laboratory. One hundred thousand events were acquired in the lymphocyte gate for Th1, Th2, and Treg determinations.14 For MDSC1 and MDSC2, all events excluding debris and doublets were acquired. The values before and after vaccinations were compared using paired t-test, and those between histological responders and non-responders (stringent) were compared using unpaired t-test as descried in the statistical analysis plan. PLASMA CYTOKINES Plasma samples were obtain by centrifugation of whole blood collected in sodium heparin tubes, and frozen in a -80°C freezer within one hour after blood draw as our previous work demonstrated that levels of some cytokines were altered significantly at two hours.3Data from one sample which was received after one hour but within two hours was utilized for cytokines shown not to be labile.3The quantities of ^-nerve growth factor ( ^-NGF), cutaneous T cell-attracting chemokine (CTACK), eotaxin, basic fibroblast growth factor (FGF), granulocyte-colony stimulating factor (G-CSF), granulocyte monocyte-colony stimulating factor (GM-CSF), chemokine (C-X-C motif) ligand 1 (CXCL1, also known as GRO- ^), hepatocyte growth factor (HGF), interferon- ^2 (IFN- ^2), interferon- ^ (IFN- ^), interleukin-1 ^ (IL-1 ^), interleukin-1 ^ (IL- 1 ^), IL-1 receptor agonist (IL-1RA), interleukin-2 (IL-2), interleukin-2R ^, (IL-2R ^), interleukin- 3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-6 (IL-6), interleukin-7 (IL-7), interleukin-8 (IL-8), interleukin-9 (IL-9), interleukin-10 (IL-10), interleukin-12 (IL-12) (p70), IL- 12 (p40), interleukin-13 (IL-13), interleukin-15 (IL-15), interleukin-16 (IL-16), interleukin-17A (IL-17A), interleukin-18 (IL-18), IFN- ^ induced protein 10 (IP-10), leukemia inhibitory factor (LIF), monocyte-colony stimulating factor (M-CSF), monocyte chemotactic protein 1 (MCP-1), monocyte chemotactic protein 3 (MCP-3), macrophage migration inhibitory factor (MIF), chemokine (C-X-C motif) ligand 9 (CXCL9, also known as MIG), macrophage inflammatory protein1 ^ (MIP-1 ^ ^, macrophage inflammatory protein-1 ^ (MIP-1 ^ ^, platelet-derived growth factor subunit B (PDGF-BB), regulated on activation, normal T-cell expressed and secreted (RANTES), stem cell factor (SCF), stem cell growth factor ^ (SCGF- ^), stromal-derived cell factor-1 ^ (SDF-1 ^), tumor necrosis factor ^ (TNF- ^), tumor necrosis factor ^ (TNF- ^), tumor necrosis factor-related apoptosis inducing ligand, (TRAIL), and vascular endothelial growth factor (VEGF) were determined using a commercially available Bio-Plex kit (Bio-Rad Laboratories) according to the manufacturer’s instructions using a Bio-Plex 200 instrument (Bio-Rad Laboratories). Tumor growth factor- ^1 (TGF- ^1), tumor growth factor- ^2 (TGF- ^2), and tumor Atty. Dkt. No.169852.00146 growth factor- ^3 (TGF- ^3) were determined separately using another Bio-Plex kit which included an acid treatment. The correlations between the base line cytokine level and histological responses (stringent) were analyzed as explained in the statistical analysis plan. PLASMA METABOLOMICS The replicate of samples used for cytokine analyses was analyzed for global profiling at Metabolon, Inc. (Morrisville, NC). Several recovery standards were added prior to the first step in the extraction process for quality control purposes. Proteins were precipitated with methanol under vigorous shaking for 2 minutes followed by centrifugation for their removal. The resulting extract was divided into five fractions. Two fractions were used for analysis by two separate reverse phase ultrahigh performance liquid chromatography tandem mass spectroscopy methods with positive ion mode electrospray ionization. One fraction was used for analysis by reverse phase ultrahigh performance liquid chromatography tandem mass spectroscopy methods with negative ion mode electrospray ionization. Another fraction was used for analysis by hydrophilic interaction liquid chromatography ultrahigh performance liquid chromatography tandem mass spectroscopy with negative ion mode electrospray. The last fraction was reserved for backup. Several types of controls were analyzed in conjunction with the experimental samples. A pooled matrix sample made by taking a small volume of each experimental sample (or alternatively, use of a pool of well-characterized human plasma) served as a technical replicate throughout the data set. Extracted water samples served as process blanks. A panel of quality control standards that were carefully chosen not to interfere with the determination of endogenous compounds were added into every analyzed sample. This allowed instrument performance monitoring, and chromatographic alignment. The correlations between individual baseline metabolite and histological responses (stringent) were examined as outlined in the statistical analysis plan. CERVICAL MICROBIOME The cervical cytology specimens in this current study were collected and reserved in the vial of the ThinPrep Pap Test (Hologic) as previously described.10,15 The specimens were frozen (-80⁰C) on the day of collection. DNA was extracted using QIAamp DNA Midi Kit (Qiagen).10 A positive control utilized in this study was a mock vaginal microbial community composed of a mixture of genomic DNA from the American Type Culture Collection (Manassas, VA). The negative control was ThinPrep preservation solution without the sample as blank extraction.16 Controls and the extracted DNA were sent to Argonne National Laboratory (Argonne,IL) for Atty. Dkt. No.169852.00146 amplification and sequencing of the 16S rRNA gene on an Illumina MiSeq sequencing platform.17 The same volume of DNA was used for each reaction, and then normalized at the PCR pooling step. This ensures that equal amounts of each amplified sample are added to the sequencing pool. Paired-end reads from libraries with ~250-bp inserts were generated for the V4 region using the barcoded primer set: 515FB: 5'-GTGYCAGCMGCCGCGGTAA-3' (SEQ ID NO: 11) and 806RB: 5'-GGACTACNVGGGTWTCTAAT-3' (SEQ ID NO: 12).18-22 MiSeq Reagent Kit v2 (2 × 150 cycles, MS-102-2002) was used. Initial sequence processing and analyses were performed using QIIME 2.23 Correlation between ^ diversity of pre-vaccination samples and vaccine response (strict) and that of individual taxon and vaccine response (strict) were examined as explained in the statistical analysis plan. HLA TYPING Low-resolution typing for HLA class I A, B, and C and class II DRB1, DQB1, and DPB1 was performed with MicroSSP Generic DNA Typing Trays (One Lambda, Los Angeles, Ca), using DNA extracted using QIAamp DNA Mini Kit (Qiagen, Germantown, MD) from PBMCs. The typing results were analyzed using HLA Fusion (One Lambda). The correlations between HLA types and histological response (stringent) and between the expected HLA frequencies among the United States population and the patient population were examined as explained in the statistical analysis plan. TABLE 3. Entry cytokine levels by histological response groups (stringent) for patients who completed the 6-month visit in both treatment groups. P-value* CytokineNo ResponseResponse (N=44)(N=32)UnadjustedAdjusted^ 4346.8 4450.7 TGFb1 (3446.0, (3058.6, 0.68 0.86 6572.5) 5867.4) 329.1 (275.5,1366.4 TGFb2 1809.5)(331.5, 0.09 0.49 2848.3) TGFb323.0 (14.5,53.6 (23.0, 72.4) 117.6)0.06 0.41CTACK506.3 (398.7,435.5 (338.1, 646.0) 682.8)0.37 0.61 Atty. Dkt. No.169852.00146 Eotaxin90.6 (60.9,69.9 (50.1, 128.7) 96.7)0.18 0.4919.9 (10.9,19.8 (11.3, G-CSF42.6 (14.4,38.0 (24.9, 49.4) 67.9)0.38 0.61GM-CSF 0.6 (0.0, 1.3) 0.0 (0.0, 0.7) 0.007 0.24 GROa191.3 (92.7,226.3 (127.7, 397.1) 942.7)0.17 0.49HGF251.1 (210.5,246.6 (198.7, 332.5) 326.8)0.71 0.86IFNg 2.4 (0.0, 6.7) 4.1 (0.0, 6.8) 1.00 1.00 IL01a 6.0 (2.0, 7.6) 3.5 (1.8, 6.2) 0.36 0.61 IL01b 1.8 (1.3, 2.5) 2.0 (1.4, 4.1) 0.38 0.61 IL01ra191.5 (112.6,240.1 (114.1, 264.7) 397.7)0.29 0.61IL02ra67.3 (54.5,58.6 (48.6, 92.4) 74.7)0.18 0.49IL04 2.6 (0.9, 3.9) 2.1 (1.1, 2.9) 0.34 0.61 IL06 1.2 (0.0, 3.1) 0.0 (0.0, 1.7) 0.10 0.49 IL08 7.5 (5.8, 9.7) 8.1 (6.4, 9.4) 0.72 0.86 IL09170.9 (68.6,295.3 (154.2, 288.6) 434.1)0.02 0.26IL10 2.1 (0.0, 4.0) 1.0 (0.0, 3.0) 0.38 0.61 IL12p70 1.9 (0.0, 3.4) 1.0 (0.0, 2.6) 0.15 0.49 IL12p4022.6 (6.3,25.8 (11.1, 27.7) 38.3)0.14 0.49 Atty. Dkt. No.169852.00146 MCP0144.5 (33.1,40.7 (33.0, 56.8) 52.4)0.48 0.66MCP03 0.2 (0.0, 1.9) 0.4 (0.0, 1.8) 0.58 0.78 1838.9 1732.1 MIF (1384.8, (1216.1, 0.98 1.00 2448.3) 3045.4) MIG273.2 (215.1,319.8 (224.9, 484.7) 466.5)0.92 0.96 MIP01a 0.7 (0.5, 1.0) 0.9 (0.6, 1.2) MIP01b93.7 (41.1,136.7 (71.0, 131.6) 198.1)0.02 0.24 PDGFbb428.4 (278.9,430.6 (215.5, 654.1) 707.2)0.86 0.952994.6 3348.5 RANTES (1967.3, (2369.9, 0.46 0.66 4742.7) 4694.2) SCF59.1 (33.8,83.4 (34.9, 93.9) 109.9)0.30 0.6146162.8 53651.9 SCGFb (35531.8, (39641.4, 0.16 0.49 61272.2) 84447.7) 1753.8 2200.6 SDF01a (1502.0, (1634.6, 0.11 0.49 2492.1) 3066.1) who completed the 6-month visit in the PepCan group. P-value CytokineNo Response* Response (N=23)(N=12)UnadjustedAdjusted^ 4199.5 TGFb1 (3333.1, 3933.6 (3006.6, 510.69 0.946169.9)31.4) Atty. Dkt. No.169852.00146TGFb2 1996.1 (993.2, 2468.6) 0.18 0.41TGFb3 69.8 (31.8, 108.1) 0.14 0.40CTACK 412.7 (282.9, 474.5) 0.09 0.40Eotaxin 65.4 (49.3, 90.7) 0.15 0.40FGF 14.1 (5.0, 27.8) 0.34 0.66G-CSF 31.7 (24.9, 54.9) 0.85 0.94GM-CSF 0.0 (0.0, 0.0) 0.07 0.40GROa169.3 (106.1,305.4) 510.2 (114.1, 1177.4) 0.31 0.62HGF246.8 (221.4,288.9) 246.3 (181.6, 310.5) 0.74 0.94IFNg 3.8 (0.4, 7.0) 0.8 (0.0, 5.1) 0.17 0.41 IL01a 3.2 (0.4, 7.4) 4.1 (1.4, 5.1) 0.94 0.97 IL01b 2.1 (1.6, 2.8) 2.0 (1.2, 4.3) 0.88 0.94IL01ra218.6 (110.7,314.9) 240.1 (174.6, 306.6) 0.65 0.94IL02ra68.3 (61.5,87.8) 52.1 (47.6, 70.3) 0.10 0.40IL04 2.5 (1.2, 3.8) 1.6 (0.7, 2.5) 0.12 0.40 IL06 0.8 (0.0, 2.0) 0.0 (0.0, 0.3) 0.10 0.40 IL08 7.0 (5.3, 9.5) 7.1 (4.2, 8.9) 0.72 0.94IL09155.7 (68.3,253.2) 337.0 (174.0, 413.3) 0.05 0.40IL10 2.3 (0.0, 4.2) 1.1 (0.0, 2.6) 0.15 0.40 IL12p70 1.5 (0.0, 2.7) 0.0 (0.0, 1.2) 0.05 0.40 IL12p40 21.6 (6.4, 27.5) 28.6 (7.5, 42.0) 0.41 0.74 IL13 0.4 (0.0, 0.7) 0.9 (0.5, 1.6) 0.10 0.40IL1688.6 (81.6,121.1) 98.4 (79.5, 121.3) 0.74 0.94IL17 1.5 (0.0, 6.2) 3.1 (0.0, 5.8) 0.55 0.92IL1838.1 (29.5,77.0) 43.9 (31.5, 54.2) 0.99 0.99IP10601.0 (463.9,898.8) 417.9 (203.8, 791.7) 0.09 0.40 Atty. Dkt. No.169852.00146 LIF 11.6 (0.3, 55.5) 20.8 (5.7, 35.6) 0.75 0.94 M-CSF24.2 (19.6,32.6) 19.1 (10.5, 23.7) 0.13 0.40MCP0147.1 (34.9,57.4) 38.7 (34.6, 44.1) 0.16 0.40MCP03 0.0 (0.0, 1.9) 0.2 (0.0, 1.1) 0.84 0.94 1853.7 MIF (1294.2, 1817.7 (1216.1, 20.90 0.952935.4)437.5)MIG265.7 (213.9,543.4) 208.9 (145.0, 265.0) 0.06 0.40MIP01a 0.8 (0.6, 1.1) 0.8 (0.6, 1.0) 0.81 0.94 MIP01b85.0 (40.6,124.6) 147.4 (91.1, 231.3) 0.02 0.40PDGFbb448.1 (294.0,643.4) 335.9 (192.1, 490.5) 0.36 0.672258.2 RANTES (1859.7, 3426.0 (2053.2, 5661.9)0.52 0.89SCF 73.8 (41.9, 109.5) 0.61 0.94SCGFb 45926.2 (36638.7, 720.79 0.9470213.2)393.3)1635.3 SDF01a (1505.6, 2154.2 (1664.6, 28670.29 0.622474.4).8)TNFa45.2 (33.1,63.1) 41.2 (21.8, 58.9) 0.79 0.94TNFb125.6 (0.0,247.9) 484.1 (140.5, 566.2) 0.04 0.40TRAIL100.6 (74.3,139.9) 92.4 (31.2, 142.6) 0.79 0.94*Wilcoxon rank-sum test; ^Benjamini and Hochberg method TABLE 5. Entry cytokine levels by histological response groups (stringent) for patients who completed the 6-month visit in the Candida group. P-value* Cytoki No Response Response ne (N=21) (N=20)UnadjustedAdjusted^ Atty. Dkt. No.169852.00146TGFb15043.3 (3752.6,5196.3 (3341.4,0.78 0.93 FGF 19.9 (10.9, 27.8) 20.4 (15.1, 40.7) 0.33 0.66 G-CSF 43.4 (9.8, 51.4) 40.4 (25.0, 74.7) 0.42 0.75 GM-CSF1.1 (0.3, 2.1) 0.0 (0.0, 0.9) 0.01 0.53GROa 197.3 (87.4, 498.1) 168.2 (130.2, 662.4) 0.46 0.76HGF264.3 (171.9,368.7) 252.4 (203.3, 326.8) 0.79 0.93IFNg 0.0 (0.0, 6.3) 5.5 (0.0, 8.2) 0.26 0.66 IL01a 6.2 (4.1, 7.7) 3.3 (2.0, 6.6) 0.13 0.66 IL01b 1.6 (1.2, 2.4) 2.0 (1.4, 3.9) 0.17 0.66IL01ra170.9 (115.3,241.4 (110.3, 420.1) 0.33 0.66 IL13 0.5 (0.0, 0.9) 0.9 (0.4, 1.6) 0.10 0.66 IL16 83.2 (75.8, 108.2) 91.4 (77.2, 131.2) 0.22 0.66 IL17 4.4 (0.0, 5.6) 1.9 (0.0, 9.9) 0.79 0.93 IL18 36.1 (28.9, 63.0) 36.0 (27.3, 80.0) 0.71 0.93IP10521.6 (291.7,1055.3) 681.0 (432.1, 868.0) 0.84 0.95LIF 8.4 (0.0, 30.2) 25.5 (10.6, 98.4) 0.12 0.66 M-CSF 23.6 (19.6, 31.5) 26.7 (19.0, 34.2) 0.77 0.93 MCP01 42.5 (31.0, 55.1) 43.2 (30.9, 53.4) 0.87 0.95 MCP03 0.5 (0.0, 2.0) 0.7 (0.0, 3.4) 0.59 0.90 Atty. Dkt. No.169852.00146 1715.5 (1395.7,1554.1 (1198.7, SCGFb40792.1 (32968.8,54553.5 (46306.1, 54366.2) 90334.5)0.04 0.66SDF01 1811.5 (1505.7, 2244.6 (1591.7, a 2488.0)3635.4)0.19 0.66TNFa 45.9 (20.6, 68.9) 51.0 (32.8, 65.4) 0.63 0.90 TNFb 173.0 (0.0, 389.6) 314.8 (67.3, 460.1) 0.45 0.76 TRAIL 101.8 (79.0, 133.3) 93.6 (37.6, 113.9) 0.26 0.66 *Wilcoxon rank-sum test; ^Benjamini and Hochberg method TABLE 6. Entry metabolite levels~ by histological response groups (stringent) for patients who completed the 6-month visit in both treatment groups. Metabolite Non-Responders Responders Log2Flod P-value* (N=44) (N=32) changes Unadju Adjust Atty. Dkt. No.169852.00146 Atty. Dkt. No.169852.00146 Atty. Dkt. No.169852.00146 Atty. Dkt. No.169852.00146 TABLE 7. Entry metabolite levels~ by histological response groups (stringent) for patients who completed the 6-month visit in the PepCan group. M li N R L 2Fl P l * ^ Atty. Dkt. No.169852.00146 Atty. Dkt. No.169852.00146 Atty. Dkt. No.169852.00146 Atty. Dkt. No.169852.00146 ~ rounding are shown. *Wilcoxon rank-sum test; ^Benjamini and Hochberg method TABLE 8. Entry metabolite levels~ by histological response groups (stringent) for patients who completed the 6-month visit in the Candida group. Metabolite Non-Responders Responders Log2Flod P-value* st Atty. Dkt. No.169852.00146 Atty. Dkt. No.169852.00146 rounding are shown. *Wilcoxon rank-sum test; ^Benjamini and Hochberg method Table 9. Summary of comparisons between diversity of histological responders and non- responders (strict) for patients who completed the 6-month visit. Diversity Index Group Non- Responders Padj* Responders Pielou Evenness Both 0.43 ± 0.21 0.44 ± 0.22 0.97 PepCan 0.41 ± 0.20 0.45 ± 0.21 0.49 Candida 0.43 ± 0.21 0.41 ± 0.20 0.73 Faith’s Both 24.77 ± 6.75 24.70 ± 6.72 0.83 Phylogenetic PepCan 25.01 ± 7.00 24.70 ± 7.03 0.61 Candida 24.34 ± 6.91 24.77 ± 6.75 0.87 Shannon Both 2.51 ± 1.32 2.57 ± 1.33 0.90 Diversity PepCan 2.42 ± 1.29 2.63 ± 1.30 0.46 Candida 2.51 ± 1.32 2.43 ± 1.28 0.87 * Benjaminin-Hochberg corrected p-value of Wilcoxon test Table 10. Summary of comparisons between a diversity between before and after vaccinations in all patients and in subgroups. Diversity Group Pre-vaccination Post- Time Padj* Index Vaccination Both 0.44 ± 0.22 0.40 ± 0.23 6 month 0.160.54 ± 0.21 12 month 0.007PepCan 0.44 ± 0.220.40 ± 0.24 6 month 0.340.55 ± 0.22 12 month 0.01Pielou C0.40 ± 0.23 6 month 0.74Evenness andida 0.43 ± 0.210.54 ± 0.22 12month 0.030.40 ± 0.23 6 month 0.36 Atty. Dkt. No.169852.00146 73.71 ± 14.21 12 month <0.001 66.30 ± 21.26 6 month <0.001Shannon Diversity± Responders 2.57 ± 1.33 2.90 ± 1.78 6 month 0.684.07 ± 1.70 12 month <0.001Non-2.51 ± 1.322.90 ± 1.80 6 month 0.24 Responders4.15 ± 1.68 12 month 0.001 * Benjaminin-Hochberg corrected of Wilcoxon test Table 11. Microbial species differentially enriched across treatment groups. Comparison Group Family Genus P d d a, s, er r s, Atty. Dkt. No.169852.00146 r r, with standard and machine-learning–based analyses, through the use of ALDEx2 (ANOVA-like differential expression, version 2). ALDEx2 is a robust compositionally aware differential abundance method that does not require rarefying of microbial amplicon data. This approach uses the Benjamini-Hochberg corrected p-value of Wilcoxon test, to detect differentially abundant features (i.e. unique microbial sequence) between time points. Table 12. Comparison of responders to non-responders (stringent) with respect to HLA types with total allele counts of 10 or greater for both groups for patients who completed the 6-month visit. HLA P-value* TypeNon-Responders RespondersUnadjusted Adjusted^ A01 0.1548 (13 / 84) 0.1290 (8 / 62) 0.81 >0.99 A02 0.2738 (23 / 84) 0.3871 (24 / 62) 0.16 0.80 A03 0.0833 (7 / 84) 0.0806 (5 / 62) >0.99 >0.99 A24 0.1310 (11 / 84) 0.0806 (5 / 62) 0.43 0.94 Atty. Dkt. No.169852.00146 HLA P-value* TypeNon-Responders RespondersUnadjusted Adjusted^ B07 0.1786 (15 / 84) 0.0781 (5 / 64) 0.09 0.80 B08 0.0714 (6 / 84) 0.0938 (6 / 64) 0.76 >0.99 B15 0.0357 (3 / 84) 0.1250 (8 / 64) 0.06 0.80 B35 0.1310 (11 / 84) 0.0781 (5 / 64) 0.42 0.94 B40 0.0476 (4 / 84) 0.0938 (6 / 64) 0.33 0.94 B44 0.1429 (12 / 84) 0.1562 (10 / 64) 0.82 >0.99 C03 0.1023 (9 / 88) 0.1429 (8 / 56) 0.60 0.94 C04 0.0909 (8 / 88) 0.0714 (4 / 56) 0.77 >0.99 C05 0.0455 (4 / 88) 0.1071 (6 / 56) 0.19 0.80 C06 0.1250 (11 / 88) 0.0714 (4 / 56) 0.41 0.94 C07 0.3750 (33 / 88) 0.3214 (18 / 56) 0.59 0.94 DP02 0.1500 (9 / 60) 0.0476 (2 / 42) 0.12 0.80 DP03 0.1000 (6 / 60) 0.0952 (4 / 42) >0.99 >0.99 DP04 0.5000 (30 / 60) 0.5238 (22 / 42) 0.84 >0.99 DQ02 0.2273 (20 / 88) 0.2031 (13 / 64) 0.84 >0.99 DQ03 0.3409 (30 / 88) 0.4531 (29 / 64) 0.18 0.80 DQ04 0.0795 (7 / 88) 0.0781 (5 / 64) >0.99 >0.99 DQ05 0.1023 (9 / 88) 0.1094 (7 / 64) >0.99 >0.99 DQ06 0.2500 (22 / 88) 0.1562 (10 / 64) 0.23 0.85 DR01 0.0682 (6 / 88) 0.0938 (6 / 64) 0.56 0.94 DR03 0.0795 (7 / 88) 0.1250 (8 / 64) 0.41 0.94 DR04 0.1932 (17 / 88) 0.2344 (15 / 64) 0.55 0.94 DR07 0.1705 (15 / 88) 0.1250 (8 / 64) 0.50 0.94 DR11 0.0682 (6 / 88) 0.0938 (6 / 64) 0.56 0.94 DR13 0.0909 (8 / 88) 0.0938 (6 / 64) >0.99 >0.99 DR15 0.2159 (19 / 88) 0.0469 (3 / 64) 0.004 0.13 *Fisher’s exact test (two-sided); ^Benjamini and Hochberg method. Table 13. Comparison of responders to non-responders with respect to HLA types with total allele counts of 10 or greater for the PepCan group for patients who completed the 6-month visit. HLA P-value* TypeNon-Responders RespondersUnadjusted Adjusted^ A01 0.1591 (7 / 44) 0.1250 (3 / 24) >0.99 >0.99 A02 0.2045 (9 / 44) 0.5417 (13 / 24) 0.007 0.08 B07 0.2143 (9 / 42) 0.1250 (3 / 24) 0.51 0.86 Atty. Dkt. No.169852.00146 HLA P-value* TypeNon-Responders RespondersUnadjusted Adjusted^ B44 0.1429 (6 / 42) 0.1667 (4 / 24) >0.99 >0.99 C07 0.4130 (19 / 46) 0.4583 (11 / 24) 0.80 0.96 DP04 0.5000 (13 / 26) 0.5714 (8 / 14) 0.75 0.96 DQ02 0.2826 (13 / 46) 0.2083 (5 / 24) 0.58 0.86 DQ03 0.3261 (15 / 46) 0.4583 (11 / 24) 0.31 0.84 DQ06 0.3043 (14 / 46) 0.2083 (5 / 24) 0.57 0.86 DR04 0.1087 (5 / 46) 0.2500 (6 / 24) 0.17 0.67 DR07 0.2391 (11 / 46) 0.1250 (3 / 24) 0.35 0.84 DR15 0.2609 (12 / 46) 0.0833 (2 / 24) 0.12 0.67 *Fisher’s exact test (two-sided); ^Benjamini and Hochberg method. Table 14. Comparison of responders to non-responders with respect to HLA types with total allele counts of 10 or greater for the Candida group for patients who completed the 6-month visit. HLA P-value* TypeNon-Responders RespondersUnadjusted Adjusted^ A01 0.1500 (6 / 40) 0.1316 (5 / 38) >0.99 >0.99 A02 0.3500 (14 / 40) 0.2895 (11 / 38) 0.63 >0.99 A24 0.1500 (6 / 40) 0.1053 (4 / 38) 0.74 >0.99 B35 0.1667 (7 / 42) 0.1000 (4 / 40) 0.52 >0.99 B44 0.1429 (6 / 42) 0.1500 (6 / 40) >0.99 >0.99 C03 0.1190 (5 / 42) 0.2188 (7 / 32) 0.34 >0.99 C07 0.3333 (14 / 42) 0.2188 (7 / 32) 0.31 >0.99 DP04 0.5000 (17 / 34) 0.5000 (14 / 28) >0.99 >0.99 DQ02 0.1667 (7 / 42) 0.2000 (8 / 40) 0.78 >0.99 DQ03 0.3571 (15 / 42) 0.4500 (18 / 40) 0.50 >0.99 DQ05 0.1429 (6 / 42) 0.1500 (6 / 40) >0.99 >0.99 DQ06 0.1905 (8 / 42) 0.1250 (5 / 40) 0.55 >0.99 DR04 0.2857 (12 / 42) 0.2250 (9 / 40) 0.62 >0.99 *Fisher’s exact test (two-sided); ^Benjamini and Hochberg method. Table 15. Summary of vaccine-induced HPV-specific T cells detected in cervix. ID Treatment 6-Month 12-Month Atty. Dkt. No.169852.00146 ) ) ) Example 2 – Methods of treating head and neck cancer In one example, a subject is suffering from head and neck cancer. The subject will be administered a therapeutically effective amount of Candida albicans extract. The Candida albicans extract will be administered by any suitable route, e.g., intradermally, subcutaneously, intratumorally, to the subject. In some instances, the Candida albicans extract will be administered to the subject in conjunction with an additional treatment, e.g., a surgical procedure. In some instances, the Candida albicans extract will be administered before the surgical procedure. In some instances, the Candida albicans extract will be administered at about the same time as the surgical procedure. In some instances, the Candida albicans extract will be administered after the surgical procedure. The surgical procedure may remove a portion of the cancer or all of the detectable cancer from the subject. The methods are expected to reduce one or more signs or symptoms of the head and neck cancer including, but not limited to, size or number of detectable tumors, sores in the mouth or throat, sore throat, difficulty swallowing, voice changes, appetite, fatigue, diarrhea, pain in the jaw, neck, or face, speech problems, or pain in the ear or hearing loss. Methods of assessing improvements in the one or more signs or symptoms of the head and neck cancer in the subject are known in the art including physical examination and radiological examination. The methods are expected to reduce the incidence of recurrence of the cancer in the subject. Methods of measuring the level of recurrence in a population are known in the art and may include, e.g., a randomized trial where recurrence is assessed in a population of subject administered Candida albicans extract, e.g., administered the extract after a surgical procedure (see also Example 4). Atty. Dkt. No.169852.00146 Example 3 – Methods of treating cancer with Candida albicans extract in combination with an immunotherapy or a targeted therapy In one example, a subject is suffering from a cancer, e.g., cervical cancer or head and neck cancer. The subject will be administered a therapeutically effective amount of Candida albicans extract. The Candida albicans extract will be administered by any suitable route, e.g., intradermally, subcutaneously, intratumorally, to the subject. In some instances, the Candida albicans extract will be administered to the subject in conjunction with an additional treatment, e.g., an immunotherapy, or a targeted therapy. In some instances, the immunotherapy is an immune checkpoint inhibitor (ICI), e.g., a PD- 1 antagonist (e.g., pembrolizumab, nivolumab), a PD-L1 antagonist (e.g., atezolizumab, durvalumab), or a CLTA-4 antagonist (e.g., ipilimumab). In some instances, the targeted therapy is an inhibitor of CCR5 (e.g., miravoc or leronlimab) or TGF-beta (e.g., galunisertib, metformin, or trabedersen). In some instances, the Candida albicans extract will be administered before the additional treatment. In some instances, the Candida albicans extract will be administered at about the same time as the additional treatment. In some instances, the Candida albicans extract will be administered after the additional treatment. The methods are expected to reduce one or more signs or symptoms of the head and neck cancer including, but not limited to, size or number of detectable tumors, sores in the mouth or throat, sore throat, difficulty swallowing, voice changes, appetite, fatigue, diarrhea, pain in the jaw, neck, or face, speech problems, or pain in the ear or hearing loss. Methods of assessing improvements in the one or more signs or symptoms of the head and neck cancer in the subject are known in the art including physical examination and radiological examination. The methods are expected to reduce the incidence of recurrence of the cancer in the subject. Methods of measuring the level of recurrence in a population are known in the art and may include, e.g., a randomized trial where recurrence is assessed in a population of subject administered Candida albicans extract, e.g., administered the extract after a surgical procedure (see also Example 4). Example 4 – Study to evaluate the efficacy and safety of Candida albicans extract for the treatment of cancer and prevention of recurrence of cancer in adults over a two-year period Atty. Dkt. No.169852.00146 In one example a study to evaluate the efficacy and safety of Candida albicans extract (Nielsen Biosciences, San Diego, CA) in adults over a two (2) year period will be conducted. Each subject will be receiving a total of 7 injections of Candida albicans extract (0.5 mL per dose) or placebo (saline) at a 3:1 ratio in a randomized double-blinded design. Subjects will receive one injection every 3 weeks until they receive 4 injections. Then, subjects will receive one injection every 3 months until they receive a total of 7 injections. Subjects will have 2 more visits approximately 6 months apart after the last injection. Immunological assessment T-cell repertoire analysis and by fluorescent activated cell sorter analysis (FACS) will be made at 4 time points (Visits 1, 5, 7, and 8). Stool and oral wash samples will be collected at the Screening Visit, Visit 5, Visit 7 and Visit 8 for microbiome diversity analysis. See FIG.6. Objectives of the study Primary Objective: To evaluate the efficacy of a 7-injection regimen of Candida albicans extract by observing recurrence. Secondary Objective: To evaluate the safety of a 7-injection regimen of Candida albicans extract. Tertiary Objective: To evaluate the immunological response to Candida albicans extract. Quaternary Objective: To analyze microbiome profile in subjects receiving Candida albicans extract. Outcomes Primary Outcome Measure: Efficacy as measured by recurrence rates of the treated and placebo arms. Secondary Outcome Measure: Safety of 7 dose regimen by clinically observing adverse events (AEs). Tertiary Outcome: Immunological responses assessed using T-cell repertoire analysis and FACS analysis. Exploratory Outcome: Profile of gut and oral microbiome before and after vaccination. Study population Seventy-two (72) subjects, 18 to 100 years of age, with a squamous cell carcinoma of head and neck (HNC) diagnosis who have achieved no evidence of disease status The vaccine arm will receive seven injections of Candida albicans extract; the placebo arm will receive seven injections of an equal volume of placebo. Route of Administration: Intradermal injection (limb). Dose Level: 0.5 mL Candida albicans extract / injection, Placebo: Intravenous 0.9% NaCl solution (Saline). Dosing Regimen: 7 injections total, one injection every three weeks for the first 4 injections. Then one injection every 3 months until a total of 7 injections has been Atty. Dkt. No.169852.00146 administered. Cancer recurrence rate will be compared between the Candida albicans extract and placebo arms. Measures of safety will be evaluated using descriptive statistics. Background HNCs account for approximately 4% of all cancers in the United States. These cancers are more than twice as common among men as they are among women. HNCs are diagnosed more often among people over age 50 than they are among younger people. Researchers estimated that more than 65,000 men and women in this country would be diagnosed with HNCs in 2017. A large number of these cases are associated with a patient’s use of alcohol and tobacco. However, the incidence of cases related to a human papilloma virus (HPV) infection, is growing. Recent studies have shown 70% of oropharynx, 25% of head and neck squamous cell carcinomas, 24% of laryngeal, and 23% of oral cavity cancers are linked to HPV. Human papilloma viruses are a group of more than 200 related viruses. More than 40 HPV types can be easily spread through direct sexual contact, from the skin and mucous membranes of infected people to the skin and mucous membranes of their partners. About 14 million new genital HPV infections occur each year. The Centers for Disease Control and Prevention (CDC) estimates that more than 90% and 80% of sexually active men and women, respectively, will be infected with at least one type of HPV at some point in their lives. Around one-half of these infections are with a high-risk HPV type. High-risk HPVs can cause cancer. About a dozen high-risk HPV types have been identified. Two of these, HPV types 16 and 18, are responsible for most HPV-caused cancers. HPV type 16 is associated with 90% of HNC associated with HPV. High-risk genotypes of HPV, specifically type 16, are found in a discrete subset of squamous cell carcinoma of head and neck. Cases of HPV-related HNC may be prevented with vaccines. Inducing appropriate HPV virus specific immune responses may aid in prevention and treatment efforts. Infection by HPV may be averted by neutralizing antibodies specific for the viral capsid proteins. In clinical trials, vaccines comprised of HPV virus-like particles (VLPs) have shown great promise as prophylactic HPV vaccines. However, given that capsid proteins are not expressed at detectable levels by infected basal keratinocytes, vaccines with therapeutic potential must target other non-structural viral antigens. HPV transformation of squamous epithelium to a malignant phenotype is mediated by two early gene products, E6 and E7. Both viral proteins interact with products of cellular human tumor- Atty. Dkt. No.169852.00146 suppressor genes: the E6 protein can bind and promote degradation of cell-encoded p53, and the E7 protein interacts with the retinoblastoma susceptibility gene product. Expression of E6 and E7 proteins has been shown to be necessary and sufficient for HPV-16 transformation of human cells. Therefore, the E6 and E7 proteins are potential molecular targets for new preventive and therapeutic modalities. Our group has developed a vaccine that uses antigens from the E6 protein since the T-cell immune responses to the HPV-16 E6 protein are associated with HPV clearance and SIL regression. Therefore, therapeutic vaccines targeting E6 and E7 may have potential to control HPV-associated malignancies. Positive results from experimental vaccination systems in animal models have led to several prophylactic and therapeutic vaccine clinical trials. These investigations include administering these proteins in live vectors, peptides or protein, nucleic acid form, as components of chimeric VLPs, or as cell-based vaccines. These vaccines may prove invaluable for the prevention of HPV infection and life-threating cancers these infections may bring. Although numerous preclinical and clinical trials have evaluated prophylactic HPV vaccines during the past few decades, these vaccines do not help those who already have established HPV infections. Clinical trials have demonstrated excellent vaccine efficacy in women negative for HPV-16 or HPV-18, but the duration of protection remains to be determined, and a study of the bivalent vaccine showed no evidence of enhanced viral clearance in women with preexisting HPV infections. Therefore, therapeutic vaccines are needed for cases in which HPV infection is already established and in which HPV-related diseases have already developed, particularly because the prophylactic vaccine coverage rate in the targeted group (girls, ages 13-17 years) reportedly is low nationally. Candida albicans extract, a skin testing antigen derived from Candida albicans, was used as a novel vaccine adjuvant by our group in developing a peptide-based HPV therapeutic vaccine called PepCan. It consists of four current good manufacturing practice (cGMP)-grade synthetic peptides covering the E6 protein of HPV type 16 (HPV-16), along with Candin. The immune response to the E6 protein has been associated with good clinical outcomes. The safety of Candin alone was examined in mice in a multiple-dose toxicity study. The dorsal side of each animal was divided into four areas, and on each dosing day, the animals received intradermal injections (100 μL), which were split approximately equally between two sites (areas 1 and 2 on days 1, 15, and 29; areas 3 and 4 on days 8 and 22). Atty. Dkt. No.169852.00146 Table 16. Two groups of C57BL / 6 female mice examined in the multiple-dose toxicology study 0 er F, ys of sacrifice of the Candin group and the vehicle control are shown in Table 16. Administration of vehicle, Candida extract had no effect on body weights, body temperatures, food consumption, or absolute or relative organ weights of mice. Clinical signs associated with treatment included scabs and sore / ulcer at the dosing sites; these signs appeared shortly after dosing and resolved within a few days of appearance. Scabs and sore / ulcer at the dosing sites appeared sporadically (including the vehicle control) with no dose response in incidence and were therefore considered to have been due to the treatment procedure itself rather than to Candida extract. Rationale for proposed route of administration, dose, and regimen The intradermal route of administration was proposed to make use of Langerhans cells as antigen-presenting cells. It is also the designated route of administration of Candida extract as a skin testing reagent. A Phase I clinical trial of a peptide vaccine for prostate cancer administered through this route has shown promising immunogenicity. Extremities have been chosen as the site of administration because of the ease of access, as well as availability of sufficient data demonstrating efficacy of Candida extract delivered at these sites from previous clinical trials. Potential benefits The intended benefit is the development of a novel therapeutic vaccine regimen to reduce cancer recurrence for patients with previously diagnosed head and neck cancer (HNC). This study will contribute to this goal by assuring the effectiveness and safety of Candida in HNC patients. Study assessments Studying the efficacy of Candida and the schedule in which this protocol specifically outlines the clinical response (i.e., reduced cancer recurrence rate) of subjects is the primary Atty. Dkt. No.169852.00146 endpoint. Cancer recurrence rate will be compared for a 2-year period between the Candida and placebo arms using a pooled Z-test. Immune response will be evaluated as the tertiary endpoint. The T-cell receptor β CDR3 regions will be PCR-amplified and sequenced (immunoSEQ, Adaptive Biotechnologies, Seattle, WA) using genomic DNA from PBMCs. Using bias-controlled V and J gene primers, the rearranged V(D)J segments were amplified and sequenced. A clustering algorithm will be used to correct for sequencing errors, and the CDR3 segments will be annotated according to the International ImMunoGeneTicsCollaboration to identify the V, D, and J genes that contributed to each rearrangement. A mixture of synthetic T-cell receptor analogs was used in PCR to estimate the number of cells bearing each unique T-cell receptor sequence. Post-vaccination samples will be compared to pre-vaccination samples to assess the extent of vaccine response.Plasma samples collected from blood specimens drawn at Visits 1, 5, 7, and 8 may be analyzed for cytokine / chemokine panel which may include of IL-1β, IL-1 receptor agonist (IL-1RA), IL-2, IL- 4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12 (p70), IL-13, IL-15, IL-17A, eotaxin, basic fibroblast growth factor (FGF), G-CSF, GM-CSF, IFNγ, IFNγ induced protein 10 (IP-10), monocyte chemotactic protein 1 (MCP-1), MIP-1α, MIP-1α, platelet-derived growth factor subunit B (PDGF-BB), regulated on activation, normal T-cell expressed and secreted (RANTES), TNF-α, vascular endothelial growth factor (VEGF), IL-2 receptor α (IL-2Rα), chemokine (C-X-C motif) ligand 1 (CXCL1), hepatocyte growth factor (HGF), IFN-α-2, LIF, chemokine (C-C motif) ligand 7 (CCL7), macrophage migration inhibitory factor (MIF), chemokine (C-X-C motif) ligand 9 (CXCL9), βnerve growth factor (βNGF), stem cell factor (SCF), stem cell growth factor β (SCGF- β), TRAIL, IL-16, and IL-18. Microbial response will be assessed as the quaternary endpoint. Extraction of microbial DNA will be performed at UAMS using the MoBio PowerFecal DNA Isolation Kit (QIAGEN, Cat. No. 12830-50, California) or ZymoBioMICS DNA Miniprep Kit (Zymo Research Cat. No. D4300, Irvine, California). Quality of isolated DNA samples may be determined by agarose gel image and OD 260 / 280 ratio (OD 260 / 280 = 1.8~2.0). Microbiome diversity analysis may be performed in two methods - Illumina MiSeq / HiSeq and MiniON Flow Cell. Researchers will evaluate the quality of data acquisition between two methods of DNA sequencing and provide the microbiome profiling data of DNAs in the fecal samples from subjects with HNC. Atty. Dkt. No.169852.00146 REFERENCES 1. Cancer IAfRo: GLOBOCAN 2020 CANCER FACT SHEET, 2020 2. Meyskens FL, Jr., Surwit E, Moon TE, et al: Enhancement of regression of cervical intraepithelial neoplasia II (moderate dysplasia) with topically applied all-trans-retinoic acid: a randomized trial. J Natl Cancer Inst 86:539-43, 1994 3. Chaturvedi AK: Beyond cervical cancer: burden of other HPV-related cancers among men and women. J Adolesc Health 46:S20-6, 2010 4. Tota JE, Chevarie-Davis M, Richardson LA, et al: Epidemiology and burden of HPV infection and related diseases: implications for prevention strategies. Prev Med 53 Suppl 1:S12- 21, 2011 5. Bruinsma FJ, Quinn MA: The risk of preterm birth following treatment for precancerous changes in the cervix: a systematic review and meta-analysis. BJOG 118:1031-41, 2011 6. Massad LS, Einstein MH, Huh WK, et al: 2012 updated consensus guidelines for the management of abnormal cervical cancer screening tests and cancer precursors. Obstet Gynecol 121:829-46, 2013 7. Athanasiou A, Veroniki AA, Efthimiou O, et al: Comparative effectiveness and risk of preterm birth of local treatments for cervical intraepithelial neoplasia and stage IA1 cervical cancer: a systematic review and network meta-analysis. Lancet Oncol 23:1097-1108, 2022 8. Kyrgiou M, Athanasiou A, Kalliala IEJ, et al: Obstetric outcomes after conservative treatment for cervical intraepithelial lesions and early invasive disease. Cochrane Database Syst Rev 11:CD012847, 2017 9. Zhuang H, Hong S, Zheng L, et al: Effects of cervical conisation on pregnancy outcome: a meta-analysis. J Obstet Gynaecol 39:74-81, 2019 10. Perkins RB, Guido RS, Castle PE, et al: 2019 ASCCP Risk-Based Management Consensus Guidelines for Abnormal Cervical Cancer Screening Tests and Cancer Precursors. J Low Genit Tract Dis 24:102-131, 2020 11. Organization WH: WHO Director-General calls for all countries to take action to help end the suffering caused by cervical cancer, 2018 12. Kumar V, Fausto N, Abbas A: Cervix, Robbins & Cotran Pathologic Basis of Disease (ed Seventh), 2004, pp 1072-1079 Atty. Dkt. No.169852.00146 13. Schlegel R, Phelps WC, Zhang YL, et al: Quantitative keratinocyte assay detects two biological activities of human papillomavirus DNA and identifies viral types associated with cervical carcinoma. Embo J 7:3181-7, 1988 14. Pirisi L, Yasumoto S, Feller M, et al: Transformation of human fibroblasts and keratinocytes with human papillomavirus type 16 DNA. J Virol 61:1061-1066, l987 15. Nakagawa M, Stites DP, Patel S, et al: Persistence of human papillomavirus type 16 infection is associated with lack of cytotoxic T lymphocyte response to the E6 antigens. J Infect Dis 182:595-8, 2000 16. Kim KH, Greenfield WW, Cannon MJ, et al: CD4+ T-cell response against human papillomavirus type 16 E6 protein is associated with a favorable clinical trend. Cancer Immunol Immunother 61:63-70, 2012 17. Nakagawa M, Gupta SK, Coleman HN, et al: A favorable clinical trend is associated with CD8 T-cell immune responses to the human papillomavirus type 16 e6 antigens in women being studied for abnormal pap smear results. J Low Genit Tract Dis 14:124-9, 2010 18. Aldahan AS, Mlacker S, Shah VV, et al: Efficacy of intralesional immunotherapy for the treatment of warts: A review of the literature. Dermatol Ther 29:197-207, 2016 19. Ju HJ, Park HR, Kim JY, et al: Intralesional immunotherapy for non-genital warts: A systematic review and meta-analysis. Indian J Dermatol Venereol Leprol 88:724-737, 2022 20. Nakagawa M, Daniels J, Goodwin A, et al: Use of Candida Extract as a Novel Vaccine Adjuvant, Immunotherapy & Vaccine Summit. Cambridge, Cambridge Healthtech Institute, 2010 21. Wang X, Coleman HN, Nagarajan U, et al: Candida skin test reagent as a novel adjuvant for a human papillomavirus peptide-based therapeutic vaccine. Vaccine 31:5806-13, 2013 22. Coleman HN, Greenfield WW, Stratton SL, et al: Human papillomavirus type 16 viral load is decreased following a therapeutic vaccination. Cancer Immunol Immunother 65:563-73, 2016 23. Greenfield WW, Stratton SL, Myrick RS, et al: A phase I dose-escalation clinical trial of a peptide-based human papillomavirus therapeutic vaccine with skin test reagent as a novel vaccine adjuvant for treating women with biopsy-proven cervical intraepithelial neoplasia 2 / 3. Oncoimmunology 4:e1031439, 2015 Atty. Dkt. No.169852.00146 24. Mirabello L, Schiffman M, Ghosh A, et al: Elevated methylation of HPV16 DNA is associated with the development of high grade cervical intraepithelial neoplasia. Int J Cancer 132:1412-22, 2013 25. Filipazzi P, Valenti R, Huber V, et al: Identification of a new subset of myeloid suppressor cells in peripheral blood of melanoma patients with modulation by a granulocyte- macrophage colony-stimulation factor-based antitumor vaccine. J Clin Oncol 25:2546-53, 2007 26. Poschke I, Mougiakakos D, Hansson J, et al: Immature immunosuppressive CD14+HLA- DR- / low cells in melanoma patients are Stat3hi and overexpress CD80, CD83, and DC-sign. Cancer Res 70:4335-45, 2010 27. Ravilla R, Coleman HN, Chow CE, et al: Cervical Microbiome and Response to a Human Papillomavirus Therapeutic Vaccine for Treating High-Grade Cervical Squamous Intraepithelial Lesion. Integr Cancer Ther 18:1534735419893063, 2019 28. Dolina JS, Van Braeckel-Budimir N, Thomas GD, et al: CD8(+) T Cell Exhaustion in Cancer. Front Immunol 12:715234, 2021 29. McLane LM, Abdel-Hakeem MS, Wherry EJ: CD8 T Cell Exhaustion During Chronic Viral Infection and Cancer. Annu Rev Immunol 37:457-495, 2019 30. Hildesheim A, Schiffman M, Scott DR, et al: Human leukocyte antigen class I / II alleles and development of human papillomavirus-related cervical neoplasia: results from a case-control study conducted in the United States. Cancer Epidemiol Biomarkers Prev 7:1035-41, 1998 31. Madeleine MM, Johnson LG, Smith AG, et al: Comprehensive analysis of HLA-A, HLA- B, HLA-C, HLA-DRB1, and HLA-DQB1 loci and squamous cell cervical cancer risk. Cancer Res 68:3532-9, 2008 32. Wang SS, Wheeler CM, Hildesheim A, et al: Human leukocyte antigen class I and II alleles and risk of cervical neoplasia: results from a population-based study in Costa Rica. J Infect Dis 184:1310-4, 2001 33. Cai S, Tan X, Miao K, et al: Effectiveness and Safety of Therapeutic Vaccines for Precancerous Cervical Lesions: A Systematic Review and Meta-Analysis. Front Oncol 12:918331, 2022 34. Loopik DL, Bentley HA, Eijgenraam MN, et al: The Natural History of Cervical Intraepithelial Neoplasia Grades 1, 2, and 3: A Systematic Review and Meta-analysis. J Low Genit Tract Dis 25:221-231, 2021 Atty. Dkt. No.169852.00146 35. Kaech SM, Cui W: Transcriptional control of effector and memory CD8+ T cell differentiation. Nat Rev Immunol 12:749-61, 2012 36. Vattai A, Kremer N, Meister S, et al: Role of FoxP3-positive regulatory T-cells in regressive and progressive cervical dysplasia. J Cancer Res Clin Oncol 148:377-386, 2022 37. Mukaida N, Sasaki SI, Baba T: CCL4 Signaling in the Tumor Microenvironment. Adv Exp Med Biol 1231:23-32, 2020 38. Aldinucci D, Borghese C, Casagrande N: The CCL5 / CCR5 Axis in Cancer Progression. Cancers (Basel) 12, 2020 39. Zeng Z, Lan T, Wei Y, et al: CCL5 / CCR5 axis in human diseases and related treatments. Genes Dis 9:12-27, 2022 40. Rojas-Zuleta WG, Sanchez E: IL-9: Function, Sources, and Detection. Methods Mol Biol 1585:21-35, 2017 41. Yang JG, Wang WM, Xia HF, et al: Lymphotoxin-alpha promotes tumor angiogenesis in HNSCC by modulating glycolysis in a PFKFB3-dependent manner. Int J Cancer 145:1358-1370, 2019 42. Yan J, Xiao G, Yang C, et al: Cancer-Associated Fibroblasts Promote Lymphatic Metastasis in Cholangiocarcinoma via the PDGF-BB / PDGFR-beta Mediated Paracrine Signaling Network. Aging Dis 15:369-389, 2024 43. Tiemessen MM, Kunzmann S, Schmidt-Weber CB, et al: Transforming growth factor- beta inhibits human antigen-specific CD4+ T cell proliferation without modulating the cytokine response. Int Immunol 15:1495-504, 2003 44. Letterio JJ, Roberts AB: Regulation of immune responses by TGF-beta. Annu Rev Immunol 16:137-61, 1998 45. Derynck R, Turley SJ, Akhurst RJ: TGFbeta biology in cancer progression and immunotherapy. Nat Rev Clin Oncol 18:9-34, 2021 46. Nakagawa M, Coleman HN, Wang X, et al: IL-12 secretion by Langerhans cells stimulated with Candida skin test reagent is mediated by dectin-1 in some healthy individuals. Cytokine 65:202-9, 2014 47. McCredie MR, Sharples KJ, Paul C, et al: Natural history of cervical neoplasia and risk of invasive cancer in women with cervical intraepithelial neoplasia 3: a retrospective cohort study. Lancet Oncol 9:425-34, 2008 Atty. Dkt. No.169852.00146 48. ClinicalTrials.gov: Safety and Efficacy of Varying Regimens of CANDIN for Treatment of Common Warts (Verruca Vulgaris) ClinicalTrials.gov ID NCT02393417, 49. Arbyn M, Redman CWE, Verdoodt F, et al: Incomplete excision of cervical precancer as a predictor of treatment failure: a systematic review and meta-analysis. Lancet Oncol 18:1665- 1679, 2017 50. Rytlewski J, Deng S, Xie T, et al: Model to improve specificity for identification of clinically-relevant expanded T cells in peripheral blood. PLoS One 14:e0213684, 2019

Claims

Atty. Dkt. No.169852.00146 CLAIMS What is claimed:

1. A method of treating a cancer having epithelial lesions or a precancerous condition having epithelial lesions in a subject comprising: excising the epithelial lesions using a surgical procedure and administering a composition comprising a recall antigen in a subject in need thereof; wherein the subject is afflicted with a cancer caused by human papilloma virus (HPV) with cancerous epithelial lesions or afflicted with precancerous epithelial lesions caused by HPV and the composition comprising a recall antigen does not comprise an antigen of the cancer or of HPV.

2. The method of claim 1, wherein the recall antigen is candida extract, mumps antigen, or trichophyton extract.

3. The method of claim 2, wherein the candida extract is a Candida albicans extract.

4. The method of any one of claims 1-3, wherein the method does not comprise administration of the composition intradermally into the epithelial lesion.

5. A method of treating cancer in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Candida albicans extract to the subject to treat the cancer.

6. The method of claim 5, further comprising excising at least a portion of the cancer before or after the administering step.

7. The method of any one of claim 1-6, wherein the surgical procedure is selected from a loop electrical excision procedure or cold cone knife procedure.

8. A method of reducing recurrence of a cancer in a subject in need thereof, the method comprising administering an effective amount of a pharmaceutical composition comprising a Candida albicans extract to the subject to reduce recurrence of the cancer in the subject.

9. The method of any one of claims 1-8, wherein the cancer is cervical cancer or cervical precancerous lesion.Atty. Dkt. No.169852.00146 10. The method of any one of claim 1-9, wherein the cancer or precancer is a cervical intraepithelial neoplasia lesion grade 2 or 3.

11. The method of any one of claims 1-8, wherein the cancer or precancer is selected from the group consisting of squamous cell cancer or precancer, head and neck cancer, colorectal adenoma, penile intraepithelial neoplasia, vaginal intraepithelial neoplasia, vulvar intraepithelial neoplasia, breast cancer, colorectal cancer, pancreatic cancer, leukemia, lymphoma, multiple myeloma, gastric cancer, lung cancer, ovarian cancer, glioblastoma, prostate cancer, and thyroid cancer.

12. The method of any one of claims 1-11, wherein the pharmaceutical composition consists essentially of the Candida albicans extract.

13. The method of any one of claims 1-12, wherein the pharmaceutical composition comprises one or more pharmaceutically acceptable excipients or carriers.

14. The method of any one of claims 1-13, wherein the subject has been previously exposed to human papilloma virus (HPV) or is infected with HPV.

15. The method of any one of claims 1-14, further comprising administering a cancer therapeutic or immunotherapy to the subject.

16. The method of claim 15, wherein the immunotherapy is an immune checkpoint inhibitor therapy, a CCR5 inhibitor or a TGF-beta inhibitor.

17. The method of any one of claims 1-16, wherein administering comprises intradermal administration.

18. The method of claim 17, wherein intradermal administration comprises intradermal administration to a limb of the subject.Atty. Dkt. No.169852.00146 19. The method of any one of claims 1-18, wherein the effective amount comprises a dose of about 0.5 ml.

20. The method of any one of claims 1-18, wherein the effective amount comprises a dose of about 0.5 ml and wherein the subject is administered a total of at least seven doses.

21. The method of claim 20, wherein the at least seven doses are administered in a sequence comprising: 4 rounds of 1 injection every three weeks followed by 3 rounds of 1 injection every 3 months.

22. The method of any one of claims 1-21, wherein the cancer is related to a human papilloma virus (HPV) infection of the subject.

23. The method of claim 22, wherein the HPV is selected from the group consisting of: HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, and 68.

24. The method of claim 23, wherein the HPV is HPV 16 or HPV 18.

25. The method of any one of claims 1-24, wherein the Candida extract is not heat killed or chemically fixed.

26. The method of any one of claims 1-25, wherein the Candida albicans extract is Candin®.

27. The method of any one of claims 1-26, wherein the subject is a human.

Images